A KASP marker primer combination for detecting resistance traits to Fusarium wilt in watermelon and its application.

Abstract

This invention discloses a KASP marker primer combination for detecting watermelon wilt resistance and its application, belonging to the field of watermelon breeding molecular biology technology. The KASP marker primer combination includes upstream primer 1, upstream primer 2, and downstream primer 1; the nucleotide sequence of upstream primer 1 is shown in SEQ ID NO.1; the nucleotide sequence of upstream primer 2 is shown in SEQ ID NO.2; and the nucleotide sequence of downstream primer 1 is shown in SEQ ID NO.3. The KASP marker primer combination uses the KASP molecular marker Cla_26118772 as the detection target. Amplification using the primer combination of this invention can accurately and rapidly identify watermelon wilt resistance, providing a new technical approach for the screening, identification, and breeding of wilt-resistant watermelon varieties.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology in watermelon breeding, and in particular to a KASP marker primer combination for detecting resistance to Fusarium wilt in watermelon and its application. Background Technology

[0002] Fusarium wilt is a devastating soil-borne fungal disease that severely hinders the development of the watermelon industry. Currently, there are no effective chemical pesticides to control it, and production mainly relies on grafting for prevention. However, grafting techniques are complex, and poor compatibility between rootstock and scion often leads to a decline in watermelon quality, making it unacceptable to growers and consumers. Therefore, developing Fusarium wilt-resistant watermelon varieties is the safest, most economical, and efficient means to solve the problem of continuous cropping obstacles in watermelons, maintain watermelon flavor, and achieve the sustainable development of the watermelon industry.

[0003] Cultivated watermelons have a narrow genetic base, with most existing resistance sources derived from wild germplasm. However, distant hybridization introduces linkage burdens of undesirable agronomic traits, requiring long-term backcrossing for improvement, making it difficult to directly apply superior alleles to breeding practices. Xu Yong et al., using the wild germplasm material PI196431-FR, first obtained the RAPD marker OPP01 / 700 linked to the resistance gene for Fusarium wilt race 1 (Fon-1), and converted it into a SCAR marker, establishing a molecular marker-assisted selection technology system for watermelon Fusarium wilt resistance breeding (Xu Yong et al., RAPD marker linked to Fusarium wilt resistance gene in wild watermelon germplasm, Acta Botanica Sinica, 1999, 41: 952-955). However, both the RAPD marker and its converted SCAR marker are dominant markers, unable to distinguish between homozygous and heterozygous genotypes, resulting in low stability and reliability. Subsequently, a dCAPS marker (patent number: ZL201310052303.3) was developed based on SNP sites linked to the watermelon wilt resistance gene. However, its detection requires enzyme digestion, which is costly, time-consuming, and cumbersome, limiting its application in large-scale breeding. This dCAPS marker was further converted into a KASP marker (patent number: ZL201910106503.X) and validated in the F2 population, but it exhibits population specificity. In summary, the identification of watermelon wilt resistance currently relies mainly on artificial inoculation at the seedling stage. Existing markers are mostly population specific, limiting their use in different hybrid populations or natural watermelon populations. Therefore, a rapid and universal molecular identification technique for watermelon wilt resistance is needed. Summary of the Invention

[0004] The purpose of this invention is to provide a KASP marker primer combination for detecting watermelon wilt resistance and its application, thereby solving the problems existing in the prior art. Applying the KASP marker primer combination of this invention can accurately and rapidly identify watermelon wilt resistance.

[0005] To achieve the above objectives, the present invention provides the following solution: Technical Solution 1: The KASP-labeled primer combination includes upstream primer 1, upstream primer 2, and downstream primer 1; the nucleotide sequence of upstream primer 1 is shown in SEQ ID NO.1; the nucleotide sequence of upstream primer 2 is shown in SEQ ID NO.2; and the nucleotide sequence of downstream primer 1 is shown in SEQ ID NO.3.

[0006] The preferred molecular marker closely linked to the watermelon wilt resistance trait is an A-to-T mutation occurring at position 26118772 bp on chromosome 6 of the watermelon genome. Primers designed for the watermelon wilt resistance trait mutation are as follows: FAM fluorescently labeled upstream primer 1 (Cla_26118772-F1): 5'-GAAGGTGACCAAGTTCATGCTTAAGTTTTTTACCATGTTAAGTATTCAAA-3' (SEQ ID NO.1); VIC fluorescently labeled upstream primer 2 (Cla_26118772-F2): 5'-GAAGGTCGGAGTCAACGGATTTAAGTTTTTTACCATGTTAAGTATTCAAT-3' (SEQ ID NO.2); Downstream primer 1 (Cla_27993083-R): 5'-TTGAAAAAGTGTTATATTTACCCTCTG-3' (SEQ ID NO.3).

[0007] Preferably, the 5' ends of the two primers Cla_26118772-F1 and Cla_26118772-F2 are connected to FAM and VIC fluorescent adapter sequences, respectively. The FAM signal is: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4); the VIC signal is: GAAGGTCGGAGTCAACGGATT (SEQ ID NO.5).

[0008] Preferably, the genotypes corresponding to the molecular markers are: T:T is a homozygous genotype resistant to Fusarium wilt; A:A is a homozygous genotype susceptible to Fusarium wilt; A:T is a heterozygous genotype susceptible to Fusarium wilt.

[0009] Furthermore, the KASP marker primer combination uses the KASP molecular marker Cla_26118772 as the detection target; Cla_26118772 is located at the 26118772 bp position on chromosome 6 of watermelon.

[0010] Technical Solution 2: A method for identifying resistance traits to Fusarium wilt in watermelons, comprising the following steps: Genomic DNA was extracted from the watermelon to be identified; PCR amplification was performed using the genomic DNA as a template and the KASP marker primer combination; the genotype of the watermelon sample to be identified was determined based on the difference in PCR fluorescence signal; the genotype included T:T genotype, A:A genotype and A:T genotype.

[0011] Further, the PCR amplification system includes: 2.5 μL 2×KASP master mix, 1.25 μL primer mix, and 1.25 μL DNA template; the primers include upstream primer 1, upstream primer 2, and downstream primer 1; the primer mix is ​​to mix upstream primer 1, upstream primer 2, and downstream primer 1 in a volume ratio of 1:1:3.

[0012] Furthermore, the PCR amplification program is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 60 s, for 27 cycles.

[0013] Furthermore, identifying the genotype of the watermelon sample to be identified includes: reading the fluorescence signal value of the PCR product; if it is a T:T genotype, it is determined to be a homozygous plant resistant to Fusarium wilt; if it is an A:A genotype, it is determined to be a homozygous plant susceptible to Fusarium wilt; and if it is an A:T genotype, it is determined to be a heterozygous plant susceptible to Fusarium wilt.

[0014] Technical Solution 3: Application of the KASP marker primer combination in detecting watermelon wilt resistance traits.

[0015] The present invention discloses the following technical effects: This invention utilizes GWAS to locate a significant associated locus controlling watermelon wilt resistance. Based on this variant locus, a KASP molecular marker associated with watermelon wilt resistance was developed. Applying the KASP marker provided by this invention to detect watermelon wilt resistance is simple and time-efficient. Traditional identification through watermelon seedling wilt inoculation requires 1-2 months for observation, while using this KASP marker only takes 1-2 hours. This is ideal for batch testing of large populations and multiple samples. Furthermore, traditional hybridization requires 5-6 generations to obtain trait-stable breeding materials, while using this KASP marker only requires 3 generations, significantly shortening the breeding cycle and improving breeding efficiency. In summary, this invention addresses the shortcomings of watermelon wilt resistance identification technology by providing a KASP marker primer combination for identifying watermelon wilt resistance. Using this KASP marker primer combination, watermelon wilt resistance can be accurately and rapidly identified, providing a new technical approach for the screening, identification, and breeding of wilt-resistant watermelon materials and varieties. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 Manhattan plot for genome association analysis of watermelon wilt resistance trait; Figure 2 The image shows the genotyping results of the Cla_26118772 marker in 115 watermelon samples. Blue indicates the fluorescent signal of the T:T genotype corresponding to primer Cla_26118772, which is a homozygous plant resistant to Fusarium wilt; green indicates the fluorescent signal of the A:T genotype corresponding to primer Cla_26118772, which is a heterozygous plant susceptible to Fusarium wilt; and red indicates the fluorescent signal of the A:A genotype corresponding to primer Cla_26118772, which is a homozygous plant susceptible to Fusarium wilt. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] Example 1: Development and application of KASP molecular markers for watermelon wilt resistance 1. Genome-wide association analysis to locate resistance traits to Fusarium wilt in watermelon Whole-genome resequencing was performed on 143 watermelon natural populations using Illumina sequencing technology, with an average sequencing depth of 15×. After filtering for minimum allele frequency (MAF) ≥5% and missing data rate ≤20%, a total of 2,923,709 SNPs were detected, providing rich genetic variation for watermelon breeding. The wilt resistance trait of the 143 watermelon materials was analyzed. Genome-wide association analysis (GWIA) was performed using the FaST-LMM (Factored Spectrally Transformed Linear Mixed Models) model to analyze the wilt resistance trait and all SNP variant sites. A significant association was found between the 26112488-26120311 region on chromosome 6 and the wilt resistance trait. The Manhattan plot of the FaST-LMM model is shown below. Figure 1As shown, there are 7 SNP loci within this association interval. Further analysis of the P-values ​​of the 7 SNP loci revealed that the smaller the P-value, the stronger the trait association. The analysis found that the smallest P-value was at SNP locus 23118772, which is the SNP locus most associated with the watermelon wilt resistance trait.

[0024] 2. Development of KASP markers for detecting resistance traits to Fusarium wilt in watermelon By comparing the genomic sequence of locus 26118772, which is significantly associated with watermelon resistance to Fusarium wilt, a 1 bp variation was identified at the genomic level between watermelon resistance to and susceptibility to Fusarium wilt. This variation leads to an A-to-T mutation, thereby producing the difference in Fusarium wilt resistance.

[0025] Based on the variation at this site, a combination of KASP marker primers was designed in the 500bp region upstream and downstream of the variation site, with the specific sequences as follows: FAM fluorescently labeled upstream primer 1 (Cla_26118772-F1): 5'-GAAGGTGACCAAGTTCATGCTTAAGTTTTTTACCATGTTAAGTATTCAAA-3' (SEQ ID NO.1); VIC fluorescently labeled upstream primer 2 (Cla_26118772-F2): 5'-GAAGGTCGGAGTCAACGGATTTAAGTTTTTTACCATGTTAAGTATTCAAT-3' (SEQ ID NO. 2); Downstream primer 1 (Cla_26118772-R): 5'-TTGAAAAAGTGTTATATTTACCCTCTG-3' (SEQ ID NO. 3).

[0026] The 5' ends of primers Cla_26118772-F1 and Cla_26118772-F2 are connected to FAM and VIC fluorescent adapter sequences, respectively. The FAM signal is GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4); the VIC signal is GAAGGTCGGAGTCAACGGATT (SEQ ID NO.5).

[0027] All the primers mentioned above were synthesized by Nanjing Jisi Huiyuan Biotechnology Co., Ltd.

[0028] The above-mentioned KASP marker primer combination was used to detect the resistance trait of watermelon to Fusarium wilt. If it is T:T genotype, it is determined to be a homozygous plant resistant to Fusarium wilt; if it is A:A genotype, it is determined to be a homozygous plant susceptible to Fusarium wilt; if it is A:T genotype, it is determined to be a heterozygous plant susceptible to Fusarium wilt.

[0029] 3. Detection of watermelon wilt resistance traits using KASP-labeled primer combinations. (1) Genomic DNA extraction. Total DNA was extracted from the leaves of 115 watermelon natural population samples using the FlaPure Plant DNA Extraction Kit (Beijing Jinsha Biotechnology Co., Ltd.). The wilt resistance traits of the 115 watermelon samples are shown in Table 1.

[0030] Table 1. Phenotypes of resistance to Fusarium wilt in 115 natural watermelon populations Experimental materials Fusarium wilt resistance phenotype Experimental materials Fusarium wilt resistance phenotype Experimental materials Fusarium wilt resistance phenotype Experimental materials Fusarium wilt resistance phenotype AA Disease resistance MW015 Illness MW052 Illness P Illness AS Disease resistance MW016 Illness MW053 Illness P1 Illness AU-GSC Illness MW018 Illness MW054 Illness P3 Disease resistance AU-RS Illness MW019 Illness MW055 Illness PI189225 Illness BD Illness MW020 Illness MW056 Illness Q Disease resistance DW3 Illness MW023 Illness MW057 Illness S Disease resistance G Illness MW025 Illness MW058 Illness SB Illness H Illness MW026 Illness MW059 Illness SW035 Illness I Disease resistance MW027 Illness MW060 Illness SW036 Illness L Illness MW028 Illness MW061 Illness SW037 Illness LW013 Disease resistance MW029 Illness MW062 Illness SW038 Illness LW017 Illness MW030 Illness MW063 Disease resistance SW043 Illness LW018 Illness MW031 Illness MW066 Illness SW077-6 Illness LW021 Disease resistance MW032 Illness MW067 Disease resistance V Disease resistance LW022 Disease resistance MW033 Illness MW068 Illness W Disease resistance LW025 Disease resistance MW034 Illness MW069 Illness X Disease resistance LW026 Illness MW038 Illness MW070 Illness Y1-1-2 Illness MW003 Illness MW039 Illness MW071 Disease resistance Y129-11-2 Illness MW004 Illness MW040 Illness MW072 Illness Y4-3 Illness MW005 Illness MW041 Illness MW073 Illness Y-51 Illness MW006 Illness MW042 Illness MW075 Illness Y-58-1-3-2 Illness MW007 Illness MW043 Illness MW089 Illness Y66 Illness MW008 Illness MW044 Illness MW094-2 Illness Y74-1-1 Illness MW009 Illness MW046 Illness MW096 Disease resistance Y8-1 Illness MW010 Illness MW047 Illness MW098 Illness Y84-2 Illness MW011 Illness MW048 Illness MW120 Illness Y84-3 Illness MW012 Illness MW049 Illness MW123 Illness Y-94-6-3 Illness MW013 Illness MW050 Illness MW124 Illness Z Disease resistance MW014 Illness MW051 Illness O Illness (2) PCR reaction system and procedure. Using the watermelon DNA extracted in step (1) as a template, PCR amplification was performed using a KASP-labeled primer combination. The total PCR reaction system was 5 µl, and the components were as follows: 2.5 µL of 2×KASP master mix, 1.25 µL of Primer mix, and 1.25 µL of DNA template. The Primer mix was a mixture of Cla_26118772-F1:Cla_26118772-F2:Cla_26118772-R in a ratio of 1:1:3.

[0031] The PCR reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 60 s, for 27 cycles.

[0032] (3) Reading the fluorescence signal value of PCR amplification products. After the PCR amplification cycle is completed, the fluorescence signal value is read using a real-time PCR instrument, and the genotyping results of the watermelon samples are obtained based on the fluorescence difference. If the homozygous genotype is T:T, it is determined to be a watermelon sample resistant to Fusarium wilt, and is represented by a blue dot in the genotyping diagram; if the homozygous genotype is A:A, it is determined to be a watermelon sample susceptible to Fusarium wilt, and is represented by a red dot in the genotyping diagram; if the heterozygous genotype is A:T, it is determined to be a watermelon sample susceptible to Fusarium wilt, and is represented by a green dot in the genotyping diagram.

[0033] 115 different watermelon samples were analyzed using primers Cla_26118772 to obtain genotyping maps, as follows: Figure 2 As shown in Table 2, the KASP test results of 115 watermelon samples are statistically analyzed.

[0034] Table 2. KASP test results of 115 watermelon samples Sample number KASP test results genotype Fusarium wilt resistance phenotype AA blue T:T Disease resistance AS blue T:T Disease resistance AU-GSC blue T:T Illness AU-RS blue T:T Illness BD blue T:T Illness DW3 red A:A Illness G red A:A Illness H green A:T Illness I blue T:T Disease resistance L red A:A Illness LW013 red A:A Disease resistance LW017 blue T:T Illness LW018 blue T:T Illness LW021 blue T:T Disease resistance LW022 blue T:T Disease resistance LW025 blue T:T Disease resistance LW026 red A:A Illness MW003 red A:A Illness MW004 red A:A Illness MW005 red A:A Illness MW006 red A:A Illness MW007 red A:A Illness MW008 red A:A Illness MW009 red A:A Illness MW010 red A:A Illness MW011 red A:A Illness MW012 red A:A Illness MW013 red A:A Illness MW014 red A:A Illness MW015 green A:T Illness MW016 red A:A Illness MW018 red A:A Illness MW019 red A:A Illness MW020 red A:A Illness MW023 red A:A Illness MW025 red A:A Illness MW026 green A:T Illness MW027 green A:T Illness MW028 red A:A Illness MW029 red A:A Illness MW030 red A:A Illness MW031 red A:A Illness MW032 red A:A Illness MW033 red A:A Illness MW034 red A:A Illness MW038 red A:A Illness MW039 red A:A Illness MW040 red A:A Illness MW041 red A:A Illness MW042 red A:A Illness MW043 red A:A Illness MW044 red A:A Illness MW046 blue T:T Illness MW047 red A:A Illness MW048 red A:A Illness MW049 red A:A Illness MW050 red A:A Illness MW051 red A:A Illness MW052 red A:A Illness MW053 red A:A Illness MW054 red A:A Illness MW055 red A:A Illness MW056 red A:A Illness MW057 red A:A Illness MW058 red A:A Illness MW059 red A:A Illness MW060 red A:A Illness MW061 red A:A Illness MW062 blue T:T Illness MW063 blue T:T Disease resistance MW066 red A:A Illness MW067 blue T:T Disease resistance MW068 red A:A Illness MW069 red A:A Illness MW070 red A:A Illness MW071 red A:A Disease resistance MW072 red A:A Illness MW073 red A:A Illness MW075 red A:A Illness MW089 red A:A Illness MW094-2 blue T:T Illness MW096 red A:A Disease resistance MW098 red A:A Illness MW120 red A:A Illness MW123 red A:A Illness MW124 red A:A Illness O red A:A Illness P red A:A Illness P1 red A:A Illness P3 blue T:T Disease resistance PI189225 green A:T Illness Q blue T:T Disease resistance S blue T:T Disease resistance SB red A:A Illness SW035 red A:A Illness SW036 blue T:T Illness SW037 red A:A Illness SW038 red A:A Illness SW043 red A:A Illness SW077-6 red A:A Illness V blue T:T Disease resistance W blue T:T Disease resistance X blue T:T Disease resistance Y1-1-2 red A:A Illness Y129-11-2 red A:A Illness Y4-3 red A:A Illness Y-51 red A:A Illness Y58-1-3-2 red A:A Illness Y66 red A:A Illness Y74-1-1 red A:A Illness Y8-1 red A:A Illness Y84-2 red A:A Illness Y84-3 red A:A Illness Y94-6-3 red A:A Illness Z blue T:T Disease resistance Table 2 shows that, through identification and screening using the Cla_6118772 primer combination, materials that detected the T:T fluorescence signal corresponding to primer Cla_26118772 were homozygous materials resistant to Fusarium wilt. Materials that detected the A:A fluorescence signal corresponding to primer Cla_27993083 were homozygous materials susceptible to Fusarium wilt. Materials that detected the A:T fluorescence signal were heterozygous materials susceptible to Fusarium wilt. Therefore, the genotyping results of the Cla_26118772 primer combination of this invention are consistent with the Fusarium wilt resistance phenotype, with a detection accuracy of 88.8%, and can be applied to the rapid identification of Fusarium wilt resistance traits in watermelon. Screening using molecular markers greatly reduces the workload of Fusarium wilt inoculation identification during the watermelon seedling stage, improves the identification accuracy, and accelerates the breeding process.

[0035] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A KASP-labeled primer combination for detecting resistance traits to Fusarium wilt in watermelon and its application, characterized in that, The KASP marker primer combination includes upstream primer 1, upstream primer 2, and downstream primer 1; the nucleotide sequence of upstream primer 1 is shown in SEQ ID NO.1; the nucleotide sequence of upstream primer 2 is shown in SEQ ID NO.2; and the nucleotide sequence of downstream primer 1 is shown in SEQ ID NO.

3. When the KASP marker primer combination is used to detect the resistance trait of watermelon wilt, if the genotype is T:T, it is determined to be a homozygous plant resistant to wilt; if the genotype is A:A, it is determined to be a homozygous plant susceptible to wilt; and if the genotype is A:T, it is determined to be a heterozygous plant susceptible to wilt.

2. The KASP marker primer combination according to claim 1, characterized in that, The KASP-labeled primer combination uses the KASP molecular marker Cla_26118772 as the detection target.

3. The KASP-labeled primer combination according to claim 2, characterized in that, The Cla_26118772 base is located at the 26118772 bp position on chromosome 6 of the watermelon.

4. A method for identifying resistance traits to Fusarium wilt in watermelons, characterized in that, Includes the following steps: Genomic DNA was extracted from the watermelon to be identified; using the genomic DNA as a template, PCR amplification was performed using the Cla_26118772 marker primers as described in any one of claims 1 to 3; based on the differences in PCR fluorescence signals, the genotypes of the watermelon samples to be identified were determined, including T:T genotype, A:A genotype, and A:T genotype; the PCR fluorescence signal values ​​were read, and if it was T:T genotype, it was determined to be a homozygous plant resistant to Fusarium wilt; if it was A:A genotype, it was determined to be a homozygous plant susceptible to Fusarium wilt; if it was A:T genotype, it was determined to be a heterozygous plant susceptible to Fusarium wilt.

5. The method according to claim 4, characterized in that, The PCR amplification system includes: 2.5 μL of 2×KASPmaster mix, 1.25 μL of primer mix, and 1.25 μL of DNA template. The primers include upstream primer 1, upstream primer 2, and downstream primer 1; the primer mix is ​​made by mixing upstream primer 1, upstream primer 2, and downstream primer 1 in a volume ratio of 1:1:

3.

6. The method according to claim 4, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 60 s, for 27 cycles.

7. The application of the KASP-labeled primer combination according to any one of claims 1-3 in detecting resistance traits to watermelon Fusarium wilt.

Images