Single-tube eight-target nucleic acid detection reagent, primer probe composition and application

Abstract

This invention proposes a single-tube detection reagent for eight target nucleic acids, primer and probe compositions, and their applications, belonging to the field of genetic engineering technology. The eight-target nucleic acid detection kit (fluorescent PCR method) for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus described in this invention can simultaneously detect eight pathogen targets: influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. Parallel detection of eight pathogen targets can be achieved through a single-tube reaction, reducing the time wasted due to incorrect reagent selection caused by target misidentification, and reducing the consumption of consumables and instrument space required by existing multi-tube reactions. This provides efficient detection technology support for the rapid identification of pathogens in wastewater or the environment.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to an eight-fold nucleic acid detection kit, primer and probe composition, and single-tube non-diagnostic detection method for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. Background Technology

[0002] Influenza A virus, influenza B virus, novel coronavirus, and respiratory syncytial virus are common pathogens in respiratory diseases; norovirus is a common pathogen in diarrheal diseases; and pepper mild mottle virus is a ubiquitous plant pathogen present at high concentrations, serving as a pollution indicator in water sources.

[0003] Influenza A virus is a common influenza virus. It is most prone to mutation, and subtypes of the influenza A virus are commonly referred to as "avian influenza." Avian influenza is an acute infectious disease caused by avian influenza viruses that can also infect humans. Symptoms after infection mainly include high fever, cough, runny nose, and muscle pain, often accompanied by severe pneumonia. In severe cases, multiple organ failure, including heart and kidney failure, can lead to death, resulting in a high mortality rate. This disease can be transmitted through various routes, including the digestive tract, respiratory tract, skin lesions, and conjunctiva. Human-to-human and vehicular traffic are significant factors in its spread.

[0004] Influenza B virus, also known as influenza B virus, commonly causes localized influenza epidemics. It is characterized by a sudden onset, with chills and fever, with body temperature peaking within hours to 24 hours, reaching 39-40°C or even higher. Accompanying symptoms include headache, body aches, fatigue, and loss of appetite. Respiratory symptoms are relatively mild, including dry throat, sore throat, dry cough, and possibly diarrhea. Other symptoms include facial flushing, conjunctival hyperemia, pharyngeal congestion, and follicles on the soft palate.

[0005] The novel coronavirus (SARS-CoV-2) often causes COVID-19 infection. It is characterized by a short incubation period and a relatively slow onset, primarily manifesting as fever, dry cough, and fatigue. Body temperature is mostly low to moderate, but high fever can occur; some patients experience a shorter fever duration during the course of the disease. Dry throat and sore throat are also common, with some patients experiencing severe, "knife-like" pain. Respiratory symptoms are mainly dry cough, sometimes accompanied by a small amount of sputum. A prominent feature is a decreased or loss of smell and taste. Nasal congestion, runny nose, conjunctivitis, myalgia, and diarrhea may also occur. Most patients have a good prognosis, but a small number become critically ill, more commonly in the elderly, those with chronic underlying diseases, and those who have not been vaccinated.

[0006] Norovirus (NV) belongs to the family Caliciviridae and is a negative-sense RNA virus. Currently, serotyping of norovirus is not possible. Based on antigenic and nucleotide sequence variations, it is classified into six genogroups (GI, GII, GIII, GIV, GV, GVI). GI and GII are the two main genogroups causing acute gastroenteritis in humans. GIV can also infect humans, but is less frequently detected. Norovirus is transmitted through human-to-human contact, food, and water. The most common symptoms of norovirus infection are diarrhea and vomiting, followed by nausea, abdominal pain, headache, fever, chills, and muscle aches. A small number of cases can develop into severe illness and even death.

[0007] Respiratory syncytial virus (RSV) is an RNA virus belonging to the Paramyxoviridae family. It is one of the most common respiratory infectious agents that seriously endangers the health of infants and young children worldwide, with RSV outbreaks occurring globally. Initial infection most often occurs in infants under one year old, especially those aged 2-6 months, and is one of the leading causes of hospitalization in infancy. It is also a significant risk factor for childhood bronchial asthma. There are two main subtypes of RSV, type A and type B, with similar clinical symptoms and no clear distinction.

[0008] Pepper mild mottle virus (PMMoV) is a plant pathogen found in high concentrations in human feces and has been included in 29 global catalogues of microbial quality and technology related to water and food. Studies have found that PMMoV, a plant pathogen with high abundance, low removal rates, and no significant seasonal variation, can sensitively indicate the presence of fecal contamination in water sources and track contaminated water, making it a promising indicator of fecal contamination.

[0009] These pathogens can contaminate the environment and water sources during their transmission, causing infection. Therefore, establishing detection technologies for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottled virus that are highly sensitive, specific, have short detection time, low detection cost, are simple and convenient to operate, and do not require sophisticated equipment are of great significance for the rapid identification of cases and the control of epidemic transmission, and have important value for public health and food safety prevention and control.

[0010] Because the eight-channel kit adds four fluorescence channels—QUASAR 705, ATTO 425, CY7, and AF 405 (Alexa Fluor 405)—in addition to the commonly used FAM, HEX, CY5, and ROX channels, there is a significant broad-spectrum cross-interference between these channels. Furthermore, occasional and unpredictable competitive inhibition often occurs between two or more pairs of primers and probes. Therefore, combining and harmoniously integrating the eight primer pairs into a single reaction system requires not only completely overcoming the significant broad-spectrum cross-interference between the eight fluorescence channels, but also fully balancing the different requirements of the eight primer pairs in the amplification process. It also necessitates optimizing the reaction system structure and primer / probe composition to avoid cross-reactions between the eight primer pairs and to resolve competitive inhibition between two or more pairs of primers and probes, ensuring that each channel maintains its unique high specificity and sensitivity for detecting the target.

[0011] Because of these difficulties, most common multiplex reagent kits on the market are quadruple kits. However, the primer and probe sets of this invention are cleverly combined, and the components of the reaction system are perfectly matched, thus achieving a balanced eight-fold reaction system and enabling the kit to detect eight pathogen targets with high specificity and sensitivity. Summary of the Invention

[0012] The purpose of this invention is to propose an eight-fold nucleic acid detection kit, primer and probe composition, and single-tube non-diagnostic detection method for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. This kit can simultaneously detect eight pathogen targets: influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. Parallel detection of these eight pathogen targets can be achieved through a single-tube reaction, reducing the time wasted due to incorrect reagent selection caused by target misidentification. It also reduces the consumption of consumables and instrument space required by existing multi-tube reactions, providing efficient detection technology support for the rapid identification of pathogens in wastewater or the environment.

[0013] The technical solution of this invention is implemented as follows: This invention provides a primer and probe composition for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. The primers for influenza A virus are sequences IAV-1 and IAV-2, and the probe is sequence IAV-3. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2; and the nucleotide sequence of the probe is shown in SEQ ID NO:3. The primers for influenza B virus are sequences IBV-1 and IBV-2, and the probe is sequence IBV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5; and the nucleotide sequence of the probe is shown in SEQ ID NO:6. The primers for the novel coronavirus N gene are the sequences nCoV N-1 and nCoV N-2, and the probe is the sequence nCoV N-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:7; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:8; and the nucleotide sequence of the probe is shown in SEQ ID NO:9. The primers for the novel coronavirus O gene are the sequences nCoV O-1 and nCoV O-2, and the probe is the sequence nCoV O-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:11; and the nucleotide sequence of the probe is shown in SEQ ID NO:12. The primers for norovirus GI type are sequences GI-1 and GI-2, and the probe is sequence GI-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:13; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:14; and the nucleotide sequence of the probe is shown in SEQ ID NO:15. The primers for norovirus GII type are sequences GII-1 and GII-2, and the probe is sequence GII-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:16; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:17; and the nucleotide sequence of the probe is shown in SEQ ID NO:18. The primers for respiratory syncytial virus (RSV) are RSV-1 and RSV-2, and the probe is RSV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:19; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:20; and the nucleotide sequence of the probe is shown in SEQ ID NO:21. The primers for the chili pepper mottle virus are sequences PMMOV-1 and PMMOV-2, and the probe is sequence PMMOV-3. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:22; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:23; and the nucleotide sequence of the probe is shown in SEQ ID NO:24.

[0014] As a further improvement of the present invention, the kit includes an eight-pair specific primer-probe composition as described above.

[0015] As a further improvement of the present invention, the eight-fold nucleic acid detection kit for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus is characterized in that: the 5' end of the influenza A virus probe sequence IAV-3 is modified with FAM, and the 3' end is modified with BHQ1; the 5' end of the influenza B virus probe sequence IBV-3 is modified with HEX, and the 3' end is modified with BHQ1; the 5' end of the novel coronavirus N gene probe sequence nCoV N-3 is modified with CY5, and the 3' end is modified with BHQ2; the 5' end of the novel coronavirus O gene probe sequence nCoV O-3 is modified with ROX, and the 3' end is modified with BHQ2; the 5' end of the norovirus GI type probe sequence GI-3 is modified with QUASAR 705, and the 3' end is modified with BHQ3; and the 5' end of the norovirus GII type probe sequence GII-3 is modified with ATTO. The 5' end of the respiratory syncytial virus probe sequence RSV-3 is modified with CY7, and the 3' end is modified with BHQ3; the 5' end of the pepper mild mottle virus probe sequence PMMOV-3 is modified with AF 405 (Alexa Fluor 405) and the 3' end is modified with BHQ1.

[0016] As a further improvement of the present invention, the molar ratio of the forward primer, the reverse primer, and the specific fluorescent probe is: Influenza A virus: (1-2): (5-10): 3; Influenza B virus: (5-10): (5-10): 6; Novel coronavirus N gene: (1-3): (1-3): 6; Novel coronavirus O gene: (1-2): (3-5): 3; Norovirus GI type: (1-3): (3-5): 3; Norovirus GII type: (3-5): (3-5): 5; Respiratory syncytial virus: (1-3): (1-2): 5; Chili pepper mild mottle virus: (5-10): (1-3): 3.

[0017] As a further improvement of the present invention, the molar ratio of the forward primer, the reverse primer, and the specific fluorescent probe is: Influenza A virus: 1.8: 8:3; Influenza B virus ratio: 8:8:6; Novel coronavirus N gene ratio: 2:3:6; Novel coronavirus O gene: 1.8: 4:3; Norovirus GI type: 2:4:3; Norovirus GII type: 4:4:5; Respiratory syncytial virus: 2.5:1.8:5; Chili pepper mild mottle virus: 7:2:3.

[0018] As a further improvement of the present invention, its components include: (1) RT-PCR reaction solution: including a. PCR reaction solution: fluorescent PCR buffer, dNTPs, and DEPC water used in RT-PCR; b. Primer-probe mixture: including primers IAV-1, IAV-2; IBV-1, IBV-2; nCoV N-1, nCoV N-2; nCoV O-1, nCoV O-2; GI-1, GI-2; GII-1, GII-2; RSV-1, RSV-2; PMMOV-1, PMMOV-2 ​​and probes IAV-3, IBV-3, nCoV N-3, nCoV O-3, GI-3, GII-3, RSV-3, PMMOV-3; c. Mixed enzyme solution: including RNase inhibitor, reverse transcriptase, and DNA polymerase; The above three components are premixed into one tube and can be used directly without preparation.

[0019] (2) Positive controls: including influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottled virus containing primers IAV-1, IAV-2; IBV-1, IBV-2; nCoV N-1, nCoV N-2; nCoV O-1, nCoV O-2; GI-1, GI-2; GII-1, GII-2; RSV-1, RSV-2; PMMOV-1, PMMOV-2 ​​amplifying the target fragment; (3) Negative control: TE solution.

[0020] This invention further protects a single-tube, non-diagnostic, eight-fold fluorescent PCR method, the method comprising the following steps: S1. Extract total nucleic acid from the sample to be tested; S2. Using the total nucleic acid as a template and the primer and probe set described in claim 1, a recombinase polymerase amplification reaction is performed; S3. Collect fluorescence signals from the detection channels of FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF 405 (Alexa Fluor405) to obtain the detection results: S301. Quality control standards: For positive controls, the fluorescence signals of FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF405 (Alexa Fluor 405) show an increase in fluorescence index, and the Ct value is ≤32; for negative controls and blank controls, there is no increase in fluorescence index, and the Ct value is ≥39.6. S302. Positive Sample: When S301 is established, FAM or / and HEX or / and CY5 or / and ROX or / and QUASAR 705 or / and ATTO 425 or / and CY7 or / and AF 405 (Alexa Fluor 405) show an increase in fluorescence index, and the Ct value is ≤37, indicating that the sample is positive for influenza A virus or / and influenza B virus or / and novel coronavirus N gene or / and novel coronavirus O gene or / and norovirus GI or / and norovirus GII or / and respiratory syncytial virus or / and capsicum mottle virus; S303. Negative Sample: When S301 is established, the fluorescence index of FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 and / or CY7 and / or AF 405 (Alexa Fluor 405) shows no increase, and the Ct value is ≥39.6, indicating that the sample does not contain influenza A virus and / or influenza B virus and / or the novel coronavirus N gene and / or the novel coronavirus O gene and / or norovirus GI and / or norovirus GII and / or respiratory syncytial virus and / or capsicum mottle virus. S304. Suspected Samples: When S301 is established, FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 and / or CY7 and / or AF 405 (Alexa Fluor 405) show an increase in fluorescence index, and 37≤Ct value≤39.6. Repeat the test once. If the retest result is still 37≤Ct value≤39.6 and there is a significant increase in the index, it is judged as positive; otherwise, it is negative.

[0021] As a further improvement of the present invention, the PCR reaction solution is a fully aliquoted liquid reagent, which has been aliquoted into eight-tube, 96-well plate, and cryopreservation tube, and does not require preparation.

[0022] As a further improvement to the present invention, the reaction conditions are shown in Table 1 below: Table 1 Reaction conditions

[0023] The present invention has the following beneficial effects: The eight-fold nucleic acid detection kit (fluorescent PCR method) for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus described in this invention can simultaneously detect eight pathogen targets: influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. Parallel detection of eight pathogen targets can be achieved through a single tube reaction, reducing the time consumed by selecting the wrong detection reagent due to target misjudgment, reducing the amount of consumables and instrument space occupied by existing multi-tube reactions, and providing efficient detection technology support for the rapid identification of pathogens in sewage or the environment. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a positive control diagram of the present invention; Figure 2 Amplification curve of BNCC influenza A virus quality control sample; Figure 3 Amplification curve of the quality control product for influenza A virus from Bondsheng Biotechnology; Figure 4 Amplification curve of BNCC influenza B virus quality control sample; Figure 5 Amplification curve of the influenza B virus quality control product from Bondsheng Biotechnology; Figure 6 Amplification curve of BNCC's novel coronavirus quality control sample; Figure 7 Amplification curve of Bondsheng Biotechnology's novel coronavirus quality control sample; Figure 8Amplification curve of BNCC norovirus GI type quality control sample; Figure 9 Amplification curve of Bondsheng Biotechnology's norovirus GI type quality control sample; Figure 10 Amplification curve of BNCC norovirus GII type quality control sample; Figure 11 Amplification curve of Bondsheng Biotechnology's norovirus GII type quality control sample; Figure 12 Amplification curve of BNCC respiratory syncytial virus quality control sample; Figure 13 Amplification curve of the respiratory syncytial virus quality control sample from Bondsheng Biotechnology; Figure 14 Amplification curve of BNCC chili pepper mild mottle virus quality control sample; Figure 15 Amplification curve of Bondsheng Bio's pepper mild mottle virus quality control sample; Figure 16 This is a negative control diagram of the present invention; Figure 17 Amplification curve of influenza A virus sample; Figure 18 Amplification curve of influenza B virus sample; Figure 19 Amplification curve of a novel coronavirus sample; Figure 20 Amplification curve of norovirus GI type sample; Figure 21 Amplification curve of norovirus GII sample; Figure 22 Amplification curve of respiratory syncytial virus sample; Figure 23 Amplification curve of virus sample from chili pepper mottled area. Detailed Implementation

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to limit the invention; the term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0028] This invention provides a primer and probe composition and kit for detecting influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus in samples using real-time fluorescence PCR technology. Specifically, it relates to the detection applications of influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. Its basic principle utilizes eight sets of specific oligonucleotide primers and eight specific oligonucleotide probes in a sample containing reverse transcriptase, DNA polymerase, RNase inhibitor (RNasin), high-quality deoxyribonucleoside triphosphates (dNTPs), and Mg... 2+ In a PCR reaction solution with equal components, the target polynucleotide is cyclically amplified using a commercially available real-time quantitative PCR instrument, thereby achieving rapid, real-time, and quantitative detection of the target polynucleotide.

[0029] To achieve the present invention, the following technical solution is adopted: Using appropriate nucleic acid analysis software, homology comparisons were performed on the nucleotide sequences of known influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI, norovirus GII, respiratory syncytial virus, and capsicum mottle virus. Based on the identification of homologous regions, oligonucleotide primers and probes were designed. Because the designed primers and probes are complementary to the sequences of influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI, norovirus GII, respiratory syncytial virus, and capsicum mottle virus, and show no homology with the nucleotide sequences of other pathogens, and do not include any common endonuclease cleavage sites, false negatives and false positives in the detection of influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI, norovirus GII, respiratory syncytial virus, and capsicum mottle virus are avoided, thus improving the reliability and accuracy of the detection.

[0030] Order commercially available primers and probes based on the designed primer and probe sequences.

[0031] Establish a suitable reaction system and fluorescence detection system for multiplex PCR amplification. The nucleic acid amplification reaction system includes an RNase inhibitor, reverse transcriptase, DNA polymerase, dNTPs, a forward primer that binds to the first strand of the double-stranded target polynucleotide, a reverse primer that binds to the second strand of the double-stranded target polynucleotide, an oligonucleotide probe that binds to the target polynucleotide and has a fluorophore and a fluorescence quencher at each end, respectively, and a buffer containing magnesium ions. The concentrations of the forward primer, reverse primer, and oligonucleotide probe all need to be adjusted to ensure that the curves for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottled virus are consistent and meet the testing requirements.

[0032] Nucleic acid was extracted from the sample to be tested and added to the aforementioned reaction system. Amplification was performed using a real-time PCR instrument. The presence of influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus gene was determined from the fluorescence amplification curve.

[0033] The present invention provides an eight-fold nucleic acid detection kit (fluorescent PCR method) for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus, comprising amplification primers and specific fluorescent probes, the sequences of which are shown below: ①The primers for influenza A virus are IAV-1 and IAV-2, and the probe is IAV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2; and the nucleotide sequence of the probe is shown in SEQ ID NO:3. ②The primers for influenza B virus are sequences IBV-1 and IBV-2, and the probe is sequence IBV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5; and the nucleotide sequence of the probe is shown in SEQ ID NO:6. ③ The primers for the novel coronavirus N gene are the sequences nCoV N-1 and nCoV N-2, and the probe is the sequence nCoV N-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:7; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:8; and the nucleotide sequence of the probe is shown in SEQ ID NO:9. ④ The primers for the novel coronavirus O gene are the sequences nCoV O-1 and nCoV O-2, and the probe is the sequence nCoV O-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:11; and the nucleotide sequence of the probe is shown in SEQ ID NO:12. ⑤ The primers for norovirus GI type are sequences GI-1 and GI-2, and the probe is sequence GI-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:13; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:14; and the nucleotide sequence of the probe is shown in SEQ ID NO:15. ⑥ The primers for norovirus GII type are sequences GII-1 and GII-2, and the probe is sequence GII-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:16; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:17; and the nucleotide sequence of the probe is shown in SEQ ID NO:18. ⑦ The primers for respiratory syncytial virus are RSV-1 and RSV-2, and the probe is RSV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:19; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:20; and the nucleotide sequence of the probe is shown in SEQ ID NO:21. ⑧ The primers for the pepper mottle virus are sequences PMMOV-1 and PMMOV-2, and the probe is sequence PMMOV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:22; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:23; and the nucleotide sequence of the probe is shown in SEQ ID NO:24.

[0034] In a preferred embodiment of the present invention, the molar ratios of forward primers:reverse primers:specific fluorescent probes for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus are respectively: ①Influenza A virus: 180nM: 800nM: 300nM; ②Influenza B virus: 800nM: 800nM: 600nM; ③ Novel coronavirus N gene: 200nM: 300nM: 600nM; ④ Novel coronavirus O gene: 180nM: 400nM: 300nM; ⑤ Norovirus GI type: 200nM: 400nM: 300nM; ⑥ Norovirus GII type: 400nM: 400nM: 500nM; ⑦ Respiratory syncytial virus: 250nM: 180nM: 500nM; ⑧ Chili pepper mild mottle virus: 700nM: 200nM: 300nM.

[0035] The present invention provides an eight-fold nucleic acid detection kit (fluorescent PCR method) for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. The kit includes PCR reaction solution (containing RT-PCR reaction solution, primer-probe mixture, and mixed enzyme solution), positive control, and negative control. Specifically, it includes: Multiple eight-tube sets, 96-well plates, or cryovials containing PCR reaction solution (including RT-PCR reaction solution, primer and probe mixture, and mixed enzyme solution), positive control, and negative control, and sealed with caps. ② Separate and group these eight-tube or 96-well plate or cryopreservation tubes into packaging boxes.

[0036] The negative control in the kit described in this invention is a TE solution, and the positive control is a synthetic positive model containing template sequences of influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus, used for quality control in actual testing.

[0037] The present invention provides an eight-fold nucleic acid detection kit (fluorescent PCR method) for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. This kit detects influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. The method includes the following steps: Nucleic acid was extracted from the sample using a commercially available nucleic acid extraction kit for PCR testing. The extraction was performed according to the kit's instruction manual.

[0038] ② Add the extracted nucleic acid to a PCR reaction tube containing PCR reaction solution for PCR amplification, and then detect it using a commercially available real-time quantitative PCR instrument.

[0039] The present invention describes an eight-fold nucleic acid detection kit (fluorescent PCR method) for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. This kit can simultaneously detect eight pathogen targets: influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus. Parallel detection of these eight pathogen targets can be achieved through a single-tube reaction, reducing the time wasted due to incorrect reagent selection caused by target misidentification. It also reduces the consumption of consumables and instrument space required by existing multi-tube reactions, providing efficient detection technology support for the rapid identification of pathogens in wastewater or the environment.

[0040] Example 1: Quality control sample testing: We used our company's nucleic acid extraction kit (Guangzhou Shengling Nucleic Acid Extraction Kit) to extract quality control samples for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsaicin mild mottle virus. Two brands were selected for each quality control sample: BNCC (Beina Biotechnology): Influenza A virus (batch number: 251023), Influenza B virus (batch number: 250812), Novel coronavirus (batch number: 251221), Norovirus G1 (batch number: 251114), Norovirus GII (batch number: 250918), Respiratory syncytial virus (batch number: 251112), Pepper mild mottle virus (batch number: 251130). Bondsheng Biotechnology: Influenza A virus (batch number: 202508012), Influenza B virus (batch number: 202507008), Novel Coronavirus (batch number: 202505010), Norovirus GI (batch number: 202506012), Norovirus GII (batch number: 202506021), Respiratory Syncytial Virus (batch number: 202510012), and Pepper Mottle Virus (batch number: 202511001). Primer solution, probe solution, and positive control are the main components of the kit described in this patent; the negative control is TE solution. Configure according to Table 2, and set the relevant parameters according to Table 3 for instrumental testing (Shanghai Hongshi Real-Time PCR Instrument, model SLAN-96H).

[0041] Table 2 Reaction System

[0042] Table 3 Reaction conditions

[0043] The test results are shown in Table 4: ① Quality control standards: The positive control FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF 405 (Alexa Fluor 405) fluorescence signals showed a logarithmic increase in fluorescence, and the Ct value was ≤32.

[0044] ② Samples tested: FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF 405 (Alexa Fluor405) all showed logarithmic fluorescence growth, indicating that the kit detected influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mild mottle virus, respectively.

[0045] ③ Negative controls: FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF 405 (Alexa Fluor405) all showed no fluorescence log growth, with Ct values ​​≥39.6, demonstrating the specificity and interference resistance of the method in this application.

[0046] Table 4 Experimental Results

[0047] The Ct values ​​above were automatically read by the real-time PCR instrument based on the amplified fluorescence signal and curve shape, ensuring the accuracy of the data.

[0048] Example 2: Real Sample Testing Extraction was performed using our company's nucleic acid extraction kit (Guangzhou Shengling Nucleic Acid Extraction Kit). Six pathogens were identified: Influenza A virus, Influenza B virus, SARS-CoV-2 N gene, SARS-CoV-2 O gene, Norovirus GI, Norovirus GII, Respiratory Syncytial Virus, and Capsicum Mild Mottle Virus. Two samples of each pathogen were collected for testing. Primer solution, probe solution, and positive control are the main components of the kit described in this patent; the negative control is TE solution. The kit was configured according to Table 2, and the relevant parameters were set according to Table 3 for instrumental testing (Shanghai Hongshi Real-Time PCR Instrument, model SLAN-96H).

[0049] The test results are shown in Table 5: Tested samples: In the detection of the target pathogen, all channels of the kit, including FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF405, showed a significant increase in fluorescence logarithmic growth, indicating that the kit accurately detects influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI, norovirus GII, respiratory syncytial virus, and capsicum mottled virus. Furthermore, no increase in fluorescence logarithmic growth was observed in the other 7 detection channels corresponding to non-target pathogens, demonstrating the accuracy and sensitivity of the reagent.

[0050] Table 5 Experimental Results

[0051] The Ct values ​​above were automatically read by the real-time PCR instrument based on the amplified fluorescence signal and curve shape, ensuring the accuracy of the data.

[0052] The relevant primer and probe sequences for the virus are as follows: Influenza A virus: SEQ ID NO:1(PQ142752:14-32, this is the sequence number and primer location in NCBI, the same below); IAV-1:ccgaggtcgaaacgtaygt; SEQ ID NO:2(PQ142752:83-66); IAV-2:agtytctgygcgatctcg; SEQ ID NO:3(PQ142752:46-65); IAV-3: ccrtcaggccccctcaaagc; Influenza B virus: SEQ ID NO:4(PQ113366:1438-1461); IBV-1: gctgtaagaagaatgctgtcaatg; SEQ ID NO:5(PQ113366:1524-1503); IBV-2:cattgartcattcatcatcttg; SEQ ID NO:6(PQ113366:1493-1469); IBV-3: cctttgacatctgcatcacgyccct; Novel Coronavirus N Gene: SEQ ID NO:7(MT019529:29423-29442); nCoV N-1: cagagacagaagaaacagca; SEQ ID NO:8(MT019529:29508-29489); nCoV N-2: ctcatggattgttgcaattg; SEQ ID NO:9(MT019529:29445-29468); nCoV N-3: ctgtgactcttcttcctgctgcag; Novel Coronavirus O Gene: SEQ ID NO:10(MT019529:1148-1168); nCoV O-1: ggctttatgggtagaattcga; SEQ ID NO:11(MT019529:1214-1196); nCoV O-2: ggcacatttggttgcattc; SEQ ID NO:12(MT019529:1169-1191); nCoV O-3: tctgtctatccagttgcgtcacc; Norovirus GI type: SEQ ID NO:13(LC122690.1:5223-5240); GI-1: ccttgaaatgtatgtgcc; SEQ ID NO:14(LC122690.1:5330-5311); GI-2:tcatttacaaattcgggcag; SEQ ID NO:15(LC122690.1:5276-5251); GI-3: tggaaccgcatccaacggaacatggc; Norovirus GII: SEQ ID NO:16(AB933654.1:5101-5118); GII-1:cgccaacccatctgatgg; SEQ ID NO:17(AB933654.1:5196-5177); GII-2:gccgcaatagcggcaccgac; SEQ ID NO:18(AB933654.1:5134-5157); GII-3:cgtcccagaggtcaacaatgaggt; Respiratory syncytial virus: SEQ ID NO:19(PQ117678:3209-3231); RSV-1:aatatggaaacatacgtgaayaa; SEQ ID NO:20(PQ117678:3281-3260); RSV-2: ctagracattgtaytgaacagc; SEQ ID NO:21(PQ117678:3233-3258); RSV-3:cttcacgarggctccacatacacacagc; Chili pepper mild mottle virus: SEQ ID NO:22(MW373851.1:1864-1883); PMMOV-1:gtggtttcaaatgagagtgg; SEQ ID NO:23(MW373851.1:1973-1955); PMMOV-2:ttcaacgaaccttcctcct; SEQ ID NO:24(MW373851.1:1899-1922); PMMOV-3:tgagaggcctaccgaagcaaatgt.

[0053] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A primer and probe composition for single-tube detection of eight pathogen targets, comprising primer and probe compositions for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus, characterized in that, The primers for the influenza A virus are sequences IAV-1 and IAV-2, and the probe is sequence IAV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2; and the nucleotide sequence of the probe is shown in SEQ ID NO:

3. The primers for the influenza B virus are sequences IBV-1 and IBV-2, and the probe is sequence IBV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:5; and the nucleotide sequence of the probe is shown in SEQ ID NO:

6. The primers for the novel coronavirus N gene are sequences nCoV N-1 and nCoV N-2, and the probe is sequence nCoV N-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:7; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:8; and the nucleotide sequence of the probe is shown in SEQ ID NO:

9. The primers for the novel coronavirus O gene are sequences nCoV O-1 and nCoV O-2, and the probe is sequence nCoV O-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:11; and the nucleotide sequence of the probe is shown in SEQ ID NO:

12. The primers for the norovirus GI type are sequences GI-1 and GI-2, and the probe is sequence GI-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:13; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:14; and the nucleotide sequence of the probe is shown in SEQ ID NO:

15. The primers for the norovirus GII type are sequences GII-1 and GII-2, and the probe is sequence GII-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:16; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:17; and the nucleotide sequence of the probe is shown in SEQ ID NO:

18. The primers for the respiratory syncytial virus are RSV-1 and RSV-2, and the probe is RSV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:19; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:20; and the nucleotide sequence of the probe is shown in SEQ ID NO:

21. The primers for the pepper mottle virus are sequences PMMOV-1 and PMMOV-2, and the probe is sequence PMMOV-3; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:22; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:23; and the nucleotide sequence of the probe is shown in SEQ ID NO:

24.

2. A single-tube nucleic acid detection kit for eight pathogen targets, comprising eight nucleic acid detection kits for influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottle virus, characterized in that, The primer-probe composition comprising the eight pathogen targets described in claim 1.

3. The nucleic acid detection kit for detecting eight pathogen targets in a single tube according to claim 2, characterized in that, The 5' end of the influenza A virus probe sequence IAV-3 is modified with FAM, and the 3' end is modified with BHQ1; the 5' end of the influenza B virus probe sequence IBV-3 is modified with HEX, and the 3' end is modified with BHQ1; the 5' end of the novel coronavirus N gene probe sequence nCoV N-3 is modified with CY5, and the 3' end is modified with BHQ2; the 5' end of the novel coronavirus O gene probe sequence nCoV O-3 is modified with ROX, and the 3' end is modified with BHQ2; the 5' end of the norovirus GI type probe sequence GI-3 is modified with QUASAR 705, and the 3' end is modified with BHQ3; the 5' end of the norovirus GII type probe sequence GII-3 is modified with ATTO 425, and the 3' end is modified with BHQ1; the 5' end of the respiratory syncytial virus probe sequence RSV-3 is modified with CY7, and the 3' end is modified with BHQ3; the 5' end of the capsicum mottle virus probe sequence PMMOV-3 is modified with AF... Modify with 405, and modify the 3' end with BHQ1.

4. The nucleic acid detection kit for detecting eight pathogen targets in a single tube according to claim 2, characterized in that, The molar ratio of forward primer, reverse primer, and specific fluorescent probe is: Influenza A virus: (1-2): (5-10): 3; Influenza B virus: (5-10): (5-10): 6; Novel coronavirus N gene: (1-3): (1-3): 6; Novel coronavirus O gene: (1-2): (3-5): 3; Norovirus GI type: (1-3): (3-5): 3; Norovirus GII type: (3-5): (3-5): 5; Respiratory syncytial virus: (1-3): (1-2): 5; Chili pepper mild mottle virus: (5-10): (1-3):

3.

5. The nucleic acid detection kit for detecting eight pathogen targets in a single tube according to claim 2, characterized in that, The molar ratio of forward primer, reverse primer, and specific fluorescent probe is: Influenza A virus: 1.8:8:3; Influenza B virus ratio: 8:8:6; Novel coronavirus N gene ratio: 2:3:6; Novel coronavirus O gene: 1.8:4:3; Norovirus GI type: 2:4:3; Norovirus GII type: 4:4:5; Respiratory syncytial virus: 2.5:1.8:5; Chili pepper mild mottle virus: 7:2:

3.

6. The nucleic acid detection kit for detecting eight pathogen targets in a single tube according to claim 2, characterized in that, Its components include: (1) PCR reaction solution: including a. Reaction solution: Fluorescent PCR buffer, dNTPs, and DEPC water used in RT-PCR; b. Primer-probe mixture: including primers IAV-1, IAV-2; IBV-1, IBV-2; nCoV N-1, nCoV N-2; nCoVO-1, nCoV O-2; GI-1, GI-2; GII-1, GII-2; RSV-1, RSV-2; PMMOV-1, PMMOV-2 ​​and probes IAV-3, IBV-3, nCoV N-3, nCoV O-3, GI-3, GII-3, RSV-3, PMMOV-3; c. Mixed enzyme solution: including RNase inhibitor, reverse transcriptase, and DNA polymerase; The above three components are premixed into one tube and can be used directly without preparation. (2) Positive controls: including influenza A virus, influenza B virus, novel coronavirus N gene, novel coronavirus O gene, norovirus GI type, norovirus GII type, respiratory syncytial virus, and capsicum mottled virus containing primers IAV-1, IAV-2; IBV-1, IBV-2; nCoV N-1, nCoV N-2; nCoV O-1, nCoV O-2; GI-1, GI-2; GII-1, GII-2; RSV-1, RSV-2; PMMOV-1, PMMOV-2 ​​amplifying the target fragment; (3) Negative control: TE solution.

7. The application of the reagent kit as described in claim 1, characterized in that, This method is used for single-tube detection of nucleic acids targeting eight pathogens using an octet fluorescent PCR technique. For non-diagnostic purposes, including detecting pathogen contamination in environmental or water samples (where the sample is not taken from a human body), the method includes the following steps: S1. Extract total nucleic acid from the sample to be tested; S2. Using the total nucleic acid as a template and the primer and probe set described in claim 1, a recombinase polymerase amplification reaction is performed; S3. Collect fluorescence signals from the detection channels of FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF 405 to obtain the detection results: S301. Quality control standards: For positive controls, the fluorescence signals of FAM, HEX, CY5, ROX, QUASAR 705, ATTO 425, CY7, and AF 405 show an increase in fluorescence index, and the Ct value is ≤32; for negative controls and blank controls, there is no increase in fluorescence index, and the Ct value is ≥39.

6. S302. Positive sample: When S301 is established, FAM or / and HEX or / and CY5 or / and ROX or / and QUASAR 705 or / and ATTO 425 or / and CY7 or / and AF 405 show an increase in fluorescence index, and the Ct value is ≤37, indicating that the sample is positive for influenza A virus or / and influenza B virus or / and novel coronavirus N gene or / and novel coronavirus O gene or / and norovirus GI or / and norovirus GII or / and respiratory syncytial virus or / and capsicum mottle virus; S303. Negative Sample: When S301 is established, FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 and / or CY7 and / or AF 405 show no increase in fluorescence index, and the Ct value is ≥39.6, indicating that the sample does not contain influenza A virus and / or influenza B virus and / or the novel coronavirus N gene and / or the novel coronavirus O gene and / or norovirus GI and / or norovirus GII and / or respiratory syncytial virus and / or capsicum mottle virus. S304. Suspected Samples: When S301 is established, FAM and / or HEX and / or CY5 and / or ROX and / or QUASAR 705 and / or ATTO 425 and / or CY7 and / or AF 405 show an increase in fluorescence index, and 37≤Ct value≤39.

6. Repeat the test once. If the retest result is still 37≤Ct value≤39.6 and there is a significant increase in the index, it is judged as positive; otherwise, it is negative.

8. The application according to claim 7, characterized in that, The PCR reaction solution is a fully aliquoted liquid reagent, already dispensed into eight-tube strips, 96-well plates, and cryovials, and does not require preparation.

9. The application according to claim 7, characterized in that, The reaction conditions are: The reaction volume was 25 μL. Virus model corresponding data collection: Influenza A virus: Fluorescence signals were collected using the FAM channel; Influenza B virus: Fluorescence signals were collected using the HEX / VIC / HEX channels; Novel coronavirus N gene: fluorescence signal collected from the CY5 channel; Novel coronavirus O gene: fluorescence signal collected via ROX channel; Norovirus GI: Fluorescence signal was acquired using QUASAR 705 channel; Norovirus GII: Fluorescence signal was acquired using ATTO 425 channel; Respiratory syncytial virus: Fluorescent signals were collected using the CY7 channel; Pepper mild mottle virus: Fluorescence signal was collected using the AF 405 channel; PCR reaction conditions include: Reverse transcription: 50℃, 15 min, one cycle; Pre-denaturation: 95℃, 5 min, cycle once; PCR: 95℃, 3s; 55℃, 45s, 40 cycles.

Images