Primer probe combination for detecting porcine bocavirus by duplex qPCR and its application

Abstract

This invention discloses a primer-probe combination for dual qPCR detection of porcine bocavirus and its application. The primer-probe combination includes primer pairs for detecting porcine bocavirus (PBoV). This combination uses a relatively small number of primers and probes to detect multiple target genes simultaneously, exhibiting high detection efficiency, high specificity and sensitivity, and good linearity and amplification efficiency.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection, specifically to a primer-probe combination for dual qPCR detection of porcine bocavirus and its application. Background Technology

[0002] Porcine bocavirus (PBoV) belongs to the family Parvoviridae, subfamily Parvovirinae, and genus Bocavirus. It is a non-enveloped, single-stranded linear DNA virus that can cause diarrhea and respiratory infections in pigs. Based on the differences in the structural proteins (VP1 / VP2 proteins) and the non-structural proteins encoded by the NS1 gene, PBoV is classified into five genotypes: PBoV1, PBoV2, PBoV3, PBoV4, and PBoV5.

[0003] my country's swine industry is highly developed, providing crucial raw materials for various biochemical drugs such as insulin, heparin sodium, thrombin, corticotropin, and posterior pituitary injections. According to the requirements of the Chinese Pharmacopoeia, the General Principles for Technical Review of Viral Safety Evaluation of Biological Tissue Extracts and Eukaryotic Cell Expression Products, and the Appendix to Biochemical Drugs in the Good Manufacturing Practice for Pharmaceuticals, it is necessary to test for potential exogenous viruses in animal-derived raw materials. The "Key Points for Risk Control of Viral Contamination in Therapeutic Biological Products," compiled by the National Pharmacopoeia Commission and the China Center for International Food and Drug Exchange, lists 11 potential swine viruses, including PBoV.

[0004] Real-time quantitative PCR (TaqMan probe) has advantages such as high specificity, high sensitivity, and good reproducibility, and is widely used for virus detection. Given that porcine biopharmaceutical raw materials often originate from multiple donors in different batches, there may be a risk of cross-contamination of multiple PBoV genotypes. Therefore, developing a qPCR detection method capable of specifically and simultaneously detecting five PBoV genotypes is of great significance in the field of biopharmaceutical safety. Summary of the Invention

[0005] The technical problem to be solved by this invention is the deficiency of existing methods for cross-detection of different genotypes of porcine bocavirus. This invention provides a primer-probe combination for dual qPCR detection of porcine bocavirus and its application, which can simultaneously detect five genotypes of PBoV to meet the needs of PBoV detection in porcine biochemical pharmaceutical raw materials.

[0006] The present invention solves the above-mentioned technical problems through the following technical solutions.

[0007] A first aspect of the present invention provides a primer pair for detecting porcine bocavirus (PBoV), the primer pair comprising a forward primer and a reverse primer; the primer pair is selected from one or more of the following: Primer pair A, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 2; and / or Primer pair B, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 5.

[0008] In this invention, primer pair A is designed based on homologous sequences of PBoV1 and PBoV2, and primer pair B is designed based on homologous sequences of PBoV3 / PBoV4 / PBoV5.

[0009] A second aspect of the present invention provides a primer-probe combination for detecting porcine bocavirus (PBoV), the primer-probe combination comprising probes and primer pairs as described in the first aspect.

[0010] In some embodiments, the nucleotide sequence of the probe for primer pair A is shown in SEQ ID NO: 3.

[0011] In some embodiments, the nucleotide sequence of the probe for primer pair B is shown in SEQ ID NO: 6.

[0012] In some embodiments, the probe is a fluorescently labeled probe.

[0013] In some preferred embodiments, the fluorescent label may be conventional in the art, such as selected from FAM, Cy5, HEX, JOE, ROX, TAMRA, TET, VIC, Cy3, Cy5.5, Texas Red, NED and their derivatives.

[0014] In some preferred embodiments, the probe further includes a quenching group, which is preferably selected from BHQ-1, BHQ-2, BHQ-3, Dabcyl, Eclipse, MGB and their derivatives.

[0015] In some specific embodiments, the 5' end of the probe of primer pair A is coupled with a FAM fluorescent group.

[0016] In some specific embodiments, the 5' end of the probe of primer pair B is coupled with a FAM fluorescent group.

[0017] In some specific embodiments, the 3' end of the probe of primer pair A is coupled with a BHQ-1 quencher group.

[0018] In some specific embodiments, the 3' end of the probe of primer pair B is coupled with a BHQ-1 quencher group.

[0019] In some specific embodiments, the 5' end of the probe of primer pair A is coupled with a FAM fluorescent group, and the 3' end is coupled with a BHQ-1 quencher group.

[0020] In some specific embodiments, the 5' end of the probe of primer pair B is coupled with a FAM fluorescent group, and the 3' end is coupled with a BHQ-1 quencher group.

[0021] A third aspect of the present invention provides a kit for detecting porcine bocavirus (PBoV), the kit comprising primer pairs as described in the first aspect, or primer-probe combinations as described in the second aspect.

[0022] In some implementations, the kit also includes a qPCR reaction system.

[0023] In some preferred embodiments, the qPCR reaction system includes TaqMan probe premix, dye, and nuclease-free water.

[0024] In some implementations, the qPCR reaction system also includes a positive control.

[0025] In some preferred embodiments, the positive control is a cloning plasmid containing the target gene sequence.

[0026] In some preferred embodiments, the cloning plasmid is conventional in the art, such as the pUC57 plasmid.

[0027] In some specific embodiments, when the kit contains primer pair A, the nucleotide sequence of the positive control is shown in SEQ ID NO: 7; when the kit contains primer pair B, the nucleotide sequence of the positive control is shown in SEQ ID NO: 8.

[0028] In some embodiments, the kit further comprises a positive control: a homologous sequence of PBoV1 and PBoV2 (SEQ ID NO: 7): The plasmid “TTCCAGTCCGGGTGGGTCACCAACGACAGAGCATACTGCTGTCCGCAATCCGACTTCAATCCGCTCGTGCAAACGAGGAGATACTACCCGACGTGGAACGGCTCATCGAACTCATACTCGTATAATAGATACGGACCCTACAAAAAACCGAGCAACTGGATGCCGGGACCGGGACTGGCCTACAAGGGCGCTACACACACAAATCAGAATCCAGATGATGCGAGAGGGCCGATCGTGACCACGATCGCTCCGA” was cloned into the pUC57 plasmid to obtain a PBoV1 / V2 positive plasmid, which was used as a positive control for the PBoV1 / V2 primer-probe qPCR reaction system; the homologous sequences of PBoV3, PBoV4, and PBoV5 (SEQ ID NO: 8) were also used. The plasmid “GTTCCGCGGGCTTCTGTTTCCTGGTTATAATTATTTGGGTCCTTTTAATCCTTTGGAAAACGGTGATCCTGTCAATAAAGCCGACGAGGCCGCAAAAAAACACGATCAAGCCTATAATAATTATATCAATAAAGGTTTAAATCCCTACCTGAAATTTAATAAAGGTGATCAAGACTTTATCGACTCTTTGCAGTCTGACTCTTCTGTGGGCGGTAACTTTGCGCGTGCCGTCTTTCATTTGAAAAAACAAATTGCGCCTGCGCTCAACGAGCCTAAAGACACGGGGGAACCTCCGGCCAAGAAGGA” was cloned onto the pUC57 plasmid to obtain the PBoV3 / V4 / V5 positive plasmid, which was used as the positive control for the PBoV3 / V4 / V5 primer-probe qPCR reaction system.

[0029] A fourth aspect of the present invention provides a method for detecting porcine bocavirus (PBoV) based on qPCR, the method comprising contacting and reacting a sample to be tested with one or more primer pairs as described in the first aspect, or one or more primer-probe combinations as described in the second aspect, in a qPCR reaction system.

[0030] In some implementations, the qPCR reaction system is as described in the third aspect.

[0031] In some implementations, the sample to be tested is a body fluid sample, blood sample, tissue sample, or fecal sample.

[0032] In some implementations, the method is for non-diagnostic purposes.

[0033] In some embodiments, the ratio of the forward primer, the reverse primer, and the corresponding probe in the reaction system is 2:2:1.

[0034] In some embodiments, the reaction conditions are 95°C for 20 seconds per cycle, 95°C for 3 seconds and 60°C for 30 seconds for 45 cycles, with fluorescence signals collected at 60°C.

[0035] In some preferred embodiments, when the primer pair that contacts and reacts with the sample to be tested is primer pair A or primer pair B, the reaction system comprises 0.4 μL of 10 μM forward primer, 0.4 μL of 10 μM reverse primer, and 0.2 μL of 10 μM probe per 20 μL of reaction system.

[0036] In some embodiments, when the primer pair that contacts and reacts with the sample to be tested is primer pair A and primer pair B, each 20 μL of the reaction system includes 0.4 μL of 10 μM forward primer of primer pair A, 0.4 μL of 10 μM reverse primer of primer pair A, 0.4 μL of 10 μM forward primer of primer pair B, 0.4 μL of 10 μM reverse primer of primer pair B, 0.2 μL of 10 μM probe of primer pair A, and 0.2 μL of 10 μM probe of primer pair B.

[0037] In some implementations, the method includes the following steps: preparing nucleic acids from the sample to be tested; creating a FAM fluorescent group detection channel on a qPCR instrument and performing a double qPCR reaction on the nucleic acids of the sample to be tested; and determining the detection results based on the amplification curve and Ct value generated by the double qPCR reaction.

[0038] In some specific implementation schemes, the reaction system for the above-mentioned duplex qPCR reaction is as follows: 10 μL of Premix Ex Taq ProbeqPCR (2X) (Takara, RR390A), 0.4 μL each of the forward primer (10 μM) and reverse primer (10 μM) of primer pair A and primer pair B, 0.2 μL each of the probe (10 μM) of primer pair A and primer pair B, 0.2 μL of ROX Reference Dye II (50 X), 2.8 μL of RT-PCR grade water, and 5 μL of template to be detected. The amplification program for the above-mentioned duplex qPCR reaction is as follows: first, pre-denaturation at 95℃ for 20 sec; then, 95℃ for 3 sec, 60℃ for 30 sec (collecting fluorescence signal), for a total of 45 cycles.

[0039] In some specific implementation schemes, the determination of the above detection results is as follows: when the Ct value of the FAM fluorescent group detection channel is ≤40 and there is an obvious amplification curve, PBoV is determined to be positive; when the Ct value of the FAM fluorescent group detection channel is >40 or there is no obvious amplification curve, PBoV is determined to be negative.

[0040] A fifth aspect of the present invention provides the application of primer pairs as described in the first aspect and primer-probe combinations as described in the second aspect in the preparation of products for quantitative detection of porcine bocavirus (PBoV).

[0041] In some implementations, the product is selected from reagent kits, test strips, and chips.

[0042] In some specific embodiments, the kit comprises primer pairs as described in the first aspect and / or primer-probe combinations as described in the second aspect, TaqMan probes, dyes, and nuclease-free water, and optionally includes instructions for use.

[0043] In some specific implementations, the test strip is a lateral flow chromatography test strip, comprising a sample pad, a conjugate pad, a nitrocellulose membrane, and an absorbent pad, wherein the conjugate pad is immobilized with a labeled probe that specifically binds to the amplification product.

[0044] In some specific implementations, the chip is a gene chip containing an array of probes that specifically hybridize with PBoV and are immobilized on a solid support.

[0045] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0046] The reagents and raw materials used in this invention are all commercially available.

[0047] The positive and progressive effects of this invention are as follows: 1. This invention designs primer pairs and probes targeting PBoV1 / V2 or PBoV3 / V4 / V5 based on the genotypes of porcine bocavirus. The 5' end of the probe is coupled with a homologous fluorescent group. When used in a dual qPCR reaction system with the primers, this allows for a superposition effect of fluorescence signals, improving detection sensitivity to a certain extent. Furthermore, it enables the simultaneous detection of five genotypes of porcine bocavirus, meeting the needs for PBoV detection in porcine-derived biochemical pharmaceutical raw materials.

[0048] 2. The method of the present invention integrates amplification and quantitative detection, and is simple and efficient to operate.

[0049] 3. The porcine bocavirus dual qPCR detection reaction system of the present invention has high specificity, and its primer and probe combination has no cross-reaction with Porcine Female Genomic DNA, pUC57 plasmid, or porcine circovirus (PCV) genome. Attached Figure Description

[0050] Figure 1 This diagram illustrates the linearity and amplification efficiency of PBoV single and dual qPCR detection systems.

[0051] Figure 2A This is a schematic diagram showing the sensitivity results (PBoV1 / V2) of the PBoV singleton qPCR detection system.

[0052] Figure 2B This is a schematic diagram showing the sensitivity results of the PBoV singleton qPCR detection system (PBoV3 / V4 / V5).

[0053] Figure 2C This is a schematic diagram showing the sensitivity results of the PBoV dual qPCR detection system.

[0054] Figure 3 This is a schematic diagram showing the specificity verification results of the PBoV dual qPCR detection method (Porcine Female Genomic DNA and pUC57-BoCV recombinant plasmid).

[0055] Figure 4A This is a schematic diagram showing the detection results of porcine circovirus (PCV) in Pig Pancreas Genomic DNA and Porcine Female Genomic DNA.

[0056] Figure 4B This is a schematic diagram showing the specificity verification results (other viral nucleic acids) of the PBoV dual qPCR detection method. Detailed Implementation

[0057] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0058] In the primer and probe combination provided in this embodiment for detecting porcine bocavirus PBoV1, PBoV2, PBoV3, PBoV4, and PBoV5, the 5' end of each probe is coupled with the same FAM fluorescent label. In actual detection, if the sample contains cross-contamination of multiple PBoV genotypes, the fluorescence signal can produce a superposition effect. The 3' end of each probe is coupled with a BHQ1 quencher group.

[0059] Example 1: Design and Synthesis of PBoV Primers and Probes

[0060] The applicant downloaded the genome sequences of PBoV1, PBoV2, PBoV3, PBoV4, and PBoV5 from NCBI. Based on genome homology analysis, the applicant optimized and designed the minimum number of primer-probe combinations to achieve the goal of simultaneously detecting five genotypes in a single-tube reaction. The primer-probe sequences are shown in Table 1. All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0061] Table 1. PBoV qPCR primers and probe sequences

[0062] Example 2: Establishment of PBoV singlet qPCR reaction system and procedure

[0063] After optimization, using the reaction system and procedure in Table 2-4, the PBoV singlet qPCR reaction showed better linearity, amplification efficiency, and sensitivity.

[0064] Table 2 PBoV1 / V2 reaction system

[0065] Table 3 PBoV3 / V4 / V5 reaction system

[0066] Table 4 PBoV qPCR reaction procedure

[0067] Example 3: Establishment of PBoV Dual qPCR Reaction System and Procedure

[0068] After optimization, using the reaction system and procedure in Table 4-5, the PBoV double qPCR reaction showed better linearity, amplification efficiency, and sensitivity.

[0069] Table 5. PBoV Dual qPCR Reaction System

[0070] Example 4: Linearity and amplification efficiency of the PBoV qPCR detection system

[0071] As mentioned earlier, homologous gene sequences of PBoV (PBoV1 / V2, PBoV3 / V4 / V5) were artificially synthesized, and recombinant plasmids were constructed to prepare standards and establish standard curves. An appropriate amount of RT-PCR grade water was added to 1 µg of lyophilized pUC57-PBoV1 / V2 and pUC57-PBoV3 / V4 / V5 recombinant plasmid powders, respectively. The plasmid copy number was calculated according to Formula 1, ensuring that the concentration of each plasmid was 1×10⁻⁶. 9 copies / µL.

[0072] Formula 1:

[0073] The above PBoV1 / V2 and PBoV3 / V4 / V5 plasmid solutions were diluted to 1×10⁻⁶. 6 copies / µL, 1×10 5 copies / µL, 1×10 4 copies / µL, 1×10 3 copies / µL, 1×10 2 Standard curves were plotted at 1×10 copies / µL and 1×10 copies / µL. Three replicate qPCR experiments were performed using the reaction system and amplification program shown in Table 2-4. Results showed that the amplification efficiency of the PBoV1 / V2 plasmid standard was 92.947%, with a correlation coefficient R0. 2 =0.999; the amplification efficiency of PBoV3 / V4 / V5 plasmid standards was 92.349%, and the correlation coefficient R was 0.999. 2 =0.998, the test results are shown below. Figure 1 .

[0074] Take a concentration of 1×10 9 PBoV1 / V2 positive plasmids at a concentration of 1×10⁶ copies / µL and 1µL of PBoV1 / V2 positive plasmids. 9 Add 10 µL each of PBoV3 / V4 / V5 positive plasmids (copies / µL) to 80 µL of RT-PCR grade water, mix well, and then dilute 10-fold with RT-PCR grade water to prepare a solution containing 1×10⁻⁶ PBoV3 / V4 / V5 positive plasmids. 7 copies / µL of PBoV1 / V2 positive plasmid and 1×10 7 A mixture of PBoV3 / V4 / V5 positive plasmids at a concentration of 2 × 10⁻⁶ copies / µL. 7 Copies / µL were prepared as plasmid standard solutions. The plasmid standard solutions were diluted to 2×10⁻⁶. 6 copies / µL, 2×10 5 copies / µL, 2×104 copies / µL, 2×10 3 copies / µL, 2×10 2 Standard curves were plotted at 10 copies / µL and 2×10 copies / µL. Three replicate qPCR experiments were performed using the reaction system and amplification program shown in Table 4-5. Results indicated that the amplification efficiency of dual qPCR detection with the PBoV1 / V2 and PBoV3 / V4 / V5 mixed plasmid standards was 92.207%, and the correlation coefficient R0 was [value missing]. 2 = 0.998 The test result is shown in the image. Figure 1 .

[0075] The linear correlation coefficient R between the porcine bocavirus duplex qPCR reaction system and the PBoV1 / V2 or PBoV3 / V4 / V5 single qPCR reaction system in this embodiment is 1. 2 The results (both > 0.99) and amplification efficiency (both > 90%) are basically consistent and better, indicating that the primer-probe combination design of this invention is reasonable and the reaction conditions are well optimized.

[0076] Example 5: Sensitivity of the PBoV qPCR detection system

[0077] The PBoV1 / V2 plasmid, PBoV3 / V4 / V5 plasmid, and mixed plasmid solutions of PBoV1 / V2 and PBoV3 / V4 / V5 were diluted to 10 copies / µL, and 10 replicate qPCR experiments were performed using the reaction systems and amplification programs shown in Table 2-5. The results showed that the sensitivity of both the PBoV singlet qPCR (PBoV1 / V2 or PBoV3 / V4 / V5) and PBoV dual qPCR (PBoV1 / V2 and PBoV3 / V4 / V5) reaction systems reached 50 copies / reaction. The detection results are shown in Table 6 and Figure 2.

[0078] Table 6 Sensitivity of PBoV single and double qPCR reaction systems

[0079] Example 6: Specificity validation of the PBoV qPCR detection method

[0080] (1) Porcine Female Genomic DNA and pUC57-BoCV Recombinant Plasmid

[0081] Porcine female Genomic DNA was purchased from ZYAGEN and diluted to 10 ng / µL as a template for PBoV duplex qPCR; the pUC57-BoCV recombinant plasmid was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and dissolved and diluted to 4.30 × 10⁻⁶. 4 2 × 10⁶ copies / µL as PBoV doublet qPCR template; 4 Copies / µL of PBoV1 / V2 and PBoV3 / V4 / V5 mixed plasmids were used as positive controls. Three replicate qPCR experiments were performed using the reaction system and amplification program shown in Table 4-5. Results showed that double qPCR detection of Porcine Female Genomic DNA and pUC57-BoCV recombinant plasmid PBoV was negative, while detection of the PBoV1 / V2 and PBoV3 / V4 / V5 mixed plasmid was positive. (See attached table). Figure 3 This indicates that the PBoV dual qPCR detection system showed no cross-reactivity with Porcine Female Genomic DNA and pUC57 plasmid.

[0082] (2) Other viral nucleic acids

[0083] Both pig circovirus (PCV) genomic DNA and porcine female genomic DNA were purchased from ZYAGEN. The results, obtained using a porcine circovirus (PCV) nucleic acid detection kit (purchased from Shanghai Xuanya Biotechnology Co., Ltd.), were positive for PCV. See attached results. Figure 4A This indicates that both types of porcine genomic DNA contain porcine circovirus (PCV) nucleic acid. Using these two types of porcine genomic DNA as PBoV duplex qPCR templates, three replicate experiments were performed according to the reaction system and amplification program shown in Table 4-5. The results showed that both Pig Pancreas Genomic DNA and Porcine Female Genomic DNA tested negative for PBoV duplex qPCR. (See attached table). Figure 4B This indicates that the PBoV dual qPCR detection system does not cross-react with porcine circovirus (PCV) genomic DNA.

Claims

1. A primer pair for detecting porcine bocavirus (PBoV), characterized in that, The primer pair includes a forward primer and a reverse primer; the primer pair is selected from one or more of the following: Primer pair A, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 2; and / or Primer pair B, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

5.

2. A primer-probe combination for detecting porcine bocavirus (PBoV), characterized in that, The primer-probe combination includes a probe and the primer pair as described in claim 1; Preferably, the nucleotide sequence of the probe for primer pair A is as shown in SEQ ID NO: 3; and / or, the nucleotide sequence of the probe for primer pair B is as shown in SEQ ID NO:

6.

3. The primer-probe combination as described in claim 2, characterized in that, The probe is a fluorescently labeled probe; Preferably, the fluorescent label is selected from FAM, Cy5, HEX, JOE, ROX, TAMRA, TET, VIC, Cy3, Cy5.5, TexasRed, NED and their derivatives; And / or, the probe further includes a quenching group, which is preferably selected from BHQ-1, BHQ-2, BHQ-3, Dabcyl, Eclipse, MGB and their derivatives.

4. A kit for detecting porcine bocavirus (PBoV), characterized in that, The kit contains one or more primer pairs as described in claim 1, or one or more primer-probe combinations as described in claim 2 or 3.

5. The kit according to claim 4, characterized in that, The kit also includes a qPCR reaction system; Preferably, the qPCR reaction system includes TaqMan probe premix, dye, and nuclease-free water.

6. The reagent kit as described in claim 5, characterized in that, The qPCR reaction system also includes positive control samples; Preferably, the positive control is a cloning plasmid containing the target gene sequence; More preferably, the cloning plasmid is the pUC57 plasmid; and / or, when the kit contains primer pair A, the positive control contains the nucleotide sequence shown in SEQ ID NO: 7; when the kit contains primer pair B, the positive control contains the nucleotide sequence shown in SEQ ID NO:

8.

7. A method for detecting porcine bocavirus (PBoV) based on qPCR, characterized in that, The method includes contacting and reacting the sample to be tested with one or more primer pairs as described in claim 1, or one or more primer probes as described in claim 2 or 3, in a qPCR reaction system; Preferably, the qPCR reaction system is as described in claim 5 or 6; and / or, the sample to be tested is a body fluid sample, blood sample, tissue sample, or fecal sample; and / or, the method is for non-diagnostic purposes.

8. The method as described in claim 7, characterized in that, In the reaction system of the said reaction, the content ratio of the forward primer, the reverse primer and the corresponding probe is 2:2:1; and / or, the reaction conditions of the said reaction are 95℃ for 20 seconds per cycle, 95℃ for 3 seconds and 60℃ for 30 seconds for 45 cycles, and the fluorescence signal is collected at 60℃; Preferably, when the primer pair that contacts and reacts with the sample to be tested is primer pair A or primer pair B, each 20 μL includes 0.4 μL of 10 μM forward primer, 0.4 μL of 10 μM reverse primer, and 0.2 μL of 10 μM probe.

9. The method as described in claim 7 or 8, characterized in that, When the primer pair that contacts and reacts with the sample to be tested is primer pair A and primer pair B, each 20 μL of the reaction system includes 0.4 μL of 10 μM forward primer of primer pair A, 0.4 μL of 10 μM reverse primer of primer pair A, 0.4 μL of 10 μM forward primer of primer pair B, 0.4 μL of 10 μM reverse primer of primer pair B, 0.2 μL of 10 μM probe of primer pair A, and 0.2 μL of 10 μM probe of primer pair B.

10. The application of the primer pair as described in claim 1, or the primer-probe combination as described in claim 2 or 3, in the preparation of products for quantitative detection of porcine bocavirus (PBoV); Preferably, the product is selected from reagent kits, test strips, and chips.

Images