Absolute RNA quantification method

By using chemically synthesized control RNA molecules for RT-qPCR calibration, the problem of impurity interference in recombinant RNA was solved, enabling more accurate absolute RNA quantification, simplifying the purification process, and improving the accuracy of quantification.

CN122374467APending Publication Date: 2026-07-10ZOETIS SERVICES LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480077552.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-12-07
Filing Date
2024-12-05
Publication Date
2026-07-10

Smart Images

  • Figure CN122374467A_ABST
    Figure CN122374467A_ABST
Patent Text Reader

Abstract

The present invention provides an improvement in absolute RNA quantification using RT-qPCR method using chemically synthesized template RNA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention generally belongs to the field of RNA quantification. Background Technology

[0002] Real-time PCR / qPCR assays have become the preferred tool for the rapid and sensitive determination and quantification of nucleic acids in various biological samples, with a wide range of applications, such as gene expression analysis, detection of genetically modified organisms in food, and cancer phenotypic analysis.

[0003] In research laboratories, qPCR assays are widely used to quantitatively measure gene copy numbers (gene dose) or the presence of mutated genes in transformed cell lines. Combined with reverse transcription PCR (RT-PCR), qPCR assays can be used to quantify changes in gene expression by measuring changes in cellular mRNA levels, for example, increases or decreases in expression in response to different environmental conditions or drug treatments.

[0004] Currently, scientists use recombinant RNA (or recRNA) as a calibration tool for absolute RNA quantification, but the presence of impurities can interfere with the accuracy of quantification. Furthermore, recRNA requires relatively long sequences because short sequences may be more difficult to purify before using the resulting RNA as a calibration tool. Summary of the Invention

[0005] This disclosure provides an improvement to a method for quantifying the amount of test RNA molecules in a sample using RT-qPCR, the improvement comprising:

[0006] a) Provide one or more calibration samples with a known amount of control RNA molecules, wherein the sequence of the full-length control RNA molecule is at least 95% identical to the sequence of the full-length test RNA molecule, and wherein the sequences of the test RNA molecule and the control RNA molecule are 100% identical in their respective primer annealing and probe annealing portions, wherein the length of the control RNA molecule is 75-150 bases, and wherein the control RNA is chemically synthesized and substantially pure;

[0007] b) Perform RT-qPCR on the one or more calibration samples in parallel with the RT-qPCR performed on the test samples; and

[0008] c) Determine the amount of amplification product in the test sample based on the amount of amplification product in one or more calibration samples.

[0009] Attached image description (AYUB, see end of document)

[0010] Figure 1 This is a representative spectral diagram of essentially pure RNA according to the present invention.

[0011] Figure 2This is an RT-qPCR amplification diagram using RNA standards.

[0012] Figure 3 This is a standard curve illustrating the detection limit of FeMV RNA standards. Detailed Implementation

[0013] The term "substantially pure" applied to control RNA molecules refers to a composition substantially consisting of a control RNA molecule and a pharmaceutically acceptable carrier. Preferably, when analyzed by mass spectrometry, the spectrum of substantially pure mRNA should show only one peak of the expected molecular weight, and optionally one or more small peaks within about 500 Da of the expected molecular weight, representing salt or trace impurities. See, for example... Figure 1 .

[0014] The term "RT-qPCR" refers to quantitative reverse transcription polymerase chain reaction.

[0015] The term "test RNA" refers to RNA that needs to be quantified.

[0016] In general, this application provides an improvement to a method for quantifying the amount of test RNA molecules in a sample by RT-qPCR, wherein the improvement includes:

[0017] a) Provide one or more calibration samples with a known amount of control RNA molecules, wherein the sequence of the full-length control RNA molecule is at least 95% identical to the sequence of the full-length test RNA molecule, and wherein the sequences of the test RNA molecule and the control RNA molecule are 100% identical in their respective primer annealing and probe annealing portions, wherein the length of the control RNA molecule is 75-150 bases, and wherein the control RNA is chemically synthesized and substantially pure;

[0018] b) Perform RT-qPCR on the one or more calibration samples in parallel with the RT-qPCR performed on the test samples; and

[0019] c) Determine the amount of amplification product in the test sample based on the amount of amplification product in one or more calibration samples.

[0020] Using short (75-150 bases, or more preferably about 100 to about 130 bases, or more preferably about 115 to 125 bases) substantially pure control RNA allows for more precise absolute quantification of the test RNA. The full-length control RNA and the corresponding portion of the test RNA should be at least 95% identical (e.g., at least 96%, at least 97%, at least 98%, or at least 99%), but the control RNA must be 100% identical to the test RNA in the portions where the primers (forward and reverse) and probes are bound. In the portions not bound to primers and probes, the test and control RNA may be at least 90% identical (including at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%). 100% identity between the primer-binding and probe-binding regions ensures that annealing between the template and the primer and / or probe is equally effective for test RNA and control RNA.

[0021] generally, in vitro / in vivo The transcribed RNA sequence is capped. Caps known in the art include various 5'-modifications, such as 7-methylguanosine caps, NAD caps, FAD caps, and UDP-glucose caps. In contrast, the chemically synthesized control RNA used in the method according to the invention is not capped.

[0022] One advantage of using chemically synthesized, essentially pure test RNA molecules is that it is possible to perform a single control reaction using a given concentration of test RNA: the inventors have found that if the initial amount of test RNA is approximately 2.8 × 10⁻⁶ per reaction... 2 If the initial amount of RNA is 38.7 (ct value), there is a linear relationship between the initial amount of RNA and the output of the RT-qPCR reaction. The upper limit of detection is approximately 3 × 10⁻⁶ molecules at a ct value of 15. 8 1 molecule. Therefore, in some embodiments, the amount of template RNA used for the control reaction is approximately 280 to approximately 3 × 10⁻⁶ molecules per reaction. 8 Changes between copies.

[0023] RT-qPCR reactions are well known in the art, and the present invention does not alter any fundamental mechanism or conditions accepted in the art in different specific implementations of the RT-qPCR method, except for the parallel use of chemically synthesized test PCRs as described above as calibration tools and the use of a single control reaction, due to the linear relationship between the amount of control RNA at the start of the method and the output (e.g., the light intensity of probe emission or quenching).

[0024] Different samples of the test RNA are suitable for the modifications disclosed herein. In some embodiments, the test RNA is part of the genome of an RNA virus, including but not limited to coronaviruses, influenza viruses, picornaviruses, and other (+)ssRNA, (-)ssRNA, or dsRNA viruses. These viruses may be present in animal samples such as blood, serum, urine, saliva, etc. In other embodiments, the virus may be present in (and isolated from) food samples, water samples, air samples, surface swabs, and sewage samples. Methods for collecting samples and isolating viruses or viral RNA from samples or viruses are well known in the art and do not require explanation to a person skilled in the art.

[0025] Suitable, non-limiting examples of RNA viruses include, but are not limited to, SARS, MERS, Covid-19, dengue virus, hepatitis C virus, hepatitis E virus, West Nile virus, Ebola virus, rabies virus, poliovirus, mumps virus, and measles virus, as well as human immunodeficiency virus (HIV).

[0026] The invention will now be described in the following non-limiting embodiments.

[0027] Example

[0028] Example 1: Feline measles virus

[0029] Feline measles virus (FeMV) is a negatively polar, single-stranded linear RNA genome. A substantially pure RNA fragment of 115 nucleotides (uucagggccagagagaauugagucuauauccaucugaaguggcacuaguugacaaaaaaucgcuuggcuaaugacccuaauaucaaagucuuguucaaugguaagccagaguc (SEQ ID NO: 1)) was chemically synthesized, representing the RNA polymerase encoding the L sequence of the FeMV gene. The copy number of this fragment was precisely calculated using this fragment with known nucleotide sequences, molecular weights, and quantitative amounts. Mass spectra were obtained at [insert mass spectra here]. Figure 1 Provided in [reference needed]. The calculated molecular weight of SEQ ID NO: 1 is 36953 g / mol. The spectrum shows a main peak corresponding to 36954 g / mol and several smaller peaks within approximately 500 Daltons of the calculated molecular weight (the average molecular weight of a nucleotide is approximately 520 Daltons), representing salts or small amounts of impurities.

[0030] Serial dilutions of the fragment were then prepared and qPCR was performed with oligonucleotide primer sets of SEQ ID NO 2 (5'-TGGCTTACCATTGAACAAGACTTTG-3') and 3 (5'-GCCAGAGAGAATTGAGTCTATATC-3') and labeled probe (5'-CAACAAAAATCGCTTGGCTAATGACCCTAA / ABkFQ-3' (SEQ ID NO: 4), with 6-carboxyfluorescein (6-FAM) at the 5' end and ABkFQ at the 3' end). A standard curve was plotted against the threshold cycle value of GTCTATATC-3'. The linear dynamic range was determined to be from 300 copies (Ct=38.7) to 3×10⁻⁶. 8 One copy (Ct=15). This qPCR method can be used to quantify FeMV virus in viral cell cultures, vaccines, or any biological fluid containing the virus. Furthermore, such RNA standards can be designed and synthesized for any RNA virus.

[0031] All publications (including patent and non-patent publications) referenced in this specification indicate the level of skill of a person skilled in the art to which this invention pertains. All such publications are incorporated herein by reference in their entirety, to the extent that each individual publication is specifically and individually indicated as incorporated by reference.

[0032] Although the invention described herein has been illustrated with reference to specific embodiments, it should be understood that these embodiments are merely illustrative of the principles and applications of the invention. Therefore, it should be understood that many modifications can be made to the illustrative embodiments, and other arrangements can be designed, without departing from the spirit and scope of the invention as defined by the following claims.

Claims

1. An improvement to a method for quantifying the amount of test RNA molecules in a sample using RT-qPCR, the improvement comprising: a) Provide one or more calibration samples having a known amount of control RNA molecules, wherein the sequence of the full-length control RNA molecule is at least 95% identical to the sequence of the full-length test RNA molecule, and wherein the sequences of the test RNA molecule and the control RNA molecule are 100% identical in their respective primer annealing and probe annealing portions, wherein the length of the control RNA molecule is 75-150 bases, and wherein the control RNA is chemically synthesized and substantially pure; b) Perform qRT-PCR on the one or more calibration samples in parallel with the RT-qPCR performed on the test samples; c) Determine the amount of amplification product in the test sample based on the amount of amplification product in the one or more calibration samples.

2. The improvement according to claim 1, wherein the length of the RT-qPCR amplification product is 100-130 bases.

3. The improvement according to any one of claims 1-3, wherein the sequence of the full-length control RNA molecule is at least 99% identical to the sequence of the full-length test RNA molecule.

4. The improvement according to any one of claims 1-3, wherein the full-length sequence of the amplification product in the test sample is identical to the full-length sequence of the amplification product in the one or more calibration samples.

5. The improvement according to claim 1 or claim 2, wherein the sequence of the full-length control RNA molecule is identical to the sequence of the full-length test RNA molecule.

6. The improvement according to any one of claims 1-5, wherein the test RNA molecule is of eukaryotic origin.

7. The improvement according to any one of claims 1-5, wherein the test RNA molecule is derived from the genome of an RNA virus.

8. The improvement according to claim 7, wherein the RNA virus is selected from the group consisting of: influenza virus, SARS virus, MERS virus, Covid-19, dengue virus, hepatitis C virus, hepatitis E virus, West Nile virus, Ebola virus, rabies virus, poliovirus, mumps virus, and measles virus, and human immunodeficiency virus (HIV).

9. The improvement according to claim 9, wherein the RNA virus is feline measles virus (FeMV), and the amplification product in the test sample is at least 95% identical to SEQ ID NO:

1.

10. The improvement according to any one of claims 1-9, wherein the sample is a food sample.

11. The improvement according to any one of claims 1-9, wherein the sample is a water sample.

12. The improvement according to any one of claims 1-9, wherein the sample is a sewer sample.

13. An improvement according to any one of claims 1-12, wherein a calibration sample having a known amount of the control RNA molecule is provided, and wherein the amount of amplification product in the test sample is determined based on the amount of amplification product in the calibration sample.