mRNA-based estrogen receptor modulating compositions and their use in estrogen low-responsive endometrial diseases
By using an mRNA-based estrogen receptor regulatory composition and a lipid nanoparticle delivery system to upregulate ESR1 expression in the endometrium, the problem of low estrogen responsiveness of thin endometrium is solved, achieving systematic regulation of the estrogen signaling pathway and significantly improving therapeutic efficacy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-10
- Publication Date
- 2026-07-14
AI Technical Summary
Current treatments for thin endometrial disease are characterized by unstable efficacy, significant individual variability, and a lack of systematic intervention strategies. In particular, the problem of low estrogen response due to decreased estrogen receptor expression has not been effectively addressed.
An mRNA-based estrogen receptor regulatory composition was used to deliver ESR1 mRNA via a lipid nanoparticle carrier. High-density extracellular vesicles and lipid nanoparticles were hybridized and fused using freeze-thaw cycles to directly regulate the expression of estrogen receptor α in the endometrium and restore its responsiveness to estrogen.
It significantly improves the endometrial response to estrogen, promotes endometrial proliferation and recovery of reproductive function, improves the thickness and receptivity of thin endometrium, and provides a highly safe and efficient targeted treatment approach.
Smart Images

Figure CN122376791A_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the biomedical field, and in particular to mRNA-based estrogen receptor regulatory compositions and their application in estrogen-insensitive endometrial diseases. Background Technology
[0002] The endometrium plays a crucial role in the female reproductive cycle, and its thickness and structure directly determine embryo implantation and pregnancy maintenance. Thin endometrium refers to endometrial thickness that is insufficient to support embryo implantation as measured by transvaginal ultrasound during the mid-luteal phase. Clinically, it is usually defined as a pathological endometrium less than 7 mm thick. It is one of the important causes of female infertility, recurrent implantation failure, and early miscarriage. Its pathophysiological mechanism may be that the embryo implants too close to the oxygen-rich basal layer, and the quality of the functional layer cannot support the growth and development of the fetus and placenta.
[0003] Factors leading to thin endometrium can be categorized into anatomical, endocrine and receptor-related, inflammatory, blood flow-related, and idiopathic factors. Among these, repeated miscarriages, curettage, and other surgical procedures that damage the basal layer of the endometrium and cause intrauterine adhesions are the main acquired causes of this phenotype. Low systemic estrogen levels due to decreased ovarian function, or the anti-estrogenic effects of long-term use of clomiphene, can directly impair the proliferative response of the endometrium. Furthermore, chronic endometritis caused by infections such as Mycobacterium tuberculosis can also lead to impaired endometrial repair. Some cases are due to idiopathic or congenital factors, possibly involving congenital hyporesponsiveness of the endometrium to hormones.
[0004] Current clinical treatments primarily rely on high-dose estrogen, but this approach suffers from significant efficacy variability, lack of responsiveness in some patients, and the potential for increased endometrial cancer risk with long-term use. Low estrogen response has been observed in some patients. Studies suggest this may be closely related to decreased expression of estrogen receptor α (ERα, ESR1) in thin endometrial stromal cells. While existing research has explored various treatment options for thin endometrium, including endocrine drug optimization, stem cell and derivative therapy, nanomedicine delivery, growth factors, and platelet-rich plasma, these approaches often target single pathological pathways and lack upstream intervention strategies that can fundamentally improve endometrial low estrogen responsiveness. Summary of the Invention
[0005] This disclosure provides an example of the use of an mRNA-based estrogen receptor regulatory composition in the preparation of a medicament for treating estrogen-insensitive endometrial diseases. The mRNA is obtained by in vitro transcription from a DNA template, the DNA template comprising a T7 promoter, a 5'UTR, an ESR1 coding region, and a 3'UTR. The sequence of the T7 promoter is SEQ ID No: 1, the sequence of the 5'UTR is SEQ ID No: 2, the sequence of the ESR1 coding region is SEQ ID No: 3, and the sequence of the 3'UTR is SEQ ID No: 4.
[0006] In some embodiments, the estrogen receptor regulating composition further includes composite lipid nanoparticles, which are prepared by the following steps: preparing lipid nanoparticles; separating seminal plasma extracellular vesicles (sEVs) from human seminal plasma and purifying them by density gradient centrifugation to obtain high-density seminal plasma extracellular vesicles (sEV-Hs); mixing the high-density seminal plasma extracellular vesicles with the lipid nanoparticles and achieving hybrid fusion of the high-density seminal plasma extracellular vesicles and lipid nanoparticles through freeze-thaw cycles.
[0007] In some embodiments, the preparation of lipid nanoparticles includes: adding ionizable lipids, cholesterol, dioleoylphosphatidylethanolamine (DOPE), polyethylene glycol-modified phospholipids and cationic compounds into a container in a preset molar ratio, adding mRNA, mixing and self-assembling, so that the lipids and mRNA self-assemble through electrostatic interaction to form an LNP@mRNA complex, wherein the preset molar ratio is (49-51):(39-41):(19-21):(0.2-0.3):(19-21).
[0008] In some embodiments, the hybrid fusion of high-density seminal plasma extracellular vesicles and lipid nanoparticles by freeze-thaw cycles includes: achieving the hybrid fusion of high-density seminal plasma extracellular vesicles and lipid nanoparticles by three freeze-thaw cycles, each freeze-thaw cycle including: first freezing at -80°C for 14-16 minutes, and then thawing at 37°C for 14-16 minutes.
[0009] In some embodiments, the mRNA or estrogen receptor regulatory composition upregulates the expression of ERα protein.
[0010] In some embodiments, the drug is administered via intrauterine injection.
[0011] In some embodiments, the drug is formulated as a uterine irrigation preparation.
[0012] In some embodiments, the drug is loaded in a uterine support device.
[0013] In some embodiments, the drug is loaded into a biodegradable anti-adhesion barrier material.
[0014] In some embodiments, the drug is used in combination with estrogen.
[0015] The mRNA disclosed herein can upregulate estrogen receptor α (ERα) expression via in situ transfection in the uterine cavity, thereby treating thin endometrium and restoring fertility. Attached Figure Description
[0016] Figure 1 The study demonstrated that transfection with ESR1-mRNA in primary endometrial stromal cells upregulated ERα protein expression and promoted cell proliferation.
[0017] Figure 2 The study demonstrates the assessment of tissue structure and function repair in a mouse model with thin endometrium after ESR1 mRNA treatment. Detailed Implementation
[0018] To enable those skilled in the art to better understand the technical solutions of this disclosure, the technical solutions of this disclosure will be described in detail below with reference to the accompanying drawings.
[0019] Exemplary embodiments will be described more fully below with reference to the accompanying drawings; however, these exemplary embodiments may be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will enable those skilled in the art to fully understand the scope of this disclosure.
[0020] Where there is no conflict, the various embodiments of this disclosure and the features thereof in the embodiments may be combined with each other.
[0021] As used herein, the term “and / or” includes any and all combinations of one or more related enumerated entries.
[0022] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. As used herein, the singular forms “a” and “the” are also intended to include the plural forms unless the context clearly indicates otherwise. It will also be understood that when the terms “comprising” and / or “made of” are used in this specification, the presence of the stated feature, integral, step, operation, element, and / or component is specified, but the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or groups thereof is not excluded.
[0023] Unless otherwise specified, all terms used herein (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art. It will also be understood that terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant art and this disclosure, and will not be interpreted as having an idealized or overly formal meaning, unless expressly so defined herein.
[0024] In this disclosure, "about" means a value within a range of ±5% of a specific value. For example, "about 500" includes ±5% of 500, that is, from 475 to 525; "about 50" includes ±5% of 50, that is, from 47.5 to 52.5; "about 30" includes ±5% of 30, that is, from 28.5 to 31.5. Unless otherwise stated, percentages or proportions in this disclosure refer to mass percentages or mass ratios.
[0025] Diseases associated with thin endometrium include intrauterine adhesions, Asherman's syndrome, chronic endometritis and tuberculosis, adenomyosis, side effects of anti-estrogenic drugs, and unexplained low estrogen response in the endometrium.
[0026] In clinical interventions for thin endometrium, estrogen therapy remains the most widely used traditional approach. Studies have shown that the dosage, route of administration, and duration of estrogen administration affect endometrial thickening. A prospective randomized controlled trial showed that both oral estradiol valerate tablets and transdermal gel therapy following hysteroscopy promoted endometrial growth, but responses varied significantly among patients. Vaginal estrogen rapidly increases serum estrogen levels and promotes endometrial proliferation, and is therefore often used for patients for whom other administration methods are ineffective. However, patients with TE (thin endometrial ectopic uterus) have reduced sensitivity to endometrial estrogen, resulting in standard-dose estrogen failing to significantly improve endometrial thickness in some patients.
[0027] In addition to estrogen, various intervention strategies to promote endometrial thickening have been explored. For example, growth hormone (GH) may improve endometrial thickness by increasing endometrial blood perfusion, regulating the expression of related genes and proteins, and inducing insulin-like growth factor-1 (IGF-1) production, but its specific mechanism of action remains unclear. Human chorionic gonadotropin (hCG), when used topically before embryo transfer, can upregulate the expression of vascular endothelial growth factor (VEGF), leukemia inhibitory factor (LIF), and matrix metalloproteinase-9 (MMP-9), thereby enhancing endometrial thickness and immune tolerance. Gonadotropin-releasing hormone agonists (GnRH-a) improve endometrial thickness and receptivity by short-term stimulation of the pituitary gland to release gonadotropins, increasing serum estrogen levels, and activating endometrial growth-related factors. Tamoxifen, as a selective estrogen receptor modulator, can promote endometrial thickening in patients with endometrial ectopic pregnancy (TE) to some extent, but its effects vary significantly among different patient groups and have not significantly improved overall pregnancy outcomes.
[0028] While different treatment approaches can improve endometrial thickness to some extent, they generally suffer from unstable efficacy and significant individual variability. The root cause lies in the decreased expression and limited function of estrogen receptors in the endometrium of patients with endometrial thrombosis (TE), making downstream-stimulation-dependent interventions less effective. Furthermore, existing therapies often focus on local or single pathological processes, lacking systematic intervention strategies targeting key upstream targets.
[0029] In terms of mRNA delivery systems, current technologies mainly include lipid-based, polymer-based, peptide-based, and exosome-based carriers. Because mRNA molecules carry a negative charge, they are typically encapsulated in cationic carriers through hydrophobic interactions, charge attraction, and van der Waals forces, thereby protecting the mRNA from degradation by endogenous RNases. Upon entering the target cell, the mRNA carrier releases the mRNA into the cytoplasm through endosomal escape mechanisms (including membrane fusion and pH response), where it is subsequently translated into functional proteins by ribosomes and performs its biological functions through folding, modification, and localization.
[0030] Messenger RNA (mRNA)-based therapeutic strategies have shown significant promise in the prevention and treatment of diseases. Unlike DNA-based drugs, mRNA translation occurs in the cytoplasm, thus avoiding the potential risks of genome integration. Furthermore, compared to traditional protein or peptide drugs, mRNA therapy, utilizing an endogenous translation system, exhibits longer expression times, reduces the impact of immune clearance, and may demonstrate higher efficacy. Based on these advantages, mRNA therapy has been applied across various branches of biomedicine, providing new therapeutic avenues for refractory diseases.
[0031] This disclosure proposes using ESR1 as a therapeutic target and employing mRNA therapy technology. Based on the upstream regulatory role of this target in various pathological mechanisms of thin endometrium, the endometrial thickness and receptivity are improved by restoring the responsiveness of the endometrium to physiological or exogenous estrogen.
[0032] This disclosure reveals for the first time the application value of ESR1 as a therapeutic target for refractory thin endometrium, effectively solving the problem of low response rate in existing estrogen therapy and significantly improving treatment efficacy. Specifically, this disclosure uses estrogen receptor α (ESR1) as the upstream regulatory node of multiple pathological mechanisms in the development of thin endometrium, selecting ESR1 as a key target to intervene in the abnormal estrogen signaling pathway of the endometrium at its source. In addition, an active drug targeting ESR1 is designed and prepared to directly regulate ESR1 expression and activity, correct the low response state of the endometrium to estrogen, and restore the normal proliferation and remodeling function of the endometrium. Thus, it solves the problem of low treatment response rate caused by the low estrogen response of thin endometrium in the prior art, and achieves precise and systematic regulation and treatment of thin endometrium.
[0033] Experimental results show that increasing ESR1 expression in thin endometrial cells and animal models can promote endometrial proliferation and restore endometrial receptivity. In animal models, increased ESR1 expression can significantly increase endometrial thickness, improve glandular number and structure, and ultimately improve reproductive outcomes.
[0034] This disclosure utilizes mRNA technology to enhance ESR1 expression in the endometrium, providing a highly safe and efficient targeted therapeutic approach. Furthermore, this disclosure synthesizes ESR1 mRNA using in vitro transcription technology (taking a lipid nanoparticle delivery system as an example), and transfects it into endometrial epithelial and stromal cells. During the critical window period, it enhances ESR1 expression in the endometrium, synergistically activating estrogen-related pathways and thereby improving the endometrial responsiveness to estrogen. This disclosed approach overcomes the limitations of traditional technologies, avoiding the risks of viral vector genome integration, the short half-life of protein-active vectors, and the low transfection efficiency of plasmid vectors, achieving efficient, safe, and controllable targeted intervention. Experimental verification shows that the mRNA preparation can be rapidly expressed in endometrial stromal and epithelial cells, reaching ideal expression intensity within 24-48 hours, activating estrogen-related pathways, and providing technical support for precise intervention within the critical time window.
[0035] The following description, in conjunction with specific embodiments, will provide a better understanding of this disclosure.
[0036] Example 1: Preparation of nanocarriers carrying ESR1 mRNA This embodiment constructed a highly efficient ESR1 mRNA expression and verified its transfection efficiency in cell and animal models.
[0037] 1.1 In vitro synthesis of ESR1 mRNA A DNA template containing a T7 promoter, 5'UTR, ESR1 coding sequence (CDS), 3'UTR, and a poly(A) tail was constructed. ESR1 mRNA was synthesized by in vitro transcription (IVT) and then capped.
[0038] The sequences of each component are as follows: (1) T7 promoter (SEQ ID No: 1): 5'-TAATACGACTCACTATAGG-3' (2) 5'UTR (SEQ ID No: 2): 5'-GAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGCCACC-3' (3) ESR1 coding region (CDS) (SEQ ID No: 3): (4) 3'UTR (SEQ ID No: 4): 5'-CTCGAGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGTAGTGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGA-3' The primer sequences for the PCR step are as follows: (1) Pre-primer (SEQ ID No: 5): TAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGT (2) ESR1 post-primer (SEQ ID No: 6): TCGAGGCTGATCAGCGGGTTTAAAC The ESR1 mRNA preparation process is as follows: (1) Template linearization (PCR method): Plasmid DNA working solution was prepared using nuclease-free water. The target DNA was amplified using the PCR kit (Vazyme, P505) instructions. Taking a 50 μL PCR reaction system as an example: 25 μL 2x Reaction Buffer, 1 μL dNTP Mix (10 mM), 2 μL front primer (10 μM), 2 μL back primer, 1 μL DNA polymerase, 3 μL plasmid DNA template, and 16 μL nuclease-free water to make up the difference. After mixing, the PCR amplification reaction was performed. The reaction procedure is shown in Table 1 below.
[0039] Table 1 After amplification, the linearized DNA product was obtained using a purification kit (Invitrogen, K310001) and detected by 0.8% agarose gel electrophoresis. A single, bright, specific band appeared at the target position, and there were no obvious primer dimers or non-specific bands, indicating that the linearized DNA product was the correct size and had good purity.
[0040] (2) IVT preparation of mRNA The in vitro transcription system employed a high-efficiency T7 RNA polymerase system (HyperScribe™ T7 High Yield RNASynthesis Kit Plus, APExBIO, K1401). First, purified linearized DNA (plasmid or PCR product containing the T7 promoter) was used as the transcription template. In a 20 μL standard reaction mixture, 10×Reaction Buffer, each of the mononucleotides (ATP, GTP, CTP, UTP, 10 mM each), 0.5 μL of template DNA, and T7 RNA Polymerase Mix were added sequentially. The reaction mixture was incubated at 37°C for 2 hours (extended to 4 hours for short transcripts smaller than 300 nt) to achieve high-yield RNA synthesis. After transcription, 1 μL of DNase I was added and incubated at 37°C for 15 minutes to completely digest any remaining DNA template. Subsequently, the synthesized mRNA was purified and enriched using a phenol / chloroform extraction and ethanol precipitation method (or column chromatography): Nuclease-free water was added to the system to adjust the volume, followed by extraction with an equal volume of phenol / chloroform (1:1) and pure chloroform. Twice the volume of anhydrous ethanol was added, and the precipitate was collected by centrifugation and washed with 70% ethanol, finally dissolved in nuclease-free water. The purified RNA product was quantitatively analyzed by measuring the A260 absorbance using a NanoDrop™ micro-spectrophotometer, and its integrity and fragment size were assessed by denaturing gel electrophoresis to ensure high-purity, full-length mRNA for subsequent experiments.
[0041] (3) In vitro enzymatic addition of Poly(A) tail to mRNA and purification After in vitro transcription, the poly(A) tail was directly introduced into the *E. coli*-derived poly(A) polymerase system (HyperScribe™ Poly(A) Tailing Kit, APExBIO, K1053) to extend the RNA 3' end without template modification. In 20 μL of in vitro transcription reaction solution, 42 μL of Nuclease-free Water, 20 μL of 5× E-PAP Buffer, 10 μL of 25 mM MnCl2, and 4 μL of 100 mM ATP solution were added sequentially, mixed thoroughly, and 0.5 μL was reserved as an enzyme-free negative control. Then, 4 μL of E-PAP polymerase (2 units / μL) was added to a final volume of 100 μL, and the mixture was incubated at 37°C for 1 hour to ensure efficient addition of a uniform Poly(A) tail ≥150 nt to the mRNA end. After the tailing reaction, 30 μL of Nuclease-free Water and 30 μL of LiCl degradation precipitate (or column chromatography or ammonium acetate precipitation) were added to the system to terminate the reaction and specifically precipitate mRNA. The precipitate was then stored at -20°C for at least 30 minutes. The RNA precipitate was collected by high-speed centrifugation at 4°C (15 minutes) and washed with 70% ethanol to remove as many unbound nucleotides and impurity proteins as possible. Finally, the purified mature tailed mRNA was resuspended in an appropriate buffer according to the needs of subsequent experiments (1 mM Sodium Citrate Buffer in this example). For strict quality control, 0.5 μL of the tailing product and a reserved enzyme-free control sample were added to a denaturing loading buffer containing approximately 20 mM EDTA (to chelate divalent cations and prevent RNA degradation during heating). After denaturation at 75°C for 10 minutes, denaturing agarose-formaldehyde gel electrophoresis was performed in a 1× MOPS buffer system (1% or 1.5% gel concentration depending on the initial transcript length). By observing the band shift using a UV transilluminator, it was confirmed that the tailed mRNA fragment showed a clear molecular weight shift of ≥150bp compared to the untailed control, thus verifying the tailing efficiency and integrity.
[0042] 1.2 Construction of lipid nanoparticles carrying mRNA (1) Preparation of ionizable lipids: 2-chloro-1,3,2-dioxophosphazenecycloalkane 2-oxide (1.1 equivalents) was added to a beaker containing an alcohol (1.0 equivalent) and triethylamine (1.1 equivalent), and stirred for 15 minutes. The reaction was then continued at 25°C for 12 hours. The precipitate in the mixture was filtered and washed three times with ether to remove triethylamine hydrochloride. Finally, the solvent was removed by rotary evaporation to obtain concentrated alkylated dioxophosphazenecycloalkane oxide molecules.
[0043] (2) Preparation of cationic compounds: Lipidoids were synthesized by coupling alkylamines to the ends of alkyl acrylates via the Michael addition reaction pathway. In short, the amine and acrylate were mixed in a glass scintillation flask at a molar ratio of 1:n and reacted under solvent-free conditions at 90°C for 3 days with stirring. Subsequently, the lipidoids were purified by rapid column chromatography (dichloromethane / methanol mixed solvent).
[0044] (3) Preparation of lipid stock solution: Weigh out ionizable lipids (synthesized as per step (1) or purchased from Xi'an Qiyue Biotechnology Co., Ltd.), dioleoylphosphatidylethanolamine (DOPE), cholesterol, polyethylene glycol-modified phospholipids (DMG-PEG2000), and cationic compounds (synthesized as per step (2) or purchased from Xi'an Qiyue Biotechnology Co., Ltd.), dissolve in anhydrous ethanol and sonicate to prepare stock solutions of the following concentrations, and store at -20℃ protected from light. Before use, equilibrate to room temperature and vortex to mix. The final concentrations are: ionizable lipids 2 mg / mL; DOPE 2 mg / mL; cholesterol 2 mg / mL; DMG-PEG2000: 0.5 mg / mL; cationic compounds: 2 mg / mL. The structural formulas of the ionizable lipids and cationic compounds are as follows: (Ionizable lipids) (Cat compounds) (4) Microfluidic preparation of LNP: In this embodiment, the LNP@mRNA complex (LNP@mRNA) was prepared using a rapid mixing method. All operations were performed on ice to maintain the stability of the lipid mixture. First, the organic phase was prepared: a clean, sterile 1.5 mL centrifuge tube was used, and the corresponding volumes of lipid ethanol stock solution were added sequentially according to the molar ratio of ionizable lipids:cholesterol:DOPE:DMG-PEG2000:cationic compound = 50:40:20:0.25:20. The volume was then brought to a total volume of 45 μL with anhydrous ethanol. Subsequently, 5 μL of 10 mM citrate-sodium citrate buffer (pH 3.0-6.6) was added to maintain an acidic environment, and the mixture was gently mixed. The final volume of this organic phase was 50 μL.
[0045] Next, prepare the aqueous phase: Thaw the purified ESR1 mRNA on ice. Dilute to the target concentration with pre-chilled 10 mM citrate-sodium citrate buffer (pH 3.0-6.6) according to experimental requirements. For example, to prepare 100 μL of LNP-mRNA, take the required amount of mRNA (e.g., approximately 0.2 μg mRNA / well for 24-well cell transfection, approximately 30 μg / mouse for in vivo experiments) and dilute to 50 μL with buffer. Finally, perform rapid mixing and self-assembly: Quickly pipette 50 μL of the organic phase and inject it vertically into 50 μL of the aqueous phase within 1 second. Immediately afterward, vigorously pipette (or vortex mixer) 100 times to ensure thorough mixing without bubble formation. After mixing, immediately add 100 μL of pre-chilled 1×PBS buffer (pH 7.4) and quickly pipette again 100 times. After mixing, the reaction solution was left to stand at room temperature for 30 minutes to allow the lipids and mRNA to self-assemble into an LNP@mRNA complex through electrostatic interactions.
[0046] (5) Purification of LNP-mRNA (for in vivo experiments): To remove residual ethanol and unencapsulated free mRNA from the preparation process and reduce potential toxicity during in vivo administration, LNP-mRNA needs to be purified by dialysis. First, a dialysis bag of approximately 50 mm (molecular weight cutoff: 3.5-8 kDa) is cut off and immersed in ultrapure water at 60-70°C, and boiled for 30 minutes to activate it. Then, the dialysis bag is quickly transferred to an ice-water bath to cool for 10 minutes to restore it to usable condition. The self-assembled LNP@mRNA complex is transferred to the pretreated dialysis bag, and both ends are sealed with dialysis clips. The dialysis bag is placed in a beaker containing 1×PBS buffer (pH 7.4) and dialyzed magnetically at 220 rpm at 4°C. The dialysis process lasts for 24 hours, during which the dialysis solution is changed 3 times.
[0047] (6) Product collection and storage: After dialysis, transfer the LNP@mRNA complex from the dialysis bag to a clean, sterile 1.5 mL centrifuge tube. Before use, store at 4°C protected from light and use within 48 hours, avoiding violent shaking or repeated freeze-thaw cycles.
[0048] 1.3 Isolation of extracellular vesicles from human seminal plasma samples (1) Low-speed centrifugation to remove cells and large particulate impurities: Transfer the collected seminal plasma to 5 mL centrifuge tubes, aliquoting approximately 15 mL of seminal plasma into each tube, and then add phosphate-buffered saline (PBS) to make up to 50 mL. Place the centrifuge tubes in a centrifuge pre-cooled to 4°C and centrifuge at 3000×g for 5 minutes. After centrifugation, collect the supernatant and transfer it to a new 50 mL centrifuge tube.
[0049] (2) Second centrifugation to thoroughly remove cell debris: Add PBS to the supernatant obtained in the previous step to make up to 50 mL, place it in a centrifuge pre-cooled to 4°C, and centrifuge at 3000×g for 3 minutes to further remove residual cell debris. Collect the supernatant for later use.
[0050] (3) Sample transfer, replenishment, and sealing balance: Transfer all reagents and consumables to the ultracentrifuge operating chamber. Use a 20mL syringe to transfer the obtained supernatant into a quick-seal tube (Beckman 342414), add PBS to fill the tube, and ensure that no air bubbles remain in the tube during the operation. After the transfer is completed, accurately balance the weight of each tube so that the mass difference between any two tubes does not exceed 0.01g, and then seal each tube using a heat sealer.
[0051] (4) Accumulation of extracellular vesicles by ultracentrifugation: After sealing and balancing, the centrifuge tube is loaded into a Type 70.1Ti rotor, the rotor is locked, and the tube is ultracentrifuged at 100000×g for 70 minutes at 4℃ to allow the extracellular vesicles to precipitate to the bottom of the tube.
[0052] (5) Precipitation collection and preliminary resuspension: After centrifugation, release the vacuum, cut open the sealed tube and discard the supernatant. Gently wash the precipitate once with PBS, then add 800 μL of PBS solution and gently pipette to mix the precipitate to obtain seminal plasma extracellular vesicle (EV) stock solution for later use.
[0053] (6) Density gradient setup: Take a 13.2 mL volumetric tube (Beckman 344059) and slowly add 1.5 mL of iodixanol solution with concentrations of 36%, 30%, 24%, 18%, and 12% in descending order of concentration to form a discontinuous density gradient; finally, gently add the obtained EV stock solution at the top of the gradient. During the operation, avoid disturbing the interfaces of each liquid layer to ensure the integrity of the density gradient.
[0054] (7) Density gradient ultracentrifugation stratification: After balancing the centrifuge tubes with the density gradient laid out, they were placed into the buckets of the SW 41Ti rotor and the fixing screws were tightened to ensure that all buckets were loaded. The tubes were centrifuged at 100,000 × g for 70 minutes at 4°C to allow the extracellular vesicles of different subpopulations to be distributed in the interlayer of the corresponding iodixanol solution according to their density differences.
[0055] (8) Observation of stratification results: After centrifugation, it can be seen that the components in the EV stock solution have been stratified according to density to the liquid surfaces of iodixanol solutions of different concentrations. From top to bottom, they are high-density extracellular vesicle layer (sEV-Hs), medium-density extracellular vesicle layer (sEV-Ms), low-density extracellular vesicle layer (sEV-Ls), and non-vesicle granule layer (NVs). The NVs layer mainly accumulates residual cell debris and other sediments.
[0056] (9) Puncture to collect each subgroup of components: Use a 1mL syringe to directly puncture the wall of the ultra-transparent thin-walled centrifuge tube, gently extract the liquid of each density layer, and collect each subgroup of components into an independent sterile 15mL centrifuge tube.
[0057] (10) Desalting treatment: Transfer the liquid components of each subgroup obtained in the previous step to a quick-sealing tube, add PBS to fill the tube, balance and seal it precisely, and centrifuge at 100000×g for 30 minutes at 4°C to completely remove the residual iodixanol in the sample and obtain purified precipitate.
[0058] (11) Resuspension and storage: Discard the supernatant, add about 500 μL of PBS buffer to each precipitate, and gently resuspend by pipetting to obtain the purified extracellular vesicle suspensions of each subpopulation (sEV-Hs, sEV-Ms and sEV-Ls). The seminal plasma extracellular vesicle fraction used in this disclosure is the sEV-Hs layer, which is aliquoted and stored in an ultra-low temperature freezer at -80℃. Vigorous shaking should be avoided during operation and transportation to prevent damage to the vesicle structure.
[0059] 1.4 Achieving hybrid fusion of LNP@mRNA and seminal plasma extracellular vesicles via freeze-thaw cycles (1) Preheat the hot water bath or metal bath to 37°C; (2) Quickly mix equal volumes of seminal plasma extracellular vesicle suspension and LNP@mRNA suspension into the same sterile 1.5mL EP tube, and gently pipette several times to mix. (3) Immediately transfer the mixture to a -80°C freezer and time it for 15 minutes. After the timer expires, quickly transfer the mixture to a 37°C water bath or metal bath and time it for 15 minutes. This constitutes one freeze-thaw cycle; repeat a total of three freeze-thaw cycles. (4) After the last incubation at 37°C, the obtained hsEV-LNP@mRNA is placed at 4°C for equilibration and stored. It must be used within 48 hours.
[0060] 1.5 Verification of LNP@mRNA transfection efficiency in primary endometrial cells Human endometrial stromal cells (Shanghai Bohu Biotechnology Co., Ltd., catalog number: P-X1387) were prepared, or primary endometrial stromal cells were isolated from endometrial samples obtained by hysteroscopy from female patients aged 25-40 years with normal menstrual cycles and with normal pathological results. The specific isolation steps are as follows: (1) Collection of clinical samples: Fresh specimens were obtained during the operation, immediately placed in 0.9% sterile saline, stored on ice and transported to the laboratory; (2) Preparation of enzyme digestion system: Dissolve 10 mg of type I collagenase (Thermo Fisher Scientific, 17100017) in 10 mL of pure DMEM / F12 medium (Thermo Fisher Scientific, C11330500CP), extract all collagenase / medium solution with a syringe, filter it through a 0.22 μm filter to sterilize, filter it into a 50 mL sterile centrifuge tube, and add 20 μL LDNase I; (3) Wash the obtained fresh endometrial tissue in PBS buffer at least 3 times and remove as much blood clot as possible; (4) Place the cleaned endometrial tissue into a sterile 1.5ml EP tube, and use sterile ophthalmic scissors to cut the tissue into small fragments of about 1mm3. Use a Pasteur pipette to add a small amount of digestion solution into the EP tube to suspend the cut endometrial tissue and transfer it all to the prepared digestion system. Seal the 50mL centrifuge tube containing the digestion system with Parafilm, place it at an angle in a shaker at 37℃, and shake at 220rpm for 20 minutes. Rinse the scissors, forceps, and other instruments, soak them in alcohol overnight, and autoclave them the next day. (5) First, filter the digested cell suspension using a 40μm sterile cell filter, rinse the filter with 5ml PBS buffer, collect the filtrate and transfer it to a new centrifuge tube, centrifuge at 1500rpm for 5 minutes; (6) Use a sterile pasteurized dropper to aspirate the supernatant, leaving the cell pellet; (7) Gently resuspend the cells in 3 mL of 20% FBS (Sigma, 12106C) + 1% penicillin-streptomycin (Thermo Fisher Scientific, 15140122) + DMEM / F12 medium (Thermo Fisher Scientific, C11330500CP) + 1% ITS (Thermo Fisher Scientific, 41400045), mix well by pipetting, seed into 6 cm cell culture dishes, mix in a cross shape, and place in a primary incubator for static culture.
[0061] (8) After 2 hours, all the cell culture medium was aspirated and transferred to a 12-well cell culture plate; culture medium containing 20% FBS was added back to the 6cm cell culture dish. Since there is a difference in the adhesion speed between hEECs and hESCs at the bottom of the cell culture dish, at this time, most of the cells transferred to the 12-well cell culture plate are hEECs, while hESCs are mostly attached to the bottom of the 6cm cell culture dish.
[0062] (9) On the second day, observe the adhesion and growth of the primary cells, and replace the medium containing 20% fetal bovine serum with a medium containing 10% fetal bovine serum. Observe and change the medium every other day. When the cell density reaches 70-80%, it can be passaged and plated for subsequent experiments.
[0063] hsEV-LNP@ESR1-mRNA was added at a concentration of 60 μL / 1 mL of culture medium, and Western blotting was performed to detect protein expression 48 hours later. Figure 1 A) and EdU cell proliferation detection ( Figure 1 (B and C in the text) For Western blotting protein expression detection: (1) Preparation of protein lysis buffer: PMSF (Beyotime, ST506) and protease inhibitor mixture (Beyotime, P1045) were diluted to 1× using RIPA lysis buffer (Beyotime, P0013B) to obtain the digestion system, which was then temporarily stored on ice. (2) Sample processing: For cell samples, discard the culture medium and wash three times with PBS. Add 100 μL of digestion system to each well, place on ice for 15 minutes, and then transfer to a new sterile 1.5 mL EP tube. For tissue samples, pre-cut the collected clinical samples or mouse tissues, place them in a sterile 1.5 mL EP tube, add 200 μL of digestion system and grinding beads, and grind five times at 4°C using a high-throughput tissue homogenizer (Ningbo Xinzhi Biotechnology Co., Ltd.), each time for 30 seconds, with a 5-minute interval between each grinding. After grinding, discard the grinding beads, place on ice for 20 minutes, and centrifuge at 2000 rpm for 5 minutes in a centrifuge pre-cooled to 4°C. Take the supernatant and transfer it to a new sterile 1.5 mL EP tube. (3) For tissue proteins, since the size and quality of the samples taken cannot be guaranteed to be strictly consistent, the total amount of protein obtained needs to be quantified by BCA. For cells, since cell counting has been performed when seeding the plates, the cell growth conditions are the same, and the expression levels of the internal reference protein are basically consistent, this step can be skipped. For organoids, since the growth rates of organoids are inconsistent, the total amount of protein obtained needs to be quantified by BCA; (4) BCA quantification: Prepare the BCA detection working solution by mixing solution A and solution B in the BCA kit (Shanghai Beyotime Biotechnology Co., Ltd., P0012) at a ratio of 50:1, and prepare the BCA standard solution using the protein standard (1 mg / ml) to calculate the standard curve. Add 2 μL of protein standard / sample to each well in a 96-well container, then add 18 μL of protein lysis buffer, and finally add 200 μL of BCA protein detection working solution. Gently shake to mix, and incubate at room temperature for 30 minutes. (5) Use a microplate reader (BioTek) to detect the absorbance at 562 nm and calculate the protein concentration of the sample to be tested according to the standard curve. Finally, based on the protein concentration of each sample, dilute the protein concentration of each group again with protein lysis buffer until the concentration of each sample is basically the same; (6) Protein denaturation: Add 6× SDS-PAGE loading buffer (Beyotime, P0015F) to each sample and dilute it to a final concentration of 1×. After mixing, place it in a metal bath at 100℃ for 10 minutes to fully denature the protein. Then, freeze the protein at -20℃ or use it directly in subsequent experiments.
[0064] (7) Gel preparation: After cleaning and air-drying the gel casting plates, align and fix the two plates on the gel casting rack. Use the 10% PAGE gel rapid preparation kit (Yamei, PG212) to prepare the gel. First, prepare the lower gel layer. For each gel, use 4 mL of lower gel solution, 4 mL of lower gel buffer, and 80 μL of coagulant. Mix well and add the mixture between the two gel casting plates. Press down with isopropanol and let stand for 15-20 minutes to allow the lower gel to solidify. Then, mix 1 mL of upper gel solution, 1 mL of upper gel buffer, and 20 μL of coagulant and add the mixture to the glass plate. Insert a 10 or 15-well comb depending on the number of samples and let stand for 20 minutes to allow the upper gel to solidify. (8) Preparation of electrophoresis buffer and transfer buffer: For electrophoresis buffer, dilute 10× electrophoresis buffer (Yaxin, PS105) to 1× with ddH2O. For transfer buffer, add 100mL of 10× transfer buffer (Yaxin, PS109) + 200mL of anhydrous methanol + 700mL of ddH2O to a 1L glass bottle, mix thoroughly, and pre-cool at 4℃. (9) Sample loading: Install the gel into the electrophoresis tank, fill the electrophoresis tank with 1× electrophoresis buffer, remove the comb, and add the protein sample and protein molecule marker (Thermo Fisher Scientific, 26616) into the gel well in sequence. Record the loading order to ensure that the loading volume is consistent. (10) Electrophoresis: Electrophoresis at a constant voltage of 80V for 20 minutes. After the protein sample is flattened into a straight line and enters the lower gel, electrophoresis at a constant voltage of 120V for 60 minutes until the protein has almost reached the bottom of the gel, then turn off the power. (11) Transfer: After electrophoresis, remove the gel from the glass plate and place it on the thick filter paper of the transfer clamp soaked in transfer buffer; attach the PVDF membrane (ThermoFisher Scientific, 88518) pre-activated with anhydrous methanol above the gel, check to ensure there are no air bubbles, clamp the transfer clamp and place it in the transfer tank. Take out the pre-cooled transfer buffer and pour it into the tank, place it in an ice bath for transfer, and the transfer conditions are constant current 250mA, 90 minutes; (12) Preparation of blocking buffer and TBST: Prepare 1×TBST by mixing 50mL of 20×TBS (Sangon Biotech, B548105-0500) + 1mL of Tween20 (Beyotime, ST825) + 950mL of ddH2O. Prepare 5% BSA blocking buffer by mixing 2.5g of BSA powder (Yeasen, 36101ES60) + 50mL of 1×TBST buffer.
[0065] (13) Membrane cutting and blocking: After the transfer is completed, remove the transfer clamp, discard the gel and carefully remove the PVDF membrane. According to the protein marker position and the required protein molecule size, cut the membrane into the appropriate size and put it into the incubation box. Wash three times with TBST for 5 minutes each time, then add 5% BSA and block at room temperature with slow shaking for 1 hour. (14) Primary antibody incubation: Discard the blocking solution, use the blocking solution to dilute the corresponding antibody to the appropriate concentration, and incubate overnight at 4°C with slow shaking. The primary antibodies used in this example are anti-ERα (Rabbit) (Protientech, 21244-1-AP, 1:1000) and anti-βactin (Rabbit) (Proteintech, HRP-60008, 1:5000). (15) Secondary antibody incubation: On the second day of WB, the primary antibody was recovered or discarded, and TBST buffer was added for rapid shaking three times at room temperature, 5 minutes each time; the corresponding secondary antibody was diluted to an appropriate concentration using TBST buffer and incubated slowly at room temperature for 1 hour. The secondary antibody used in this example was anti-Rabbit IgG (Goat) (Proteintech, SA00001-2, 1:5000); (16) Recover the secondary antibody and wash it three times with TBST buffer at room temperature, 5 minutes each time; (17) Development: Take out the PVDF film, blot it dry with paper, and evenly cover the PVDF film with the developing solution. Place it in the developing apparatus for development. (18) If the membrane needs to be recycled for incubation of other antibodies, after exposure, place the membrane in an appropriate amount of membrane regeneration solution (Beijing Pulilai, P1650-500), shake slowly at room temperature for 30 minutes and then discard it. Wash with TBST buffer at room temperature and shake quickly 3 times, 5 minutes each time. Repeat the blocking, primary antibody and secondary antibody incubation steps to detect the expression level of the new target protein. For EdU cell proliferation assay: (1) Prepare 2×EdU working solution: Dilute the EdU stock solution (10mM) in the EdU cell proliferation assay kit (Beyotime, C0072S) with 10% cell culture medium at a ratio of 1:500 to a final concentration of 20μM; (2) EdU incubation: Add an equal volume of 2×EdU working solution preheated at 37℃ to the culture medium of the 12-well plate to make the final EdU concentration 10μM, and continue to incubate in a constant temperature incubator at 37℃ for 2 hours; (3) Fixation: After EdU labeling, remove all culture medium, wash three times with PBS, add 1 mL of 4% paraformaldehyde (PFA) fixative, and fix at room temperature for 15 minutes; (4) Washing: Wash three times with 3% BSA / PBST solution at room temperature, shaking for 5 minutes each time; (5) Permeabilization: Prepare cell permeabilization buffer containing 0.3% Triton X-100 with PBST, incubate at room temperature for 15 minutes, discard the permeabilization buffer after permeabilization, and wash three times with washing buffer at room temperature for 5 minutes each time. (6) Preparation of Click reaction solution: For a 12-well plate, take 172 μL Click Reaction Buffer + 8 μL CuSO4 + 0.4 μL Azide 488 + 20 μL Click Additive Solution from the kit to prepare a final volume of 200 μL of Click reaction solution. (7) Click reaction: Discard the washing buffer, add 200 μL of Click reaction solution to each well, gently shake the plate to ensure that the cells are evenly covered, and incubate at room temperature in the dark for 30 minutes; (8) After incubation, discard the Click reaction solution and wash with washing solution at room temperature with rapid shaking 3 times, 5 minutes each time; (9) 4',6-Diamidinyl-2-phenylindole (DAPI) staining of nuclei: Dilute DAPI in PBST at a ratio of 1:5000, add 500 μL of DAPI solution to each well, and incubate at room temperature in the dark for 10 minutes; after incubation, discard the DAPI solution, and wash three times with washing buffer at room temperature for 5 minutes each time. (10) The fluorescence signal expression of the DAPI channel and the green fluorescence channel was observed using a fluorescence microscope. The results are as follows: Figure 1 As shown in C.
[0066] Example 2: In vivo therapeutic effect of ESR1 mRNA in situ transfection into the uterine cavity on a mouse model with thin endometrium In this embodiment, lipid nanoparticles carrying mRNA delivery technology were used in a mouse model with thin endometrium to upregulate the expression level of ESR1 and demonstrate its therapeutic effect on thin endometrium.
[0067] 2.1 Animal Model Establishment and Grouping Female ICR mice (6-8 weeks old, weighing 28-32 g / mouse, purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd.) were selected and housed in an SPF-grade animal facility under the following environmental conditions: constant temperature of 24℃, relative humidity of 50%-60%, and a 12-hour / 12-hour light / dark cycle. All animals had free access to food and water and underwent a one-week acclimatization period before the formal experiment. Table 2 shows the treatment methods for each group.
[0068] Table 2 Appropriate drug treatment was administered immediately after modeling. Uterine tissue was collected from each group of mice on day 7 post-modeling. To eliminate inter-individual differences in estrous cycles, all mice received a subcutaneous injection of estrogen (E2, 100 μL) in the posterior cervix 24 hours before tissue collection to synchronize their endocrine cycles.
[0069] 2.2 Mouse intrauterine injection drug delivery surgical model (1) Weigh the ICR mice before surgery, calculate the anesthetic dose, administer tribromoethanol intraperitoneally at a dose of 20 μL / g body weight, observe the mice to confirm the depth of anesthesia, and confirm that the mice's vital signs are stable. (2) The mouse was placed in a supine position. The abdomen was disinfected with iodine. A 1-2 cm incision was made about 1 cm above the pubic symphysis to enter the abdominal cavity. After finding the mouse uterus, it was gently moved to the outside of the abdominal cavity. (3) Expose both uteri of the mouse, insert a 1 mL needle containing 95% alcohol into the cervix and towards the uterine horn, and inject 100 μL of 95% alcohol into the uterine cavity, maintaining for 2 minutes; after 2 minutes, withdraw the needle and insert a needle containing physiological saline to rinse. For the sham surgery group, physiological saline is given instead of 95% alcohol in this step; (4) Insert a 1 mL insulin injection needle into the cervix, pointing towards the uterine horn, and inject 100 μL of the therapeutic drug into the uterine cavity. Repeat the operation on the other side. After the injection, take 10-20 μL of pre-cooled thermosensitive hydrogel Pluronic-F127 (Boson, D50421, 40%) on ice, insert a 1 mL injection needle containing the thermosensitive hydrogel into the previous injection hole, and push the thermosensitive hydrogel into the cervix. After solidification, withdraw the needle and check whether the uterus is distended, whether there is any fluid leakage, and whether there is any obvious rupture or tissue damage. For the sham surgery group, physiological saline is given instead of the transfection drug in this step. The abdomen is closed by suturing, and the mice are given warming and comfort measures. Vital signs are observed and the mice are awaited to wake up.
[0070] 2.3 Assessment of ESR1 expression levels Total protein was extracted from uterine tissue, and ERα protein expression was detected using Western blotting following the steps described above.
[0071] like Figure 1 As shown in Figure A, the results showed that ERα protein expression was significantly restored in the ESR1 mRNA treatment group compared with the negative control group, indicating that in situ transfection of ESR1 mRNA in the uterine cavity can effectively reverse the loss of ERα protein caused by thin endometrium at the protein level.
[0072] 2.4 Histopathological evaluation The uterine tissue sections from each group were subjected to HE staining, immunohistochemistry, and Masson's trichrome staining, respectively. The specific steps are as follows: For immunohistochemistry: (1) Fixation: After obtaining fresh mouse or human tissue samples, fix them in 4% PFA (Beijing Solarbio, EX1310); (2) Section preparation: The sections were sent to Wuhan Sewell Biotechnology Co., Ltd. for paraffin embedding and HE staining results of continuous sections and representative sections were obtained. After the sections were returned, they were observed under an optical microscope. Based on the HE staining results of the continuous stained sections in the same batch, sections with complete tissue morphology were selected for subsequent experiments.
[0073] For immunohistochemical staining: (3) Baking: Preheat the baking machine to 65°C, place the selected slices in the baking machine for more than 45 minutes until the paraffin melts; (4) Dewaxing: Immediately place the sections in dewaxing solution I (Grimm specimen, GS-01) for 10 minutes, then place them in dewaxing solution II (Grimm specimen, GS-01) for 10 minutes; (5) Hydration: Soak all sections in a gradient concentration of ethanol for hydration (5 minutes each for anhydrous ethanol, 95% ethanol, 90% ethanol, and 80% ethanol). After hydration, soak all sections in ddH2O for 5 minutes. Repeat three times. (6) Antigen retrieval: Dilute 50× Tris-EDTA (Proteintech, PR30002) with ddH2O to prepare a final volume of 200 mL of 1× Tris-EDTA antigen retrieval solution. Preheat the antigen retrieval solution to 100°C using a water bath. Place all sections into the antigen retrieval solution, retrieval human tissue sections for 20 minutes and mouse tissue sections for 10 minutes. After completion, remove all sections and immerse them in the antigen retrieval solution to cool to room temperature for about 1 hour. (7) Endogenous enzyme blockade: After antigen retrieval is completed, all sections are immersed in 1×PBST for 5 minutes and washed for 3 times. After washing, the sections are taken out, excess water around the tissue is wiped off with paper towels, and a water-blocking pen is used to draw circles around the tissue. Then, solution A (hydrogen peroxide) from the immunohistochemistry kit (Absin, ABS957) is dropped onto the sections to cover the entire tissue to consume peroxidase. After incubation for 10 minutes, solution A is discarded, and the sections are immersed in 1×PBST for 5 minutes and washed for 3 times. (8) Background blocking: Add reagent B (super blocking solution) to the slide to cover the entire tissue and block the antigen; after incubation for 5 minutes, discard reagent B, immerse in 1× PBST and wash for 5 minutes, repeat 3 times; (9) Primary antibody incubation: Dilute the primary antibody to a certain ratio using 1×PBST (the specific ratio is determined based on the results of the preliminary experiment before the formal experiment; in this experiment, 1:1000 is used), and drop it onto a glass slide to cover the entire tissue. Place the slide in a humidified chamber and incubate overnight at 4°C. (10) Rewarming: On the second day, remove the humidified box and warm it to room temperature for 30 minutes; discard the primary antibody, wash the slides in 1×PBST for 5 minutes, and repeat 3 times. In this example, the primary antibody is Anti-Estrogen Receptor alpha antibody (Rabbit mAb, Severell, GB15205, 1:1000); (11) Amplification agent incubation: Add reagent C (primary antibody amplification agent) from the kit to the slide to cover the entire tissue, incubate for 10 minutes and then discard it. Wash with 1×PBST for 5 minutes and repeat 3 times. (12) Enzyme-labeled polymer incubation: Add reagent D (enzyme-labeled secondary antibody polymer) to the slide to cover the entire tissue, incubate for 5 minutes and then discard it. Wash in 1×PBST for 5 minutes and repeat 3 times. (13) Colorimetric reaction: Mix 1 ml of solution E and 30 μl of solution F from the kit to prepare DAB solution. For the preliminary experiment, cover the entire tissue and start the timer. Observe the degree of color development of the tissue sections under an optical microscope to control the color development time. Once the tissue is stained, discard the DAB solution and record the required time. Use the color development time of this section as a reference for the color development time of the remaining sections to count down the time. For the formal experiment, count down the time of all sections according to the color development time determined in the preliminary experiment to ensure that the DAB staining time of each tissue is the same. After the color development is completed, insert the sections into ddH2O and let them stand for 2 minutes. (14) Hematoxylin nuclear staining: Hematoxylin (Biosharp, BL702B) was dropped onto the slide to cover the entire tissue. After incubation for 10 seconds, the slide was gently rinsed under running water to remove the hematoxylin. The slide was then placed in a ddH2O box and rinsed under running water for about 30 seconds.
[0074] (15) Dehydration and clearing: All sections were immersed in gradient concentrations of ethanol (80% ethanol, 90% ethanol, anhydrous ethanol, and anhydrous ethanol for 2 minutes each), and finally immersed in clearing solution I and clearing solution II (Grin specimen, GS-06) for 5 minutes each.
[0075] (16) Mounting: Place all slides in the room to air dry for about 1 hour, add neutral resin (Sangon Biotech, E675007), cover with a coverslip, and avoid generating air bubbles during mounting. Observe and photograph all slides under an optical microscope.
[0076] For Masson's tricolor staining: (1) Fixation and section preparation: This step is the same as immunohistochemical staining; (2) Dewaxing and hydration: This step is the same as immunohistochemical staining; (3) Hematoxylin staining of nuclei: Weigert iron hematoxylin staining solution was prepared by mixing reagents A1 and A2 in a 1:1 ratio using the Masson staining kit (Beijing Solarbio, G1340). The solution was then dropped onto the slide to cover the entire tissue and stained for 10 minutes. (4) Differentiation: Discard the Weigert iron hematoxylin staining solution, immerse all sections in ddH2O for 5 minutes, then add reagent B (acidic differentiation solution) to the sections to cover the entire tissue, and differentiate for 10 seconds; (5) Blueing: Discard the acidic differentiation solution, immerse all sections in ddH2O for 30 seconds, then add reagent C (Masson blueing solution) to the sections to cover the entire tissue, and let it blue for 5 minutes; (6) Fuchsin staining: Discard the bluing solution, immerse all sections in ddH2O for 30 seconds, then add reagent D (Pompon Red Fuchsin staining solution) to the sections to cover the entire tissue, and stain for 10 minutes; (7) Preparation of weak acid solution: Prepare weak acid working solution according to the ratio of ddH2O: acetic acid = 2:1, discard the Ponceau S and fuchsin staining solution, and wash all sections with weak acid working solution for 30 seconds; (8) Phosphomolybdic acid differentiation: Discard the weak acid liquid, add reagent F (phosphomolybdic acid solution) to the slice to cover the entire tissue, and treat for 2 min; (9) Aniline blue staining: Discard the phosphomolybdic acid solution, wash all sections with weak acid working solution for 30 seconds, then discard the excess liquid, add reagent G (aniline blue staining solution) to the sections to cover the entire tissue, stain for 2 minutes, discard the aniline blue staining solution after staining, and wash all sections with weak acid working solution for 30 seconds. (10) Dehydration, clearing and mounting: This step is the same as immunohistochemical staining.
[0077] The endometrial thickness, number of functional glands, degree of fibrosis, and localization of ESR1 in the endometrial epithelium and stromal cells were observed in each group. The results are as follows: Figure 2 As shown in A and B.
[0078] Example 3: Effect of ESR1 mRNA on the restoration of fertility in a mouse model with thin endometrium Each group of mice was given a 2-week recovery period after surgery to eliminate the interference of acute surgical inflammation on pregnancy. After the recovery period, the mice were housed with male mice at a 1:1 female-to-male ratio, and the pregnancy was monitored throughout the entire process, with the formation of a vaginal plug as the starting point of pregnancy (E0.5). (1) Embryo implantation assessment (E5.5): On day 5.5 after thrombus formation (E5.5), Evans Blue dye was injected via the tail vein, and the implantation sites of the uterus in each group were dissected and observed. (2) Late pregnancy fetal development assessment (E18.5): On day 18.5 after thrombus formation (E18.5), pregnant mice in each group were dissected to record weight gain, changes in abdominal circumference, and fetal development; (3) delivery outcome and offspring assessment: After natural delivery, the number of live births, birth weight, and physical development of the newborn pups were recorded in each group. Monitoring continued until day 14 postpartum (PD14) to assess the growth and developmental trajectory of the offspring. Results are shown in [Table missing]. Figure 2 D.
[0079] Comparative Example 1: Primary endometrial stromal cells negative control Protocol: In Example 1, untreated or groups with an equal volume of empty LNP were used as negative control groups, and groups transfected with ESR1-mRNA were used as experimental groups.
[0080] Results Comparison: In primary endometrial stromal cells, Western blotting results showed that ESR1 expression was significantly upregulated compared to the negative control group after transfection with hsEV-LNP@ESR1-mRNA; EdU was detected 48 hours after transfection. Figure 1 As shown in the results, EdU (+) cells were significantly increased in the group that was transfected with ESR1-mRNA and had its ERα protein upregulated.
[0081] Conclusion: Transfection of ESR1-mRNA into primary endometrial stromal cells significantly promotes cell proliferation.
[0082] Comparative Example 2: Sham-operated group and negative control group in mouse surgical model Protocol: In Examples 2 and 3, a mouse sham-operated model with saline injection only in the uterine horn was used as a blank control group, and an ethanol-induced thin endometrial model and saline treatment were used as negative control groups.
[0083] Result comparison: such as Figure 2 As shown, in a mouse model of thin endometrium caused by ethanol, treatment with ESR1 mRNA significantly increased endometrial thickness and the number of functional glands; the number of mouse embryo implantation sites significantly recovered, and the growth and development level of offspring was not significantly different from that of the blank control group.
[0084] Conclusion: This study demonstrates that ESR1 mRNA treatment for thin endometrium can significantly restore the uterine cavity anatomy and improve reproductive outcomes.
[0085] This disclosure provides a technical solution for upregulating estrogen receptor α (ERα) expression, restoring endometrial thickness, and restoring fertility through in situ transfection of ESR1 mRNA into the uterine cavity. Compared with existing technologies, this disclosure has the following significant advantages: 1) Precisely targeting the core pathological mechanism of thin endometrium at the receptor level to achieve etiological treatment: Existing clinical treatments for thin endometrium (such as high-dose estrogen replacement therapy and intrauterine perfusion of platelet-rich plasma) mainly rely on exogenous ligands or non-specific proliferative agents, and their efficacy depends on the integrity of receptor function. This disclosure targets the ERα receptor itself, a core component of the estrogen signaling pathway, and directly restores endogenous ERα protein expression by exogenously supplementing ESR1 mRNA, fundamentally solving the estrogen signaling transduction disorder caused by ERα deficiency or downregulation. This strategy has groundbreaking etiological targeted therapeutic value for thin endometrium with impaired ERα function (including those caused by repeated intrauterine procedures and hormone resistance), filling the gap in existing treatments at the receptor level.
[0086] 2) Intrauterine in-situ transfection strategy achieves highly efficient local delivery and significantly reduces the risk of systemic exposure: This disclosure utilizes lipid nanoparticles carrying ESR1 mRNA for intrauterine injection, achieving in-situ delivery and highly efficient transfection of therapeutic nucleic acid molecules in target organs. Compared with systemic administration, intrauterine local administration can create a high concentration of therapeutic effect in the endometrium, while minimizing the distribution of ESR1 mRNA and its translation products in non-target tissues. This effectively avoids potential side effects in tissues such as the breast and bone that may be caused by systemic estrogen receptor activation, significantly improving the safety of treatment.
[0087] 3) The mRNA delivery method has multiple advantages of high efficiency, instantaneous controllability and gene safety: The advantages of using ESR1 mRNA as the therapeutic active ingredient are reflected in: (1) High efficiency: ESR1 mRNA intrauterine transfection can achieve rapid translation and high efficiency of ERα protein in vivo. Western blotting results confirmed that the ERα protein expression level in the treatment group was significantly restored, close to the level of the normal control group, which verified the transfection efficiency of this delivery method in living tissue; (2) Safety: mRNA does not enter the cell nucleus and does not integrate into the host genome, which fundamentally eliminates the risk of insertion mutation and carcinogenesis; at the same time, mRNA has a limited half-life in vivo, and ERα protein expression has time-limited and self-limiting properties, which can effectively avoid the risk of endometrial hyperplasia or malignant transformation that may be induced by long-term overexpression of estrogen receptor, which is highly consistent with the physiological characteristics of the periodic repair of endometrium; (3) Controllability: The dosage and timing of administration can be flexibly adjusted according to clinical needs, which provides a technical basis for the formulation of individualized treatment plans.
[0088] 4) Dual confirmation of endometrial structural repair at the histopathological and molecular levels: This disclosure systematically verified the tissue repair effect of ESR1 mRNA treatment using a multi-dimensional assessment system (Western blotting, HE staining, Masson's trichrome staining, and immunohistochemistry). Experimental results showed that key pathological indicators such as endometrial thickness, number of functional glands, and degree of fibrosis in the treatment group were significantly improved compared to the negative control group. Furthermore, the localization and expression of ERα protein in endometrial epithelial cells and stromal cells were effectively restored, jointly confirming the endometrial repair efficacy of this regimen from both histomorphological and molecular expression perspectives.
[0089] 5) Fully restores fertility function with good safety for mothers and offspring: This invention conducted a systematic assessment of the entire pregnancy cycle in an in vivo fertility experiment. The results showed that: (1) Embryo implantation ability was restored: The number of implantation sites in the ESR1 mRNA treatment group (E5.5) was significantly increased compared with the negative control group, indicating that endometrial receptivity was effectively reconstructed; (2) Pregnancy maintenance and full-term delivery ability were restored: The number of live fetuses and full-term live pups in the late pregnancy (E18.5) of the treatment group was significantly higher than that of the negative control group, and the pregnancy loss rate was significantly reduced; (3) Good safety for offspring: There were no significant differences between the offspring of the treatment group and the sham surgery group in terms of birth weight, appearance phenotype, and growth trajectory within 14 days postpartum, suggesting that this protocol has no significant adverse effects on the health of offspring and has good reproductive safety. The above results fully confirm from a functional perspective that this invention can effectively reverse the infertility and pregnancy loss phenotype caused by thin endometrium, and achieves systematic restoration of fertility function while ensuring maternal and infant safety, which has important clinical translation prospects.
[0090] Based on the ESR1 mRNA intrauterine in situ transfection technology established in this disclosure and the experimental evidence obtained in the treatment of thin endometrium and fertility reconstruction, this disclosure has clear translational application prospects in the following areas: 1) Targeted Drug Development for Thin Endometrium: The absence or impairment of ERα expression is a fundamental reason for the poor response to conventional estrogen therapy in a significant proportion of patients with thin endometrium. The ESR1 mRNA formulation disclosed herein can be developed into a precision drug targeting the aforementioned patient subgroup based on different delivery systems. It directly reconstructs ERα protein supply at the post-transcriptional level, thereby restoring the normal endometrial response to estrogen and providing a new interventional approach for refractory cases unresponsive to existing clinical protocols.
[0091] 2) Development of a drug-device combination product for preventing recurrence and repairing intrauterine adhesions: Rapid reconstruction of the functional endometrial layer after intrauterine adhesion breakdown is key to preventing re-adhesion. This disclosure can function in this scenario in two ways: First, by selecting a suitable carrier, ESR1 mRNA can be formulated into a postoperative intrauterine irrigation preparation for immediate administration, thereby repairing the postoperative endometrial response to estrogen and accelerating functional endometrial regeneration; Second, it can be loaded into intrauterine support devices or biodegradable anti-adhesion barrier materials to construct a drug-device combination product that combines physical isolation and biological repair functions, prolonging the local effective action time while avoiding the adverse exposures caused by systemic administration.
[0092] 3) Intervention for recurrent implantation failure due to low endometrial receptivity: After excluding embryonic factors, endometrial receptivity defects in patients with recurrent implantation failure are often closely related to abnormal estrogen signaling responses. This disclosure can be used as a pre-implantation conditioning protocol, administering medication intrauterinely during the endometrial preparation phase of the embryo transfer cycle. By restoring the ERα-mediated transcriptional regulatory network, it upregulates receptivity molecules associated with embryo adhesion and invasion, creating a better intrauterine microenvironment for embryo implantation and expanding the clinical applicability of assisted reproductive technology.
[0093] 4) Non-hormonal intervention for endocrine-related endometrial atrophy: Endometrial atrophy caused by premature ovarian failure, surgical menopause, or long-term progesterone exposure is characterized by estrogen insensitivity due to functional downregulation of endometrial cells' ERα. This disclosure proposes a more localized and controllable alternative for patients who are unsuitable for or unwilling to undergo systemic hormone replacement therapy by locally supplementing ESR1 mRNA in the uterine cavity, without increasing systemic estrogen load, to selectively restore the estrogen response capacity of target organs.
[0094] 5) Multi-target synergistic treatment strategy: The intervention mechanism at the receptor function level disclosed in this invention has natural complementarity with many existing therapies, and can construct multi-target combined programs: When combined with estrogen replacement therapy, it can convert hormone-resistant patients into treatment responders; when combined with anti-fibrotic agents, it can simultaneously address the two interrelated pathological links of endometrial fibrosis and ERα function loss; when combined with endometrial stem cell or bone marrow-derived cell transplantation, it can improve the survival, differentiation and functional integration efficiency of exogenous cells in the damaged endometrium by reconstructing the normal estrogen signaling microenvironment, providing a theoretical basis and program reference for the comprehensive treatment of severe intrauterine injury.
[0095] Example embodiments have been disclosed herein, and while specific terminology has been used, it is for illustrative purposes only and should be construed as such, and is not intended to be limiting. In some instances, it will be apparent to those skilled in the art that features, characteristics, and / or elements described in connection with particular embodiments may be used alone, or in combination with features, characteristics, and / or elements described in connection with other embodiments, unless otherwise expressly indicated. Therefore, those skilled in the art will understand that various changes in form and detail may be made without departing from the scope of this disclosure as set forth by the appended claims.
Claims
1. The use of an mRNA-based estrogen receptor-regulating composition in the preparation of a medicament for treating estrogen-insensitive endometrial diseases, wherein, The mRNA is obtained by in vitro transcription from a DNA template, the DNA template containing a T7 promoter, a 5'UTR, an ESR1 coding region, and a 3'UTR. The sequence of the T7 promoter is SEQ ID No: 1, the sequence of the 5'UTR is SEQ ID No: 2, the sequence of the ESR1 coding region is SEQ ID No: 3, and the sequence of the 3'UTR is SEQ ID No:
4.
2. The application according to claim 1, characterized in that, The estrogen receptor regulating composition further includes composite lipid nanoparticles, which are prepared by the following steps: Preparation of lipid nanoparticles; Seminal plasma extracellular vesicles (sEVs) were isolated from human seminal plasma and purified by density gradient centrifugation to obtain high-density fraction seminal plasma extracellular vesicles (sEV-Hs). The high-density seminal plasma extracellular vesicles are mixed with the lipid nanoparticles, and the hybrid fusion of the high-density seminal plasma extracellular vesicles and the lipid nanoparticles is achieved through freeze-thaw cycles.
3. The application according to claim 2, characterized in that, The preparation of lipid nanoparticles includes: Ionizable lipids, cholesterol, dioleoylphosphatidylethanolamine (DOPE), polyethylene glycol-modified phospholipids, and cationic compounds are added to a container in a preset molar ratio. The mRNA is then added, and the mixture is mixed and self-assembled, allowing the lipids and mRNA to self-assemble through electrostatic interactions to form an LNP@mRNA complex. The preset molar ratio is (49-51):(39-41):(19-21):(0.2-0.3):(19-21).
4. The application according to claim 3, characterized in that, The hybrid fusion of the high-density seminal plasma extracellular vesicles and the lipid nanoparticles by freeze-thaw cycles includes: achieving the hybrid fusion of the high-density seminal plasma extracellular vesicles and the lipid nanoparticles through three freeze-thaw cycles, each of which includes: freezing at -80°C for 14-16 minutes and then thawing at 37°C for 14-16 minutes.
5. The application according to claim 4, characterized in that, The mRNA or the estrogen receptor regulatory composition upregulates the expression of ERα protein.
6. The application according to claim 4, characterized in that, The drug is administered via intrauterine injection.
7. The application according to claim 4, characterized in that, The drug is formulated as a uterine irrigation preparation.
8. The application according to claim 4, characterized in that, The drug is loaded in a uterine cavity support device.
9. The application according to claim 4, characterized in that, The drug is loaded into a biodegradable anti-adhesion barrier material.
10. The application according to claim 4, characterized in that, The drug is used in combination with estrogen.