Method for regulating the viscosity of a starch paste

Abstract

This invention discloses the application of phosphogluconate-water dual kinase GWD3 as a target in regulating starch gelatinization viscosity and / or storage starch content in plants. Knocking out the MeGWD3 gene in the cassava chromosome can increase starch gelatinization viscosity and / or storage starch content. Therefore, the GWD3 gene can be used to create high-quality root and tuber crop varieties, providing a genetic resource for breeding new root and tuber crop varieties with high starch gelatinization viscosity and / or storage starch content.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to the application of phosphoglucan-water dual kinase GWD3 as a target in regulating the gelatinization viscosity of plant starch and / or the content of stored starch in plants. Background Technology

[0002] Cassava (Manihot esculenta Crantz) is a tuberous, perennial shrub belonging to the Euphorbiaceae family. Native to the Amazon River basin in South America, it is an important staple food in subtropical and tropical regions of Africa, Asia, and South America. It possesses typical tropical characteristics such as high photosynthetic efficiency, high starch yield, and tolerance to poor soil. Although a C3 plant, cassava exhibits a very high photosynthetic rate compared to other crops. At a suitable temperature of 30-35℃, its carbon assimilation rate is approximately 43 mmol CO2 / m³. 2 / s, approaching or exceeding the highest assimilation rate of C4 plants such as maize, sweet potato, and sorghum. Cassava storage roots (tuberous roots) are the most important economic part of cassava, with a high starch content (accounting for 70%-90% of dry weight), making them an important raw material for grain reserves and biomass energy development in my country's tropical regions.

[0003] Currently, the demand for modified starch is gradually increasing to meet specific production and living needs. Previously, people would use physical, chemical, or enzymatic methods to treat natural starch, introducing new functional groups onto the starch molecules or altering the size of starch molecules and the properties of starch granules, thereby changing the natural properties of starch to improve its performance and make it suitable for specific applications. Gelatinized starch, in particular, has a wide range of uses. Starch gelatinization generally refers to mixing starch with water and heating it to a certain temperature, causing the starch granules to swell and collapse, forming a viscous, uniform, transparent paste solution. Gelatinized starch, with its thickening, stability, and binding properties, plays an important role in the food, pharmaceutical, textile, and paper industries.

[0004] However, the acquisition of starch with high gelatinization viscosity is often limited to artificial modification after starch production, which is usually time-consuming and labor-intensive. Cassava varieties capable of directly producing high gelatinization viscosity starch have not yet been explored and researched. Therefore, it is necessary to utilize laboratory molecular biology techniques to deeply analyze the cassava starch metabolic pathway and identify genes that play a decisive role in the physicochemical properties of starch. This would allow for the creation of a new cassava variety capable of directly producing high gelatinization viscosity starch from the root of genetic improvement, possessing practical value for production and daily life applications. Summary of the Invention

[0005] In our research on cassava starch improvement, our group utilized laboratory molecular biology techniques to analyze the metabolic pathways of cassava starch and identify genes that play a decisive role in the physicochemical properties of starch. Since starch phosphorylation is the only covalent modification of starch, it plays a crucial role in starch catabolism. Phosphoglucan-water dikinase (GWD3) can catalyze the phosphorylation of glucan at the C3 position even after α-glucan-water dikinase (GWD1) has phosphorylated at the C6 position, making it an important enzyme component in starch catabolism. We attempted to verify its biological function through interference mutations in the key gene MeGWD3, using cassava genetic transformation technology, starch physicochemical property analysis, and field pilot tests. This fundamentally overcomes the technical challenge of not yet having cassava germplasm capable of directly producing high-gelatinization viscosity starch. Specifically, this invention provides the following technical solution.

[0006] This invention mainly provides the application of phosphoglucan-water dikinase (GWD3) as a target in regulating the gelatinization viscosity of plant starch and / or the content of stored starch in plants.

[0007] In one specific embodiment, the aforementioned GWD3 is MeGWD3 (GenBank No. KAG8654929.1 or OAY51179.1, LOC110615148, amino acid sequence as shown in SEQ NO:2, and CDS region sequence of the expression gene coding region as shown in SEQ NO:1) or its homologous protein, wherein the amino acid sequence of the homologous protein has more than 60%, preferably more than 65%, preferably more than 70%, preferably more than 75%, more preferably more than 80% homology (identity) with SEQ NO:2, and has the function of phosphoglucan-water dual kinase.

[0008] Preferably, the above-mentioned plants are crops that express GWD3 and produce stored starch, and the crops are selected from the group consisting of: cassava, sweet potato, yam, potato, sugar beet, yam, taro, corn, rice, wheat, sorghum, soybean and other cash crops, especially root and tuber crops.

[0009] In one embodiment, the above application is a method for increasing starch gelatinization viscosity and / or storage starch content by targeting the GWD3 gene, comprising the following steps: downregulating, inactivating, weakening or knocking out the expression of the GWD3 gene in the chromosomes of wild-type plants.

[0010] Optionally, increasing the gelatinized viscosity of plant starch and / or the storable starch content can be achieved by the following methods:

[0011] (1) Knock out the GWD3 gene in the chromosomes of wild-type plants;

[0012] (2) Downregulate the expression level of the gene GWD3 in the chromosomes of wild-type plants;

[0013] (3) Replace the GWD3 gene in the chromosome of wild-type plants with a GWD3 mutant that has lost or downregulated coding function; and / or

[0014] (4) Block, inhibit or interfere with the expression of the GWD3 gene in the chromosomes of wild-type plants.

[0015] Furthermore, the above method (2) can be selected from the following group:

[0016] (2-1) Mutations in the promoter region and / or coding region of the GWD3 gene lead to downregulation of the expression level of the GWD3 gene;

[0017] (2-2) Mutations in upstream regulators of the GWD3 gene lead to downregulation of GWD3 expression levels; or

[0018] (2-3) Introduce GWD3 interacting proteins into wild-type plants to alter the function of the GWD3 gene.

[0019] Optionally, the mutation in the coding region described in the above method (2-1) is a frameshift mutation, which leads to GWD3 inactivation or loss of function.

[0020] Preferably, the above methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

[0021] While it is theoretically possible to improve seed germination tolerance by overexpressing exogenous gene GWD3 mutants in plants, such as plants, to achieve mutations in the plant genome, considering that overexpression of exogenous genes often leads to abnormalities in plant physiological homeostasis, the steps of downregulating, inactivating, weakening or knocking out GWD3 expression in the chromosomes of wild-type plants are preferably implemented through gene editing technology, antisense nucleic acids, and transcriptional regulation.

[0022] In another embodiment, the above application is a method for reducing starch gelatinization viscosity and / or storage starch content by targeting GWD3, characterized by the following steps: overexpressing endogenous or exogenous GWD3 genes in wild-type plants.

[0023] Alternatively, overexpression of phosphoglucan-water dual kinase GWD3, such as MeGWD3, can be achieved in the following manner:

[0024] A. The gene encoding phosphoglucan-water dual kinase (GWD3), such as MeGWD3 (nucleotide sequence SEQ ID NO: 1), is cloned into a plasmid vector, preferably into a plasmid vector suitable for expression in Agrobacterium, to form a recombinant plasmid, i.e., a GWD3 overexpression vector. Then, plant cells or tissues are transformed using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, or Agrobacterium-mediated transformation. The transformed plant tissues are then cultured into plants, preferably transformed using Agrobacterium-mediated transformation, to obtain transgenic plants overexpressing phosphoglucan-water dual kinase, such as MeGWD3; or

[0025] B. By using gene editing technology, the gene encoding phosphoglucan-water dual kinase (GWD3), such as MeGWD3 (with the nucleotide sequence SEQ ID NO:1), is cloned into a plant chromosome to obtain transgenic plants overexpressing phosphoglucan-water dual kinase (GWD); or

[0026] C. Place existing phosphoglucan-water dual kinases (GWD3), such as MeGWD3, in the plant genome under the regulation of enhanced promoters, such as the cauliflower mosaic virus (CAMV) 35S promoter or the ubiquitin promoter, i.e., the Ubi promoter.

[0027] The aforementioned Agrobacterium species include, for example, Agrobacterium tumefaciens, Agrobacterium EHA105, Agrobacterium GV3101, and Agrobacterium LBA4404. For instance, the recombinant plasmid can be transferred into an Agrobacterium strain using a freeze-thaw method to form an engineered microbial bacterium.

[0028] Furthermore, the plasmid vector mentioned in step A above is selected from binary Agrobacterium vectors and vectors that can be used for plant microbombardment. The plasmid vectors are, for example, vectors used for plant transgenic purposes or modified vectors such as pHB-YFP, pHB-FLAG, pBin19, pUN1301, fluorescent reporter vectors pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, or pTF102.

[0029] Preferably, the gene editing technology described above can be selected from the group consisting of: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0030] In one implementation, the above application involves using the GWD3 gene as a target to breed new root and tuber crop varieties with high starch gelatinization viscosity and / or high storage starch content.

[0031] This invention newly discovered that cassava phosphoglucan-water dual kinase MeGWD3 negatively regulates starch gelatinization viscosity and storage starch content. Knocking out the MeGWD3 gene in the cassava chromosome can increase starch gelatinization viscosity and storage starch content. Therefore, the GWD3 gene can be used to create high-quality root and tuber crop varieties, providing a gene resource for breeding new root and tuber crop varieties with high starch gelatinization viscosity and / or storage starch content, and has promising prospects for promotion and application. Attached Figure Description

[0032] Figure 1 A schematic diagram of the structure of the RNAi binary expression vector MeGWD3-RNAi containing a hairpin structure is shown.

[0033] Figure 2 The image shows a Southern blot image used to identify the copy number of the foreign gene insertion in MeGWD3-RNAi transgenic cassava. In this identification, Southern blot was used to determine the copy number of the foreign gene insertion in MeGWD3-RNAi transgenic cassava. Genomic DNA was digested with HindIII and XbaI enzymes, and the probe was the hygromycin phosphotransferase gene *hpt*.

[0034] Figure 3 The results show the comparative identification of transcriptional levels in MeGWD3-RNAi transgenic cassava. A and B: Real-time PCR was used to detect the expression levels of MeGWD3 transcription in leaves (A) and storage roots (B) of wild-type and MeGWD3-RNAi transgenic cassava. All results shown in the figure are the mean ± standard deviation of three biological replicates and three experimental replicates. * indicates a significant difference between MeGWD3-RNAi transgenic cassava and wild-type cassava as determined by Student's t-test (* < 0.01). <P<0.05;**0.001<P<0.01;***P<0.001)。

[0035] Figure 4 The images show Western blot images used to identify protein levels in MeGWD3-RNAi transgenic cassava. In this identification, the Western blot method was used to detect the expression levels of MeGWD3 protein in wild-type and MeGWD3-RNAi transgenic cassava leaves (A) and storage roots (B), with β-Actin as an internal control.

[0036] Figure 5This paper shows a comparison of field phenotypes between wild-type and MeGWD3-RNAi transgenic cassava. A: Field phenotypes of wild-type and MeGWD3-RNAi transgenic cassava. The first row shows the field phenotype of the whole plant, and the second row shows the field phenotype of the storage roots. B and F: Plant height (B, n≥6), storage root weight (C, n≥6), storage root length (D, n≥6), storage root diameter (E, n≥6), and number of storage roots (F, n≥6) for wild-type and MeGWD3-RNAi transgenic cassava, respectively.

[0037] Figure 6 The gelatinization curves of storage starch from wild-type and MeGWD3-RNAi transgenic cassava are compared. The gelatinization characteristics of 5% cassava starch were analyzed using a rapid viscosity analyzer. The results shown in the figure are the average of three biological replicates and three experimental replicates.

[0038] Figure 7 The figure shows a comparison of starch content in storage roots of wild-type and MeGWD3-RNAi transgenic cassava at different developmental stages. FR: fibrous roots, DR: developing roots, MR: mature roots. All results shown are mean ± standard deviation of three biological replicates and three experimental replicates. * indicates a significant difference between MeGWD3-RNAi transgenic cassava and wild-type cassava as determined by Student's t-test (* < 0.01). <P<0.05;**0.001<P<0.01;***P<0.001)。

[0039] Figure 8 This image shows a comparison of the properties of storage starch from wild-type and MeGWD3-RNAi transgenic cassava. A: Phenomorphological observation of storage starch granules from wild-type and MeGWD3-RNAi transgenic cassava. Images are from scanning electron microscopy, scale bar: 10 μm. B: Particle size distribution of storage starch from wild-type and MeGWD3-RNAi transgenic cassava. The results shown are the average of three biological replicates and three experimental replicates.

[0040] Figure 9 This image shows a comparison of starch morphology in the storage roots of wild-type and MeGWD3-RNAi transgenic cassava. The images are from transmission electron microscopy (TEM) observations; scale bar: 10 μm.

[0041] Figure 10 The comparison of amylose content in storage starch of wild-type and MeGWD3-RNAi transgenic cassava is shown. All results shown in the figure are the mean ± standard deviation of three biological replicates and three experimental replicates. Detailed Implementation

[0042] We cloned the MeGWD3 gene from cassava for the first time. By constructing MeGWD3 overexpression and RNAi vectors and stably transforming cassava callus tissue using Agrobacterium-mediated transformation, we obtained MeGWD3 RNAi transgenic cassava. Wild-type and MeGWD3 transgenic cassava were then tested in the field to observe their phenotypes. Subsequently, we used molecular biology techniques to investigate the effect of MeGWD3 interference on the gelatinization viscosity characteristics of cassava storage root starch, confirming that this interference can produce a starch line with high gelatinization viscosity. Further analysis of the effects of MeGWD3 interference on other basic starch properties confirmed that this high-gelatinization starch line meets the requirements in terms of starch properties and yield, demonstrating the feasibility of this method.

[0043] Research reports on the GWD3 homolog are limited, with studies currently only conducted in plants such as Arabidopsis thaliana, rice, and potato. Furthermore, there are no reports on its role in regulating starch gelatinization viscosity. We have cloned the MeGWD3 gene from cassava for the first time. Through cassava genetic transformation, starch physicochemical property analysis, and field trials, we validated its biological function. Our results demonstrate that by reducing the expression of this gene, we can increase the gelatinization viscosity of starch while maintaining a certain yield, thus obtaining a new cassava line with high gelatinization starch characteristics. This line possesses absolute advantages in terms of varietal and technological aspects due to its thickening, stability, and binding properties, and has broad application prospects in the food, pharmaceutical, textile, and paper industries.

[0044] Based on the function of cassava phosphoglucan-water dual kinase MeGWD3 in negatively regulating starch gelatinization viscosity and storage starch content, it is reasonable to expect that wild-type plants, especially root and tuber crops, that express protein GWD3 and produce storage starch may have increased starch gelatinization viscosity and / or storage starch content in their mutant strains after the GWD3 gene is knocked out or its expression is suppressed; conversely, the starch gelatinization viscosity and / or storage starch content of mutant strains that overexpress the GWD3 gene may decrease.

[0045] As used in this article, the term "wild-type (WT)" refers to the original plant with a normal phenotype and expressing the normal GWD3 gene. Correspondingly, the terms "plant mutant," "plant mutant strain," "transgenic plant," and "genetically engineered plant" in this article have the same meaning, all referring to genetically engineered plants that have undergone GWD3 gene knockout / suppression or overexpression of the GWD3 gene, either from wild-type plants or original plants with a normal phenotype.

[0046] In some implementations, the terms "(starch gelatinization viscosity and / or storage starch content) increase" or "enhancement" may mean an increase of at least 10% compared to a reference level (e.g., normal plant), such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100% of the reference level, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times of the reference level.

[0047] Conversely, the terms "(starch gelatinization viscosity and / or storage starch content) decrease" or "reduction" can mean a decrease of at least 10% relative to a reference level (e.g., normal plant), such as a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100% of the reference level, or any decrease between 10% and 100%, or a decrease of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times of the reference level.

[0048] In this document, for the sake of simplicity, the names of a protein, such as GWD3, and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, for MeGWD3, when describing the function or class of phosphoglucan-water dual kinase, it refers to the protein (GenBank ID KAG8654929.1 or OAY51179.1); when used as a gene description, it refers to the gene encoding the protein (LOC110615148).

[0049] There are various techniques for inactivating, attenuating, and / or preventing the expression of GWD3 genes, such as MeGWD3, in plants. These techniques can be used individually or in combination. For example, one inactivation method is to mutate the GWD3-encoding gene, altering the amino acid sequence of the polypeptide and / or terminating translation. Similarly, there are various techniques for overexpressing GWD3 genes, such as MeGWD3, in plants. These techniques can be used individually or in combination.

[0050] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0051] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.

[0052] Example

[0053] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0054] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0055] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0056] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0057] The primer synthesis and gene sequencing in this embodiment were commissioned to Sangon Biotech (Shanghai) Co., Ltd. and BGI Genomics.

[0058] Molecular biology methods and transgenic plant construction methods, including the construction of RNAi vectors with MeGWD3 gene knockout (i.e., CRISPR-Cas9 system plasmids) and gene editing technologies, are carried out using techniques commonly used in this field.

[0059] plant materials

[0060] The wild-type cassava (TMS60444) and MeGWD3-RNAi transgenic cassava used in this study were preserved in our laboratory.

[0061] plasmid

[0062] The CRISPR-Cas9 vectors pBSRNAi (Ampr) and pP35RNAi (Kanr) used in this project were constructed and preserved in our laboratory.

[0063] These plasmids and MeGWD3-RNAi transgenic cassava may be obtained by any organization or individual for the purpose of verifying this invention, but may not be used for other purposes, including development, scientific research and teaching, without the permission of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences.

[0064] strain

[0065] Escherichia coli: DH5α;

[0066] Agrobacterium: LBA4404.

[0067] Experimental protocol

[0068] (1) The MeGWD3-RNAi vector was constructed and cassava callus was stably transformed using Agrobacterium-mediated transformation to obtain MeGWD3-RNAi transgenic cassava.

[0069] (2) Wild-type and MeGWD3 transgenic cassava were tested in the field to observe the phenotype.

[0070] (3) The effects of MeGWD3 interference on the gelatinization viscosity characteristics of cassava storage root starch were investigated using molecular biology techniques, and it was determined that this interference could produce starch varieties with high gelatinization viscosity.

[0071] (4) Further analysis of the effects of MeGWD3 interference on other basic properties of starch confirmed that the high gelatinization starch strain meets the requirements in terms of starch properties and starch yield, and the creation method is feasible.

[0072] Example 1: Screening, cloning, and sequence analysis of the MeGWD3 gene

[0073] Our research group, in studying the mechanisms of cassava starch synthesis and degradation, has identified genes that play a decisive role in the physicochemical properties of starch based on the analysis of cassava starch metabolic pathways. Since starch phosphorylation is the only covalent modification of starch, it plays a crucial role in starch catabolism. Our study found that phosphoglucan-water dikinase (GWD3) can catalyze the phosphorylation of dextran at the C3 position even after α-glucan-water dikinase (GWD1) has already phosphorylated the C6 position, suggesting that GWD3 is an important enzymatic component in the starch catabolism process.

[0074] To clone the corresponding homologous gene in cassava, we first used the AtGWD3 (AT5G26570) sequence from Arabidopsis thaliana as a reference and searched its amino acid sequence in the Phytozome database (https: / / phytozome-next.jgi.doe.gov / ) using Blast to obtain its corresponding homologous clone MeGWD3 (Manes.05G194300v8). It encodes cassava phosphoglucan-water dikinase (GWD3), which can catalyze phosphorylation at the C3 position of glucan. The full-length coding region of the gene is 3522 bp (as shown in SEQ NO:1) and encodes 1173 amino acids (as shown in SEQ NO:2).

[0075] The following examples focus on the relationship between the MeGWD3 gene and starch gelatinization viscosity and storage starch content.

[0076] Example 2: Construction of the gene knockout MeGWD3-RNAi vector and obtaining transgenic cassava

[0077] Sequence alignment of MeGWD family members was performed to identify the specific region in MeGWD3 that distinguishes it from other MeGWD family members. The interference fragment of MeGWD3 is 484 bp in length (as shown in SEQ NO:3). The specific region of MeGWD3 was amplified using specific primers containing KpnI and ClaI, and XhoI and BamHI restriction sites, respectively. The corresponding fragment in pBSRNAi was then replaced with the target fragment amplified using KpnI and ClaI specific primers, and XhoI and BamHI specific primers, respectively. The hairpin structure constructed on the pBSRNAi vector was then replaced with the pP35RNAi expression vector using double digestion with KpnI and BamHI, thus obtaining the RNAi expression vector MeGWD3-RNAi. Figure 1 The final RNAi expression vector, MeGWD3-RNAi, was introduced into Agrobacterium. PCR and enzyme digestion verification were performed before and after the introduction to ensure the correctness of the constructed vector. The constructed MeGWD3-RNAi vector was transformed into Agrobacterium LBA4404, and then Agrobacterium was used to infect brittle suspension callus of cassava. Positive plants were obtained from the infected callus tissue through regeneration and selection. The MeGWD3-RNAi transgenic cassava was designated as GWD3RNAi, abbreviated as G3i.

[0078] The pBSRNAi vector uses the existing plasmid pRNAi-dsAC1, which has been disclosed in the literature (Dose-dependent RNAi-mediated geminivirus resistance in the tropical root crop cassava. Herve ′ Vanderschuren, et al., Plant Mol Biol (2009) 70: 265-272. DOI 10.1007 / s11103-009-9472-3.).

[0079] The construction method of the MeGWD3-RNAi vector is briefly described below:

[0080] Sequence alignment was performed on members of the MeGWD family to identify the specific region in which MeGWD3 differs from other MeGWD family members. The interference fragment of MeGWD3 is 484 bp in length (from 2577 to 3061 bp, see supplementary content for sequence). The AC1 sequence in the vector pBSRNAi (pRNAi-dsAC1) was replaced with the amplified 484 bp target fragment. The specific method is as follows:

[0081] The target fragment was amplified using primers containing KpnI and ClaI sites (GWD3Ri-FP KpnI:CGGGGTACCGCCTGTGGTCGTTTAGCCTCTTTGG, GWD3Ri-RP ClaI:CCATCGATACACACCAGCAGCTCGACGG), and then the same fragment was amplified as an inverted repeat sequence using specific primers containing XhoI and BamHI restriction sites (GWD3Ri-FP XhoI:CGCGGATCCGCCTGTGGTCGTTTAGCCTCTTTGG, GWD3Ri-RP BamHI:CCGCTCGAGACACACCAGCAGCTCGACGG). The amplified fragments from pBSRNAi were then replaced with the target fragment using double restriction sites of KpnI and ClaI, and XhoI and BamHI, respectively. After the first fragment replacement, colony PCR was used to select single clones for sequencing to verify fragment correctness. After the inverted repeat fragment replacement, single clones were selected using PCR with outer primers or intron primers (RNAi vector intron primers IFP: TGCATGATATCATAAAACCATGGCGC, IRP: TTTTTGGCTAACATTTTCCATGGTTT). Plasmids were extracted (plasmid extraction kit, Tiangen, Beijing, DP105), and the correctness of the constructed hairpin structures was verified by restriction enzyme digestion and PCR. The hairpin structures constructed on the intermediate vector were replaced into pP35RNAi by double digestion with KpnI and BamHI to construct the final RNAi expression vector. All vectors were verified by PCR and restriction enzyme digestion before and after introduction into *Agrobacterium tumefaciens*.

[0082] Primer sequences:

[0083] GWD3Ri-FP KpnI:CGGGGTACCGCCTGTGGTCGTTTAGCCTCTTTGG

[0084] GWD3Ri-RP ClaI:CCATCGATACACACCAGCAGCTCGACGG

[0085] GWD3Ri-FP XhoI:CGCGGATCCGCCTGTGGTCGTTTAGCCTCTTTGG

[0086] GWD3Ri-RP BamHI:CCGCTCGAGACACACCAGCAGCTCGACGG

[0087] The PCR reaction conditions are as follows:

[0088] PCR reaction system

[0089]

[0090] PrimeSTAR Max Premix (2X) Kit: TaKaRa, Dalian, China (Code No. R045A).

[0091] PCR reaction conditions: 98℃ for 10s, 55℃ for 15s, 72℃ for 30-60s / kb, 35 cycles.

[0092] Agarose gel PCR product recovery

[0093] The operating procedure is described in the kit instructions.

[0094] Agarose gel DNA recovery kit: Tianjin, Beijing, China (Code No. DP209).

[0095] Double enzyme digestion reaction conditions:

[0096] Double enzyme digestion system

[0097]

[0098] 37℃, 2h.

[0099] Restriction endonucleases (TaKaRa, Dalian, China):

[0100] KpnI: Takara Code, 1605; ClaI: Takara Code, 1608; XhoI: Takara Code, 1635; BamHI: Takara Code, 1615.

[0101] PCR fragment ligation reaction conditions:

[0102]

[0103] 16°C, overnight ligation. T4 DNA Ligase: TaKaRa Code, D2011A.

[0104] Example 3: Molecular identification of MeGWD3-RNAi transgenic cassava

[0105] 1. Four positive transgenic cassava lines (G3i-6, G3i-10, G3i-12, and G3i-29) were obtained through Agrobacterium-mediated transformation of cassava suspension callus. Molecular analysis was performed on these transgenic cassava lines. Southern blotting was used to determine the copy number of the exogenous gene insertion in the MeGWD3-RNAi transgenic cassava lines. The results showed that G3i-6 and G3i-29 transgenic cassava lines were multiple copies, while G3i-10 and G3i-12 transgenic cassava lines were single copies. Figure 2 ).

[0106] 2. Real-time PCR was used to detect the transcriptional expression level of MeGWD3 in wild-type and MeGWD3-RNAi transgenic cassava leaves and storage roots. The results showed that the expression level of MeGWD3 in both MeGWD3-RNAi transgenic cassava leaves and storage roots was significantly lower than that in wild-type, with the expression level in roots decreasing by more than 90%. Figure 3 ).

[0107] 3. Western blot was used to further detect the expression levels of MeGWD3 protein in the leaves and storage roots of wild-type and transgenic cassava. The results showed that compared with wild-type, the protein level of MeGWD3 in the leaves and storage roots of MeGWD3-RNAi transgenic cassava was reduced below the detection level, almost undetectable, further indicating that the protein level of MeGWD3 in MeGWD3-RNAi transgenic cassava was significantly inhibited. Figure 4 ).

[0108] Example 4: Field phenotypic observation of MeGWD3-RNAi transgenic cassava

[0109] To further investigate the effects of MeGWD3 interference on cassava plants and yield, we conducted a field pilot experiment at the Wushe Farm, Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. After six months of cultivation, materials grown at Wushe Farm were harvested in mid-November. The phenotypes of wild-type and MeGWD3-RNAi transgenic cassava were observed, and physiological phenotypes such as plant height, storage root weight, storage root length, storage root diameter, and number of storage roots were measured. The results showed that both wild-type and MeGWD3-RNAi transgenic cassava plants grew well in the field. The length and diameter of the storage roots in MeGWD3-RNAi transgenic cassava were not significantly different from those in wild-type plants, and the yield was only slightly reduced, which was less than the impact of mutations in other starch metabolism pathways on yield. Figure 5 ).

[0110] Example 5: Reducing MeGWD3 expression to increase the gelatinized viscosity of stored starch

[0111] The gelatinization properties of starch are an important indicator of starch quality. Gelatinized starch possesses many excellent properties, such as thickening, stability, and binding properties, and therefore has wide applications in the food, pharmaceutical, textile, and paper industries. To investigate the effect of MeGWD3 on the gelatinization properties of storage starch, we used a Rapid Visco Analyzer (RVA) to determine the gelatinized viscosity of wild-type and MeGWD3-RNAi transgenic cassava storage starch. The experimental results showed that the viscosity of wild-type storage starch reached its maximum at approximately 4.15 min, while the viscosity of MeGWD3-RNAi transgenic cassava storage starch reached its maximum later than that of wild-type storage starch. The peak viscosity range of MeGWD3-RNAi transgenic cassava storage starch was 973-1054 cP, which was higher than the peak viscosity of 893 cP for wild-type storage starch. Hot paste viscosity reflects the shear resistance of starch at high temperatures. The hot paste viscosity range of MeGWD3-interferenced storage starch is 638-752 cP, higher than the 485 cP of wild-type storage starch. Furthermore, MeGWD3 interference also affects the final viscosity of storage starch, with a range of 1128-1306 cP, higher than the 861 cP of wild-type storage starch. The retrogradation value (489-558 cP) of MeGWD3-RNAi transgenic cassava storage starch also differs from that of wild-type storage starch (386 cP) (Table 1). These results indicate that the gelatinized viscosity of transgenic MeGWD3-RNAi cassava starch is significantly improved, which will greatly expand the applications of cassava starch.

[0112] Table 1. Gelatinization viscosity characteristics of storage starch from wild-type and MeGWD3-RNAi transgenic cassava

[0113]

[0114] Note: The results shown in the table are the mean ± standard deviation of three biological replicates and three experimental replicates. * indicates the significance of the difference between MeGWD3-RNAi transgenic cassava and wild type by Student's-test (* 0.01). <P<0.05;**0.001<P<0.01;***P<0.001)。

[0115] Example 6: The effect of reduced MeGWD3 expression on the gelatinization thermodynamic properties of storage starch

[0116] To investigate the effect of MeGWD3 on the gelatinization thermodynamics of storage starch, we used differential scanning calorimetry (DSC) to determine the gelatinization thermodynamic properties of storage starch. The results showed that compared to the wild type, the gelatinization initiation temperature (To) of MeGWD3-RNAi transgenic cassava storage starch increased, while the peak temperature (Tp) decreased. This result may be due to the altered microstructure of starch molecules caused by MeGWD3 interference. Furthermore, the enthalpy change (ΔH) during gelatinization of MeGWD3-RNAi transgenic cassava storage starch generally decreased compared to the wild type. ΔH is closely related to the crystallinity of starch, indicating that MeGWD3 may affect the crystallinity of storage starch. Figure 6 (See Table 1). The above results indicate that MeGWD3 can affect the gelatinization thermodynamic properties and crystallinity of starch to a certain extent.

[0117] Table 2. Thermodynamic parameters of storage starch in wild-type and MeGWD3-RNAi transgenic cassava

[0118]

[0119] Note: To: initial temperature; Tp: peak temperature; Tc: final temperature; ΔH: enthalpy of gelatinization. The results shown in the table are the mean ± standard deviation of three biological replicates and three experimental replicates. * indicates a significant difference between MeGWD3-RNAi transgenic cassava and wild-type cassava, as determined by the Student's-test (* 0.01). <P<0.05;**0.001<P<0.01;***P<0.001)。

[0120] Example 7: Reducing MeGWD3 expression promotes increased storage starch content

[0121] We anticipated improving the gelatinization viscosity of starch without reducing the amount of starch produced through starch synthesis; therefore, we determined the storage starch content in storage roots. We collected fibrous roots (FR), developing roots (DR), and mature roots (MR) from wild-type and MeGWD3-RNAi transgenic cassava, and used a Total Starch (K-TSTA, Megazyme, Ireland) kit to determine the storage starch content in these three root types. The results showed that the starch content in the fibrous roots, developing roots, and mature roots of MeGWD3-RNAi transgenic cassava was significantly higher than that in the wild-type roots. This indicates that interference with MeGWD3 leads to the accumulation of storage starch, which aligns with our goal of obtaining a cassava line with high gelatinization viscosity without affecting starch yield.

[0122] Example 8: MeGWD3 does not affect the morphology of stored starch.

[0123] We anticipated improving the gelatinization viscosity of starch without affecting other fundamental properties of starch granules. Therefore, we further investigated whether interference with MeGWD3 affected the morphology of storage starch granules. We extracted storage starch from wild-type and MeGWD3-RNAi transgenic cassava and observed the morphology of storage starch granules using scanning electron microscopy (SEM). The results showed that both wild-type and MeGWD3-RNAi transgenic cassava storage starch granules exhibited the bell-shaped morphology characteristic of cassava. Overall, the size of MeGWD3-RNAi transgenic cassava storage starch granules was not significantly different from that of wild-type storage starch granules. Furthermore, to more accurately study the size of storage starch granules, we used a Master-size 2000 laser diffractometer (Malvern Instruments Ltd, Worcestershire, UK) and employed a wet method to determine the particle size of the storage starch granules. The experimental results showed that there was no difference in the particle size of storage starch granules between wild-type and MeGWD3-RNAi transgenic cassava, with most storage starch granules having a particle size of 3.33-42.79 μm, consistent with the results observed by scanning electron microscopy.

[0124] Example 9: MeGWD3 does not affect the internal structure of stored starch.

[0125] To further investigate the effect of MeGWD3 on the internal structure of stored starch, we collected storage roots from wild-type cassava and MeGWD3-RNAi transgenic cassava of the same growth period and thickness, and observed the internal structure of stored starch using transmission electron microscopy. The results showed that the internal structure of stored starch in MeGWD3-RNAi transgenic cassava was not significantly different from that in wild-type cassava, indicating that MeGWD3 does not affect the internal structure of stored starch.

[0126] Example 10: Effect of MeGWD3 on amylose content

[0127] Starch includes amylose and amylopectin. We hoped that our obtained MeGWD3-RNAi transgenic cassava would only affect the gelatinization viscosity of the starch without significantly impacting other starch properties. Therefore, the amylose content of the starch was also determined. To investigate the effect of MeGWD3 on amylose content, we used a cuvette method to determine the amylose content in the storage starch of wild-type and MeGWD3-RNAi transgenic cassava. The results showed that the amylose content in the storage starch of MeGWD3-RNAi transgenic cassava was not significantly different from that in the storage starch of wild-type cassava, with amylose accounting for approximately 20% of the storage starch content in both cases. This indicates that MeGWD3 does not affect the amylose content in storage starch.

[0128] In summary, this invention is the first to clone the MeGWD3 gene from cassava, construct a gene interference system, and verify its biological function through cassava genetic transformation technology, starch physicochemical property analysis, and field pilot tests. This invention achieves the improvement of starch properties in cassava storage roots, constructs a new cassava variety capable of producing starch with high gelatinization viscosity, and has minimal impact on cassava yield. It is feasible to apply to the industrial production of large-scale modified starch and has an absolute advantage in terms of variety and technology.

[0129] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of phosphogluconate-water dual kinase (GWD3) as a target in regulating the gelatinization viscosity of plant starch and / or the content of stored starch in plants.

2. The application as described in claim 1, characterized in that, The GWD3 is a cassava-derived GWD3, namely MeGWD3 (GenBank No. KAG8654929.1 or OAY51179.1), or its homologous protein, wherein the amino acid sequence of the homologous protein is more than 60% identical to SEQ NO:2 and has the function of phosphoglucan-water dual kinase.

3. The application as described in claim 1, characterized in that, The plant is a crop that expresses GWD3 and produces stored starch, and the crop is selected from the group consisting of: cassava, sweet potato, yam, potato, sugar beet, yam, taro, corn, rice, wheat, sorghum, and soybean.

4. The application as described in claim 1, wherein the application is a method for increasing starch gelatinization viscosity and / or storage starch content by targeting the GWD3 gene, characterized in that, Includes the following steps: It can downregulate, inactivate, weaken, or knock out the GWD3 gene expression in the chromosomes of wild-type plants.

5. The application as described in claim 4, characterized in that, Increasing the gelatinized viscosity and / or storage starch content of plant starches can be achieved through the following methods: (1) Knock out the GWD3 gene in the chromosomes of wild-type plants; (2) Downregulate the expression level of the gene GWD3 in the chromosomes of wild-type plants; (3) Replace the GWD3 gene in the chromosome of wild-type plants with a GWD3 mutant that has lost or downregulated coding function; and / or (4) Block, inhibit or interfere with the expression of the GWD3 gene in the chromosomes of wild-type plants.

6. The application as described in claim 5, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the GWD3 gene lead to downregulation of the expression level of the GWD3 gene; (2-2) Mutations in upstream regulators of the GWD3 gene lead to downregulation of GWD3 expression levels; or (2-3) Introduce GWD3 interacting proteins into wild-type plants to alter the function of the GWD3 gene.

7. The application as described in claim 5, characterized in that, The methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

8. The application as described in claim 1, wherein the application is a method for reducing starch gelatinization viscosity and / or storage starch content by targeting GWD3, characterized in that, Includes the following steps: This induces overexpression of the endogenous or exogenous GWD3 gene in wild-type plants.

9. The application as described in claim 1, characterized in that, The overexpression of phosphoglucan-water dual kinase, GWD3, is achieved through the following method: A. The gene encoding phosphoglucan-water dual kinase (GWD3) is cloned into a plasmid vector to form a recombinant plasmid, i.e., a GWD3 overexpression vector. Then, plant cells or tissues are transformed using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, or Agrobacterium-mediated transformation. The transformed plant tissues are then cultured into plants to obtain transgenic plants overexpressing phosphoglucan-water dual kinase; or B. By cloning the gene encoding phosphoglucan-water dual kinase (GWD3) into plant chromosomes using gene editing technology, transgenic plants overexpressing phosphoglucan-water dual kinase (GWD) are obtained; or C. Place the existing phosphoglucan-water dual kinase GWD3 in the plant genome under the regulation of a functionally enhanced promoter.

10. The application as described in claim 1, characterized in that, The GWD3 gene was used as a target to breed new root and tuber crop varieties with high starch gelatinization viscosity and / or high storage starch content.

Images