Use of an inhibitor of rrbp1 protein in the preparation of a product for the protection against lung fibrosis

Abstract

The application discloses application of an RRBPl protein inhibitor in preparation of a product with a protective effect on lung fibrosis, and belongs to the technical field of biological medicines. The product with the protective effect on lung fibrosis refers to a medicine or a recombinant carrier for inhibiting expression of RRBPl protein, and the recombinant carrier contains or carries a polynucleotide for coding RRBPl shRNA. The application further discloses an adeno-associated virus carrier with the protective effect on lung fibrosis and carrying RRBPl shRNA, which is beneficial to protecting lung fibrosis induced by bleomycin, reducing infiltration of myofibroblasts and deposition of extracellular matrix. In-vivo cell experiments find that RRBPl knockdown can inhibit transdifferentiation of human primary lung fibroblasts into myofibroblasts and deposition of extracellular matrix. These results show that RRBPl can be targeted to treat or prevent fibroproliferative diseases. The application provides a new method for treating fibroproliferative diseases.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of RRBP1 protein inhibitors in the preparation of drugs for the treatment or prevention of fibroproliferative diseases. Background Technology

[0002] Fibrosis is a large class of diseases characterized by fibroblast proliferation, massive extracellular matrix accumulation, inflammatory damage, and tissue structural destruction, representing the terminal stage of these diseases. In other words, it involves abnormal repair of damaged normal tissue, leading to structural abnormalities. Pulmonary fibrosis (PF) is an interstitial lung disease of unknown etiology, characterized by rapid progression, extremely poor prognosis, and a very high mortality rate, with no effective treatment available. Its typical pathological features include diffuse interstitial collagen deposition and scar formation, progressive and irreversible alveolar structural destruction, and diffuse fibrosis. Most patients die from respiratory failure due to impaired gas exchange. Common causes include infection, dust, drugs, smoking, and autoimmune diseases. Idiopathic pulmonary fibrosis (IPF) is a type of pulmonary fibrosis of unknown etiology, and is the most common and severe form of pulmonary fibrosis, sometimes exhibiting acute exacerbations. IPF is characterized by the excessive proliferation and collagen deposition of fibroblasts and myofibroblasts (MFBs), which damage lung structure and function. Fibroblasts and MFBs are activated and aggregate in fibroblastic foci, producing excessive extracellular matrix. IPF patients experience a progressive decline in lung function, eventually dying from respiratory failure. The average survival after diagnosis is only 3-5 years, with a 5-year mortality rate exceeding 40%.

[0003] Despite extensive research on fibrosis (including pulmonary fibrosis), its etiology and pathogenesis are not fully understood, and effective treatments remain lacking. Currently, only three drugs are available for IPF: pirfenidone, nintedanib, and nalmilast tablets, but none of them effectively improve patient survival, and all are expensive. Lung transplantation is currently the only treatment that can effectively prolong survival, but its application is also limited by numerous conditions.

[0004] Ribosome-binding protein 1 (RRBP1, Genebank ID: 6238), also known as p180 or ES130, is a highly conserved ribosome-binding protein that plays an important role in various cellular processes, including protein synthesis and post-translational modification. Studies have reported that RRBP1 can be localized near mitochondria during mitochondrial depolarization, regulating MAP1LC3 / LC3 lipidation and influencing mitochondrial protein import stress and autophagy-lysosome formation. Current research on RRBP1 is limited, primarily focusing on tumors such as breast cancer, prostate cancer, and lung cancer. Studies have reported that RRBP1 is overexpressed in lung cancer tissues, and its role in promoting lung cancer is related to the regulation of endoplasmic reticulum stress. Overexpression of RRBP1 can also significantly upregulate KAR2 mRNA levels in yeast (the protein encoded by this gene is homologous to the mammalian BiP / GRP78 molecular chaperone), further confirming RRBP1's involvement in endoplasmic reticulum stress and UPR pathway activation. However, the function and mechanism of RRBP1 in pulmonary fibrosis remain unclear.

[0005] Therefore, it is necessary to provide more effective methods and means to treat or prevent fibrosis. Summary of the Invention

[0006] Based on the problems existing in the prior art, this invention discloses for the first time the application of RRBP1 inhibition in the treatment of pulmonary fibrosis. Through in vitro and in vivo experiments, this invention has found that RRBP1 silencing can inhibit the proliferation of lung fibroblasts, inhibit the transformation of lung fibroblasts into myofibroblasts, and inhibit the deposition of extracellular matrix, indicating that targeted inhibition of RRBP1 can be used to treat or prevent fibroproliferative diseases. This invention provides a new method for the treatment of fibroproliferative diseases.

[0007] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One of the objectives of this invention is to provide the application of substances that inhibit RRBP1 protein expression in the preparation of drugs for the prevention and treatment of fibroproliferative diseases.

[0008] Furthermore, the substance is selected from any one or more of the following: (a) Compounds that inhibit the activity of RRBP1 protein; (b) A polynucleotide that inhibits RRBP1 gene expression or a recombinant vector containing said polynucleotide.

[0009] Furthermore, the polynucleotide is a DNA, RNA, and / or DNA-RNA hybrid that inhibits RRBP1 gene expression.

[0010] Furthermore, the recombinant vector includes viral vectors and / or non-viral vectors.

[0011] Furthermore, the viral vector is any one or more of retroviruses, adenoviruses, adeno-associated viruses, herpes simplex virus, vaccinia virus, baculoviruses, and lentiviruses.

[0012] Furthermore, the viral vector is adeno-associated virus.

[0013] Furthermore, the non-viral vector is any one or more of plasmids, liposomes, reverse transcription elements, transposons, augmentative vectors, cationic polymers, chitosan polymers, inorganic nanoparticles, and exosomes.

[0014] Furthermore, the fibroproliferative disease is any one or more of the following: pulmonary fibroproliferative disease, cardiovascular fibroproliferative disease, liver fibroproliferative disease, kidney fibroproliferative disease, ocular fibroproliferative disease, nervous system fibroproliferative disease, bone marrow fibroproliferative disease, and skin fibroproliferative disease.

[0015] Furthermore, the fibroproliferative disease is pulmonary fibroproliferative disease.

[0016] Furthermore, the pulmonary fibrotic disease is idiopathic pulmonary fibrosis.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention discloses the application of RRBP1 protein reduction in the preparation of drugs for treating pulmonary fibrosis. Products with protective effects against pulmonary fibrosis refer to drugs that inhibit RRBP1 protein expression or recombinant vectors that inhibit RRBP1 protein expression, wherein the recombinant vector inhibiting RRBP1 protein expression comprises a vector containing or carrying a polynucleotide encoding RRBP1 shRNA protein. This invention also discloses an adeno-associated virus serotype 9 (AAV9) vector carrying RRBP1 shRNA that has a protective effect against pulmonary fibrosis. This vector is beneficial in protecting against pulmonary fibrosis induced by BLM, reducing myofibroblast infiltration and extracellular matrix deposition. In vivo cell experiments have shown that RRBP1 knockdown can inhibit the transdifferentiation of human primary fibroblasts into myofibroblasts and the deposition of extracellular matrix. These results indicate that RRBP1 can be targeted to treat or prevent fibroproliferative diseases. This invention provides a new method for the treatment of fibroproliferative diseases. Attached Figure Description

[0018] Figure 1 This shows the expression changes of RRBP1 in lung tissue and MFBs of IPF patients and bleomycin (BLM)-induced pulmonary fibrosis mouse models in Example 1 of the present invention.

[0019] Figure 2This is the result of the effect of knocking down RRBP1 in lung tissue on the severity of pulmonary fibrosis in mice in Example 2 of the present invention.

[0020] Figure 3 This is the result of the effect of TGF-β1 stimulation on RRBP1 expression in human primary lung fibroblasts in Example 3 of the present invention.

[0021] Figure 4 This describes the effect of knocking down RRBP1 on TGF-β1-induced lung fibroblast activation and extracellular matrix in Example 4 of the present invention. Detailed Implementation

[0022] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.

[0023] The RRBP1 siRNA involved in this embodiment of the invention was purchased from Wuhan Jinkairui Biotechnology Co., Ltd.

[0024] The adeno-associated virus serotype 9 (AAV9) vector involved in this invention encodes a short hairpin RNA (shRNA) construct targeting the mouse Rrbp1 gene (GenBank RefSeq number NM_024281; targeting sequence SEQ ID NO.7: GCAGTTCAGTTCTATTGTGAAT; shRNA sequence SEQ ID NO.8: 5'-CCGG-GCAGTCAGTTCTATTGTGAATCTCGAGATTCACAATAGAACTGACTGC-TTTTT-3'), driven by the U6 promoter, and purchased from Weizhen Biotechnology Co., Ltd.

[0025] The BLM involved in this embodiment of the invention was purchased from MedChemExpress (MCE) (Cat#: HY-17565).

[0026] The experimental animals used in this invention embodiment were SPF-grade wild-type C57BL / 6 mice purchased from Guangdong Yaokang Biotechnology Co., Ltd. All animals were bred and housed in the SPF-grade animal facility of the Experimental Animal Center of the First Affiliated Hospital of Guangzhou Medical University. Mice were randomly grouped for experiments at 8-10 weeks of age. All animal use and handling were reviewed and approved by the Experimental Animal Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University.

[0027] The statistical processing methods involved in this embodiment of the invention are as follows: GraphPad Prism 10.0 software is used for statistical analysis and software graphing. The experimental results are expressed as mean ± standard error (Mean ± SEM). The t-test is used to compare the means between two groups of samples, and the one-way ANOVA test is used to compare the means of multiple groups. p < 0.05 is considered statistically significant.

[0028] The technical solution of the present invention will be further described in detail below with reference to the embodiments.

[0029] Example 1: RRBP1 expression was significantly increased in lung tissues of IPF patients and BLM-induced pulmonary fibrosis mice. Lung tissue specimens from IPF patients were all obtained from lung tissue of patients who underwent lung transplantation at the First Affiliated Hospital of Guangzhou Medical University, and were clinically diagnosed as IPF; normal control lung tissue was obtained from lung transplant donor lung tissue from the First Affiliated Hospital of Guangzhou Medical University.

[0030] Establishment of a mouse pulmonary fibrosis model: BLM was administered intratracheally via tracheoendotracheal intubation at a dose of 1.3 mg / kg. The control group received a corresponding dose of physiological saline. Mice were anesthetized by intraperitoneal injection of 1.2% aphthylamine (0.2 ml / 10 g), ensuring the anesthesia was not too deep. The mice were fixed to the surgical table, perpendicular to the surface. The laryngoscope was inserted into the mouse's mouth, and the entire laryngoscope was lifted upwards to expose the glottis. As the glottis opened, a 22 g intravenous catheter was inserted into the trachea, and approximately 0.1 ml of gas was injected into the trachea using a syringe tip. The mouse was observed to ensure it could still breathe normally and evenly. If the mouse experienced brief respiratory arrest, the tracheal intubation was considered successful. Diluted BLM was injected into the trachea, and the mouse's tail was gently pinched to stimulate breathing, further drawing the fluid from the catheter into the lungs. The mouse's body was gently shaken to promote the even distribution of BLM in the lungs.

[0031] Western blotting was used to detect the expression levels of relevant target proteins in lung tissue. The detection method is as follows: (1) Total protein extraction from lung tissue: The frozen lung tissue was taken out of the -80℃ freezer, washed with physiological saline, and dried. The weight of the lung tissue was weighed, and approximately 1 ml of protein lysis buffer was added for every 100 mg of lung tissue. The buffer was placed in a homogenizing tube and homogenized with a high-speed homogenizer until the lysate was a thick soup-like consistency. The mixture was centrifuged in a high-speed refrigerated centrifuge at 4℃ and 12000 rpm for 25 minutes. The supernatant was transferred to a new EP tube for subsequent protein concentration measurement, and the precipitate was discarded.

[0032] (2) Protein concentration determination: Follow the instructions for the Beyotime BCA protein concentration assay kit. Add 20 μl of serially diluted standards. Dilute 2 μl of sample with water 20 times to a total volume of 20 μl and add to a 96-well plate. Mix reagent A and reagent B at a ratio of 50:1, and add 200 μl of the mixture to the 96-well plate containing the standards and sample. Incubate at 37°C in the dark for 30 minutes. Measure the OD value of each well at 562 nm using a full-wavelength microplate reader, construct a standard curve, and calculate the protein concentration of each sample.

[0033] (3) Preparation of loading protein: The total loading volume is 20 μg. Calculate the loading volume of each sample based on the measured protein concentration. Dilute the sample with protein lysis buffer to ensure a consistent final loading volume for each sample. Add 5× loading buffer according to the ratio. Boil the sample in 100℃ water for 10 min to denature the protein. After boiling, cool the sample on ice and store it at -20℃.

[0034] (4) Western blot: Prepare 10% separating gel and 5% stacking gel in advance. Add electrophoresis buffer to the electrophoresis tank, pull out the sample comb vertically upward, and add the sample to the sample well. First, perform electrophoresis at a constant voltage of 70 V until the sample is pressed into a straight line by the stacking gel and the marker begins to separate. Increase the voltage to 120 V and continue electrophoresis at a constant voltage until the bromophenol blue reaches about 0.5 cm at the bottom. Soak the PVDF membrane in methanol, take it out and place it in a dish containing electrotransfer buffer. Discard the electrophoresis buffer, take the gel out of the electrophoresis tank, and prepare an electrotransfer "sandwich" in the order of "sponge-filter paper-gel-PVDF membrane-filter paper-sponge". Place the sandwich clip in the electrotransfer tank, pour the pre-cooled electrotransfer buffer into the electrotransfer apparatus, and place ice packs to keep the electrotransfer buffer at a low temperature. Electrotransfer at 300 mA for 120 min and cover the electrotransfer tank with ice. After electroporation, remove the PVDF membrane, add the corresponding primary antibody to the target protein band, and incubate overnight at 4°C with gentle shaking. The next day, wash the membrane three times with TBST for 10 minutes each time, add the corresponding secondary antibody, and incubate at room temperature for 1 to 2 hours. Wash the membrane three times with TBST for 10 minutes each time. Develop using a fully automated chemiluminescence imaging system, analyze the grayscale values ​​of the target band using ImageJ image analysis software, and perform statistical analysis using GraphPad software.

[0035] result: (1) The expression of RRBP1 in the lung tissue of IPF patients was significantly increased: Western blot results showed that the protein level of RRBP1 in the lung tissue of IPF patients was significantly increased compared with that in control lung tissue. Figure 1 A, C). Immunofluorescence staining results showed that RRBP1 expression was significantly increased in MFBs of lung tissue from IPF patients (A, C). Figure 1 E).

[0036] (2) RRBP1 protein expression was significantly increased in lung tissue of BLM-induced pulmonary fibrosis mice: Western blot results showed that compared with control mice, the expression level of RRBP1 in lung tissue of BLM model mice was significantly increased ( Figure 1 B, D). Immunofluorescence staining results showed that the fluorescence intensity of RRBP1 in MFBs of lung tissue from pulmonary fibrosis mice was significantly increased (B, D). Figure 1 F).

[0037] Example 2: Effects of RRBP1 gene knockdown on BLM-induced pulmonary fibrosis in mice AAV9-RRBP1 shRNA virus was administered intratracheally to knock down RRBP1 in lung tissue. Two weeks after administration of AAV9 virus, a mouse model of pulmonary fibrosis was established by a single intratracheal infusion of BLM. Twenty-one days after modeling, the effects of RRBP1 knockdown on the survival rate, body weight, and fibrosis severity of BLM-induced pulmonary fibrosis mice were observed.

[0038] The method for establishing a mouse pulmonary fibrosis model is the same as above.

[0039] HE staining of mouse lung tissue: The isolated mouse lung tissue was fixed with paraformaldehyde, then dehydrated, embedded, and sectioned into sections approximately 3 μm thick. The sections were baked on a slide press for 2 h to fully melt the paraffin; dewaxing: xylene 10 min × 2 times, 100% alcohol 5 min × 2 times, 95% alcohol 5 min × 2 times, rinsed with running water for 5 min; hematoxylin staining of the nucleus 10 min, rinsed with running water for 3 min; 2% hydrochloric acid-alcohol conversion 15 s, rinsed with running water for 2 min; eosin staining 1 min, rinsed with running water for 4 min; dehydration and clearing: 95% alcohol 5 min × 2 times, 100% alcohol 5 min × 2 times, xylene 2 times; after the slides dried, they were mounted with neutral resin; after full-field scanning with a slide scanner, the lung lesions were observed.

[0040] Masson staining of mouse lung tissue: Mouse lung tissue was fixed with formaldehyde, routinely dehydrated, embedded, and sectioned. After dewaxing, the sections were placed in fixative overnight at room temperature and rinsed with running water. Stained for 2 minutes each in azurite blue solution and hematoxylin and eosin, then differentiated with 1% hydrochloric acid-ethanol solution and rinsed with running water for 10 minutes. Treated for 10 minutes each in fuchsin solution and 1% aluminosilicate solution, then stained for 5 minutes in 2% aniline blue solution, and treated for 2 minutes in 0.2% glacial acetic acid solution. Dehydrated with 95% ethanol, followed by graded ethanol dehydration, cleared with xylene, and mounted with neutral resin.

[0041] The method for Western blotting of proteins is the same as above.

[0042] result: (1) Mouse survival rate and body weight: Compared with the AAV9-NC shRNA + BLM group, the survival rate of the AAV9-RRBP1 shRNA + BLM group was significantly increased ( Figure 2 A) The mouse body weight increased significantly ( Figure 2 B).

[0043] (2) HE and Masson staining results of mouse lung tissue: The alveolar structure of mice in the AAV9-NC shRNA + BLM group was destroyed, the alveolar walls and alveolar septa were thickened, and inflammatory cell infiltration was visible in the airways and around the alveoli. Fibrous tissue hyperplasia was observed in the alveolar septa. The pathological changes in the lung tissue of mice in the AAV9-RRBP1 shRNA + BLM group were significantly improved. Figure 2 C).

[0044] (3) Western blot results showed that knocking down RRBP1 expression in lung tissue significantly reduced the expression of profibrotic factors α-SMA, Col1, and FN. Figure 2 D, E).

[0045] Example 3: RRBP1 gene silencing can inhibit TGF-β1-induced transdifferentiation of human primary lung fibroblasts into myofibroblasts and ECM synthesis. Extraction and culture of primary human lung fibroblasts: ① Fresh lung tissue from IPF patients undergoing surgical lung transplantation and healthy donors was collected clinically, stored on ice in DMEM medium, and promptly delivered to the laboratory; ② Mice were soaked in alcohol, removed, and transferred to glass culture dishes on a laminar flow hood, with the limbs and head fixed. The abdominal skin was lifted with hemostatic forceps in the left hand, and the skin was cut open with ophthalmic straight scissors in the right hand to fully expose the abdomen. The renal artery and vein and the abdominal main vein were located, and the vessels were cut open to release blood and reduce pulmonary congestion. A cotton ball was placed to absorb the blood and prevent leakage. Then, the diaphragm was cut, and after the lungs retracted, the thoracic cavity was cut along both sides of the sternum to expose the lung tissue and heart. A 10 ml syringe filled with physiological saline was used to perfuse the pulmonary vessels in the right ventricle, flushing away blood until the lung lobes turned white. The lungs were removed with ophthalmic forceps and scissors and placed in a glass petri dish containing PBS (containing 200 U / ml penicillin and streptomycin) to rinse away surface blood. Divide the lung into several lobes using ophthalmic scissors. Remove the bronchi and blood vessels at the hilum using the same scissors. Rinse with PBS containing antibiotics and transfer to a 1.5 ml EP tube. ③ Use sterile ophthalmic scissors to mince human or mouse lung tissue into 1 mm pieces. 3Add 1 ml of 5 mg / ml collagenase to the culture medium, incubate at 37°C for 15 min, then centrifuge at 3000 rpm for 5 min and discard the supernatant. Resuspend the cells in 1 ml of complete culture medium containing 10% FBS and 1% antibiotics, and then evenly spread them into 10 cm culture dishes. After 4-6 hours, add 1 ml of complete culture medium, and change the medium after 48 hours, replacing 2-3 ml each time. After 72 hours of adhesion, a large number of fibroblasts can be seen crawling out under a microscope. Remove the tissue block and continue culturing for 2-3 days until the cells reach confluence, then passage. ④ Perform cell experiments on the isolated and cultured fibroblasts at passages 3-8. Early passage cells are cryopreserved for future use.

[0046] Extraction of total cellular protein: Discard the culture medium from the cell culture plate or dish, wash once with PBS, discard the PBS, add the prepared protein lysis buffer, and lyse on ice for 30 min. Scrape cells with a cell scraper, aspirate the protein lysis buffer and cell debris into a 1.5 ml EP tube, and centrifuge at 12,000 rpm for 15 min at 4°C in a pre-chilled centrifuge. Transfer the supernatant to a new 1.5 ml EP tube, discard the precipitate, and store at -80°C for subsequent experiments. The subsequent Western blotting assay is performed using the same method.

[0047] result: (1) Human primary lung fibroblasts were isolated and cultured, and cell modeling was successfully established by treatment with TGF-β1 (10 ng / ml) for 48 h. It was found that TGF-β1 stimulation could induce an increase in RRBP1 expression, and the protein expression of fibrosis-related markers α-SMA, FN, and Col 1 was significantly increased. Figure 3 ).

[0048] (2) Study on the effect of RRBP1 gene knockdown on transdifferentiation and ECM synthesis in human primary fibroblasts: Human RRBP1 siRNA was constructed (sequences: SEQ ID NO.1: 5'-CCUAAUGGGAAGAUACCUGAA-3'; SEQ ID NO.2: 5'-UUCAGGUAUCUUCCCAUUAGG-3'; SEQ ID NO.3: 5'-CUGAGGCAACUUCUCCUAGAA-3'; SEQ ID NO.4: 5'-UUCUAGGAGAAGUUGCCUCAG-3'; SEQ ID NO.5: 5'-GCAUGUCGGUUACAAGAAGAA-3'; SEQ ID NO.6: 5'-UUCUUCUUGUAACCGACAUGC-3'). The siRNA was transfected into human primary lung fibroblasts using transfection reagents. Western blot was used to detect RRBP1 expression, and the siRNA with the highest inhibition rate (scan number 3) was selected for subsequent cell experiments. Figure 4 A). Control and RRBP1 siRNA were transfected into human primary lung fibroblasts using transfection reagents. After TGF-β1 stimulation for 48 h, RRBP1 protein expression levels were detected by Western blot. The results showed that interfering with RRBP1 expression significantly inhibited the transdifferentiation of fibroblasts into MFBs and the protein expression of ECM components (α-SMA, COL1, FN). Figure 4 B, C).

[0049] Note: In NIPO ST.26, "T" represents uracil in the RNA sequence and thymine in the DNA sequence, so the "U" in the above sequences was converted to "T" during the manufacturing process.

[0050] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of substances that inhibit RRBP1 protein expression in the preparation of drugs for the prevention and treatment of fibroproliferative diseases.

2. The application according to claim 1, characterized in that, The substance is selected from any one or more of the following: (a) Compounds that inhibit the activity of RRBP1 protein; (b) A polynucleotide that inhibits RRBP1 gene expression or a recombinant vector containing said polynucleotide.

3. The application according to claim 2, characterized in that, The polynucleotide is a DNA, RNA, and / or DNA-RNA hybrid that inhibits RRBP1 gene expression.

4. The application according to claim 2, characterized in that, The recombinant vectors include viral vectors and / or non-viral vectors.

5. The application according to claim 4, characterized in that, The viral vector is any one or more of the following: retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, vaccinia virus, baculovirus, and lentivirus.

6. The application according to claim 5, characterized in that, The viral vector is adeno-associated virus.

7. The application according to claim 4, characterized in that, The non-viral vector is any one or more of plasmids, liposomes, reverse transcription elements, transposons, augmentative vectors, cationic polymers, chitosan polymers, inorganic nanoparticles, and exosomes.

8. The application according to claim 1, characterized in that, The fibroproliferative diseases mentioned are any one or more of the following: pulmonary fibroproliferative diseases, cardiovascular fibroproliferative diseases, hepatic fibroproliferative diseases, renal fibroproliferative diseases, ocular fibroproliferative diseases, nervous system fibroproliferative diseases, bone marrow fibroproliferative diseases, and cutaneous fibroproliferative diseases.

9. The application according to claim 8, characterized in that, The fibroproliferative disease mentioned is pulmonary fibroproliferative disease.

10. The application according to claim 9, characterized in that, The pulmonary fibrotic disease mentioned is idiopathic pulmonary fibrosis.

Images