DNA methylation markers and use thereof in acute ischemic stroke diagnostic kits

Abstract

The present application relates to the technical field of molecular biology, and discloses DNA methylation markers and application thereof in an acute ischemic stroke diagnosis kit, including methylation regions of CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3 and PCDHB9 genes. The present application screens and obtains a combination of 12 methylation regions of 7 marker genes with high specificity and high sensitivity and highly related to early onset risk of acute ischemic stroke, and the combination of the methylation regions is used as a marker for early detection of acute ischemic stroke, and the result is highly accurate, and can provide a reference for auxiliary diagnosis for clinicians.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and more specifically, to DNA methylation markers and their application in diagnostic kits for acute ischemic stroke. Background Technology

[0002] Stroke is currently the leading cause of death and disability in my country. Acute ischemic stroke accounts for about 80% of all strokes, and its incidence is increasing year by year, greatly reducing patients' quality of life and increasing the burden on individuals and society.

[0003] The main diagnostic methods for acute ischemic stroke include cranial CT scans and magnetic resonance imaging (MRI). However, CT has a sensitivity of only 16% in the early diagnosis of acute ischemic stroke, while MRI, although more accurate, is expensive and not available in all medical centers. Furthermore, some patients cannot undergo MRI due to claustrophobia or the presence of metals in their bodies. These factors collectively hinder the rapid diagnosis and timely administration of medication for acute ischemic stroke. Therefore, establishing a biomarker-based diagnostic method for acute ischemic stroke is particularly urgent.

[0004] Currently, acute ischemic stroke is believed to be related to genetic factors, environmental factors, and their interactions, with genetic background-related risk accounting for approximately 37.9%. Although genome-wide association studies have identified different loci associated with ischemic stroke risk, these genetic variations can only explain 5%-10% of the genetic risk, meaning that many genetic risk factors related to ischemic stroke have not been discovered or given sufficient attention, and DNA methylation is one of them. Recent studies have found that DNA methylation plays an important role in the pathogenesis and recurrence of ischemic stroke, suggesting that DNA methylation molecules may become a new diagnostic biomarker for ischemic stroke.

[0005] Therefore, finding DNA methylation molecules in peripheral blood with good specificity and high sensitivity as diagnostic biomarkers for acute ischemic stroke is an urgent problem to be solved.

[0006] In view of the above, this application is hereby submitted. Summary of the Invention

[0007] The existing technology has the problem that the main diagnostic method for acute ischemic stroke is cranial CT scan, which has low sensitivity and poor accuracy in the early stages. To address these issues, this invention provides a combination of DNA methylation biomarkers, their applications, and a kit. This combination comprises a combination of 12 methylation regions from 7 biomarker genes with high specificity and sensitivity, which are highly associated with the early risk of acute ischemic stroke. When this combination of methylation regions is used as a biomarker for the early detection of acute ischemic stroke, the results are highly accurate and can provide clinicians with auxiliary diagnostic references.

[0008] This invention is achieved through the following technical solution: In a first aspect, the present invention provides a combination of DNA methylation biomarkers associated with acute ischemic stroke, including methylated regions of the CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3 and PCDHB9 genes.

[0009] In one specific embodiment, the methylated region of the CDH2 gene includes CDH2-1: chr18:25756618-25756733, CDH2-2: chr18:25756025-25756134, CDH2-3: chr18:25757265-25757474, CDH2-4: chr18:25758020-25758176; The methylated region of the PCDHB10 gene includes PCDHB10-5: chr5:140574147-140574355; The methylated region of the PCDHB11 gene includes PCDHB11-6: chr5:140581363-140581525; The methylated region of the PCDHB14 gene includes PCDHB14-8: chr5:140605105-140605298; The methylated region of the PCDHB16 gene includes PCDHB16-10: chr5:140563971-140564127; The methylated regions of the PCDHB3 gene include PCDHB3-11: chr5:140480755-140480898, PCDHB3-12: chr5:140482070-140482226; The methylated regions of the PCDHB9 gene include PCDHB9-16: chr5:140568728-140568884, PCDHB9-17: chr5:140568913-140569112.

[0010] Secondly, the present invention provides the application of the DNA methylation biomarker combination in the preparation of a screening and diagnostic reagent for acute ischemic stroke.

[0011] Thirdly, this invention provides a set of primers for screening and diagnosing acute ischemic stroke, comprising a specific primer set for detecting the methylation status of methylation regions in the combination of 12 methylation region markers from the 7 genes. The nucleotide sequences of the specific primers have a 5-10 bp long sequence at the 5' end that is complementary to the 3' end but does not pair with the terminal CG base of the 3' end; the Tm value of the nucleotide sequence of the specific primers is 2-4°C higher than the annealing temperature of the PCR reaction system.

[0012] In one specific embodiment, the specific primer nucleotide sequences for CDH2-1 are: SEQ ID NO:1 and SEQ ID NO:2; The specific primer nucleotide sequences for CDH2-2 are: SEQ ID NO:3 and SEQ ID NO:4; The specific primer nucleotide sequences for CDH2-3 are: SEQ ID NO:5 and SEQ ID NO:6; The specific primer nucleotide sequences for CDH2-4 are: SEQ ID NO:7 and SEQ ID NO:8 The specific primer nucleotide sequences for PCDHB10-5 are: SEQ ID NO:9 and SEQ ID NO:10; The specific primer nucleotide sequences for PCDHB11-6 are: SEQ ID NO:11 and SEQ ID NO:12; The specific primer nucleotide sequences for PCDHB14-8 are: SEQ ID NO:13 and SEQ ID NO:14; The specific primer nucleotide sequences for PCDHB16-10 are: SEQ ID NO:15 and SEQ ID NO:16; The specific primer nucleotide sequences for PCDHB3-11 are: SEQ ID NO:17 and SEQ ID NO:18; The specific primer nucleotide sequences for PCDHB3-12 are: SEQ ID NO:19 and SEQ ID NO:20; The specific primer nucleotide sequences for PCDHB9-16 are: SEQ ID NO:21 and SEQ ID NO:22; The specific primer nucleotide sequences for PCDHB9-17 are: SEQ ID NO:23 and SEQ ID NO:24.

[0013] Fourthly, the present invention provides a diagnostic kit for screening acute ischemic stroke, comprising the aforementioned set of detection primers.

[0014] In one specific embodiment, it is used to detect the degree of methylation of the methylated regions of the CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3 and PCDHB9 genes in peripheral blood DNA.

[0015] In one specific embodiment, the invention also includes a probe for detecting the methylation status of the methylation regions in the combination of markers for the 12 methylation regions of the 7 genes; and internal reference gene detection primers and internal reference gene detection probes for the internal reference gene GAPDH.

[0016] In one specific embodiment, the nucleotide sequence of the probe is labeled with a fluorescent group at the 5' end and a quenching group at the 3' end; the fluorescent group includes, but is not limited to, FAM, ROX, CY5, CY3, TET, Texas Red, JOE, and HEX, and the quenching group includes, but is not limited to, BHQ1 and BHQ2.

[0017] In one specific implementation, detection probes labeled with different fluorescent channels can be placed in one tube for reaction, ensuring the optimal amplification efficiency of different target genes in the sample. The fluorescence curve is a standard S-shaped amplification curve, maintaining the same trend as the fluorescence curves of single amplification of each gene.

[0018] In one specific embodiment, the kit further includes reagents used in any one or more of the following methylation detection methods, wherein the methylation detection methods include: whole-genome bisulfite sequencing, pyrosequencing, bisulfite sequencing, methylation-specific polymerase chain reaction (methylation-specific PCR), bisulfite-specific polymerase chain reaction, methylation-sensitive restriction endonuclease-PCR / Southern method, bisulfite-binding restriction endonuclease, digital polymerase chain reaction, restriction marker genome scanning, CpG island microarray, single nucleotide primer extension, methylation mapping analysis, and methylation microarray.

[0019] The diagnostic kit further includes reagents for processing samples.

[0020] The process may include the steps of extracting DNA and converting cytosine to uracil.

[0021] The reagents most commonly used in the step of converting cytosine to uracil are bisulfite reagents.

[0022] The bisulfite reagent includes a bisulfite buffer and a protective buffer.

[0023] The DNA extraction reagents may include lysis buffer, binding buffer, washing buffer, and elution buffer.

[0024] The lysis buffer comprises a protein denaturant, a detergent, a pH buffer, and a nuclease inhibitor.

[0025] The binding buffer comprises a protein denaturant and a pH buffer.

[0026] The pH buffer is selected from one or more of Tris, boric acid, phosphate, and MES.

[0027] The nuclease inhibitor is selected from one or more of EDTA, EGTA, and DEPC.

[0028] The washing buffer is selected from one or more of Tris, boric acid, sorbitol, polyethylene glycol and mercaptoethanol.

[0029] The elution buffer is selected from one or more of NaCl, Tris-HCl and EDTA.

[0030] Fifthly, the present invention provides a method for screening combinations of methylation biomarkers to aid in the diagnosis of acute ischemic stroke, comprising the following steps: (1) Screening stage 1) Collect research samples, including acute ischemic stroke patients and healthy controls who meet the inclusion criteria; 2) Differential DNA methylation sites can be determined by high-throughput sequencing, and functional differential methylation sites located in gene promoter regions can be screened out; 3) Candidate genes were identified through GO and KEGG analyses; (2) Verification phase 1) Expand the collection of research samples; 2) Validate candidate genes: First, validate a small number of differentially methylated sites in the promoter regions of candidate genes with a small sample size to determine the reliability of the high-throughput sequencing results. Based on this, further expand the sample size to validate the methylation level of the promoter regions of candidate genes, and identify the final differentially methylated genes, differentially methylated CpG islands, and CpG sites.

[0031] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. The DNA methylation biomarkers provided in this embodiment of the invention and their application in the diagnostic kit for acute ischemic stroke are used to screen 12 combinations of methylation regions of 7 biomarker genes that are highly specific and sensitive and are highly associated with the early risk of acute ischemic stroke. When the combination of methylation regions is used as a biomarker for the early detection of acute ischemic stroke, the results are highly accurate and can provide clinicians with auxiliary diagnostic reference. 2. The DNA methylation biomarkers provided in this invention and their application in an acute ischemic stroke diagnostic kit, through the study of methylation data from acute ischemic stroke patients and healthy controls, screened out combinations of highly specific and sensitive methylation regions that are highly correlated with the early incidence risk of acute ischemic stroke, and developed an early auxiliary diagnostic kit for acute ischemic stroke that can be used in clinical applications, providing data support for the early auxiliary diagnosis of acute ischemic stroke, providing a theoretical basis for the discovery of novel small molecule drugs with potential therapeutic value, and solving the technical problem in the existing technology of needing biomarkers that can accurately and effectively achieve early diagnosis or treatment; 3. The DNA methylation markers provided in this embodiment of the invention and their application in the diagnostic kit for acute ischemic stroke, the detection primers and probes and the kit can use peripheral blood as a sample, and based on peripheral blood DNA analysis, it provides a non-invasive or minimally invasive, highly sensitive and highly specific detection method for early detection of acute ischemic stroke. 4. The DNA methylation markers provided in this embodiment of the invention and their application in the acute ischemic stroke diagnostic kit, the kit, combined with specific primers and probes, sample pretreatment reagents, Taq polymerase in PCR reaction solution, etc., ensures that the kit maintains high sensitivity to low concentrations of template when used, and is very sensitive to the early detection of acute ischemic stroke, which helps to reflect the methylation level of different subjects, can quickly determine the early risk of the disease in subjects, and is a powerful supplement to the existing diagnosis of acute ischemic stroke, suitable for the early detection of acute ischemic stroke. Attached Figure Description

[0032] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0033] Figure 1 Structural feature diagrams of 12 methylation regions (CpG islands) in the promoter regions of 7 differentially methylated genes provided by this invention; Figure 2 A schematic diagram of the marker screening scheme provided by the present invention; Figure 3 ROC curves of the methylation regions of the seven genes provided for this invention. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0035] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, it will be apparent to those skilled in the art that these specific details are not necessary to practice the invention. In other embodiments, well-known materials or methods have not been specifically described in order to avoid obscuring the invention.

[0036] Throughout this specification, references to "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in connection with that embodiment or example is included in at least one embodiment of the invention. Therefore, the phrases "an embodiment," "an example," "an example," or "an example" appearing in various places throughout the specification do not necessarily refer to the same embodiment or example. Furthermore, specific features, structures, or characteristics can be combined in one or more embodiments or examples in any suitable combination and / or sub-combination. Moreover, those skilled in the art will understand that the illustrations provided herein are for illustrative purposes and are not necessarily drawn to scale. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0037] Currently, the main diagnostic method for acute ischemic stroke is cranial CT scan. However, it has low sensitivity and poor accuracy in the early stages, making early diagnosis impossible. To address these issues with existing technologies... Firstly, such as Figure 1 As shown, the present invention provides a combination of DNA methylation biomarkers associated with acute ischemic stroke, including methylated regions of the CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3 and PCDHB9 genes.

[0038] In one specific embodiment, the methylated region of the CDH2 gene includes CDH2-1: chr18:25756618-25756733, CDH2-2: chr18:25756025-25756134, CDH2-3: chr18:25757265-25757474, CDH2-4: chr18:25758020-25758176; The methylated region of the PCDHB10 gene includes PCDHB10-5: chr5:140574147-140574355; The methylated region of the PCDHB11 gene includes PCDHB11-6: chr5:140581363-140581525; The methylated region of the PCDHB14 gene includes PCDHB14-8: chr5:140605105-140605298; The methylated region of the PCDHB16 gene includes PCDHB16-10: chr5:140563971-140564127; The methylated regions of the PCDHB3 gene include PCDHB3-11: chr5:140480755-140480898, PCDHB3-12: chr5:140482070-140482226; The methylated regions of the PCDHB9 gene include PCDHB9-16 chr5:140568728-140568884, PCDHB9-17 chr5:140568913-140569112.

[0039] Secondly, the present invention provides the application of the DNA methylation biomarker combination in the preparation of a screening and diagnostic reagent for acute ischemic stroke.

[0040] Thirdly, this invention provides a set of primers for screening and diagnosing acute ischemic stroke, comprising specific primer sets corresponding to the combination of markers for the 12 methylation regions of the 7 genes. The nucleotide sequences of the specific primers have a 5-10 bp long sequence at the 5' end that is complementary to the 3' end but does not pair with the CG bases at the 3' end; the Tm value of the nucleotide sequence of the specific primers is 2-4°C higher than the annealing temperature of the PCR reaction system.

[0041] In one specific embodiment, the specific primer nucleotide sequences for CDH2-1 are: SEQ ID NO:1 and SEQ ID NO:2; The specific primer nucleotide sequences for CDH2-2 are: SEQ ID NO:3 and SEQ ID NO:4; The specific primer nucleotide sequences for CDH2-3 are: SEQ ID NO:5 and SEQ ID NO:6; The specific primer nucleotide sequences for CDH2-4 are: SEQ ID NO:7 and SEQ ID NO:8 The specific primer nucleotide sequences for PCDHB10-5 are: SEQ ID NO:9 and SEQ ID NO:10; The specific primer nucleotide sequences for PCDHB11-6 are: SEQ ID NO:11 and SEQ ID NO:12; The specific primer nucleotide sequences for PCDHB14-8 are: SEQ ID NO:13 and SEQ ID NO:14; The specific primer nucleotide sequences for PCDHB16-10 are: SEQ ID NO:15 and SEQ ID NO:16; The specific primer nucleotide sequences for PCDHB3-11 are: SEQ ID NO:17 and SEQ ID NO:18; The specific primer nucleotide sequences for PCDHB3-12 are: SEQ ID NO:19 and SEQ ID NO:20; The specific primer nucleotide sequences for PCDHB9-16 are: SEQ ID NO:21 and SEQ ID NO:22; The specific primer nucleotide sequences for PCDHB9-17 are: SEQ ID NO:23 and SEQ ID NO:24.

[0042] in, SEQ ID NO:1:GAGTGGYGGGATTGTTGTTTT SEQ ID NO:2:AATAACRCTCCCCAAAAACTCC SEQ ID NO:3: TTTATTGTGYGGGYGGTGTT SEQ ID NO:4:AACCAATCRAAAACCACCAAAC SEQ ID NO:5:TTGGGYGGTTTTGTTTTAGG SEQ ID NO:6:CCTAAAACCCCRCCAAA A SEQ ID NO:7: TTTGTTYGGTTGTTTGTGTTTT SEQ ID NO:8:AATTAAAACTACCCCRAAACTAAAAAC SEQ ID NO:9:GGTAGTTTTGGGATAGGGGTTTAG SEQ ID NO:10:TCCCCACCCCTACCTACCTCTC SEQ ID NO:11:AGATGTTTGGAAAGGGGTTTTTT SEQ ID NO:12:CTCTCCCAACCCTACCTACC SEQ ID NO:13:GTTGGTGTTTGAGTTTTTGTTTGT SEQ ID NO:14: TCACAAACTTAAAAACCCCAAAC SEQ ID NO:15: TTTTGGGATAGGGT TTYGGTGT SEQ ID NO:16:AACCCTACCTACCRTCCTAAAAC SEQ ID NO:17:GGTAGGAAGGGTTGGGAGA SEQ ID NO:18: TACCAACTACTCAAA AACCACRAAAC SEQ ID NO:19:TTTGGATGTTTTATTGGGGTTGTTTT SEQ ID NO:20:AAACAACCTCCAAAACTACACTATCAC SEQ ID NO:21:AGGTAGGTAGGGTTGGGAGAAG SEQ ID NO:22: TACCAACTACTCAAA AACCACRAAAC SEQ ID NO:23:GAGGTAGGTAGGGTTGGGAGAAG SEQ ID NO:24:ACCAACTACTCAAA AACCACRAAAC Fourthly, the present invention provides a diagnostic kit for screening acute ischemic stroke, comprising the aforementioned set of detection primers.

[0043] In one specific embodiment, it is used to detect the degree of methylation of the methylated regions of the CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3 and PCDHB9 genes in peripheral blood DNA.

[0044] In one specific embodiment, the invention also includes a probe for detecting the methylation status of the methylation regions in the combination of markers for the 12 methylation regions of the 7 genes; and internal reference gene detection primers and internal reference gene detection probes for the internal reference gene GAPDH.

[0045] The specific primer nucleotide sequences for GAPDH are: SEQ ID NO:25 and SEQ ID NO:26.

[0046] SEQ ID NO:25:AGGTTAAATATAGTTGTTGA SEQ ID NO:26:CAACCCAAACCCCCAAC In one specific embodiment, the nucleotide sequence of the probe is labeled with a fluorescent group at the 5' end and a quenching group at the 3' end; the fluorescent group includes, but is not limited to, FAM, ROX, CY5, CY3, TET, Texas Red, JOE, and HEX, and the quenching group includes, but is not limited to, BHQ1 and BHQ2.

[0047] In one specific implementation, detection probes labeled with different fluorescent channels can be placed in the same tube for reaction, ensuring the optimal amplification efficiency of different target genes in the sample. The fluorescence curve is a standard S-shaped amplification curve, maintaining a consistent trend with the fluorescence curves compared to single amplification of each gene.

[0048] In one specific embodiment, the kit further includes reagents used in any one or more of the following methylation detection methods, which include: whole-genome bisulfite sequencing, pyrosequencing, bisulfite sequencing, methylation-specific polymerase chain reaction (methylation-specific PCR), bisulfite-specific polymerase chain reaction, methylation-sensitive restriction endonuclease-PCR / Southern method, bisulfite-binding restriction endonuclease, digital polymerase chain reaction, restriction marker genome scanning, CpG island microarray, single nucleotide primer extension (SNUPE), methylation mapping analysis, and methylation microarray.

[0049] The diagnostic kit further includes reagents for processing samples.

[0050] The process may include the steps of extracting DNA and converting cytosine to uracil.

[0051] The reagents most commonly used in the step of converting cytosine to uracil are bisulfite reagents.

[0052] The bisulfite reagent includes a bisulfite buffer and a protective buffer.

[0053] The DNA extraction reagents may include lysis buffer, binding buffer, washing buffer, and elution buffer.

[0054] The lysis buffer comprises a protein denaturant, a detergent, a pH buffer, and a nuclease inhibitor.

[0055] The binding buffer comprises a protein denaturant and a pH buffer.

[0056] The pH buffer is selected from one or more of Tris, boric acid, phosphate, and MES.

[0057] The nuclease inhibitor is selected from one or more of EDTA, EGTA, and DEPC.

[0058] The washing buffer is selected from one or more of Tris, boric acid, sorbitol, polyethylene glycol and mercaptoethanol.

[0059] The elution buffer is selected from one or more of NaCl, Tris-HCl and EDTA.

[0060] Fifthly, such as Figure 2 As shown, this invention provides a method for screening combinations of methylation biomarkers to aid in the diagnosis of acute ischemic stroke, comprising the following steps: (1) Screening stage 1) Collect research samples, including acute ischemic stroke patients and healthy controls who meet the inclusion criteria; 2) Differential DNA methylation sites can be determined by high-throughput sequencing, and functional differential methylation sites located in gene promoter regions can be screened out; 3) Candidate genes were identified through GO and KEGG analyses; (2) Verification phase 1) Expand the collection of research samples; 2) Validate candidate genes: First, validate a small number of differentially methylated sites in the promoter regions of candidate genes with a small sample size to determine the reliability of the high-throughput sequencing results. Based on this, further expand the sample size to validate the methylation level of the promoter regions of candidate genes, and identify the final differentially methylated genes, differentially methylated CpG islands, and CpG sites.

[0061] Example 1 This invention provides a method for screening combinations of methylation biomarkers to aid in the diagnosis of acute ischemic stroke, as detailed below: 1) The samples for this study were obtained from the First Affiliated Hospital of Harbin Medical University. Peripheral blood samples from 4 patients with acute ischemic stroke (2 males and 2 females) and 4 sex- and age-matched healthy controls (2 males and 2 females) were analyzed using an Illumina 850K microarray to detect whole-genome methylation levels (containing over 853,000 CpG sites) and screen for candidate genes with differential methylation in acute ischemic stroke. Methylation levels were expressed as "β" values, ranging from 0 (no cytosine methylation) to 1 (complete cytosine methylation). β values ​​were reported as a percentage. CpG sites located on single nucleotide polymorphisms (SNPs) and on the X and Y chromosomes were discarded to avoid potential confounding effects of SNPs and sex.

[0062] 2) Genomic DNA was extracted from the above 8 peripheral blood samples using commercially available nucleic acid extraction or purification reagents and methylation detection sample pretreatment kits, and the DNA underwent bisulfite conversion to obtain qualified converted bis-DNA for subsequent methylation microarray screening and detection. The results from acute ischemic stroke and healthy control samples were compared and analyzed using a significant differential methylation site algorithm to screen for differentially methylated sites.

[0063] 3) Perform GO analysis on genes containing differentially methylated sites, list the genes included in each GO entry, and calculate the enrichment difference for each entry. P The value indicates that when P A value <0.05 indicates that the GO entry is enriched in acute ischemic stroke. Therefore, based on GO analysis... P Candidate genes were determined based on their enrichment values ​​and the biological significance of the enriched entries. The entry "calcium-dependent cell-cell adhesion via plasma membrane cell adhesion molecules" showed the most significant enrichment difference. This pathway contains eight genes: PCDHB14, PCDHB11, PCDHB3, PCDHB16, PCDHB9, CDH2, PCDHB10, and PCDHB6. These eight genes were ultimately selected as candidate genes.

[0064] Example 2 Of the eight candidate genes screened in Example 1, in a 20:20 case-control sample of acute ischemic stroke, five out of ten CpG sites showed statistically significant differences. P <0.05), and although no statistically significant differences were found in the other 5 CpG sites during the validation phase, the trend of their methylation levels was consistent with the results of the 850K chip, as shown in Table 1, confirming the reliability of the 850K chip results.

[0065] Table 1. Results of 10 CpG sites in the 850K chip and verification phase. .

[0066] Example 3 In this embodiment of the invention, among 188 pairs of acute ischemic stroke case-control samples, 7 out of the above 8 candidate genes showed statistical differences, as shown in Table 2.

[0067] Table 2. Validation of 8 candidate genes .

[0068] Among the 12 CpG islands in the promoter regions of the above 7 genes, statistical differences were observed, as shown in Table 3. All 12 CpG islands were in a hypomethylated state, and even after adjusting for confounding factors such as smoking, alcohol consumption, history of hypertension and diabetes, total cholesterol, triglycerides, high-density lipoprotein, and low-density lipoprotein, they still showed statistical differences. P <0.05).

[0069] Table 3. Validation of 17 CpG islands from 8 candidate genes .

[0070] Example 4 This invention provides the methylation levels of seven genes in 188 pairs of acute ischemic stroke case-control samples: 1) A total of 188 cases of acute ischemic stroke with known confirmed diagnosis via head MRI or CT were selected: 67 cases of large artery atherosclerosis, 13 cases of cardioembolic stroke, 64 cases of small artery occlusion, 5 cases of other causes, and 39 cases of unknown cause; another 188 cases were healthy controls. All samples were peripheral blood samples. As shown in Table 4, hypomethylation was more significant in the large artery atherosclerosis subtype of stroke compared to the small artery occlusion subtype.

[0071] Table 4. Degrees of hypomethylation of various genes in different subtypes of acute ischemic stroke .

[0072] 2) Comparing head imaging results, among 376 peripheral blood samples, including 188 cases of acute ischemic stroke and 188 healthy controls, the results are as follows: Figure 3 As shown in Table 5.

[0073] Table 5. ROC analysis of 7 differentially methylated genes and multi-gene models .

[0074] The CDH2 gene, as a biomarker for acute ischemic stroke, showed a specificity of 0.7872, a sensitivity of 0.883, an accuracy of 0.8351, and an area under the ROC curve of 0.9067.

[0075] The PCDHB10 gene, as a biomarker for acute ischemic stroke, showed a specificity of 0.7979, a sensitivity of 0.8617, an accuracy of 0.8298, and an area under the ROC curve of 0.9015.

[0076] The PCDHB11 gene, as a biomarker for acute ischemic stroke, showed a specificity of 0.8191, a sensitivity of 0.8298, an accuracy of 0.8245, and an area under the ROC curve of 0.8924.

[0077] The PCDHB14 gene, as a biomarker for acute ischemic stroke, showed a specificity of 0.8191, a sensitivity of 0.8191, an accuracy of 0.8191, and an area under the ROC curve of 0.8679.

[0078] The PCDHB16 gene, as a biomarker for acute ischemic stroke, showed a specificity of 0.8191, a sensitivity of 0.8245, an accuracy of 0.8218, and an area under the ROC curve of 0.874.

[0079] The PCDHB3 gene, as a biomarker for acute ischemic stroke, showed a specificity of 0.8245, a sensitivity of 0.8245, an accuracy of 0.8245, and an area under the ROC curve of 0.8793.

[0080] The PCDHB9 gene, as a biomarker for acute ischemic stroke, showed a specificity of 0.7872, a sensitivity of 0.8617, an accuracy of 0.8245, and an area under the ROC curve of 0.891.

[0081] The combined detection of seven target genes (PCDHB14, PCDHB11, PCDHB3, PCDHB16, PCDHB9, CDH2, and PCDHB10) showed the best overall sensitivity and specificity in 376 peripheral blood samples, with a specificity of 0.8723, a sensitivity of 0.883, an accuracy of 0.8777, and an area under the ROC curve of 0.9384. This indicates that the combination of multiple genes is more effective and efficient than single genes in diagnosing acute ischemic stroke.

[0082] Example 5 For the 12 methylation regions of the 7 target genes screened in Example 3, primers were designed and screened based on the specific sequences of the methylation regions, resulting in the nucleotide sequences of the methylation region detection primers shown in Table 6. The kit also includes target gene detection probes for detecting the methylation status of the methylation regions in the aforementioned biomarker combinations, and the nucleotide sequences of these target gene detection probes are shown in Table 7.

[0083] Table 6 Primer sequence information corresponding to different methylation regions of the target gene .

[0084] Table 7. Probe sequence information corresponding to different methylation regions of the target gene. .

[0085] Using the primers and probes listed in Tables 6 and 7 above, a detection kit (PCR amplification system kit) was prepared, including PCR reaction solution, primer-probe mixture, positive control and negative control, the main components of which are shown in Table 8 below.

[0086] Table 8. PCR amplification system kit composition .

[0087] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A combination of DNA methylation biomarkers associated with acute ischemic stroke, characterized in that, This includes the methylated regions of the CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3, and PCDHB9 genes.

2. The combination of DNA methylation biomarkers related to acute ischemic stroke according to claim 1, characterized in that, The methylated regions of the CDH2 gene include CDH2-1: chr18:25756618-25756733, CDH2-2: chr18:25756025-25756134, CDH2-3: chr18:25757265-25757474, CDH2-4: chr18:25758020-25758176; The methylated region of the PCDHB10 gene includes PCDHB10-5: chr5:140574147-140574355; The methylated region of the PCDHB11 gene includes PCDHB11-6: chr5:140581363-140581525; The methylated region of the PCDHB14 gene includes PCDHB14-8: chr5:140605105-140605298; The methylated region of the PCDHB16 gene includes PCDHB16-10: chr5:140563971-140564127; The methylated regions of the PCDHB3 gene include PCDHB3-11: chr5:140480755-140480898, PCDHB3-12: chr5:140482070-140482226; The methylated regions of the PCDHB9 gene include PCDHB9-16: chr5:140568728-140568884, PCDHB9-17: chr5:140568913-140569112.

3. The use of the DNA methylation biomarker combination according to claim 1 or 2 in the preparation of a screening and diagnostic reagent for acute ischemic stroke.

4. A primer set for screening and diagnosing acute ischemic stroke, characterized in that, This includes a specific primer combination for detecting the methylation status of methylated regions in the biomarker combination of claim 1 or 2.

5. A detection primer set for screening and diagnosing acute ischemic stroke according to claim 4, characterized in that, The specific primer nucleotide sequences for CDH2-1 are: SEQ ID NO:1 and SEQ ID NO:2; The specific primer nucleotide sequences for CDH2-2 are: SEQ ID NO:3 and SEQ ID NO:4; The specific primer nucleotide sequences for CDH2-3 are: SEQ ID NO:5 and SEQ ID NO:6; The specific primer nucleotide sequences for CDH2-4 are: SEQ ID NO:7 and SEQ ID NO:8; The specific primer nucleotide sequences for PCDHB10-5 are: SEQ ID NO:9 and SEQ ID NO:10; The specific primer nucleotide sequences for PCDHB11-6 are: SEQ ID NO:11 and SEQ ID NO:12; The specific primer nucleotide sequences for PCDHB14-8 are: SEQ ID NO:13 and SEQ ID NO:14; The specific primer nucleotide sequences for PCDHB16-10 are: SEQ ID NO:15 and SEQ ID NO:16; The specific primer nucleotide sequences for PCDHB3-11 are: SEQ ID NO:17 and SEQ ID NO:18; The specific primer nucleotide sequences for PCDHB3-12 are: SEQ ID NO:19 and SEQ ID NO:20; The specific primer nucleotide sequences for PCDHB9-16 are: SEQ ID NO:21 and SEQ ID NO:22; The specific primer nucleotide sequences for PCDHB9-17 are: SEQ ID NO:23 and SEQ ID NO:

24.

6. A diagnostic kit for screening acute ischemic stroke, characterized in that, Includes the detection primer set as described in claim 4 or 5.

7. The test kit for screening and diagnosing acute ischemic stroke according to claim 6, characterized in that, This is used to detect the degree of methylation of the methylated regions of the CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3 and PCDHB9 genes in peripheral blood DNA.

8. The test kit for screening and diagnosing acute ischemic stroke according to claim 6, characterized in that, It also includes a probe for detecting the methylation status of methylated regions in the biomarker combination of claims 1 to 3.

9. The diagnostic kit for acute ischemic stroke screening according to claim 6, characterized in that, The nucleotide sequence of the probe is labeled with a fluorescent group at the 5' end and a quencher group at the 3' end; the fluorescent groups include FAM, ROX, CY5, CY3, TET, Texas Red, JOE or HEX, and the quencher groups include BHQ1 or BHQ2.

Images