A primer probe combination, kit and application thereof for detecting a novel human circovirus

By designing a primer-probe combination targeting the Rep gene of a novel human circovirus and combining it with real-time quantitative PCR, the sensitivity and specificity issues of existing technologies for detecting novel human circoviruses have been resolved, enabling rapid and accurate quantitative detection of the virus, which is suitable for large-scale clinical screening.

CN122445862APending Publication Date: 2026-07-24SHANXI MEDICAL UNIV +3
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610715775.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-22
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid, accurate, and low-cost detection of novel human circoviruses, especially for large-scale clinical screening, where highly sensitive, specific, and quantifiable detection methods are lacking.

Method used

A primer-probe combo targeting the Rep gene of a novel human circovirus was designed, including forward primers, reverse primers, and probes labeled with fluorescent reporter and quencher groups, for real-time quantitative PCR detection. Combined with closed-tube operation, it enables specific amplification and quantitative analysis.

Benefits of technology

It achieves high sensitivity (LOD 0.6 copies/mL), high specificity, rapid (completed within 2 hours), high amplification efficiency (96.14%), and good reproducibility (intra-assay CV 0.013%~0.138%, inter-assay CV 1.765%~3.463%) for the detection of novel human circovirus, and is suitable for absolute quantification of clinical samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445862A_ABST
    Figure CN122445862A_ABST
Patent Text Reader

Abstract

The application discloses a primer probe combination for detecting a novel human circovirus, a kit and application thereof, and belongs to the technical field of biotechnology. In view of defects that existing detection methods of the novel human circovirus rely on metagenomic sequencing, are time-consuming, high in cost and difficult to realize accurate quantification, the application designs specific primers and TaqMan probes with fluorescent labels based on a conservative region of a replicase protein gene of the novel human circovirus, and the specific primers and the TaqMan probes have no cross reaction with other viruses of the circovirus genus (including porcine circovirus types 1-4 and the like) and other common human pathogens, and high-specificity detection can be realized. The kit comprises the primer probe combination, PCR reaction components, positive and negative quality control samples and quantitative standard samples, and has the advantages of simple operation, high sensitivity and high amplification efficiency, and provides an effective means for rapid and accurate quantification detection of the novel human circovirus, and can be applied to the fields of clinical sample detection, blood screening and epidemiological monitoring.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a primer-probe combination, kit, and application for detecting novel human circoviruses. Background Technology

[0002] Human circovirus (HuCV) is a novel DNA virus belonging to the family Circoviridae, possessing a circular single-stranded DNA genome. In recent years, HuCV has been detected in the plasma of hepatitis patients in China, France, Switzerland, and other countries. Studies have shown that HuCV is hepatotropic and can cause persistent infection and recurrent hepatitis in immunocompromised individuals, posing a potential threat to clinical diagnosis and public health.

[0003] Given the increasing number of patients with unexplained liver disease in clinical practice, and considering the novel human circovirus (HPV), a newly emerging virus closely related to hepatitis, we hypothesize a link between HPV infection and unexplained liver disease. To verify this hypothesis, there is an urgent need to establish a rapid and accurate pathogen detection method. This method is crucial for clinical screening, epidemiological investigations, and further clarification of the pathogenicity of HPV. Currently, the identification of HPV mainly relies on metagenomic next-generation sequencing (mNGS). While this method can effectively identify the pathogen, it is complex to operate, costly, dependent on high-end instruments, has a long identification cycle, and requires bioinformatics support from professionals, making it difficult to meet the current urgent clinical need for rapid, large-scale screening.

[0004] With the development of molecular biology techniques, virus isolation and culture are considered the "gold standard" for pathogen detection. However, novel human circoviruses lack mature in vitro culture systems and have low isolation success rates, failing to meet the needs of rapid diagnosis. Serological detection methods have not yet been standardized due to the lack of specific antigens and antibodies. Although some researchers have reported the use of loop-mediated isothermal amplification (LAMP) to detect novel human circoviruses, this method can only perform qualitative or semi-quantitative detection, has limited sensitivity, and cannot achieve precise quantification of the pathogen.

[0005] Therefore, there is an urgent need in this field to develop a novel human circovirus detection method that is highly sensitive, specific, quantifiable, and easy to operate to meet the needs of rapid clinical diagnosis. Real-time quantitative PCR (qPCR) technology, with its advantages of high sensitivity, high specificity, closed-tube operation, and absolute quantification, has become an ideal method for rapid pathogen detection. However, systematic research on the screening of specific molecular targets for novel human circoviruses and the construction of corresponding qPCR detection systems still lacks progress. Summary of the Invention

[0006] To address the aforementioned technical challenges, this invention develops a primer-probe combination, kit, and application targeting the Rep gene of novel human circoviruses. This method demonstrates excellent performance in terms of specificity, sensitivity, amplification efficiency, and reproducibility, meeting current clinical needs for rapid screening and quantitative detection. The inventors' preliminary research revealed that the replicase protein gene (Rep) is highly conserved in novel human circoviruses and exhibits sufficient sequence differences from other circoviruses (including porcine circoviruses 1, 2, 3, and 4, and human fecal-associated circoviruses). Furthermore, the protein encoded by this gene participates in viral genome replication and is a crucial element essential for viral replication, thus making it an ideal detection target.

[0007] The present invention provides a composition comprising: a forward primer, a reverse primer, and a probe for detecting a novel human circovirus, wherein the nucleotide sequences of the forward primer and the reverse primer are shown in SEQ ID NO.1 and 2, respectively; and the nucleotide sequence of the probe is shown in SEQ ID NO.3.

[0008] Preferably, the probe has a fluorescent reporter group labeled at its 5' end and a fluorescent quencher group labeled at its 3' end.

[0009] More preferably, the fluorescent reporter group is selected from 6-FAM, HEX or ROX, and the fluorescent quencher group is selected from BHQ1 or BHQ2.

[0010] More preferably, the probe is marked with 6-FAM at the 5' end and BHQ1 at the 3' end.

[0011] The present invention also provides a kit comprising the above-described composition.

[0012] The present invention also provides the use of the above composition in the preparation of a kit for detecting novel human circoviruses.

[0013] This invention also provides a method for detecting novel human circovirus in a sample for non-diagnostic purposes, comprising the following steps: amplifying the sample using the above-described composition, and determining the presence or absence of novel human circovirus in the sample based on the amplification results; when the amplification results show that the Ct value of the FAM channel is ≤39 and the curve shows obvious exponential growth, it is determined to be positive for novel human circovirus; when the Ct value is >40 or there is no Ct value and no obvious amplification curve, it is determined to be negative; when 39 < Ct value ≤40, it is determined to be suspicious and retested for confirmation.

[0014] Preferably, the amplification is performed by real-time quantitative PCR.

[0015] More preferably, the sample is selected from human biological samples.

[0016] More preferably, the sample is a serum sample, a plasma sample, or a liver tissue sample.

[0017] Compared with the prior art, the present invention has the following beneficial effects: (1) High sensitivity: This invention achieves specific amplification of the conserved region of the Rep gene through optimized primer and probe design, with a limit of detection (LOD) of 0.6 copies / mL. The standard curve shows the coefficient of determination (R²). 2 The detection limit was 0.999, and the amplification efficiency was 96.14%, maintaining good linearity even at low concentrations. Compared with previously reported LAMP methods (detection limits of approximately 1.96–2.56 copies / mL), the sensitivity was significantly improved.

[0018] (2) High specificity: The primer-probe combination is designed for conserved regions of the Rep gene, exhibiting high species specificity. Rep gene targets were screened through bioinformatics comparisons, and experimental verification confirmed no cross-reactivity with porcine circovirus type 1 (PCV1), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), porcine circovirus type 4 (PCV4), human fecal-associated circovirus (HuStAsCV), hepatitis B virus (HBV), hepatitis C virus (HCV), influenza A H1N1 virus (H1N1), and influenza A H3N2 virus (H3N2). The tested viruses covered closely related to the circovirus family and common human pathogens. Results showed that only the novel human circovirus produced a specific fluorescent signal; negative controls and non-target viruses showed no amplification.

[0019] (3) High amplification efficiency and accurate quantification: The amplification efficiency of the method of the present invention is 96.14%, which is in the optimal range of 90%-105%, and can realize the absolute quantification of viral load in clinical samples, especially suitable for accurate detection of samples with low viral load.

[0020] (4) Fast and efficient: The entire testing process is completed within 2 hours. Combined with the closed-tube operation design, it can effectively reduce the risk of contamination and improve testing efficiency.

[0021] (5) Good repeatability: The intra-batch coefficient of variation is 0.013%~0.138%, the inter-batch coefficient of variation is 1.765%~3.463%, and the standard deviation ranges from 0.004 to 0.772, indicating that the method has good repeatability and the results are stable and reliable, and it is suitable for high-throughput detection scenarios.

[0022] (6) Wide range of applications: The primer-probe combination or kit of the present invention can be used to prepare reagents for detecting novel human circoviruses, detect pathogens in clinical samples, screen blood products, and for scientific research or epidemiological investigations for non-diagnostic purposes. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the standard curve for the novel human circovirus qPCR detection in Example 2.

[0024] Figure 2 This is a schematic diagram of the sensitivity analysis of the novel human circovirus qPCR detection in Example 2.

[0025] Figure 3 This is a schematic diagram of the specificity analysis of the novel human circovirus qPCR detection in Example 3. Detailed Implementation

[0026] Example 1

[0027] Primer and probe design and synthesis: The complete genome sequence of a representative strain of novel human circovirus (HuCV) was obtained from GenBank. Simultaneously, reference strain sequences of circoviruses for specific alignment were downloaded, including porcine circovirus type 1 (PCV1, accession number: AF071879), porcine circovirus type 2 (PCV2 JX0301, accession number: AY651850), and four strains of porcine circovirus type 3 (PCV3 CH / GX / 2051A / 2018, accession number: MK095623; PCV3 99, accession number: MK496297; PCV3PCV3-CN2018JL-1, accession number: MH277112; PCV3...). 94, accession number: MK496292), porcine circovirus type 4 (PCV4HNU-AHG1-2019, accession number: MK986820) and human fecal-associated circovirus (HuStAsCV NG13, accession number: GQ404856).

[0028] After performing multiple sequence alignment of the above nucleotide sequences using DNAMAN software (Lynnon Biosoft, USA), the highly conserved region of the Rep gene was identified. Three pairs of primers and nine TaqMan probes specifically targeting the novel human circovirus Rep gene were designed using Primer Premier 5 software (Premier Laboratories, Canada). The specificity of the primers and probes was verified using the Basic Local Alignment Search (BLAST) tool, and they were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Through experimental screening, one pair of primers and one probe with the best performance were finally obtained for TaqMan-based real-time quantitative PCR detection. The sequences are as follows: SEQ ID NO.1 (upstream primer): GCGTGCTCACTTAGAAGCGGC; SEQ ID NO.2 (downstream primer): AAGCCTCGCAACACACTTCA; SEQ ID NO.3 (probe): GATTTGGAGACAGCAGCGAAGATACTGAATCC; The probe is labeled with the nucleotide sequence of 6-FAM at the 5' end and BHQ1 at the 3' end: FAM-GATTTGGAGACAGCAGCGAAGATACTGAATCC-BHQ1. Example 2

[0029] Standard curve establishment and sensitivity testing: The recombinant plasmid pUC57-Rep, containing the target fragment of the novel human circovirus Rep gene, was serially diluted 10-fold, with concentrations ranging from 6 × 10⁻⁶. 6 copies / mL to 6×10 -1 Copies / mL were used as templates for amplification using this method. Real-time quantitative PCR based on TaqMan probes was performed using the AceQ Universal U+Probe Master Mix V2 kit (Nanjing Novizan Biotechnology Co., Ltd.) on an Applied Biosystems QuantStudio 7 Pro real-time quantitative PCR system (Applied Biosystems, Inc.). The reaction mixture consisted of: 10 mL 2×Master Mix, 0.4 mL upstream primer (10 mM), 0.4 mL downstream primer (10 mM), 0.2 mL probe (10 mM), 2 mL template DNA, and 7 mL ddH2O. The amplification program was: 37℃ for 2 min for contamination digestion, 95℃ for 5 min for pre-denaturation, followed by 45 cycles of 95℃ denaturation for 10 sec and 60℃ annealing and extension for 30 sec. Results are shown below. Figure 1 , Figure 2 As shown, the standard curve equation is Y = -3.418X + 40.908, and the coefficient of determination R0 is... 2 The value was 0.999, the amplification efficiency was 96.14%, and the limit of detection was 0.6 copies / mL. Example 3

[0030] Specificity testing: Nucleic acids from porcine circovirus type 1 (PCV1), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), porcine circovirus type 4 (PCV4), human fecal-associated circovirus (HuStAsCV), hepatitis B virus (HBV), hepatitis C virus (HCV), influenza A H1N1 virus (H1N1), and influenza A H3N2 virus (H3N2) were used as templates. A novel human circovirus recombinant plasmid was used as a positive control, and nuclease-free water was used as a negative control. Real-time quantitative PCR was performed for detection. Results are as follows: Figure 3As shown in the figure, the three positive amplification curves are three replicates of the same novel human circovirus sample. Only the novel human circovirus positive control produced a specific amplification curve, while other viruses and the negative control did not show any amplification signal, indicating that this method has high specificity and no cross-reaction with closely related viruses and other common pathogens.

[0031] The criterion for determining a positive result is based on the Ct value, as follows: (1) If the Ct value of the FAM channel is ≤39 and the curve shows obvious exponential growth, it is judged as positive, indicating that the novel human circovirus was detected in the sample.

[0032] (2) If the FAM channel has no Ct value and no obvious amplification curve, it is judged as negative, indicating that the novel human circovirus was not detected in the sample.

[0033] (3) If the Ct value of FAM channel 39 < ≤ 40, it is considered suspicious and the sample should be retested. If the retest result is still Ct value ≤ 40 and shows a typical amplification curve, it is considered positive; otherwise, it is considered negative.

[0034] Table 1

[0035] Note: "-" indicates that a reference strain with a specific accession number was not used, and a clinically positive sample confirmed by sequencing was used as a template. Example 4

[0036] Repeatability testing: for high, medium, and low concentrations (6×10⁻⁶) 5 6×10 3 and 6×10 1 The plasmid pUC57-Rep (copies / mL) was used for intra- and inter-batch repeatability testing. The results are shown in Table 2. The intra-batch coefficient of variation (CV) was 0.013%~0.138%, and the inter-batch coefficient of variation (CV) was 1.765%~3.463%, indicating that the method has good repeatability and the results are stable and reliable.

[0037] Table 2 Example 5

[0038] The qPCR detection method established in this invention was used to test serum / plasma samples from 154 individuals with abnormal liver function. Samples were collected from Shanxi Bethune Hospital and the Central Hospital of China Railway 17th Bureau Group Co., Ltd., and all sample collection was approved with informed consent and by the ethics committee.

[0039] DNA extraction from serum / plasma samples: Take 200 mL of serum sample, add lysis buffer containing proteinase K, and digest overnight at 55°C (approximately 2 hours). Extract using Tris-saturated phenol-chloroform-isoamyl alcohol (25:24:1), mix vigorously, centrifuge, carefully aspirate the supernatant, add isopropanol to precipitate DNA, wash twice with 75% ethanol, and dissolve the precipitate in TE buffer (pH 8.0). RNA extraction from viral fluid samples: Take 200 μL of viral fluid, add 1 mL of TRIzol reagent, vortex to mix, and let stand at room temperature for 5 minutes. Add 200 μL of chloroform, shake vigorously for 15 seconds, let stand at room temperature for 3 minutes, and then centrifuge at 12000 g for 15 minutes at 4°C. Transfer the upper aqueous phase to a new centrifuge tube, add an equal volume of isopropanol, mix, let stand at room temperature for 10 minutes, and centrifuge at 12000 g for 10 minutes at 4°C, discarding the supernatant. Wash the precipitate twice with 1 mL of 75% ethanol, centrifuge at 7500 g for 5 minutes at 4°C, discard the supernatant, and air dry at room temperature. Dissolve the precipitate in 20 μL of DEPC-treated water. Take 10 μL of the extracted RNA template, add 1 μL of random primers (50 μM) and 1 μL of dNTP mixture (10 mM), heat at 65°C for 5 minutes, and then quench on ice. Add 4 μL of 5× reverse transcription buffer, 1 μL of LRNase inhibitor (40 U / μL), and 1 μL of reverse transcriptase (200 U / μL) sequentially, and then bring the volume to 20 μL with DEPC-treated water. The reaction conditions were: 25℃ for 5 minutes, 55℃ for 60 minutes, and 70℃ for 15 minutes to terminate the reaction. The resulting cDNA was stored at -20℃ for later use.

[0040] The qPCR reaction system consisted of: 10 mL 2×Master Mix, 0.4 mL upstream primer (10 mM), 0.4 mL downstream primer (10 mM), 0.2 mL probe (10 mM), 2 mL template DNA, and 7 mL ddH2O. The amplification program was: 37℃ for 2 min (contamination digestion); 95℃ for 5 min (pre-denaturation); 95℃ for 10 sec, 60℃ for 30 sec, for a total of 45 cycles. A positive control (6×10⁻⁶) was included in each batch of tests. 3The test included a standard of recombinant plasmid (copies / mL) and a negative control (nuclease-free water). The result interpretation criteria were as follows: a Ct value ≤ 39 in the FAM channel and a typical S-shaped amplification curve indicated a positive result; a Ct value > 40 or no typical amplification curve indicated a negative result; a Ct value < 39 < Ct value ≤ 40 indicated a suspicious result, requiring retesting. If the retest result still showed a Ct value ≤ 40 and a typical amplification curve, it was considered positive; otherwise, it was negative. The test results showed that a total of 4 HuCV positive samples were detected, with a positive rate of 2.60%. All positive samples had Ct values ​​< 39 and exhibited typical amplification curves. Sequencing verification of the positive samples confirmed them to be novel human circovirus.

[0041] Table 3 Analysis of qPCR results for clinical samples

[0042] Note: 1. In the qPCR results, "+" indicates the detection of novel human porcine circovirus, and "-" indicates the absence of novel human porcine circovirus; 2. The units for ALT and AST are (U / L), and "-" indicates that the indicator was not detected. Example 6

[0043] Performance comparison of the method of this invention with reported primers and probes Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd., referring to the primer and probe sequences in the previously reported literature (WU S, YIP CC, SITU J, et al. Human Circovirus in Patients with Hepatitis, Hong Kong [J]. Emerg Infect Dis, 2024, 30(12): 2521-31.). The recombinant plasmid pUC57-Rep was serially diluted 10-fold (6×10⁻⁶) to a specific density. 6 copies / mL ~ 6×10 -1 Using copies / mL as templates, real-time quantitative PCR detection was performed using the primer-probe combination of the present invention and the above-mentioned reference primer-probe combination under the same reaction system and amplification program.

[0044] The results show that the standard curve equation of the method of this invention is Y = -3.418X + 40.908, R 2 =0.999, the amplification efficiency is 96.14%; the amplification efficiency of the reference primer probe is 86.75%. The amplification efficiency of the method of this invention is within the optimal range of 90%-105%.

[0045] In addition, 154 clinical samples were selected for parallel testing, and the results of the two methods are shown in Table 4. The results showed that the method of this invention (Method A) detected 4 positive samples, while the reference method (Method B) detected 1 positive sample. Using Method B as the gold standard, the positive concordance rate (PPA) of the method of this invention (Method A) was 100%, the negative concordance rate (NPA) was 98.04%, the overall concordance rate was 98.05%, and the Kappa value was 0.407. Sequencing verification was performed on 3 samples with inconsistent results (Method A positive, Method B negative), confirming that they were positive for a novel human circovirus, suggesting that the sensitivity of the method of this invention may be higher than that of previously reported methods.

[0046] Table 4

[0047] Note: "Method A" refers to this method, and "Method B" refers to a method reported in the literature.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. A composition, characterized in that, It comprises: a forward primer, a reverse primer, and a probe for detecting a novel human circovirus; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2, and the nucleotide sequence of the probe is shown in SEQ ID NO.

3.

2. The composition according to claim 1, characterized in that, The probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

3. The composition according to claim 2, characterized in that, The fluorescent reporter group is selected from 6-FAM, HEX or ROX, and the fluorescent quencher group is selected from BHQ1 or BHQ2.

4. The composition according to any one of claims 1 to 3, characterized in that, The probe is labeled 6-FAM at the 5' end and BHQ1 at the 3' end.

5. A reagent kit, characterized in that, It comprises the composition according to any one of claims 1 to 3.

6. The use of the composition according to any one of claims 1 to 3 in the preparation of a kit for detecting novel human circovirus.

7. A method for detecting novel human circoviruses in samples for non-diagnostic purposes, characterized in that, The method includes the following steps: amplifying the sample using the composition of any one of claims 1 to 3, and determining the presence or absence of a novel human circovirus in the sample based on the amplification results.

8. The method according to claim 7, characterized in that, The amplification was performed using real-time quantitative PCR.

9. The method according to claim 8, characterized in that, The samples were selected from human biological samples.

10. The method according to claim 9, characterized in that, The sample may be a serum sample, a plasma sample, or a liver tissue sample.