Use of slfn5 inhibitors in the preparation of a medicament for the prevention and / or treatment of aortic dissection

By using SLFN5 inhibitors, especially siRNA or CRISPR/Cas9 systems, to target and inhibit the expression of the SLFN5 gene or protein, the high mortality rate of aortic dissection has been addressed, providing new therapeutic targets, reducing inflammatory responses, and achieving effective prevention and treatment.

CN122461331APending Publication Date: 2026-07-28BEIJING FRIENDSHIP HOSPITAL CAPITAL MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING FRIENDSHIP HOSPITAL CAPITAL MEDICAL UNIV
Filing Date
2026-05-12
Publication Date
2026-07-28

AI Technical Summary

Technical Problem

Current technologies for treating aortic dissection still have a high mortality rate, and the pathogenesis of the disease is not fully understood, with a lack of effective targets for prevention and treatment.

Method used

SLFN5 inhibitors, including siRNA or CRISPR/Cas9 gene editing systems, are used to target and inhibit the expression of the SLFN5 gene or protein. These inhibitors are then used to prepare drugs such as oral solutions and injections for the prevention and treatment of aortic dissection.

Benefits of technology

It effectively inhibits the formation of aortic dissection, reduces mortality, and provides a new therapeutic target by regulating the secretion of cytokines in aortic adventitia fibroblasts and reducing inflammatory responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides application of an SLFN5 inhibitor in preparation of a drug for preventing and / or treating aortic dissection, and belongs to the technical field of aortic dissection prevention and treatment.The application provides application of an SLFN5 inhibitor in preparation of a drug for preventing and / or treating aortic dissection, and first proposes that SLFN5 genes or SLFN5 proteins can be used as target points for preparation of a drug for preventing and / or treating aortic dissection.The application first proposes that overexpression of SLFN5 promotes formation of aortic dissection and degradation of elastic fibers of a mouse induced by 3-aminopropionitrile fumarate (BAPN); and knockdown of SLFN5 inhibits formation of aortic dissection and degradation of elastic fibers of a mouse induced by BAPN.The application uses SLFN5 as a target point for preparation of a drug for preventing and / or treating aortic dissection, can effectively prevent and / or treat aortic dissection, and provides a new target point for treating aortic dissection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of aortic dissection prevention and treatment technology, specifically involving the application of SLFN5 inhibitors in the preparation of drugs for the prevention and / or treatment of aortic dissection. Background Technology

[0002] Aortic dissection (AD) is a serious and potentially fatal cardiovascular disease. It occurs when blood from within the aorta enters the tunica media through a tear in the intima, causing separation of the tunica media and creating a false lumen – a separation between the true and false lumens. Clinically, AD is classified into two types based on whether the ascending aorta is involved: Stanford type A and Stanford type B. Stanford type A AD involves the ascending aorta and is considered high-risk, requiring immediate surgery, while Stanford type B AD can be treated with interventional procedures. Although significant progress has been made in AD treatment due to advancements in technology and surgical techniques, the mortality rate remains high. While research into the etiology of AD has made some progress, its specific pathogenesis still requires further investigation. Therefore, actively studying its causes and pathological mechanisms, and identifying therapeutic targets for aortic dissection, is crucial for the effective prevention and treatment of this disease. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide the use of SLFN5 (Schlafen family member 5) inhibitors in the preparation of drugs for the prevention and / or treatment of aortic dissection.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the use of SLFN5 inhibitors in the preparation of drugs for the prevention and / or treatment of aortic dissection.

[0005] Preferably, the SLFN5 inhibitor comprises siRNA or a CRISPR / Cas9 gene editing system.

[0006] Preferably, the siRNA includes siRNA1 and siRNA2, the nucleotide sequence of siRNA1 is shown in SEQ ID NO.1~SEQ ID NO.2, and the nucleotide sequence of siRNA2 is shown in SEQ ID NO.3~SEQ ID NO.4.

[0007] Preferably, the CRISPR / Cas9 gene editing system contains sgRNA targeting the SLFN5 gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.5~SEQ ID NO.6.

[0008] The present invention also provides a drug that can prevent and / or treat aortic dissection, said drug being able to inhibit the expression of the SLFN5 gene or SLFN5 protein.

[0009] Preferably, the active ingredient of the drug includes siRNA or sgRNA targeting the SLFN5 gene; the siRNA includes siRNA1 and siRNA2, the nucleotide sequence of siRNA1 is shown in SEQ ID NO.1~SEQ ID NO.2, and the nucleotide sequence of siRNA2 is shown in SEQ ID NO.3~SEQ ID NO.4.

[0010] Preferably, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.5~SEQ ID NO.6.

[0011] Preferably, the dosage form of the drug includes oral liquid, injection, tablet, pill, dispersant, capsule or granule.

[0012] The present invention also provides a method for constructing a model of aortic dissection disease, including the step of overexpressing the SLFN5 gene in vivo.

[0013] The present invention also provides a method for screening drugs for the prevention and treatment of aortic dissection, which involves detecting the effect of the drug on the expression level of SLFN5 gene or protein. If the drug can reduce the expression level of SLFN5 gene or protein, it indicates that the drug has a potential effect on the prevention and treatment of aortic dissection.

[0014] The beneficial effects of this invention are: This invention is the first to propose that SLFN5 overexpression promotes BAPN-induced aortic dissection formation and elastic fiber degradation in mice; while SLFN5 knockdown inhibits BAPN-induced aortic dissection formation and elastic fiber degradation. Mechanistically, SLFN5 exerts its effect by regulating cytokine secretion in aortic adventitia fibroblasts, promoting the secretion of inflammatory factors by these cells. This invention uses SLFN5 as a target to prepare drugs for the prevention and / or treatment of aortic dissection, effectively preventing and / or treating the condition. This invention provides a novel target for the treatment of aortic dissection. Attached Figure Description

[0015] Figure 1The expression levels of SLFN5 in patients with aortic dissection and mice with aortic dissection models are shown in Figure 1. A represents the intersection of proteomic and transcriptomic sequencing results from the mouse aortic dissection model; B is a heatmap of 16 differentially expressed genes from the intersection of A; C shows the changes in mRNA expression levels of Acp5, Slfn5, and Fap in the aortic tissue of control mice and mice with aortic dissection models; D shows single-cell sequencing results of aortic tissue from control mice (left) and mice with aortic dissection models (right); E shows the changes in SLFN5 expression levels in fibroblasts, macrophages, and endothelial cells (ECs) in the aortic tissue of control mice (Water) and mice with aortic dissection models (BAPN); F shows the expression levels of GS... The changes in SLFN5 expression levels in aortic dissection tissues of patients with aortic dissection (E153434 database) and healthy individuals (G represents the changes in SLFN5 expression levels in aortic dissection tissues of patients with aortic dissection (GSE57691 database); H represents the mRNA level of SLFN5 in aortic tissues of patients with aortic dissection (GSE57691 database) and healthy individuals undergoing coronary artery bypass grafting (CABG); I represents the Western blot of SLFN5 in aortic tissues of patients with aortic dissection (GSE57691 database) and healthy individuals undergoing CABG. Western blotting results (top) and quantitative protein expression level (bottom); J represents the mRNA level of Slfn5 in the aortic tissue of control mice (Water) and aortic dissection model mice (BAPN); K represents the Western blotting results of SLFN5 in the aortic tissue of control mice (Water) and aortic dissection model mice (BAPN) (top) and quantitative protein expression level (bottom).

[0016] Figure 2 To eliminate the effect of SLFN5 knockout on the occurrence of aortic dissection; where A represents SLFN5. KO A) Schematic diagram of gene editing during mouse model construction; B) Schematic diagram of BAPN-induced mouse aortic dissection model construction; C) Representative mouse aortic dissection images under stereomicroscopy; D) Slfn5 KO Survival curve analysis of littermate control mice after 4 weeks of BAPN feeding and sterile water feeding. Note: The green and orange lines overlapped; E represents Slfn5. KO The incidence of aortic dissection in mice and littermate control mice after 4 weeks of BAPN feeding; F represents the H&E and EVG staining results of mouse aortic tissue; G represents the statistical results of the degree of degradation and breakage of membrane elastic fibers in mouse aortic tissue.

[0017] Figure 3 The study investigated the effect of SLFN5 overexpression on aortic dissection. A shows representative mouse aortic dissection images under a stereomicroscope; B shows survival curves of SLFN5-overexpressing and littermate control mice after 4 weeks of BAPN and sterile water feeding (note: the green and orange lines overlap); C shows the incidence of aortic dissection in SLFN5-overexpressing and littermate control mice after 4 weeks of BAPN feeding; D shows H&E and EVG staining results of mouse aortic tissue; and E shows the statistical results of the degree of degradation and breakage of membrane elastic fibers in mouse aortic tissue.

[0018] Figure 4 The effect of SLFN5 overexpression on cytokine secretion in human aortic adventitia fibroblasts is shown in the following diagrams: A) Heatmap of differentially expressed genes in SLFN5-overexpressing human aortic adventitia fibroblasts compared to the control group; B) Enrichment of differentially expressed genes downregulated in SLFN5-knockdown and ... Intersection of secreted proteins downregulated after N5 knockdown and upregulated after overexpression; F shows the mRNA levels of CCL2, IL-6, LIF, and GDF5 in the aortic tissue of patients with aortic dissection (AD) and patients who underwent coronary artery bypass grafting and aortic perforation (Health); G shows the mRNA levels of SLFN5, CCL2, IL-6, LIF, and GDF5 in SLFN5-overexpressing fibroblasts (Ad-SLFN5) and the control group (Ad-LacZ); H shows the Western blotting results (top) and quantitative protein expression levels (bottom) of SLFN5, CCL2, IL-6, LIF, and GDF5 in SLFN5-overexpressing fibroblasts (Ad-SLFN5) and the control group (Ad-LacZ).

[0019] Figure 5The effects of SLFN5 on the RSAD2-TRAF6 pathway are shown in Figure A. A represents the combined analysis of upregulated differentially expressed genes in SLFN5 transcriptome sequencing and CUT&Tag sequencing in human aortic adventitia fibroblasts. B represents the combined analysis of downregulated differentially expressed genes in SLFN5 transcriptome sequencing and CUT&Tag sequencing in human aortic adventitia fibroblasts. C represents the Western blotting results (top) and protein expression level quantification (bottom) of SLFN5, RSAD2, TRAF6, and IKBKG in human aortic adventitia fibroblasts overexpressing SLFN5 (Ad-SLFN5) and the control group (Ad-LacZ). D represents the mRNA levels of SLFN5, RSAD2, TRAF6, and IKBKG in human aortic adventitia fibroblasts overexpressing SLFN5 (Ad-SLFN5) and the control group (Ad-LacZ). Detailed Implementation

[0020] This invention provides the use of SLFN5 inhibitors in the preparation of drugs for the prevention and / or treatment of aortic dissection.

[0021] In this invention, the SLFN5 gene sequence number is NCBI GENE ID: 162394. This invention is the first to propose that the SLFN5 (Slfn5) gene or SLFN5 (Slfn5) protein can be used as a target for the preparation of drugs to prevent and / or treat aortic dissection. In this invention, the SLFN5 gene or protein is knocked down or its expression level is reduced to prevent and / or treat aortic dissection. This invention is the first to propose that the SLFN5 gene or protein is upregulated in the aortic tissue of BAPN-induced aortic dissection model mice and patients with aortic dissection. Mice with SLFN5 knockdown exhibited lower ascending aortic dilation and mortality, and a significantly reduced number of ruptured medial elastic fibers, indicating that SLFN5 knockdown can inhibit BAPN-induced aortic dissection formation in mice. Mice with SLFN5 overexpression exhibited higher ascending aortic dilation and mortality, and a significantly increased number of ruptured medial elastic fibers, indicating that SLFN5 overexpression promotes BAPN-induced aortic dissection formation in mice. Mechanistically, SLFN5 exerts its effects by influencing the inflammatory response of the aortic wall. SLFN5 promotes the secretion of inflammatory factors such as CCL2 by aortic adventitia fibroblasts, while knocking down SLFN5 inhibits this phenomenon, indicating that the present invention provides a new target for the treatment of aortic dissection.

[0022] In this invention, the SLFN5 inhibitor preferably comprises siRNA or a CRISPR / Cas9 gene editing system. The siRNA preferably comprises siRNA1 and siRNA2, the nucleotide sequence of siRNA1 preferably being shown in SEQ ID NO.1~SEQ ID NO.2, and the nucleotide sequence of siRNA2 preferably being shown in SEQ ID NO.3~SEQ ID NO.4. In this invention, the CRISPR / Cas9 gene editing system preferably comprises sgRNA targeting the SLFN5 gene, the nucleotide sequence of which is preferably shown in SEQ ID NO.5~SEQ ID NO.6.

[0023] The present invention also provides a drug that can prevent and / or treat aortic dissection, said drug being able to inhibit the expression of the SLFN5 gene or SLFN5 protein.

[0024] In the medicament of this invention, the active ingredient preferably includes siRNA or sgRNA targeting the SLFN5 gene; the siRNA preferably includes siRNA1 and siRNA2, the nucleotide sequence of siRNA1 is preferably as shown in SEQ ID NO.1~SEQ ID NO.2, the nucleotide sequence of siRNA2 is preferably as shown in SEQ ID NO.3~SEQ ID NO.4, and the nucleotide sequence of sgRNA is preferably as shown in SEQ ID NO.5~SEQ ID NO.6. In this invention, the dosage form of the medicament preferably includes oral liquid, injection, tablet, pill, dispersant, capsule, or granule. This invention does not have specific limitations on the excipients in the medicament; any pharmaceutical excipient that does not affect the efficacy of the active ingredient can be used.

[0025] This invention also provides a method for constructing an aortic dissection disease model, including the step of overexpressing the SLFN5 gene in vivo. In this invention, the vector used for overexpression is preferably an adeno-associated virus (AAV) vector. This invention does not specifically limit the method for cloning the SLFN5 cDNA into the AAV expression vector; conventional cloning methods in the art can be used.

[0026] This invention also provides a method for screening drugs for the prevention and treatment of aortic dissection, which involves detecting the effect of the drug on the expression level of the SLFN5 gene or protein. If the drug can reduce the expression level of the SLFN5 gene or protein, it indicates that the drug has a potential effect on the prevention and treatment of aortic dissection. This invention does not specifically limit the method for detecting the effect of the drug on the expression level of the SLFN5 gene or protein; conventional detection methods in the art can be used.

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Unless otherwise specified, the following embodiments are all conventional methods.

[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0030] Example 1 (1) Screening of differentially expressed genes First, a mouse model of aortic dissection was established: Three-week-old wild-type C57 mice were fed drinking water with a 0.25% solution of 3-aminopropionitrile fumarate (BAPN) (2.5g BAPN per 1L of sterile water, Sigma-Aldrich, A3134-25G). After four weeks of feeding, the mice were sacrificed and designated as the WT+BAPN group (also labeled the BAPN group). Three-week-old littermate wild-type C57 mice fed drinking water without BAPN for four weeks served as the control group, designated as the WT group (also labeled the Sham group). The model construction process is as follows: Figure 2 As shown in Figure B. Mouse aortic tissue was subjected to mass spectrometry and transcriptomics sequencing. The intersection of the mass spectrometry and transcriptomics sequencing results was obtained, as shown in Figure B. Figure 1 As shown in Figure A, the expression of 16 differentially expressed genes in the intersection was analyzed, and the results are as follows: Figure 1 As shown in Figure B, the top three genes are Acp5, Slfn5, and Fap. The mRNA levels of Acp5, Slfn5, and Fap were detected in mouse aortic tissue, and the results are as follows. Figure 1 As shown in Figure C, among the three genes, Slfn5 expression was upregulated most significantly. Single-cell sequencing was performed on mouse aortic tissue, and the results are as follows. Figure 1 As shown in D and E, Slfn5 expression was most significantly upregulated in fibroblasts. Subsequent analysis of the GSE database (GSE153434, GSE57691) of aortic dissection patients yielded the following results: Figure 1 As shown in F and G, SLFN5 is upregulated in the aortic tissue of patients with aortic dissection.

[0031] (2) Expression level of SLFN5 in aortic tissue of patients with aortic dissection To confirm the changes of SLFN5 in aortic dissection, the mRNA and protein expression levels of SLFN5 in aortic tissue were examined in patients with aortic dissection (AD) and patients who underwent coronary artery bypass grafting with aortic perforation (Healthy). The results are as follows: Figure 1 As shown in H and I. The results indicate that SLFN5 protein expression is upregulated in AD patients.

[0032] (3) Expression level of SLFN5 in aortic tissue of mice with aortic dissection Aortic dissection model mice were constructed using the same method as described above (same step (1)), designated as the BAPN group. Three-week-old age-matched wild-type C57 mice fed with water without BAPN for four weeks served as the control group, designated as the Water group. Whole aortic tissue was collected from both groups of mice, flash-frozen in liquid nitrogen, and a portion was used to extract RNA for qPCR detection of SLFN5 mRNA levels; the remaining portion was used to extract protein for Western blotting detection of SLFN5 protein levels. The results are as follows: Figure 1 As shown in J and K. The results showed that the mRNA and protein levels of SLFN5 were upregulated in the aortic tissue of mice with aortic dissection.

[0033] The above results indicate that SLFN5 is upregulated in the aortic tissue of patients with aortic dissection and mice with a BAPN-induced aortic dissection model, and the upregulation is most significant in aortic adventitia fibroblasts.

[0034] Example 2 (1) SLFN5 knockout mice Slfn5 KO Construction: To investigate the function of SLFN5 in aortic dissection formation, a mouse model with systemic SLFN5 knockout was constructed. KO First, based on the SLFN5 genome structure and conserved regions of protein function, Exon3 was identified and selected as the knockout region. This region contains the start codon ATG. Knocking out this region leads to the loss of function of the SLFN5 protein. The Slfn5 gene knockout mouse model was established by knocking out Exon3 of the Slfn5 gene using CRISPR / Cas9 technology. The sequence of sgRNA1 is: CTCGGGTCATCTGTAAAACCTGG (SEQ ID NO.5), and the sequence of sgRNA2 is: GTCCCGTTAGAGGTTGATGCGGG (SEQ ID NO.6). A schematic diagram of the gene editing is shown below. Figure 2 As shown in Figure A. The specific procedure is as follows: The CRISPR / Cas9 system was microinjected into the fertilized eggs of C57BL / 6JGpt mice. Positive F0 generation mice were obtained after transplantation, and confirmed by PCR and sequencing. Stable F1 generation Slfn5 mice were successfully bred by mating positive F0 generation mice with C7BL / 6JGpt mice. KO Mouse model.

[0035] (2) Experimental grouping: 29 three-week-old Slfn5 mice were selected. KOMice and 29 age-matched wild-type (WT) mice served as controls; among them, 23 were Slfn5 mice. KO Mice and 23 WT mice were given BAPN (0.25% concentration) in drinking water for 4 weeks at 3 weeks of age, as follows: Figure 2 As shown in B, they are denoted as Slfn5. KO +BAPN group and WT+BAPN group; 6 Slfn5 KO Mice and 6 WT mice were fed sterile water for 4 weeks at 3 weeks of age, and were designated as Slfn5. KO +Water group (also marked as Slfn5) KO +Saline group or Slfn5 KO ) and WT+Water group (also labeled as WT+Saline group or WT).

[0036] (3) Experimental measurements: After 4 weeks of feeding, the entire aorta was photographed under a stereomicroscope, and the mortality rate and the incidence of aortic dissection were recorded. The results are as follows: Figure 2 C~ Figure 2 As shown in Figure E, BAPN induction can increase ascending aortic dilation and mortality; under BAPN induction conditions, compared with WT mice, Slfn5... KO Mice exhibited a lower incidence of aortic dissection and mortality.

[0037] Four groups of mice had their ascending aortas fixed, embedded in paraffin, and sectioned. H&E staining and EVG staining were performed to compare the differences in the rupture of vascular elastic fibers. The results are as follows: Figure 2 As shown in F and G. It can be seen that BAPN induction can significantly increase the rupture of medial elastic fibers; under BAPN induction conditions, compared with WT mice, Slfn5 KO The rupture of elastic fibers in the middle membrane of mice was significantly reduced.

[0038] The above results indicate that knocking out SLFN5 can inhibit aortic dissection formation.

[0039] Example 3 (1) Construction of SLFN5 overexpression mice: In order to investigate the function of SLFN5 in aortic dissection, transgenic mice Slfn5 overexpressing SLFN5 were constructed. TG The specific construction process is as follows: Slfn5 cDNA is cloned into an expression vector to obtain the transgenic Slfn5 construct (AAV-Slfn5). The Slfn5 construct (AAV-Slfn5) is then injected into a single-cell embryo of a C57BL / 6 mouse and further hybridized with C57BL / 6 mice to obtain the Slfn5 transgenic construct (Slfn5). TGMice. Simultaneously using Slfn5... TG Age-matched wild-type (WT) littermates of mice were used as controls.

[0040] (2) Experimental grouping: 20 three-week-old Slfn5 mice were selected. TG Mice and 20 littermate wild-type mice (WT) served as controls; among them, 15 were Slfn5 mice. TG Mice and 15 WT mice were given BAPN (0.25% concentration) in drinking water for 4 weeks at 3 weeks of age, and were designated as Slfn5. TG +BAPN group (also labeled AAV-Slfn5+BAPN group) and WT+BAPN group (also labeled AAV-null+BAPN group); 5 Slfn5 TG Mice and 5 WT mice were fed sterile water for 4 weeks as controls, denoted as Slfn5. TG +Water group (also labeled as AAV-Slfn5+Water group, AAV-Slfn5+Saline group or AAV-Slfn5 group) and WT+Water group (also labeled as AAV-null+Water group, AAV-null+Saline group or AAV-null group).

[0041] (3) Experimental measurements: Mice that had been fed for 4 weeks were used to take photographs of the entire aorta tissue under a stereomicroscope. The mortality rate and the incidence of aortic dissection in each group were recorded. The results are as follows: Figure 3 As shown in Figures A through C, BAPN induction can be seen to increase ascending aortic dilation and mortality; under BAPN induction conditions, compared with the control group (WT) mice, Slfn5... TG Increased incidence and mortality of aortic dissection in mice.

[0042] Four groups of mice had their ascending aortas fixed, embedded in paraffin, and sectioned. H&E staining and EVG staining were performed to compare the differences in the rupture of vascular elastic fibers. The results are as follows: Figure 3 As shown in D and E, BAPN induction significantly increases the breakage of medial elastic fibers; under BAPN induction conditions, compared to WT mice, Slfn5... TG The number of broken elastic fiber layers in the middle membrane of mice increased significantly.

[0043] The above results indicate that overexpression of SLFN5 promotes the formation of aortic dissection.

[0044] Example 4 The results of Examples 2 and 3 above confirmed that SLFN5 can promote the occurrence of aortic dissection in mice, but the mechanism is not yet clear. In this invention, SLFN5 was overexpressed and knocked down in human arterial adventitia fibroblasts (HAF), and RNA was extracted for transcriptomic sequencing to explore the mechanism by which SLFN5 promotes the occurrence of aortic dissection.

[0045] (1) Construction of HAF overexpressing SLFN5: HAF was transfected with Ad (adenovirus)-Slfn5 for 48 h to obtain HAF overexpressing SLFN5 (denoted as Ad-Slfn5 group, also labeled as SLFN5-OE); HAF was transfected with Ad-LacZ (referring to the control plasmid using adenovirus as a vector) for 48 h as a control (denoted as Ad-LacZ group). Transcriptomic sequencing was performed on RNA from both groups of cells, and the results are as follows. Figure 4 As shown in Figure A.

[0046] (2) Construction of SLFN5-knockdown HAFs: SLFN5 was knocked down by transfecting HAFs with siRNA (SLFN5-si) to obtain SLFN5-knockdown HAFs (referred to as the SLFN5-si group); HAFs transfected with scrambled sequences (where scrambled refers to sequences with the same composition as the target sequence but randomly arranged, not targeting any known gene or protein, used to exclude non-specific effects, and therefore used as a control) were used as controls (referred to as the Scrambled group); the SLFN5 si1 sense strand sequence was: GCGTTTACAGTTCGTATTTTT (SEQ ID NO.1), and the antisense strand sequence was: AAAATACGAACTGTAAACGCTC (SEQ ID NO.2); the SLFN5 si2 sense strand sequence was: GGAATGGTTATTCTCTGAATT (SEQ ID NO.3), and the antisense strand sequence was: TTCAGAGAGATAACCATTCCGC (SEQ ID NO.3). NO.4); the scrambled sense strand sequence is: ATCTTGTCGACTAGTTATGTG (SEQ ID NO.7), and the antisense strand sequence is CACATAACTAGTCGACAAGAT (SEQ ID NO.8). Transcriptomic sequencing was performed on RNA from both groups of cells.

[0047] KEGG pathway enrichment analysis was performed on the transcriptomics sequencing results, and the results are as follows: Figure 4As shown in Figures B and C, the cytokine interaction pathway was enriched in differentially regulated genes after SLFN5 overexpression in HAF, and enriched in differentially regulated genes after SLFN5 knockdown. This suggests that this pathway may be a key pathway by which SLFN5 affects aortic dissection.

[0048] The intersection of differentially expressed genes upregulated by SLFN5 and enriched in the cytokine interaction pathway after HAF overexpression and differentially expressed genes downregulated by SLFN5 and enriched in the cytokine interaction pathway was performed, and the results are as follows: Figure 4 As shown in Figure D, eight differentially expressed genes were identified through the intersection. Since cell-cell interactions are mostly mediated through secretory proteins, secretory proteins from the differentially expressed genes in the transcriptomic sequencing results were screened. The intersection of secretory proteins upregulated by HAF overexpression of SLFN5 and downregulated by SLFN5 knockdown was also analyzed. The results are shown below. Figure 4 As shown in Figure E, 11 secreted proteins were found at the intersection, among which IL-6, CCL2, LIF, and GDF5 were found to be related to... Figure 4 The analysis results of D overlap.

[0049] To further screen the analysis results, aortic tissue was extracted from patients with aortic dissection (AD) and patients who underwent coronary artery bypass grafting with aortic perforation (Health). RNA was extracted, and the mRNA levels of IL-6, CCL2, LIF, and GDF5 were detected. The results are as follows: Figure 4 As shown in Figure F. SLFN5 was overexpressed in HAF. The mRNA levels of IL-6, CCL2, LIF, GDF5, and SLFN5 were detected by qPCR, and the protein levels of IL-6, CCL2, LIF, GDF5, and SLFN5 were detected by Western blotting. The results are shown in Figure F. Figure 4 As shown in G and H. The results indicate that SLFN5 overexpression significantly upregulated the expression of inflammatory factors IL-6, CCL2, LIF, and GDF5. The above results suggest that SLFN5 may influence the occurrence of aortic dissection by affecting the expression of inflammatory factors such as IL-6, CCL2, LIF, and GDF5.

[0050] Example 5 To investigate the mechanism by which SLFN5 promotes the expression of inflammatory factors IL-6, CCL2, LIF, and GDF5, thereby contributing to aortic dissection, SLFN5 was overexpressed and knocked down in human arterial adventitia fibroblasts (HAF) (using the same method as in Example 4). CUT & Tag sequencing was performed, and the sequencing results were combined with the transcriptomic sequencing results from Example 4 for analysis. The results are as follows: Figure 5 As shown in Figures A and B, the results indicate that RSAD2 is the gene with the most significant variation among all differentially expressed genes.

[0051] To further validate the sequencing results, SLFN5 was overexpressed in HAF, and the protein levels of SLFN5, RSAD2, TRAF6, and IKBKG were detected by Western blotting. The results are as follows: Figure 5 As shown in Figure C; the mRNA levels of SLFN5, RSAD2, TRAF6, and IKBKG were detected by qPCR, and the results are as follows. Figure 5 As shown in Figure D. The results showed that after HAF overexpression of SLFN5, the expression levels of RSAD2 and TRAF6 proteins and mRNAs increased significantly, while the expression levels of IKBKG proteins and mRNAs decreased significantly.

[0052] The above results indicate that aortic adventitia fibroblasts SLFN5 promote the secretion of inflammatory factors such as IL-6, CCL2, LIF, and GDF5 by activating the RSAD2-TRAF6 pathway and inhibiting IKBKG expression, thereby ultimately promoting the occurrence of aortic dissection.

[0053] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of SLFN5 inhibitors in the preparation of drugs for the prevention and / or treatment of aortic dissection.

2. The application according to claim 1, characterized in that, The SLFN5 inhibitors include siRNA or CRISPR / Cas9 gene editing systems.

3. The application according to claim 2, characterized in that, The siRNA includes siRNA1 and siRNA2, the nucleotide sequence of siRNA1 is shown in SEQ ID NO.1~SEQ ID NO.2, and the nucleotide sequence of siRNA2 is shown in SEQ ID NO.3~SEQ ID NO.

4.

4. The application according to claim 2, characterized in that, The CRISPR / Cas9 gene editing system contains sgRNA targeting the SLFN5 gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.5~SEQ ID NO.

6.

5. A drug capable of preventing and / or treating aortic dissection, characterized in that, The drug can inhibit the expression of the SLFN5 gene or SLFN5 protein.

6. The drug according to claim 5, characterized in that, The active ingredient of the drug includes siRNA or sgRNA targeting the SLFN5 gene; the siRNA includes siRNA1 and siRNA2, the nucleotide sequence of siRNA1 is shown in SEQ ID NO.1~SEQ ID NO.2, and the nucleotide sequence of siRNA2 is shown in SEQ ID NO.3~SEQ ID NO.

4.

7. The drug according to claim 6, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.5~SEQ ID NO.

6.

8. The drug according to claim 5, characterized in that, The dosage forms of the drug include oral liquid, injection, tablet, pill, dispersant, capsule or granule.

9. A method for constructing a model of aortic dissection disease, characterized in that, This includes the step of overexpressing the SLFN5 gene in the body.

10. A method for screening drugs for the prevention and treatment of aortic dissection, characterized in that, The effect of the test drug on the expression level of SLFN5 gene or protein is detected. If the test drug can reduce the expression level of SLFN5 gene or protein, it indicates that the test drug has a potential role in the prevention and treatment of aortic dissection.