Agrostis stolonifera acdrebc gene and application thereof in promoting plant growth

Abstract

The application discloses an Agrostis stolonifera AcDREB1C gene and application thereof in promoting plant growth, and the AcDREB1C gene is screened from Agrostis stolonifera leaves. When the AcDREB1C gene is overexpressed in plants (such as rice), the plant height, root length, tiller number, leaf number, stem diameter, leaf length and leaf width can be increased, so that the plant growth is promoted. The application provides a new resource and method for functional development and molecular breeding of the AcDREB1C gene, and provides a solid technical foundation for improving the yield and quality of plants.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and plant breeding technology, specifically relating to the AcDREB1C gene of *Agropyron cristatum* and its application in promoting plant growth. Background Technology

[0002] *Agropyron cristatum*, a perennial xerophytic herb belonging to the genus *Agropyron* in the Poaceae family, possesses excellent characteristics such as drought resistance, cold tolerance, tolerance to poor soil, well-developed root system, early greening, and long green period. It is widely used in the restoration of degraded grasslands, vegetation reconstruction in sandy areas, and the establishment of artificial grasslands. *Agropyron cristatum* has abundant stress-resistant germplasm resources, with a large number of key genes for stress resistance and growth regulation in its genome, making it an excellent gene pool for crop trait improvement and molecular breeding. Currently, research on *Agropyron cristatum* mainly focuses on resource evaluation and the physiological mechanisms of stress resistance characteristics (such as drought resistance, cold resistance, and salt tolerance), while functional studies on genes related to growth and development are relatively rare. Therefore, exploring key gene resources for the growth and development of *Agropyron cristatum* and revealing its molecular regulatory mechanisms has significant theoretical and practical implications for promoting molecular marker-assisted breeding and gene editing breeding.

[0003] DREB transcription factors (dehydration responsive element-binding proteins) are core regulators of plant stress response and growth development. They establish a regulatory network by binding to cis-acting elements of dehydration responsive elements / C-repeat (DRE / CRT), activating the expression of downstream genes and playing a crucial role in regulating plant tolerance to abiotic stresses. A key characteristic is the presence of a conserved AP2 / EREBP domain (approximately 57–70 AA) in the DNA-binding region. They are mainly divided into four subfamilies: AP2, DREB, ERF, and RAV, with the DREB subfamily further subdivided into six classes (A1–A6). DREB transcription factors contain only one AP2 / EREBP domain, which includes two conserved regions, YRG and RAYD. Different DREB subgroups exhibit functional differences. Members of the A1 subgroup, namely the Dehydration responsive element binding 1 / C-repeat binding factor (DREB1 / CBF) family, are mainly associated with the expression of genes responding to low temperature stress. Members of the A2 to A6 subgroups are also related to abiotic stress and plant growth and development.

[0004] Since their identification, DREB transcription factors have been extensively explored and systematically studied in various plants. There are 21 in Arabidopsis thaliana, 31 in rice (Oryza sativa), and 6 in maize (Zea mays). Among them, DREB2A in Arabidopsis is a core gene regulating drought and salt stress tolerance. DREB2A interacts with a cis-acting dehydration response element (DRE) sequence, activating the expression of downstream genes responding to drought and salt stress in Arabidopsis. Currently, in rice, it has been confirmed that three homologous genes of DREB1 (DREB1A, DREB1B, and DREB1C) are induced to express during cold stress and, after binding to the GCC box in the promoter region of target genes, enhance the cold tolerance of rice plants.

[0005] Recent studies have shown that the DREB1C subfamily can simultaneously enhance stress resistance and promote growth, achieving the dual function of "stress resistance + high yield." In rice and wheat (Triticum aestivum), it has been proven to improve photosynthetic efficiency, nitrogen utilization, and increase yield and maturity, demonstrating significant breeding value. Currently, the exploration of stress resistance genes in *Agropyron cristatum* is severely insufficient, lacking genes, vectors, and transformation systems suitable for molecular breeding. The AcDREB1C gene has also not yet been cloned and its function elucidated. Therefore, cloning the *Agropyron cristatum* AcDREB1C gene and clarifying its function in growth, development, and stress resistance has important theoretical and applied value for cultivating new high-yielding and highly stress-resistant plant germplasm. Summary of the Invention

[0006] In order to fully explore the function of the AcDREB1C gene of *Agropyron cristatum* and cultivate new germplasm resources of high-yielding and highly stress-resistant plants, this invention provides the following technical solution.

[0007] In a first aspect, the present invention provides an AcDREB1C gene of *Agropyron cristatum*, the nucleic acid sequence of which is shown in SEQ ID NO.1.

[0008] The nucleic acid sequence shown in SEQ ID NO.1 is as follows:

[0009] (SEQ ID NO.1).

[0010] In a second aspect, the present invention provides a vector comprising the AcDREB1C gene described in the first aspect.

[0011] Preferably, the carrier is pBWA(V)HU-ccdB-35s-GUS or pBWA(V)HS-ccdB-35s-GUS, and more preferably pBWA(V)HU-ccdB-35s-GUS.

[0012] Thirdly, the present invention provides a host cell comprising the vector described in the second aspect.

[0013] Preferably, the host cell includes plant cells, Escherichia coli competent cells, or Agrobacterium tumefaciens competent cells.

[0014] Furthermore, the plant cells are selected from rice cells or *Agropyron cristatum* cells, more preferably rice cells.

[0015] Furthermore, the competent Escherichia coli cells include Trans1-T1 or DH5α, more preferably Trans1-T1.

[0016] Furthermore, the competent Agrobacterium tumefaciens cells are EHA105.

[0017] Fourthly, the present invention provides a callus tissue comprising the host cells described in the third aspect.

[0018] Fifthly, the present invention provides the application of the AcDREB1C gene described in the first aspect, the vector described in the second aspect, the host cell described in the third aspect, or the callus tissue described in the fourth aspect.

[0019] Preferably, the application is to promote plant growth.

[0020] Furthermore, the plant is rice or *Agropyron cristatum*.

[0021] Furthermore, the application includes at least one of the following:

[0022] (1) Application in increasing plant height;

[0023] (2) Applications in increasing root length;

[0024] (3) Application in increasing the number of tillers;

[0025] (4) Applications in increasing the number of leaves;

[0026] (5) Application in increasing stem diameter;

[0027] (6) Applications in increasing leaf length;

[0028] (7) Application in increasing leaf width.

[0029] Preferably, the AcDREB1C gene is overexpressed in the plant.

[0030] Sixthly, the present invention provides a method for constructing AcDREB1C gene overexpressing plants, comprising the following steps:

[0031] S1, a clone of the AcDREB1C gene;

[0032] Construction of the S2,AcDREB1C gene cloning vector;

[0033] Construction of S3, AcDREB1C gene expression vector;

[0034] S4, the acquisition of Agrobacterium tumefaciens-positive engineered bacteria;

[0035] S5, the Agrobacterium tumefaciens-positive engineered bacteria are used to infect plant callus tissue, and plants overexpressing the AcDREB1C gene are obtained by culturing.

[0036] Preferably, in step S1, total RNA is extracted from the leaves of *Agropyron cristatum*, reverse transcribed into cDNA, and then subjected to PCR to obtain a DNA fragment carrying AcDREB1C.

[0037] Preferably, the PCR primers in S1 are:

[0038] AcDREB1C-F:ttgtttggtgttacttctgttgcaacatggaccagtacaactacgg (SEQ ID NO. 2).

[0039] AcDREB1C-R: cagtactgaagacagagctagttacatcagtagctccagagcgc (SEQ ID NO. 3).

[0040] Preferably, in step S2, the vector pBWA(V)HU-ccdB-35s-GUS is digested with BsaI / Eco31I enzyme and purified to obtain the cloning vector pBWA(V)HU-ccdB-35s-GUS(D).

[0041] Preferably, in step S3, the PCR product purified in S1 is ligated with the cloning vector in S2, transformed into competent E. coli cells, and the expression vector (pBWA(V)HU-ccdB-35s-GUS(D)-AcDREB1C) is obtained by colony PCR identification.

[0042] Preferably, the positive primer for PCR identification in step S3 is pubiseq+, and the negative primer is E19823.

[0043] pubiseq+:cctgccttcatacgctatttatttgcttgg (SEQ ID NO. 4).

[0044] E19823: catgtgcgagccaccctgc (SEQ ID NO. 5).

[0045] Preferably, in step S4, the expression vector from S3 is electroporated into competent cells EHA105, and colonies are picked for PCR testing to obtain positive Agrobacterium tumefaciens engineered bacteria.

[0046] Furthermore, the forward primer for the PCR verification is pubiseq+, and the reverse primer is NOseq-R.

[0047] NOseq-R: caagaccggcaacaggattcaatc (SEQ ID NO. 6).

[0048] Preferably, in step S5, after sterilizing the plant seeds, they are sown on an induction medium, and callus tissue is obtained through induction culture. Then, the Agrobacterium tumefaciens-positive engineered bacteria from S4 are co-cultured with the callus tissue, and then induced to differentiate shoots and root, resulting in complete transgenic seedlings.

[0049] The beneficial effects of this invention are:

[0050] I. When the AcDREB1C gene of *Agropyron cristatum* screened in this invention is overexpressed in plants (such as rice), it can increase plant height, root length, number of tillers, number of leaves, stem diameter, leaf length, and leaf width, thereby promoting plant growth.

[0051] Second, this invention transforms the AcDREB1C gene of *Agropyron cristatum* into plants (such as rice), providing new resources and methods for molecular breeding of growth-promoting genes, and at the same time providing a solid technical foundation for increasing plant yield. Attached Figure Description

[0052] Figure 1 The image shows the construction results of the AcDREB1C expression vector of *Agropyron cristatum*.

[0053] Figure 2 The image shows the GUS staining results of positive transgenic rice plants.

[0054] Figure 3 The figure shows the plant height of wild-type and AcDREB1C-overexpressing rice plants;

[0055] Figure 4 The figure shows the root length of wild-type and AcDREB1C-overexpressing rice plants.

[0056] Figure 5 The figure shows the number of tillers in wild-type and AcDREB1C-overexpressing rice plants;

[0057] Figure 6 The figure shows the number of leaves in wild-type and AcDREB1C-overexpressing rice plants.

[0058] Figure 7The figure shows the stem diameter of wild-type and AcDREB1C-overexpressing rice plants;

[0059] Figure 8 The image shows the leaf length of wild-type and AcDREB1C-overexpressing rice plants.

[0060] Figure 9 The image shows the leaf width of wild-type and AcDREB1C-overexpressing rice plants. Detailed Implementation

[0061] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. The described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0062] It should be noted that, unless otherwise specified, the reagents and methods used in the embodiments are understood to be conventional reagents and methods in the art.

[0063] The culture medium used in the examples is as follows:

[0064] Callus induction medium: 100 mL MSmax stock solution (10×), 10 mL MSmin stock solution (100×), 10 mL Fe2EDTA stock solution (100×), 10 mL vitamin stock solution (100×), 2.5 mL 2,4-D stock solution, 0.5 g proline, 0.5 g glutamine, 30 g sucrose, 3 g plant gel, add distilled water to 600-700 mL, and adjust the pH to 6.0 with 1 mol / L KOH.

[0065] MSmax stock solution: NH4NO3 16.5 g, KNO3 19.0 g, KH2PO4 1.7 g, MgSO4·7H2O 3.7 g, CaCl2 3.32 g.

[0066] MSmin stock solution: KI 0.083 g, H3BO3 0.62 g, MnSO4·4H2O 2.23 g, ZnSO4·7H2O 0.86 g, Na2MoO4·2H2O 0.025 g, CuSO4·5H2O 0.0025 g, CoCl2·6H2O 0.0025 g, add distilled water to a final volume of 1 L.

[0067] Fe2EDTA stock solution: Add 2.78 g of FeSO4·7H2O to 300 mL of distilled water in one bottle, and add 3.73 g of Na2EDTA·2H2O to 300 mL of distilled water at 70°C in another bottle. After both dissolve, mix them together and keep at 70°C for 2 h, then add distilled water to a final volume of 1 L.

[0068] Vitamin stock solution: 0.1 g niacin, 0.1 g pyridoxine hydrochloride (VB6), 0.1 g thiamine hydrochloride (VB1), 0.2 g glycine, 10 g inositol, add distilled water to a final volume of 1 L.

[0069] Callus co-culture medium: KNO3 2.83 g, (NH4)2SO4 0.463 g, MgSO4·7H2O 0.185 g, CaCl2·2H2O 0.166 g, KH2PO4 0.4 g, Na2EDTA 0.0373 g, FeSO4·7H2O 0.0278 g, MnSO4·4H2O 0.0044 g, ZnSO4·7H2O 0.0015 g, KI 0.0008 g, H3BO3 0.0016 g, casein amino acids 0.300 g, glycine 0.002 g, inositol 0.1 g, nicotinic acid 0.0005 g, pyridoxine hydrochloride 0.0005 g, thiamine hydrochloride 0.001 g, 2,4-D 0.002 g. Add 0.02 g of AS (Acetosyringone), 30 g of sucrose, and 10 g of glucose to distilled water to a final volume of 1 L.

[0070] Callus primary screening medium: 25 mL N6max stock solution (10×), 2.5 mL N6min stock solution (100×), 2.5 mL Fe2EDTA stock solution (100×), 2.5 mL vitamin stock solution (100×), 0.625 mL 2,4-D stock solution, 0.15 g hydrolyzed casein, 7.5 g sucrose, and 1.75 g agarose. Distilled water was added to bring the volume to 1 L, and the pH was adjusted to 6.0. The medium was then sealed with a sealing film and sterilized using an autoclave. Before use, the medium was thawed and hygromycin B (50 mg / L) and cephalosporin (400 mg / L) were added.

[0071] N6max stock solution: Dissolve each component in the following order: 28.3 g KNO3, 4.0 g KH2PO4, 4.63 g (NH4)2SO4, 1.85 g MgSO4·7H2O, 1.66 g CaCl2·2H2O or 1.25 g CaCl2. Add distilled water to a final volume of 1 L.

[0072] N6min stock solution: Dissolve each component in sequence: KI 0.08 g, H3BO3 0.16 g, ZnSO4·7H2O 0.15 g, MnSO4·4H2O 0.44 g or MnSO4·H2O 0.33 g, and add distilled water to a final volume of 1 L.

[0073] Secondary screening culture medium for callus: 25 mL MSmax stock solution (10×), 2.5 mL MSmin stock solution (100×), 2.5 mL Fe2EDTA stock solution (100×), 2.5 mL vitamin stock solution (100×), 0.5 mL 6-BA stock solution, 0.5 mL KT stock solution, 50 μL NAA stock solution, 50 μL IAA stock solution, 0.15 g hydrolyzed casein, 7.5 g sucrose, and 1.75 g agarose. Add distilled water to a final volume of 250 mL, adjust the pH to 5.9, seal with sealing film, and sterilize. Before use, thaw the sterilized culture medium and add hygromycin B (50 mg / L), 600 mg / L glyphosate, and 200 mg / L cephalosporin.

[0074] Callus differentiation culture medium: 100 mL MSmax stock solution (10×), 10 mL MSmin stock solution (100×), 10 mL Fe2EDTA stock solution (100×), 10 mL vitamin stock solution (100×), 2 mL 6-BA stock solution, 2 mL KT stock solution, 0.2 mL NAA stock solution, 0.2 mL IAA stock solution, 1 g hydrolyzed casein, 30 g sucrose, 3 g plant gel, add distilled water to make up to 1 L, and adjust the pH to 6.0 with 1 mol / L KOH.

[0075] Callus rooting medium: 50 mL MSmax stock solution (10×), 5 mL MSmin stock solution (100×), 10 mL Fe2EDTA stock solution (100×), 10 mL vitamin stock solution (100×), 20 g sucrose, 3 g plant gel, add distilled water to make up to 1 L, and adjust the pH to 5.8 with 1 mol / L KOH.

[0076] Example 1: Gene Cloning

[0077] 1.1 Leaf samples of *Agropyron cristatum* were collected, and total RNA was extracted using the Plant RNA Kit (Suzhou Youyilandi Biotechnology Co., Ltd., UE-MN-MS-RNA-50), which was then reverse transcribed into cDNA. The target gene was amplified using Touch-down PCR according to the reaction system in Table 1. The PCR program was as follows: 94℃ pre-denaturation for 5 min, followed by 30 cycles (94℃ denaturation for 30 sec, 50℃ annealing for 45 sec, 72℃ extension for 42 sec), a final extension at 72℃ for 10 min, and finally storage at 16℃ for 30 min. The amplified product was stored at 4℃ for later use. Electrophoresis was performed on a 1% agarose gel at 5 V / cm for 20 min. The electrophoretic fragments were excised under UV light and recovered using a sol-gel method. The recovered DNA was dissolved in 40 μL of water (labeled as rDNAA1).

[0078] Table 1 Touch-down PCR reaction system

[0079]

[0080] After sequencing, rDNAA1 was analyzed using BioXM2.7 software to predict its coding region (SEQ ID NO.1), and BLAST alignment analysis was performed using NCBI. The results showed that rDNAA1 shared 84.34% and 90.20% similarity with the barley (Hordeum vulgare) CBF5 gene and the wheat CBFII gene, respectively. rDNAA1 also showed high homology with the barley CBF5 gene, the hexaploid wheat CBFII gene, and the rye (Secale cereale) CBFII-5 gene. rDNAA1 contains an N-terminal nuclear localization signal (NLS), an AP2 / ERF domain, and a C-terminal transcription activation domain. The resulting new gene was named AcDREB1C.

[0081] The nucleic acid sequence of AcDREB1C is as follows:

[0082] ATGGACCAGTACAACTACGGCGGCGTGTCCTACTACGGCAGCGCCGGCGGCGCCGGCGGGGGCGACAATGGCCAGGGCGGGTACGCGACGGTGACGTCGGCGCCGCCGAAGCGGCCGGCGGGGCGGACCAAGTTCCGGGAGACGCGCCACCCGGTGTACCGCGGCGTGCGCCGGCGCGGCGCCGCGGGGCGGTGGGTGTGCGAGGTGCGCGAGCCCAACAAGAAGTCCCGCATCTGGCTCGGCACCTTCGCCAGCCCGGAGGCCGCCGCGCGCGCCCACGACGTCGCCGCGCTCGCGCTCCGGGGCCGCGCCGCGTGCCTCAACTTCGCCGACTCGGCGTCCCTGCTCGCCGTCGACCCCGCCACGCTCCGCACCCCCGACGACATCCGCGCCGCCGCCATCGCGCTCGCCGAGACCGCCTGCCCCGCCGCGCCAGCGTCGACGTCGTCCGTGGCCGCCGAGGCGTCCGCGCCGGCGCCCGCGACGTTGACGATGATGATGCAAGAGTCCGCGGCGGCGCAGTACGACGACTACGCGATGTATGGCGGCATTGAGGACTTGGACCCGCATTCGTTCTACTATGACGGGATGAGTGGCGCCGGCGGCGACTGGCAGGGTGGCTCGCACATGGACGGAGACGACGACGACGCAAACTGCGGCAGTGGCTACGGCGCCGGCGAGGTCGCGCTCTGGAGCTACTGA (SEQ ID NO.1).

[0083] AcDREB1C-F:ttgtttggtgttacttctgttgcaacatggaccagtacaactacgg (SEQ ID NO.2)

[0084] AcDREB1C-R:cagtactgaagacagagctagttacatcagtagctccagagcgc (SEQ ID NO.3)

[0085] Example 2 Vector construction

[0086] 2.1 Construction of cloning vector

[0087] According to the reaction system in Table 2, BsaI / Eco31I was used to react the support pBWA(V)HU-ccdB-35s-GUS ( Figure 1 The enzyme was digested with a single enzyme. After incubation at 37°C for 1 h, the digested product was purified using a PCR purification kit. The purified product was labeled as the cloning vector pBWA(V)HU-ccdB-35s-GUS(D).

[0088] Table 2. Cloning vector construction reaction system

[0089]

[0090] 2.2 Constructing the expression vector

[0091] Following the recombination reaction system in Table 3, the target fragment rDNAA1 and the linearized vector pBWA(V)HU-ccdB-35s-GUS(D) were recombined. The reaction conditions were incubation at 37℃ for 30 h to obtain the ligation product pBWA(V)HU-ccdB-35s-GUS(D)-AcDREB1C.

[0092] Table 3 Recombination Reaction System

[0093]

[0094] 2.3 Transformation

[0095] Remove the Trans1-T1 competent E. coli cells and thaw them on ice. Prepare an electrode cup, dry the alcohol inside and pre-cool it on ice. Add 5 μL of the ligation product to the E. coli culture (approximately 100 μL per vial), mix well, transfer to the electrode cup, push the electrode cup into the electrode, set the voltage mode, and click the start button. The electrocoagulation is now complete.

[0096] Transfer the electroporated mixture to a sterile 1.5 mL EP tube, add 600 μL of LB liquid medium, seal the tube cap with sealing film, and incubate at 37°C with shaking (180 rpm) for approximately 45 min. Spread 5–10 μL of the transformation product onto a solid plate containing kanamycin (Kan) resistance, incubate at 37°C for 12 h, and pick 10 single colonies. Simultaneously perform PCR identification of the colonies in the 1.5 mL EP tube and detect band size by agarose gel electrophoresis. Take 100 μL of the bacterial culture corresponding to 1–3 positive bands for sequencing, and inoculate the remaining 400 μL of bacterial culture into 5–10 mL of Kan-resistant LB medium, and shake the tubes.

[0097] After the sequencing results are available, plasmids are extracted from the bacterial culture with the correct sequencing. Using pubiseq+ as the universal primer and E19823(351C) as the target gene-specific primer, ten 25 μL PCR reaction systems were prepared (see Table 4). PCR reaction program: 94℃ pre-denaturation for 5 min, followed by 30 cycles (94℃ denaturation for 30 sec, 50℃ annealing for 45 sec, 72℃ extension for 42 sec), a final extension at 72℃ for 10 min after the first cycle, and finally storage at 16℃ for 30 min.

[0098] pubiseq+: cctgccttcatacgctatttatttgcttgg (SEQ ID NO.4)

[0099] E19823(351C):catgtgcgagccaccctgc(SEQ ID NO.5)

[0100] Table 4 Plasmid extraction reaction system

[0101]

[0102] 2.4 Plasmid introduction into Agrobacterium

[0103] Add 1 µL of plasmid to 50 µL of EHA105 Agrobacterium competent cells, mix thoroughly, and transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and transfer to a 1.5 mL centrifuge tube. Incubate on a shaker at 30°C and 180 rpm for 30 min. Take 50 µL of Agrobacterium bacterial culture and inoculate it onto LB solid medium. Incubate in the dark at 30°C for 48 h.

[0104] Single Agrobacterium colonies were picked from the culture plate, and Agrobacterium suspension and colony PCR were performed simultaneously to screen for positive Agrobacterium. The PCR reaction system was prepared according to Table 5, with the forward primer being pubiseq+ and the reverse primer being NOseq-R. The reaction program was as follows: 95℃ pre-denaturation for 5 min, followed by 30 cycles (95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 50 sec), a final extension at 72℃ for 5 min, and a final incubation at 25℃ for 5 min.

[0105] NOseq-R: caagaccggcaacaggattcaatc (SEQ ID NO.6)

[0106] Table 5. Agrobacterium PCR Identification Reaction

[0107]

[0108] Example 3: Transformation of the AcDREB1C gene into rice and its detection

[0109] Select rice grains without mold spots and with normal bud openings. Disinfect with 75% alcohol for 1 min, rinse with sterile water for 1 min each time; disinfect with 15% sodium hypochlorite for 20 min, rinse with sterile water 3 times for 1 min each time; sow the disinfected rice grains on induction medium and culture at 26℃ under light for 20 days to obtain embryogenic callus tissue.

[0110] Select positive Agrobacterium bacteria from 2.4 and infect them with LB+AS 20 mg / L solution to prepare OD. 600 = 0.2% Agrobacterium resuspension. Embryogenic callus tissue was picked into Erlenmeyer flasks, Agrobacterium resuspension was added, and after 10-15 min of incubation, the bacterial suspension was discarded. The callus tissue was then inoculated onto co-culture medium and co-cultured at 20°C for 48-72 h. Then, the callus tissue was inoculated onto primary selection medium and cultured in the dark at 26°C for 20-30 days. Positive callus tissue was inoculated onto secondary selection medium, ensuring that only single-clonal callus tissue was selected during the callus picking process, and cultured in the dark at 26°C for 7-10 days. Positive callus tissue was inoculated onto differentiation medium and cultured under light at 25-27°C for 15-20 days. After 2-5 cm shoots differentiated, they were inoculated onto rooting medium and cultured under light at 30°C for 7-10 days. Leaves from seedlings differentiated from callus tissue approximately 0.5 cm in length were cut and immersed in GUS staining solution, then stained overnight in a 37°C incubator. After staining, the leaves were decolorized with a 95% ethanol solution. After complete decolorization, the leaves were rinsed thoroughly with clean water. Images were then taken under a stereomicroscope. Figure 2 Rice seedlings showing blue spots after GUS staining were further sampled for DNA extraction. Rice genomic DNA was extracted using the CTAB method and PCR detection was performed. The detection method was the same as that for Agrobacterium 2.4. The finally identified positive rice plants were properly cared for and T2 generation homozygous seeds were harvested.

[0111] Example 4: Growth Phenotypic Analysis of Rice Transgenic AcDREB1C

[0112] Seeds from T2 generation rice plants OE7, OE21, OE23, and WT were selected. The seed coats were removed, and the seeds were transferred to 50 mL centrifuge tubes. After rinsing with 75% alcohol for 30 seconds, the liquid was discarded. Then, 30% sodium hypochlorite was added, and the mixture was sterilized in a shaker for 10 minutes. The seeds were rinsed 4-5 times with sterile water. The sterilized seeds were inoculated onto petri dishes lined with moistened filter paper and cultured at 28℃, 5000 lux, and 24 hours of continuous light. Once the seedlings had robust root systems, the tillering nodes were secured in the hydroponic container with a sponge, ensuring the roots were fully immersed in Hoagland's nutrient solution (Qingdao Haibo Biotechnology Co., Ltd., HB8870-1; 1.26 g of this product and 0.945 g of calcium nitrate are required for use). The nutrient solution was changed weekly.

[0113] Eight seedlings from each line were selected and transplanted into hydroponic containers. The rice seedlings in the hydroponic containers were placed in an artificial climate chamber with a day / night temperature of 30℃ / 25℃, a relative humidity of 70%, and a photoperiod of 16 hours. Starting from day 7, the growth indicators of the rice were recorded, and the growth indicators (plant height, root length, number of tillers, number of leaves, stem diameter, leaf length, and leaf width) were measured every 7 days.

[0114] like Figure 3 As shown, the results indicated that during the observation period of 7–42 days, the plant height of all lines continuously increased with the growth process, and the growth advantage of the overexpressing lines became increasingly significant over time. From day 14 onwards, the plant heights of lines OE7, OE21, and OE23 were higher than those of WT, and the difference gradually widened with the increase of the number of growth days. By day 42, the plant heights of lines OE7, OE21, and OE23 all reached 57–58 cm, significantly higher than the 51 cm of WT.

[0115] like Figure 4 As shown, the results indicated that during the observation period of 7–42 days, the root length of all lines continuously increased with the growth process, and the growth advantage of the overexpressing lines became increasingly significant over time. From day 21 onwards, the root lengths of the OE7, OE21, and OE23 lines were significantly higher than those of the WT lines, and the difference gradually widened with the increase of the number of growth days. At day 42, the root lengths of the OE7, OE21, and OE23 lines were 23–24 cm, significantly higher than the WT line's 21 cm, with no significant difference among the three overexpressing lines.

[0116] like Figure 5 As shown, on day 28, the number of tillers in the overexpression line OE7 was significantly higher than that in WT; on day 35, the number of tillers in the overexpression lines OE21 and OE23 was significantly higher than that in WT; on day 42, the number of tillers in the OE7 line was the highest at 7.0, followed by the OE23 line at 6.7, and the OE21 line at 6.2. The number of tillers in OE7 and OE23 was significantly higher than that in WT at 5.7.

[0117] like Figure 6 As shown, at 28 days and 42 days, the number of leaves in the overexpression lines was significantly higher than that in the WT line (P < 0.05). At 42 days, the mean number of leaves in the OE7, OE21, and OE23 lines was between 10.1 and 10.5, which was significantly higher than the 8.8 leaves in the WT line, with the OE21 line having the most leaves.

[0118] like Figure 7 As shown, on day 7, the stem diameter of OE7 and OE21 lines was significantly higher than that of WT and OE23 lines, with no significant difference between OE7 and OE21, and no significant difference between WT and OE23. On days 14, 21, 28, and 35, the stem diameter of the overexpressing lines was significantly higher than that of WT. On day 42, there was no significant difference in stem diameter between WT and the three overexpressing lines.

[0119] The results of leaf length and width measurements of the fully expanded upper three leaves of WT and overexpression lines at 42 days showed that the leaf lengths of the first (1st) and second (2nd) fully expanded leaves of the three overexpression lines were significantly longer than those of WT. The leaf length of the third (3rd) fully expanded leaf of the OE23 line was significantly longer than that of OE7, OE21, and WT. Figure 8 Regarding leaf width, the first fully expanded leaf of the OE23 strain was significantly wider than that of the WT and other overexpression strains. The second fully expanded leaf of all three overexpression strains was significantly wider than that of the WT strain. The third fully expanded leaf of the WT strain was significantly wider than that of the three overexpression strains. Figure 9 ).

[0120] The above experimental results show that overexpression of AcDREB1C can simultaneously promote the coordinated growth of the aboveground parts (plant height, number of tillers, number of leaves, stem diameter, and leaf length) and underground parts (root length) of rice, thereby improving the overall vegetative growth level of the plant. The AcDREB1C gene has a positive regulatory effect on the growth and development of rice.

[0121] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. Flat-spike ice plant AcDREB1C Genes, including the AcDREB1C The application of a gene vector, a host cell containing the vector, or a callus containing the host cell in promoting rice growth, characterized in that... The AcDREB1C The nucleic acid sequence of the gene is shown in SEQ ID NO.

1. AcDREB1C Gene overexpression, the application of which includes at least one of the following: (1) Application in increasing plant height; (2) Applications in increasing root length; (3) Applications in increasing the number of tillers and leaves; (4) Application in increasing stem diameter.

2. The application according to claim 1, characterized in that, The carrier is pBWA(V)HU-ccdB-35s-GUS or pBWA(V)HS-ccdB-35s-GUS.

3. The application according to claim 1, characterized in that, The host cells include Trans1-T1, DH5α, or EHA105.

Images