Recombinant vectors, cells, kits, and methods of screening for host factors dependent on influenza polymerase activity

Abstract

The application belongs to the technical field of biotechnology, and particularly relates to a recombinant vector, a cell, a kit and a method for screening of a host factor dependent on influenza virus polymerase activity. The application provides a recombinant vector, which is configured with an mScarlet reporter gene through a double tandem strategy (PB1-PB2, PA-NP), and a red fluorescent cell line stably expressing H5N1 polymerase driven by the red fluorescent cell line can be efficiently constructed by using only three lentiviral vectors. Compared with a traditional co-transduction method of five vectors, the difficulty of multiple vectors entering the same cell is greatly reduced, and the recombinant vector does not need live virus and can be stably passaged for a long time. Based on the recombinant vector, a host factor affecting polymerase activity is screened by using a whole genome CRISPR under a non-infectious state, and the method has the advantages of simple operation, high throughput and low cost.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, specifically relating to recombinant vectors, cells, reagent kits, and methods for screening influenza virus polymerase activity-dependent host factors. Background Technology

[0002] The cross-species transmission capability of avian influenza viruses is highly dependent on the activity of their RNA-dependent RNA polymerase (RdRP) complex (composed of three subunits: PA, PB1, and PB2) in human cells. This polymerase complex, together with nucleoproteins (NPs), is responsible for the transcription and replication of the viral genome. Mutations such as E627K in the PB2 subunit are known to be a key molecular basis for the adaptation of avian influenza viruses to mammalian hosts. Species differences in the host factor ANP32A have been confirmed as an important factor limiting the activity of avian influenza polymerases; avian ANP32A has 33 more amino acids than human ANP32A, and only when the avian influenza PB2 subunit undergoes the E627K mutation can it effectively utilize human ANP32A. However, recent studies have found that viral PB2 adaptive mutations can replicate independently of ANP32A, suggesting the existence of more unknown host factors involved in regulating polymerase activity.

[0003] The current standard method for detecting influenza virus polymerase activity involves transient co-transfection of 293T cells, simultaneously expressing influenza virus PB1, PB2, PA, NP, and a human Pol I-driven luciferase reporter gene. This method has low throughput and is not suitable for whole-genome screening. Although studies have reported the establishment of an A549 cell line stably expressing Gaussian luciferase driven by H1N1 polymerase, its construction requires simultaneous transduction of five lentiviruses (expressing Gluc / Blasticidine, NP, PA, PB1, and PB2, respectively). The probability of multiple vectors co-entering the same cell is extremely low, and the luciferase reporter system is difficult to sort by single cell using flow cytometry, making it unsuitable for screening CRISPR-Cas9 whole-genome knockout libraries. Furthermore, traditional proteomics-based interaction screening can only identify candidate proteins that bind to polymerase or NP, while the host factors obtained by whole-genome CRISPR screening under infection cover the entire viral life cycle (invasion, replication, assembly, budding) and are not specifically targeted at polymerase activity itself. To date, there is no stable transfection cell line for H5N1 polymerase-driven red fluorescent proteins (such as mScarlet), nor is there a technical platform for systematically screening host factors that affect polymerase activity in a non-infected state.

[0004] Therefore, there is an urgent need in this field for an efficient, stable cell line and screening method suitable for high-throughput screening, in order to directly identify host factors affecting influenza virus polymerase activity across the entire genome. Summary of the Invention

[0005] Based on this, one embodiment of this application provides a recombinant vector, cells, a reagent kit, and a method for screening influenza virus polymerase activity-dependent host factors.

[0006] This application provides a recombinant vector, comprising:

[0007] (a) A first recombinant vector comprising tandem influenza virus PB1 protein-coding genes and PB2 protein-coding genes, and carrying a first resistance selection marker gene.

[0008] (b) A second recombinant vector comprising tandem influenza virus PA protein-coding genes and NP protein-coding genes, and carrying a second resistance selection marker gene.

[0009] (c) A third recombinant vector comprising a reporter gene encoding the red fluorescent protein mScarlet, driven by the RNA polymerase I promoter, and carrying a third resistance selection marker gene.

[0010] In some embodiments, the sources of the influenza virus PB1 protein-coding gene, PB2 protein-coding gene, PA protein-coding gene, and NP protein-coding gene include avian influenza A virus.

[0011] In some of these embodiments, the virus is derived from the H5N1 subtype of avian influenza.

[0012] In some embodiments, the PB1 protein-coding gene and the PB2 protein-coding gene are linked by a P2A peptide coding sequence.

[0013] In some embodiments, the PA protein-coding gene and the NP protein-coding gene are linked by a P2A peptide coding sequence.

[0014] In some embodiments, the first resistance selection marker gene includes a blasticidine resistance gene.

[0015] In some embodiments, the second resistance selection marker gene includes the Zeocin resistance gene.

[0016] In some embodiments, the third resistance selection marker gene includes the Hygromycin resistance gene.

[0017] In some embodiments, the recombinant vector includes a lentiviral vector.

[0018] In some embodiments, the promoter in the lentiviral vector includes the CMV promoter.

[0019] Another aspect of this application provides a cell, said cell comprising the recombinant vector described above;

[0020] In some embodiments, the cells are 293T cells or A549 cells.

[0021] Another aspect of this application provides a kit for screening influenza virus polymerase activity-dependent host factors, comprising the recombinant vector or the cells described herein.

[0022] This application also provides a method for screening influenza virus polymerase activity-dependent host factors, comprising: screening using the recombinant vector or the cells.

[0023] In some embodiments, the method for screening influenza virus polymerase activity-dependent host factors includes:

[0024] S1. Provide the cells described above;

[0025] S2. Transduce the cells using a whole-genome CRISPR-Cas9 knockout library;

[0026] S3, the red fluorescent negative cell population obtained in step S2 by flow cytometry sorting; and

[0027] S4. High-throughput sequencing was performed on the sorted red fluorescent negative cell population to analyze the enriched sgRNA and screen for host factors that affect the activity of H5N1 influenza virus polymerase.

[0028] In some embodiments, the red fluorescent negative cell population sorted in step S3 includes cells with red fluorescence intensity below a preset threshold and / or no red fluorescence at all.

[0029] This application provides a recombinant vector that, through a dual tandem strategy (PB1-PB2, PA-NP) combined with an mScarlet reporter gene, can efficiently construct a stable H5N1 polymerase-driven red fluorescent cell line using only three lentiviral vectors. Compared with the traditional five-vector co-transduction method, this significantly reduces the difficulty of multiple vectors entering the same cell, and it does not require live virus and can be stably passaged for a long time. Based on this recombinant vector, whole-genome CRISPR screening of host factors affecting polymerase activity can be achieved in a non-infected state. It has the advantages of simple operation, high throughput, and low cost, providing a powerful tool for elucidating cross-species transmission mechanisms and developing broad-spectrum antiviral drugs. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 Flowchart for screening host factors affecting H5N1 polymerase activity using the whole-genome CRISPR-Cas9 method;

[0032] Figure 2 H5N1 polymerase-driven expression of red fluorescent mScarlet; Figure 2 A: A schematic diagram of transcription and translation of the H5N1 polymerase-driven reporter plasmid mScarlet; Figure 2 Western-Blot analysis of B:H5N1 polymerase protein expression; Figure 2 Fluorescence pattern of red fluorescent mScarlet expression driven by C:H5N1 polymerase protein (4× scale bar = 500 μm, 10× scale bar = 100 μm).

[0033] Figure 3 To drive red fluorescent mScarlet expression through cis-transfection of tandem expression plasmids; Figure 3 A: Fluorescence image of 293T cells 40 h after transfection with pcDNA3.1-PA / PB1 / PB2 / NP+ pcDNA3.1-polⅠ-mScarlet in a 2:2:1:4:2 ratio in chronotransfection; Figure 3 B: Fluorescence image of 293T cells 40 h after transfection with PCDH-PA-P2A-NP, ploc-PB1-P2A-PB2 and pcDNA3.1-polⅠ-mScarlet driver plasmid in a 2:2:1 sequential manner (scale bar = 200 μm).

[0034] Figure 4 To construct polymerase-driven expression of red fluorescent cells; Figure 4 A: Fluorescence expression of 293T / A549 cells transduced with 3 lentiviruses after multiple passages (scale bar = 100 μm). Figure 4 B in the figure: Percentage of red fluorescent cells identified by flow cytometry;

[0035] Figure 5 To sort polymerase-driven red fluorescent monoclonal cells; monoclonal cells were expanded from 96-well plates to 12-well plates, and fluorescence images were obtained under a fluorescence microscope (scale bar = 200 μm).

[0036] Figure 6 The fluorescence intensity decreased after knocking out the positive control gene ANP32A, which affects polymerase activity, in 293T-5ps monoclonal cells. Figure 6 A in the text: Western blot was used to identify the ANP32A protein level in ANP32A knockout cell lines; Figure 6Fluorescence images of B:293T-5ps monoclonal cells with ANP32A knockout and control cells; Figure 6 C in the figure: Fluorescence intensity after ANP32A knockout was determined by flow cytometry. Detailed Implementation

[0037] The present application will be further described in detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0038] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0039] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0040] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0041] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0042] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0043] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0044] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0045] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0046] In this application, the technical features described in an open-ended manner include both closed technical solutions composed of the listed features and open technical solutions composed of the listed features.

[0047] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0048] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0049] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0050] All references to documents mentioned in this application are incorporated herein by reference as if each document were individually incorporated by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, all cited documents are incorporated herein by reference in their entirety and for all purposes. When citing documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When citing documents in this application, examples and alternative arrangements of the cited relevant technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0051] To address the core technical challenge of constructing cell lines that stably express influenza virus polymerase protein and drive reporter gene expression, this application provides a recombinant vector, a cell, and its application in screening influenza virus polymerase activity-dependent host factors.

[0052] The first aspect of this application provides a recombinant vector comprising: (a) a first recombinant vector comprising tandem influenza virus PB1 and PB2 protein encoding genes and carrying a first resistance selection marker gene; (b) a second recombinant vector comprising tandem influenza virus PA and NP protein encoding genes and carrying a second resistance selection marker gene; and (c) a third recombinant vector comprising a reporter gene encoded by an RNA polymerase I promoter and encoding a red fluorescent protein mScarlet and carrying a third resistance selection marker gene.

[0053] This recombinant vector system expresses different functional elements through three independent vectors, each carrying a different resistance selection marker, ensuring that all essential elements can be stably integrated and expressed in the same cell. This design solves the technical challenge of stably expressing multiple genes in the same cell, providing a reliable technical foundation for constructing stable cell lines.

[0054] Instability of reporter genes can lead to false positive or false negative results when screening for polymerase activity and host factors. mScarlet, a relatively stable red fluorescent protein, outperforms all other red fluorescent proteins in terms of strong and stable fluorescence.

[0055] In some embodiments, the sources of the influenza virus PB1 protein-coding gene, PB2 protein-coding gene, PA protein-coding gene, and NP protein-coding gene include avian influenza A virus. The H5N1 subtype avian influenza virus is a highly pathogenic avian influenza virus, and its polymerase activity studies are of great significance for understanding cross-species transmission mechanisms and developing antiviral drugs. The coding sequence of the H5N1 polymerase protein can be obtained from the GenBank database, and optionally, validated functional sequences can be used. In addition to the H5N1 subtype, this recombinant vector system is also applicable to other subtypes of influenza viruses such as H1N1, H3N2, and H7N9.

[0056] In some embodiments, the PB1 and PB2 protein coding genes are linked by a P2A peptide coding sequence; and / or the PA and NP protein coding genes are linked by a P2A peptide coding sequence. The P2A peptide is a self-cleaving peptide capable of precise cleavage of multiple proteins during translation, ensuring the independent function of each protein subunit. The amino acid sequence of the P2A peptide is ATNFSLLKQAGDVEENPGP, and its coding sequence can be optimized according to the codon preferences of the host cell. Besides the P2A peptide, other self-cleaving peptides such as T2A, E2A, and F2A can also be used, but the P2A peptide has the highest cleavage efficiency, reaching over 90%.

[0057] In some embodiments, the first antibiotic resistance marker gene includes a blasticidine resistance gene; and / or the second antibiotic resistance marker gene includes a zeocin resistance gene; and / or the third antibiotic resistance marker gene includes a hygromycin resistance gene. The combined use of three different antibiotic resistance genes can effectively screen for positive cells that simultaneously integrate three recombinant vectors, avoiding false positives caused by single-antibiotic screening. The selection concentration of blasticidine is generally 5-20 μg / mL, the selection concentration of zeocin is generally 100-500 μg / mL, and the selection concentration of hygromycin is generally 50-200 μg / mL. The screening time is usually 7-14 days, during which the selection medium needs to be changed regularly.

[0058] In some embodiments, the recombinant vector comprises a lentiviral vector; optionally, the promoter in the lentiviral vector comprises a CMV promoter. Lentiviral vectors have advantages such as high integration efficiency, stable expression, and low immunogenicity, making them an ideal choice for constructing stable cell lines. Commonly used lentiviral vectors include ploc, pCDH, lenti, and other series of vectors. The CMV promoter is a potent constitutive promoter capable of driving high levels of target gene expression, ensuring adequate expression of the polymerase protein. In addition to the CMV promoter, other strong promoters such as EF1α and CAG can also be used, but the CMV promoter exhibits the highest expression efficiency in 293T and A549 cells. Weak promoters may result in low expression levels of viral polymerase protein, thus failing to drive mScarlet expression.

[0059] This application employs a dual tandem expression approach: PB1-PB2 tandem, PA-NP tandem, and polI-mScarlet clones are inserted into lentiviral vectors containing different resistances and different selection markers. Furthermore, the three lentiviruses can be transduced together, maintaining a positive rate of 70-80% even after multiple passages, significantly improving the efficiency of subsequent single-clone sorting. Therefore, this construction strategy is stable, efficient, and easy to operate. This cell line can also be used for drug screening targeting specific polymerases. During outbreaks of emerging respiratory infectious diseases, polymerase-driven mScarlet expression cell lines can be rapidly constructed for screening targeted polymerase drugs. In addition, since influenza polymerases are relatively conserved, this cell line can be used to screen broad-spectrum influenza drugs, providing candidate drugs for the treatment of other highly pathogenic influenza viruses.

[0060] This application also provides a cell line comprising the aforementioned recombinant vector; optionally, the cell line comprises 293T cells or A549 cells. This cell line is constructed by simultaneously transducing three recombinant vectors and is capable of stably expressing influenza virus polymerase protein and driving the expression of mScarlet red fluorescent protein. 293T cells are a human embryonic kidney cell line that is easily transfected and packaged with the virus, while A549 cells are a human lung adenocarcinoma cell line; both cell lines support influenza virus polymerase activity. In addition to 293T and A549 cells, other cell lines supporting influenza virus replication, such as MDCK and Vero, can also be used. The cell culture conditions are 37°C, 5% CO2, and the culture medium is DMEM or RPMI-1640 supplemented with 10% fetal bovine serum.

[0061] This application allows the construction of a whole-genome CRISPR-Cas9 knockout library using this cell line. Red fluorescent negative cells can be obtained by flow cytometry sorting, enabling the study of host factors affecting polymerase activity across the entire genome in a non-infected state. This process is high-throughput and convenient, and does not require operation in a biosafety level 3 laboratory.

[0062] This application also provides a kit for screening influenza virus polymerase activity-dependent host factors, comprising the aforementioned recombinant vector or the aforementioned cells. This kit provides researchers with a complete set of experimental tools, including all the recombinant vectors or pre-constructed stable cell lines required for building stable cell lines, greatly simplifying the experimental procedure and improving research efficiency. The kit may also include instructions for use, positive control sgRNA, negative control sgRNA, antibiotic screening solution, and other auxiliary reagents.

[0063] like Figure 1 As shown, this application expresses PB1-PB2 and PA-NP proteins in a dual tandem manner, using a bright and stable red fluorescent mScarlet as the fluorescent agent. The lentiviral vector promoter uses a strongly expressed CMV promoter. After lentiviral packaging and concentration, three lentiviruses with different resistances were simultaneously transduced into 293T / A549 cells. After 48 hours of transduction, polymerase-driven, stably expressing red fluorescent mScarlet cells were constructed through selection with plasticidine, zeocin, and hygromycin antibiotics. Single clones were further sorted, transduced into human genome knockout library cell lines, and then selected with puromycin. Cells not expressing mScarlet were then sorted by flow cytometry. These cell lines were subjected to next-generation sequencing to obtain candidate genes, which are host factors essential for polymerase activity.

[0064] This application also provides a method for screening host factors that affect influenza virus polymerase activity, comprising: screening using the aforementioned recombinant vector or the aforementioned cells. This method utilizes a constructed stable cell line to systematically screen for host factors affecting influenza virus polymerase activity across the entire genome, offering advantages such as high throughput, strong specificity, and ease of operation. Compared to traditional screening methods under infected conditions, this method is performed under non-infected conditions, avoiding the operational limitations of a biosafety level 3 laboratory, and significantly reducing the technical threshold and safety risks of the experiment.

[0065] In some embodiments, the screening method includes:

[0066] S1. Provide the above-mentioned cells;

[0067] S2. Transduce the cells using a whole-genome CRISPR-Cas9 knockout library;

[0068] S3. The red fluorescent negative cell population obtained in step S2 was sorted by flow cytometry; and S4. The sorted red fluorescent negative cell population was subjected to high-throughput sequencing to analyze the enriched sgRNA and screen for host factors that affect the activity of H5N1 influenza virus polymerase.

[0069] This method uses CRISPR-Cas9 technology to knock out host cell genes and screens for host factors affecting polymerase activity by detecting changes in the red fluorescence intensity of mScarlet. When a host factor is knocked out, polymerase activity decreases, mScarlet expression decreases, and the red fluorescence intensity of cells decreases. These fluorescently negative cells can be sorted by flow cytometry, and the knocked-out gene can be identified by high-throughput sequencing.

[0070] In some embodiments, the red fluorescence-negative cell population sorted in step S3 includes cells with red fluorescence intensity below a preset threshold or no red fluorescence at all. The preset threshold can be set according to experimental conditions, generally selecting the 5-10% of cell population with the lowest fluorescence intensity for sorting. Flow cytometry sorting can be performed using flow cytometers such as FACSAria and MoFlo. The sorted cells can be used directly for genomic DNA extraction or extracted after a short period of culture to increase cell quantity. High-throughput sequencing can be performed using sequencing platforms such as Illumina and Ion Torrent, and data analysis can be performed using bioinformatics tools such as MAGeCK and CRISPResso.

[0071] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0072] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0073] It should be understood that in the various embodiments of this application, the order of the above-mentioned processes does not imply the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0074] Example 1

[0075] This embodiment provides a method for establishing an H5N1 polymerase-driven red fluorescent mScarlet expression system.

[0076] I. Cloning of the H5N1 polymerase protein encoding gene

[0077] The encoding genes for H5N1 polymerase proteins PA, PB1, PB2, and NP were obtained through gene synthesis and cloned into the pcDNA3.1 vector (purchased from Guangzhou Aiji Biotechnology Co., Ltd., catalog number BA01-PL1H001-001U). The constructed pcDNA3.1-PA, pcDNA3.1-PB1, pcDNA3.1-PB2, and pcDNA3.1-NP plasmids were sent to a sequencing company for sequencing verification to ensure sequence accuracy.

[0078] II. Polymerase Protein Expression Validation

[0079] The plasmids pcDNA3.1-PA, pcDNA3.1-PB1, pcDNA3.1-PB2, and pcDNA3.1-NP were transfected into 293T cells (purchased from the Cell Bank of the Chinese Academy of Sciences, catalog number GNHu17). Cells were collected 48 hours after transfection, and the expression of polymerase proteins PA, NP, PB1, and PB2 was identified using Western blotting. The results showed that H5N1 polymerase proteins were correctly expressed, and the protein sizes were consistent with expectations.

[0080] III. Validation of the Polymerase-Driven mScarlet Expression System

[0081] The plasmids pcDNA3.1-PA, pcDNA3.1-PB1, pcDNA3.1-PB2, pcDNA3.1-NP, and pcDNA3.1-polⅠ-mScarlet were mixed at a mass ratio of 2:2:1:4:2, with a total plasmid amount of 825 ng. The mixture was then transfected into 293T cells clockwise using PEI-40000 transfection reagent (purchased from Polyscience, catalog number 24765-1). Twenty-four hours after transfection, mScarlet expression was observed under a fluorescence microscope (Nikon Ti-S). The results showed that the transfected cells exhibited significant red fluorescence, while the untransfected control group showed no fluorescence, indicating that a polymerase-driven red fluorescent mScarlet expression system was successfully established.

[0082] The results are as follows Figure 2 As shown: A schematic diagram of H5N1 polymerase-driven reporter plasmid mScarlet transcription and translation. Figure 2 As shown in A, PA / PB1 / PB2 / NP were synthesized and cloned into pcDNA3.1, and sequencing confirmed their correct expression. After transfection of the pcDNA3.1-PA / PB1 / PB2 / NP plasmid into 293T cells for 48 h, Western blotting was used to identify the expression of polymerase proteins PA / NP / PB1 / PB2. All H5N1 polymerase proteins were correctly expressed. Figure 2(B in the original text). Then, pcDNA3.1-PA / PB1 / PB2 / NP+ pcDNA3.1-polⅠ-mScarlet were transfected into 293T cells in a 2:2:1:4:2 ratio, with a total amount of 825 ng, respectively. 24 h after transfection, significant expression of mScarlet was observed under a fluorescence microscope. Figure 2 The presence of C indicates the successful establishment of a polymerase-driven red fluorescent mScarlet expression system.

[0083] Example 2: Verification by cischronic transfection of tandem expression plasmids

[0084] This embodiment verifies the effect of tandem expression plasmid driving mScarlet expression.

[0085] I. Construction of Non-Tandem Expression Vector Systems

[0086] The PA, PB1, PB2, and NP genes of H5N1 were cloned into the ploc-Blasticidine lentiviral vector (purchased from Addgene, catalog number 36083). After lentiviral packaging, the cells were transduced into 293T cells at a ratio of 1:1:1:1. After selection with Blasticidine (10 μg / mL, purchased from Invivogen, catalog number ant-bl-1) for 3-7 days, the cells were transfected sequentially with the pcDNA3.1-polⅠ-mScarlet plasmid. The results showed no expression of mScarlet, presumably because PA, PB1, PB2, and NP were not expressed in the same cell and the same antibiotic selection marker was used.

[0087] II. Construction of Tandem Expression Vectors

[0088] A stable polymerase-expressing cell line was constructed using a dual tandem approach. First, the PB1 and PB2 tandem genes (linked by a P2A peptide) were synthesized by a gene synthesis company and cloned into a plasticidine-resistant ploc lentiviral vector to construct the ploc-PB1-P2A-PB2-Blasticidine vector. The PA and NP genes, linked by a P2A peptide, were then cloned into a Zeocin-resistant pCDH lentiviral vector (purchased from Guangzhou Aiji Biotechnology Co., Ltd., catalog number BA01-PL1J031-001U) to construct the pCDH-PA-P2A-NP-Zeocin vector. The polⅠ-mScarlet gene was synthesized and cloned into the pCDH-Hygromycin vector (purchased from Guangzhou Aiji Biotechnology Co., Ltd., catalog number BA01-PL1J043-001U) to construct the pCDH-polⅠ-mScarlet-Hygromycin vector.

[0089] III. Functional Verification of Tandem Expression Plasmids

[0090] pcDNA3.1-PA, pcDNA3.1-PB1, pcDNA3.1-PB2, pcDNA3.1-NP, and pcDNA3.1-polⅠ-mScarlet were transfected into 293T cells in a sequential ratio of 2:2:1:4:2 as a positive control. Simultaneously, pCDH-PA-P2A-NP, ploc-PB1-P2A-PB2, and pcDNA3.1-polⅠ-mScarlet plasmids were co-transfected into 293T cells at a ratio of 2:2:1 (total 1 μg). Forty hours after transfection, mScarlet expression was observed under a fluorescence microscope. Figure 3 As shown in the results, both groups exhibited obvious red fluorescence, demonstrating that the tandem expression plasmid can effectively drive the expression of mScarlet.

[0091] Example 3: Construction of polymerase-driven red fluorescent cells using lentiviral vectors

[0092] This embodiment provides a method for constructing polymerase-driven expression of red fluorescent cells using a lentiviral vector.

[0093] I. Lentiviral Packaging and Concentration

[0094] Lentiviral viruses ploc-PB1-P2A-PB2-Blasticidine, pCDH-PA-P2A-NP-Zeocin, and pCDH-polⅠ-mScarlet-Hygromycin were packaged in T75 culture flasks using 293FT cells (Thermo Fisher Scientific, catalog number R70007). Third-generation packaging systems, including psPAX2 (Addgen, catalog number 12260) and pMD2.G (Addgen, catalog number 12259), were used to package plasmids. Viral supernatant was collected 48 hours after packaging and concentrated 20-fold using Lenti-X™ Concentrator (Clontech, catalog number 631231) to obtain high-titer lentivirus.

[0095] II. Cell Transduction and Screening

[0096] Three concentrated lentiviruses were simultaneously added to 293T or A549 cells (purchased from ATCC, catalog number CCL-185). After 48 hours of transduction, three antibiotics were added for selection: blasticidine (10 μg / mL / 10 μg / mL), zeocin (50 μg / mL / 800 μg / mL, purchased from Invivogen, catalog number ant-zn-05), and hygromycin (1200 μg / mL / 1000 μg / mL, purchased from Invivogen, catalog number ant-hg-1). The culture medium was changed every 2-3 days during selection to maintain antibiotic selection pressure. Once all control cells had died, the antibiotic concentration was halved for maintenance culture.

[0097] III. Identification of Stable Cell Lines

[0098] Four to seven days after antibiotic screening, the expression of red fluorescence in cells was observed under a fluorescence microscope. Figure 4 As shown. The results showed that most cells expressed red fluorescence (…). Figure 4 In the A1 cell line, flow cytometry (BD LSR Fortessa X-20) analysis showed that 73.8% of the 293T-5ps cells expressed red fluorescence, and 81.5% of the A549-5ps cells expressed red fluorescence. Figure 4 (B in the text). The positive rate remained stable after multiple passages, proving that a stable expression cell line was successfully constructed, named 293T-5ps and A549-5ps.

[0099] Example 4: Sorting of monoclonal cells using limiting dilution method

[0100] This embodiment provides a method for sorting monoclonal cells using the limiting dilution method.

[0101] I. Sorting of Monoclonal Cells

[0102] Since not all 293T-5ps cells obtained through lentiviral transduction expressed red fluorescence, cells were sorted into 96-well plates using a limiting dilution method, with one cell per well. Cells were cultured in complete medium containing three antibiotics, with the medium changed every 2-3 days.

[0103] II. Screening and Large-Scale Culture of Monoclonal Cells

[0104] After two weeks of culture, single-clonal cells were selected and expanded to 12-well plates, yielding a total of 33 single clones. The red fluorescence expression of each single clone was observed under a fluorescence microscope, revealing varying fluorescence intensities, categorized into weak, medium, and strong levels. A single clone with medium fluorescence intensity was selected for subsequent experiments (under the fluorescence microscope, all cells exhibited uniform red fluorescence, and their consistent morphology preliminarily identified them as single clones), and named 293T-5ps-28#.

[0105] Example 5: ANP32A knockout verification

[0106] This embodiment verifies that the constructed cell line can be used to screen host factors that affect polymerase activity.

[0107] I. Construction of ANP32A knockout plasmid

[0108] The sgRNA sequence targeting the ANP32A gene (SEQ ID NO.1: CTTTGGTAAGTTTGCGATTG) was designed, cloned into the lentiCRISPRV2 plasmid (purchased from Addgen, catalog number 98290), and after successful sequencing verification, it was packaged into a lentivirus.

[0109] II. Construction of ANP32A knockout cell lines

[0110] ANP32A-KO lentivirus was transduced into 293T-5ps-28# monoclonal cells. After 48 hours of transduction, Puromycin (2 μg / mL, Sigma-Aldrich, catalog number P8833) was added, and cells were selected for 4-7 days to obtain viable cells. ANP32A protein levels were identified by Western blotting. Figure 6 As shown, the results indicated that the ANP32A protein level significantly decreased to half of its original level. Figure 6 (A in the middle).

[0111] III. Polymerase Activity Assay

[0112] 293T-5ps-28# monoclonal cells were transduced with Nontarget control lentivirus and ANP32A-KO lentivirus, respectively. After selection with Puromycin, the cells were observed under a fluorescence microscope. Figure 6 As shown, the results indicated that the red fluorescence intensity of ANP32A knockout cells was significantly reduced, while the fluorescence intensity of control group cells was normal. This result preliminarily demonstrates that polymerase activity-dependent host factors can be screened using a combination of fluorescence intensity and whole-genome CRISPR knockout library screening method.

[0113] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A recombinant vector, characterized in that, include: (a) A first recombinant vector comprising tandem influenza virus PB1 protein-coding genes and PB2 protein-coding genes, and carrying a first resistance selection marker gene; (b) A second recombinant vector comprising a tandem influenza virus PA protein-coding gene and an NP protein-coding gene, and carrying a second resistance selection marker gene; (c) A third recombinant vector comprising a reporter gene encoding the red fluorescent protein mScarlet, driven by the RNA polymerase I promoter, and carrying a third resistance selection marker gene.

2. The recombinant vector according to claim 1, characterized in that, The sources of the influenza virus PB1 protein-coding gene, PB2 protein-coding gene, PA protein-coding gene and NP protein-coding gene include avian influenza A virus; Alternatively, it may be from the H5N1 subtype of avian influenza virus.

3. The recombinant vector according to claim 1, characterized in that, The PB1 protein-coding gene and the PB2 protein-coding gene are linked by a P2A peptide coding sequence; and / or The PA protein-coding gene and the NP protein-coding gene are linked by the P2A peptide coding sequence.

4. The recombinant vector according to claim 1, characterized in that, The first resistance selection marker gene includes the blasticidine resistance gene; and / or The second resistance selection marker gene includes the Zeocin resistance gene; and / or The third resistance selection marker gene includes the Hygromycin resistance gene.

5. The recombinant vector according to any one of claims 1 to 4, characterized in that, The recombinant vector includes a lentiviral vector; Optionally, the promoter in the lentiviral vector includes the CMV promoter.

6. A cell, characterized in that, The cells comprise the recombinant vector according to any one of claims 1 to 5; Optionally, the cells are 293T cells or A549 cells.

7. A kit for screening influenza virus polymerase activity-dependent host factors, characterized in that, Includes the recombinant vector according to any one of claims 1 to 5 or the cell according to claim 6.

8. A method for screening influenza virus polymerase activity-dependent host factors, characterized in that, include: The recombinant vector according to any one of claims 1 to 5 or the cell according to claim 6 is used for screening.

9. The method for screening influenza virus polymerase activity-dependent viruses according to claim 8 The host factor method is characterized by comprising: S1. Provide the cell according to claim 6; S2. Transduce the cells using a whole-genome CRISPR-Cas9 knockout library; S3, the red fluorescent negative cell population obtained in step S2 by flow cytometry sorting; and S4. High-throughput sequencing was performed on the sorted red fluorescent negative cell population to analyze the enriched sgRNA and screen for host factors that affect the activity of H5N1 influenza virus polymerase.

10. The method for screening influenza virus polymerase activity-dependent viruses according to claim 9 The host factor method is characterized by, The red fluorescence negative cell population sorted in step S3 includes cells with red fluorescence intensity below a preset threshold and / or no red fluorescence at all.

Images