Dpr3 gene and application thereof in increasing natural rubber yield of rubber grass
By overexpressing the DPR3 gene in rubber grass, the problem of low natural rubber yield was solved, root biomass and natural rubber content were significantly increased, and the industrialization process of rubber grass was promoted.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-05-28
- Publication Date
- 2026-08-04
AI Technical Summary
The low yield of natural rubber from rubber grass limits its industrial application, and systematic research on PC family proteins in rubber grass is relatively scarce, affecting the development and application of genes in the artificial domestication and genetic improvement of rubber grass.
The DPR3 gene was cloned and overexpressed. By overexpressing the DPR3 gene in rubber grass, the biomass of the roots and the relative content of natural rubber in rubber grass were increased. The overexpression vector was introduced into the rubber grass recipient material using Agrobacterium-mediated transformation to cultivate transgenic rubber grass plants with increased root biomass and natural rubber content.
It significantly increased the root biomass of rubber grass and the yield of natural rubber, with increases ranging from 33.16% to 46.89%, thereby enhancing the industrialization potential of rubber grass.
Smart Images
Figure CN122503401A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the DPR3 gene and its application in increasing the yield of natural rubber from rubber grass. Background Technology
[0002] Natural rubber (NR) is rubber extracted from naturally occurring rubber-producing plants, and its basic chemical composition is cis-1,4-polyisoprene. Natural rubber possesses advantages such as high elasticity, high mechanical strength, good abrasion resistance, and easy adhesion to other materials, making it an important basic industrial raw material widely used in the production of rubber products such as tires, medical gloves, rubber hoses, rubber bags, and rubber shoes. Commercially available natural rubber is mainly extracted and prepared from the latex of the Brazilian rubber tree (Hevea brasiliensis Muell. Arg.). This rubber tree has stringent environmental requirements, only thriving in specific tropical and subtropical regions, and is highly susceptible to extreme climates, limited production resources, and biological stresses such as South American leaf blight, directly causing significant vulnerability and security risks in the global natural rubber supply chain. Given the continuously rising global demand for natural rubber, there is an urgent need to develop and cultivate alternative rubber-producing crops with commercial application value.
[0003] Rubber grass (Taraxacum kok-saghyz Rodin, TKS) is a perennial herbaceous plant belonging to the genus Taraxacum in the Asteraceae family, capable of synthesizing natural rubber in its roots. The rubber produced by rubber grass is highly similar in structure and physicochemical properties to that produced by the Brazilian rubber tree (Hevea brasiliensis), giving it core potential as a commercial substitute crop for natural rubber. However, rubber grass has not undergone systematic artificial domestication, resulting in low natural rubber yields, which severely restricts its industrial application. Therefore, it is necessary to identify key functional genes regulating rubber grass root development, providing core molecular targets for breeding high-yield rubber varieties, accelerating the artificial domestication of rubber grass, and thus advancing its industrialization process.
[0004] Phytocyanins (PCs) are an important family of functional proteins in plants. Uclacyanin (UCC) is one of its core subfamilies. Existing research shows that PC family proteins are widely involved in the regulation of plant growth and development and the entire process of abiotic stress response. At the growth and development level, Arabidopsis UCC1 and UCC2 are located in the central nanodomain of the Casparian strip in the root endodermis and are key regulators of lignification in this region, maintaining endodermal barrier permeability and mineral nutrient homeostasis. Members of the rice ursolic acid-like protein (UCL) family participate in the regulation of pollen wall development, and some members can also regulate plant photosynthetic efficiency and yield. The PC family also mediates the dark-induced senescence process of plant leaves. At the stress response level, some PCs proteins have antioxidant activity and can enhance plant tolerance to abiotic stress by scavenging reactive oxygen species. Their family members can also regulate plant resistance to biotic stress via the salicylic acid signaling pathway.(Jia YR, Jin YF, Jiao Y, Zhou YX, Shi Y, Chen J, Chen YN, Huang YY, Huang J.(2024). A review on the research progress of the Phytocyanin (PC) protein family[J]. Plant Science Journal 42(5): 644-653. Nersissian, AM, Immoos,C., Hill, MG, Hart, PJ, Williams, G., Herrmann, RG, & Valentine, JS (1998). Uclacyanins, stellacyanins, and plantacyanins are distinct subfamilies of phytocyanins: plant-specific mononuclear blue copper proteins. Protein Science, 7(9), 1915-1929. Reyt, G., Chao, Z., Flis, P., Salas-González, I., Castrillo, G., Chao, DY, & Salt, DE (2020). Uclacyaninproteins are required for lignified nanodomain formation within Casparianstrips. Current Biology, 30(20), 4103-4111.e6.).
[0005] Currently, systematic research on PC family proteins in rubber grass is still relatively scarce, and the lack of relevant research has become a key constraint limiting the development and application of this family of genes in the artificial domestication and genetic improvement of rubber grass. Summary of the Invention
[0006] The inventors of this application discovered and cloned a functional gene regulating natural rubber synthesis from rubber grass and named it DPR3 (Distinguished Plant Root 3). The genomic DNA sequence of this gene is shown in SEQ ID NO:1, the coding sequence (CDS) is shown in SEQ ID NO:2, and the amino acid sequence encoding the DPR3 protein is shown in SEQ ID NO:3. Overexpression of the DPR3 gene in rubber grass promotes biomass accumulation in the roots and significantly increases the relative content of natural rubber in the roots and the yield of natural rubber. Figure 7 and Figure 8 ).
[0007] Based on the above research findings, the present invention provides a nucleic acid molecule whose nucleotide sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 2.
[0008] The nucleic acid molecules can be amplified from the genomic DNA or cDNA of rubber grass by polymerase chain reaction (PCR), or obtained by DNA chemical synthesis methods.
[0009] The present invention also provides an expression cassette, recombinant vector, or host bacterium containing the nucleic acid molecule.
[0010] The expression cassette includes a promoter that drives the expression of the nucleic acid molecule, the nucleic acid molecule, and a transcription terminator. In some embodiments, the promoter is a 35S promoter.
[0011] In some embodiments, the vector is a cloning vector carrying the aforementioned nucleic acid molecules and functional elements required for autonomous plasmid replication. In some embodiments, the vector is a plant expression vector (such as the pFGC5941 plasmid) carrying the aforementioned nucleic acid molecules and functional elements regulating heterologous protein expression.
[0012] In some embodiments, the host bacterium is *E. coli* DH5α carrying the aforementioned cloning vector, primarily used for the amplification and preservation of the nucleic acid molecules. In some embodiments, the host bacterium is *Agrobacterium tumefaciens* AGL1 carrying the aforementioned plant expression vector; this strain can mediate plant genetic transformation processes and is used to prepare transgenic plants.
[0013] The application of the nucleic acid molecules in cultivating rubber grass plants with increased root biomass and natural rubber content also falls within the scope of this invention.
[0014] The present invention also provides a method for increasing the root biomass and natural rubber content of rubber grass, which includes increasing the content or activity of DPR3 protein in rubber grass; the amino acid sequence of said DPR3 protein is shown in SEQ ID NO: 3.
[0015] Preferably, the content or activity of DPR3 protein in rubber grass is increased by overexpressing the nucleic acid molecule in rubber grass.
[0016] The present invention also provides a method for obtaining rubber grass with increased root biomass and natural rubber content, comprising: introducing an overexpression vector for overexpressing the nucleic acid molecule into rubber grass recipient material, and culturing to obtain transgenic rubber grass plants with increased root biomass and natural rubber content.
[0017] Preferably, the overexpression vector is introduced into the rubber grass receptor material using an Agrobacterium-mediated method.
[0018] The rubber grass recipient material can be any rubber grass variety or strain with genetic transformation feasibility, such as the rubber grass genome sequencing strain TK62.
[0019] Transgenic rubber grass plants with increased root biomass and natural rubber content obtained by the above method also fall within the scope of this invention.
[0020] The present invention also provides a method for producing natural rubber, comprising: cultivating transgenic rubber grass plants with increased root biomass and natural rubber content, and extracting natural rubber from the roots of the plants.
[0021] The present invention also provides a protein having the amino acid sequence shown in SEQ ID NO: 3.
[0022] This invention provides novel functional gene targets and technical support for the molecular genetic improvement and germplasm innovation of rubber grass, and has broad application prospects in the breeding of superior new varieties of high-yielding rubber grass. Attached Figure Description
[0023] Figure 1 Schematic diagram of the DPR3 gene. UTR represents the untranslated region.
[0024] Figure 2 A heatmap based on normalized RPKM (Reads Per Kilobase of exon model per Million mapped reads) values shows the relative expression abundance of the DPR3 gene in nine different tissues of rubber grass.
[0025] Figure 3 Agarose gel electrophoresis image of the full-length CDS of the DPR3 gene.
[0026] Figure 4 Statistical results of DPR3 gene expression levels in the roots of wild-type (WT) TK62 and 35S::DPR3 transgenic rubber grass lines (#1, #2, #3) were detected by real-time quantitative PCR. The ordinate represents the relative expression level of the DPR3 gene. Data are expressed as mean ± standard error (n = 3). One-way ANOVA combined with Tukey's test was used for significance analysis. Different letters indicate significant differences between groups (P < 0.05).
[0027] Figure 5 Photographs of 3-month-old plants of TK62 wild-type (WT) rubber grass and 35S::DPR3 transgenic rubber grass lines (#1, #2, #3), scale bar 2 cm.
[0028] Figure 6 The results of the determination of root dry weight of 3-month-old plants of wild-type (WT) rubber grass TK62 and transgenic rubber grass lines (#1, #2, #3) were statistically analyzed. Data are expressed as mean ± standard error (n = 14). One-way ANOVA combined with Tukey's test was used to analyze the significance of differences. Different letters indicate significant differences between groups (P < 0.05).
[0029] Figure 7 The relative content of natural rubber in the roots of 3-month-old rubber grass plants of wild-type (WT) TK62 and transgenic (#1, #2, #3) rubber grass lines were analyzed. Data are expressed as mean ± standard error (n = 3). One-way ANOVA combined with Tukey's test was used to analyze the significance of differences. Different letters indicate significant differences between groups (P < 0.05).
[0030] Figure 8 Analysis of natural rubber yield per plant in 3-month-old plants of wild-type (WT) rubber grass TK62 and transgenic rubber grass lines (#1, #2, #3). Data are expressed as mean ± standard error (n = 14). One-way ANOVA combined with Tukey's test was used to analyze the significance of differences. Different letters indicate significant differences between groups (P < 0.05). Detailed Implementation
[0031] The present invention will be further described in detail below with reference to specific embodiments. The listed embodiments are only illustrative of the present invention and do not constitute any limitation on the scope of protection of the present invention.
[0032] Unless otherwise specified, all reagents used in the examples are conventional reagents in the field of biotechnology, which can be purchased through commercial channels or prepared using conventional methods in the art. Unless otherwise specified, the experimental operations involved in the examples all employ conventional techniques in the art, and specific operations can be performed with reference to experimental manuals, published academic literature, or product instructions for the corresponding reagents / instruments. All technical and scientific terms in this document, unless otherwise defined, have the meanings commonly understood by those skilled in the art.
[0033] The rubber grass (Taraxacum kok-saghyz Rodin, TKS) TK62 strain used in the following examples was collected from Zhaosu County, Xinjiang Uygur Autonomous Region. This laboratory preserves and propagates this strain. The public can apply to the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, to obtain this material, but only for the purpose of replicating this invention.
[0034] The pFGC5941 vector used in the following examples is a plant expression vector, described in the literature "Tang, G., Yan, J., Gu, Y., Qiao, M., Fan, R., Mao, Y., & Tang, X. (2012). Construction of short tandem target mimic (STTM) to block the functions of plant and animal microRNAs. Methods 58(2), 118-25." This vector is held in our laboratory and can be obtained from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, for the sole purpose of replicating this invention.
[0035] The Escherichia coli DH5α and Agrobacterium tumefaciens AGL1 used in the following examples are commercially available strains in the field of molecular biology and can be purchased from commercial channels.
[0036] The main reagents used in the following examples are as follows: RNA Rapid Extraction Kit, manufactured by Beijing Huayueyang Biotechnology Co., Ltd., catalog number: 0416-50. SuperScript® III First-Strand Synthesis System Reverse Transcription Kit, manufactured by Invitrogen, catalog number: 18080051. DNA Polymerase KOD Plus, manufactured by Toyobo, catalog number: KOD-201. Agarose Gel Recovery Kit, manufactured by Beijing Bomaide Gene Technology Co., Ltd., catalog number: DH101-01. In-Fusion Snap Assembly Master Mix Seamless Cloning Kit, manufactured by Takara, catalog number: 638949. Basic PCR enzyme TaKaRa Taq. TM The following are product specifications: * **Product Name:** Takara Bio Inc., catalog number R001A. * **Product Name:** Plasmid small-volume rapid extraction kit, manufactured by Beijing Bomed Gene Technology Co., Ltd., catalog number DP102-01. * **Product Name:** MS basal culture medium powder, manufactured by Beijing Qiweiyicheng Technology Co., Ltd., catalog number M0222.0050. * **Product Name:** MES, 6-BA, NAA, and plant gel, all purchased from Sigma-Aldrich. * **Product Name:** Sucrose purchased from Sinopharm Chemical Reagent Co., Ltd. * **Product Name:** SsoFast EvaGreen® Supermix, manufactured by Bio-Rad, catalog number 1725201. * **Product Name:** Natural rubber standard (cis-polyisoprene), CAS number 104389-31-3, manufactured by Sigma-Aldrich, catalog number 431257-100G. * **Product Name:** Narrow-distribution polystyrene standard, purchased from the National Institute of Metrology, China, catalog number NIM-RM2068.
[0037] In the following examples, GraphPad Prism statistical software was used to process the experimental data, and the results are expressed as mean ± standard deviation. One-way ANOVA combined with Tukey's test was used to analyze significant differences. Different letters indicate significant differences between groups (P < 0.05).
[0038] Example 1. Discovery and analysis of the DPR3 gene in rubber grass.
[0039] Based on the whole genome data of rubber grass (Taraxacum kok-saghyz Rodin, TKS), a gene potentially involved in root development regulation was screened using local BLAST sequence alignment and accompanying bioinformatics analysis methods. This gene was named DPR3 (Distinguished Plant Root 3), and its genomic DNA sequence is shown in SEQ ID NO: 1, while its coding sequence (CDS) is shown in SEQ ID NO: 2. Figure 1 As shown, the DPR3 gene contains 4 exons and 3 introns. The full-length amino acid sequence of the protein encoded by the DPR3 gene is shown in SEQ ID NO: 3. Bioinformatics prediction indicates that the DPR3 protein belongs to the plant-specific Uclacyanin (UC / UCC) subfamily. To elucidate the expression pattern of the DPR3 gene in rubber grass, RNA-seq data from 9 tissues including rubber grass flowers, seeds, and young leaves obtained by our research group were analyzed. It was found that the DPR3 gene is expressed only in rubber grass flower tissues, making it a flower-specific expression gene. Figure 2 ).
[0040] Example 2. Amplification of the DPR3 gene in rubber grass and construction of an overexpression vector.
[0041] Total RNA was extracted from the flowers of wild-type plants of the TK62 strain of *Taraxacum kok-saghyz Rodin* (TKS) using a rapid RNA extraction kit (Beijing Huayueyang Biotechnology, 0416-50). The total RNA was then reverse transcribed into cDNA using the SuperScript® III First-Strand Synthesis System (Invitrogen, 18080051). Using the synthesized cDNA as a template, PCR was performed using specific primers PF-DPR3-F / PF-DPR3-R to amplify the full-length coding sequence of the DPR3 gene (SEQ ID NO: 2). The nucleotide sequences of the primers are as follows:
[0042] Upstream primer PF-DPR3-F:
[0043] 5'-TACAATTACCATGGGGCGCGCC ATGGCTATTAACAGGTTGAGGATCAT -3' (SEQ ID NO: 4)
[0044] Downstream primer PF-DPR3-R:
[0045] 5'-GGTCTTAATTAACTCTCTAGA CTAGAGTTTTACTAGTTTTCTTCCTCCCTTG -3' (SEQ IDNO: 5)
[0046] PCR amplification was performed using KOD Plus (Toyobo, KOD-201) DNA polymerase. The amplification system (50 μL) consisted of: 5 μL 10×KOD Plus Buffer, 5 μL 2 mM dNTPs, 2 μL 25 mM MgSO4, 1 μL KOD Plus (1.0 U / μL), 0.75 μL PF-DPR3-F (10 μM), 0.75 μL PF-DPR3-R (10 μM), 2 μL cDNA template, and ddH2O to a final volume of 50 μL. The amplification program was: 94℃ for 3 min; 30 cycles (98℃ for 10 s, 55℃ for 30 s, 68℃ for 2 min); 68℃ for 10 min. PCR products were detected by 1% agarose gel electrophoresis, and the DPR3 gene fragment was recovered from the gel using an agarose gel recovery kit (Beijing Bomaide Gene, DH101-01) according to the kit instructions. Figure 3 ).
[0047] The recovered DPR3 gene fragment was cloned into the pFGC5941 vector, which had been double-digested with restriction endonucleases BamHI and AscI, via recombination. The reaction mixture consisted of 150 ng of the DPR3 gene fragment, 150 ng of the double-digested pFGC5941 vector, 2 μL of 5× In-Fusion Snap Assembly Master Mix (Takara, 638949), and ddH2O to a final volume of 10 μL. The mixture was incubated at 50°C for 15 minutes to obtain the recombination product.
[0048] The recombinant reaction product was transformed into *E. coli* DH5α competent cells via heat shock. The bacterial culture was then plated on LB agar plates containing 50 mg / L kanamycin and incubated overnight at 37°C with the plates inverted. Single colonies were picked and inoculated into 500 μL of LB liquid medium containing 50 mg / L kanamycin and cultured at 37°C with shaking at 200 rpm for 3 h. The bacterial culture was identified by PCR using the DPR3 gene-specific forward primer qDPR3-F and the pFGC5941 vector reverse primer PF-R.
[0049] Forward primer qDPR3-F: 5'-CCATTCCTCCCGCTCAAGAA-3' (SEQ ID NO: 6)
[0050] Reverse primer PF-R: 5'-AAACCGGCGGTAAGGATCTG-3' (SEQ ID NO: 7)
[0051] Using the basic PCR enzyme TaKaRa TaqTM (Takara, R001A) was used for bacterial PCR. The total volume was 20 μL: 10 μL 2×GCBuffer, 2 μL 2 mM dNTPs, 0.2 μL TaKaRa Taq (5 U / μL), 0.3 μL each of 10 μM primers qDPR3-F and PF-R, and 2 μL bacterial culture. The volume was brought to 20 μL with ddH2O. The amplification program was: 94℃ for 3 min; 30 cycles (94℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min); 72℃ for 10 min. The PCR products were verified for fragment size by 1% agarose gel electrophoresis. Positive bacterial cultures were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. 200 μL of correctly sequenced bacterial culture was inoculated into 10 mL of LB liquid medium containing 50 mg / L kanamycin and incubated overnight at 37℃ and 200 rpm. The bacterial culture that had been cultured overnight was used to extract plasmids using a plasmid small-volume rapid extraction kit (Beijing Biomed Gene, DP102-01) according to the kit instructions, to obtain the DPR3 recombinant expression vector pFGC5941-DPR3.
[0052] Example 3. Obtaining DPR3-overexpressing transgenic rubber grass
[0053] 1. Preparation of recombinant Agrobacterium
[0054] The recombinant expression vector pFGC5941-DPR3 obtained in Example 2 was introduced into *Agrobacterium tumefaciens* AGL1 competent cells via electroporation. After resistance selection and sequencing verification, recombinant *Agrobacterium* AGL1-pFGC5941-DPR3 was obtained. Positive single clones of this recombinant *Agrobacterium* were picked and inoculated into LB liquid medium containing 25 mg / L rifampin and 50 mg / L kanamycin (medium composition: NaCl 10 g / L, peptone 10 g / L, yeast extract 5 g / L, pH adjusted to 7.0), and cultured at 28°C and 200 rpm in a constant temperature shaker until OD... 600 The bacterial cells were collected by centrifugation at 3,800 rpm for 10 min after reaching a pH of 0.6. The cells were then fully resuspended in an equal volume of TkR5 infection medium containing 50 mg / L acetylsyringone to obtain the AGL1-pFGC5941-DPR3 infection solution. This solution was placed on ice and allowed to stand for subsequent infection experiments. The TkR5 infection solution formulation was as follows: 4.4 g / L MS medium, 0.5 g / L MES, 0.5 mg / L 6-BA, 10 μg / L NAA, 20 g / L sucrose, and the pH was adjusted to 5.8.
[0055] 2. Agrobacterium-mediated genetic transformation of rubber grass
[0056] The TK62 cultivar of rubber grass, which underwent genome sequencing, was used as the genetic transformation recipient material. Healthy 1-2 month old leaves of the TK62 cultivar were washed and then soaked in 70% ethanol for 10 seconds, followed by soaking in 12% (v / v) Flower King disinfectant for 12 minutes. Residue was then washed away with sterile water. After removing redundant parts of the leaves with a sterile scalpel, the leaves were placed in callus induction medium (formulation: MS 4.4 g / L, MES 0.5 g / L, 6-BA 0.5 mg / L, NAA 0.01 mg / L, sucrose 20 g / L, plant gel 3.6 g / L, pH 5.8) to obtain callus tissue.
[0057] The obtained callus tissue was transferred to a sterile empty culture dish, and the prepared AGL1-pFGC5941-DPR3 infection solution was added. The callus tissue was then divided into small pieces with a particle size of approximately 2 mm using forceps, and the infection was continued for 15 min. After infection, the callus tissue was transferred to sterile filter paper, the residual bacterial solution adhering to its surface was blotted off, and the tissue was air-dried. It was then co-cultured at 21°C in the dark for 2–3 days. After co-culture, the callus tissue was transferred to TkR5 solid medium supplemented with 200 mg / L termethin and 10 mg / L Basta, and resistance selection was performed under the conditions of 21°C, 16 h light / 8 h dark. After approximately 20 days of continuous selection, resistant buds differentiated from the callus tissue. Resistant shoots were transferred to 1 / 2 MS solid medium (formulation: MS 2.2 g / L, MES 0.5 g / L, sucrose 10 g / L, plant gel 3.6 g / L, with 400 mg / L termethin and 10 mg / L Basta added, pH adjusted to 5.8) containing the corresponding screening antibiotics and cultured, with subculture every 2 weeks. After the root system of the resistant seedlings was fully developed, the resistant seedlings were transplanted to a greenhouse for planting, obtaining the T0 generation DPR3 overexpressing transgenic rubber grass (35S::DPR3).
[0058] 3. Analysis of DPR3 gene expression level in transgenic rubber grass
[0059] Transgenic rubber grass (35S::DPR3) overexpressing DPR3 (generation T0) was cultivated in a greenhouse. Nutrient soil and vermiculite were mixed evenly at a volume ratio of 1:1 as the cultivation substrate. The cultivation conditions were set as follows: constant temperature cultivation at 21℃, long day-photoperiod (16 h light / 8 h dark), and light intensity controlled at 80–120 μmol·m⁻¹. -2 ·s -1 Within the range. After 3 months of greenhouse cultivation, the whole plants were removed from the cultivation substrate, the substrate adhering to the root surface was rinsed off, the surface moisture was dried, and the root tissue was cut off. After being flash-frozen with liquid nitrogen, it was placed in an ultra-low temperature freezer at -80℃ for storage for subsequent experiments.
[0060] Total RNA was extracted from the roots of the T0 generation 35S::DPR3 transgenic rubber grass line using a rapid RNA extraction kit (Beijing Huayueyang Biotechnology, 0416-50) according to the kit instructions. Subsequently, reverse transcription was performed using the SuperScript® III First-Strand Synthesis System reverse transcription kit (Invitrogen, 18080051) according to the kit instructions to synthesize root cDNA. Quantitative real-time PCR (qRT-PCR) was performed using root cDNA from wild-type rubber grass TK62 plants and root cDNA from the T0 generation 35S::DPR3 transgenic rubber grass line as amplification templates to analyze the relative expression level of the DPR3 gene. The internal reference gene used was TkGAPDH, whose sequence and related annotation information can be found in the GWH database of the National Genome Science Data Center (http: / / bigd.big.ac.cn / gwh / ), accession number PRJCA000437, Gene ID evm.model.utg9113.3. The qRT-PCR reaction system was prepared using SsoFast EvaGreen® Supermix reagent (Bio-Rad, 1725201). Amplification and fluorescence signal acquisition were performed on a Bio-Rad CFX96 real-time quantitative PCR instrument.
[0061] The primers for quantitative real-time PCR of the DPR3 gene are:
[0062] Upstream primer qDPR3-F: 5'-CCATTCCTCCCGCTCAAGAA-3' (SEQ ID NO: 6)
[0063] Downstream primer qDPR3-R: 5'-GGCCCTGGTTACAATGGTCT-3' (SEQ ID NO: 8)
[0064] The primers for quantitative real-time PCR of the TkGAPDH gene are:
[0065] Upstream primer qTkGAPDH-F: 5'-AGTTGGTTTCGTGGTATGAC-3' (SEQ ID NO: 9)
[0066] Downstream primer qTkGAPDH-R: 5'-ACATGTCAGTGAACAGGTAGAC-3' (SEQ ID NO: 10)
[0067] The total reaction volume for quantitative real-time PCR was 10 μL, containing 5 μL of 2× SsoFast mix, 2 μL of cDNA template, and 1.5 μL each of 1 μM forward and reverse primers. The amplification program was set as follows: 98℃ pre-denaturation for 30 s; 40 cycles (98℃ for 5 s, 60℃ for 5 s, fluorescence collected at the end of each cycle); melting curve at 60–95℃, 0.5℃ / 5 s, with fluorescence signal collected every 5 s. Data were analyzed using BIO-RAD CFX Manager software.
[0068] The test results showed that the relative expression level of the DPR3 gene in the T0 generation 35S::DPR3 transgenic rubber grass lines (#1, #2, #3) was significantly higher than that in the wild-type rubber grass TK62 (WT). Figure 4 ).
[0069] Example 4. Asexual propagation of DPR3-overexpressing transgenic rubber grass
[0070] Clonal propagation of wild-type rubber grass TK62 (WT) and the T0 generation 35S::DPR3 transgenic rubber grass lines (#1, #2, #3) obtained in Example 3 was carried out using tissue culture technology. After callus tissue formed at the leaf cuts of the wild-type and transgenic lines, it was transferred to a new callus induction medium for further culture. When the callus tissue grew to a suitable size, it was divided into small pieces and slightly dried before being inoculated into a seedling strengthening medium (formulation: MS 2.2 g / L, MES 0.5 g / L, sucrose 10 g / L, plant gel 3.6 g / L, pH 5.8). Adventitious buds emerged after culture. The adventitious buds differentiated into complete sterile seedlings after 2-3 consecutive subcultures. After rooting, the sterile seedlings were transplanted to a greenhouse, and the cultivation substrate was a 1:1 (v / v) mixture of nutrient soil and vermiculite. The greenhouse cultivation parameters were: constant temperature of 21℃, light-dark cycle of 16 h / 8 h, and light intensity of 80~120 μmol·m⁻². -2 ·s -1 .
[0071] Example 5. Analysis of root biomass and natural rubber yield of DPR3-overexpressing transgenic rubber grass
[0072] 1. Root biomass analysis
[0073] Tissue-cultured aseptic seedlings of wild-type (WT) rubber grass TK62 and transgenic rubber grass lines (#1, #2, #3) were transplanted to a greenhouse for three months. The intact plants were then dug up and thoroughly cleaned. After photographing the overall phenotype of the plants, the above-ground parts were removed, and the entire root system was dried in a 50℃ oven to constant weight. The dry weight of individual roots was measured, and statistical significance analysis was performed.
[0074] The results showed that DPR3 gene overexpression significantly increased root biomass accumulation in rubber grass. Figure 5 and Figure 6 Compared with the wild-type rubber grass TK62 (WT), the root dry weight of the three 35S::DPR3 transgenic rubber grass lines (#1, #2, and #3) was significantly increased, with the increase in #1 line being 33.16%, #2 line being 18.38%, and #3 line reaching an increase of 46.89%. Figure 6 ).
[0075] 2. Extraction and yield analysis of natural rubber from roots
[0076] Tissue-cultured aseptic seedlings of wild-type (WT) rubber grass TK62 and transgenic rubber grass lines (#1, #2, #3) were transplanted to a greenhouse for 3 months. Roots were harvested intact, rinsed clean, and dried at 50℃ to constant weight. After weighing the dry weight of the roots, the roots were frozen in liquid nitrogen and ground into powder. 100 mg of root powder was accurately weighed and placed in a 2.0 mL centrifuge tube, 1 mL of toluene was added for complete suspension, vortexed for 1 min, and then extracted at 50℃ and 750 rpm for 2 h. After extraction, the extract was centrifuged at 10,000 rpm for 10 min at room temperature, and the supernatant was obtained as the natural rubber extract.
[0077] The natural rubber content was determined using Fourier Transform Infrared (FT-IR) spectroscopy, following the method described in the literature "Rolere, S., Liengprayoon, S., Vaysse, L., Sainte-Beuve, J., and Bonfils, F. (2015). Investigating natural rubber composition with Fourier Transform Infrared (FT-IR) spectroscopy: a rapid and non-destructive method to determine both protein and lipid contents simultaneously. Polymer Testing 43,83-93." The specific steps are as follows:
[0078] Natural rubber standard solutions of 0.5, 1, 2, 4, 6, and 8 mg / mL (Sigma-Aldrich, 431257-100G) were prepared using toluene as solvent. 150 μL of each concentration of natural rubber standard solution was mixed with 15 μL of 10 mg / mL narrow-distribution polystyrene internal standard solution (National Institute of Metrology, NIM-RM2068). 70 μL of the mixture was evenly coated onto potassium bromide pellets, dried, and then detected using a BRUKER TENSOR 27 Fourier transform infrared spectrometer, with 32 scans per sample. After atmosphere compensation and baseline correction, the characteristic peak of natural rubber (835 cm⁻¹) was calculated. -1 ) and the characteristic peak of the internal standard (699 cm⁻¹) -1 The peak area ratio of natural rubber was used as the ordinate. A standard curve was plotted with the peak area ratio as the ordinate and the natural rubber concentration as the abscissa, and the regression equation obtained was X = (Y - 0.0698) / 0.2596 (R²). 2 = 0.9961), where X represents the concentration of natural rubber (mg / mL), and Y represents 835 cm⁻¹. -1 With 699 cm -1 The peak area ratio.
[0079] The prepared natural rubber extract was tested according to the above standard test procedure. The peak area ratio of the obtained characteristic peaks was substituted into the above standard curve equation to calculate the natural rubber concentration of the sample. Then, the relative content of natural rubber in the roots of the rubber grass TK62 wild type and 35S::DPR3 transgenic rubber grass lines was calculated according to the formula "Relative content of natural rubber (%) = [Natural rubber concentration (mg / mL) × Volume of toluene used to dissolve rubber (mL) / Mass of dry root powder (mg)] × 100%". Figure 7 As shown, the relative content of natural rubber in the roots of DPR3-overexpressing transgenic rubber grass lines (#1, #2, #3) was significantly increased compared with that of wild-type rubber grass TK62 (WT), with increases of 46.22% (#1), 54.54% (#2), and 25.79% (#3), respectively.
[0080] The yield of natural rubber per plant is calculated by combining the root dry weight of each plant with the formula: "Natural rubber yield per plant = Relative natural rubber content in roots × Root dry weight per plant". For example... Figure 8 As shown, the natural rubber yield per plant of the DPR3 overexpressing transgenic rubber grass lines (#1, #2, #3) was significantly higher than that of the wild-type rubber grass TK62 (WT), with line #1 increasing by 104.02%, line #2 by 91.69%, and line #3 by 93.61%.
Claims
1. A nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO:
2.
2. An expression cassette, recombinant vector, or host bacterium comprising the nucleic acid molecule of claim 1.
3. The application of the nucleic acid molecule described in claim 1 in cultivating rubber grass plants with increased root biomass and natural rubber content.
4. A method for increasing the root biomass and natural rubber content of rubber grass, comprising increasing the content or activity of DPR3 protein in rubber grass; the amino acid sequence of said DPR3 protein is shown in SEQ ID NO:
3.
5. The method according to claim 4, characterized in that: The content or activity of DPR3 protein in rubber grass is increased by overexpressing the nucleic acid molecule of claim 1 in rubber grass.
6. A method for obtaining rubber grass with increased root biomass and natural rubber content, comprising: An overexpression vector for overexpressing the nucleic acid molecule of claim 1 was introduced into a rubber grass recipient material, and transgenic rubber grass plants with increased root biomass and natural rubber content were obtained through cultivation.
7. The method according to claim 6, characterized in that: The overexpression vector was introduced into the rubber grass receptor material using Agrobacterium-mediated transformation.
8. A transgenic rubber grass plant with increased root biomass and natural rubber content obtained by the method of claim 6 or 7.
9. A method for producing natural rubber, comprising: The transgenic rubber grass plant with increased root biomass and natural rubber content as described in claim 8 is cultivated, and natural rubber is extracted from the roots of the plant.
10. A protein having the amino acid sequence shown in SEQ ID NO: 3.