Application of SNP molecular marker related to pig feed conversion ratio
By identifying and selecting individuals with the AG genotype as parents through the SNP molecular marker at the 158bp site of the 6th intron of the CTSL gene, the problem of the lack of molecular markers related to the feed conversion ratio in pigs in the existing technology has been solved, thereby reducing the feed conversion ratio of pig offspring and improving breeding efficiency and economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JILIN ACAD OF AGRI SCI
- Filing Date
- 2026-07-08
- Publication Date
- 2026-08-04
AI Technical Summary
The lack of efficient molecular markers related to the feed conversion ratio in pigs in existing technologies makes it difficult to optimize pig breeding programs through scientific means, which affects breeding costs and economic benefits.
A SNP molecular marker associated with the feed conversion ratio (FCR) of pigs is provided, located at the 158bp site of the 6th intron of the pig CTSL gene. Individuals with the genotype AG are identified by PCR amplification and sequencing. These individuals are then used as parents for breeding to reduce the FCR of pig offspring.
By identifying and selecting individuals with the AG genotype as parents, the feed conversion ratio of pig offspring can be significantly reduced, feed conversion efficiency can be improved, breeding costs can be reduced, and genetic breeding auxiliary selection tools can be provided to enhance the production performance and market competitiveness of pigs.
Smart Images

Figure CN122503520A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic breeding technology, specifically to the application of an SNP molecular marker related to the feed conversion ratio in pigs. Background Technology
[0002] With changing market demands and increasing complexity in the farming environment, traditional breeding methods are no longer sufficient to meet the needs of modern animal husbandry, especially given the frequent occurrence of diseases, climate change, and rising consumer demands for pork quality. Therefore, optimizing pig breeding programs through scientific methods has become a research hotspot. Systematic genetic improvement, precise mating, and environmental adaptability enhancement can significantly improve pig production performance and market competitiveness. Marker-assisted selection (MAS) helps identify individuals carrying superior genes, but current technologies lack efficient molecular markers directly related to feed conversion ratio (F / G). F / G is a key economic trait for measuring feed conversion efficiency in pigs and directly impacts farming costs.
[0003] Therefore, developing SNP molecular markers related to feed conversion ratio is of great significance for improving the breeding efficiency and economic benefits of pigs. Summary of the Invention
[0004] To address the above problems, this invention provides an application of SNP molecular markers related to the feed conversion ratio in pigs.
[0005] This invention is achieved through the following technical solution: An application of a SNP molecular marker related to pig feed conversion ratio, wherein the base sequence of the SNP molecular marker is shown in SEQ ID NO. 1, and the base at the 158th bp position is A or G.
[0006] The application refers to any one of the following (1) and (2): (1) Identification of feed conversion ratio in pigs: The feed conversion ratio of individuals with the genotype AG at 158bp of SEQ ID NO. 1 is lower than that of individuals with the genotype AA or GG.
[0007] (2) Reduce the feed conversion ratio of pig offspring: Select individuals with genotype AG at 158bp of SEQ ID NO. 1 as parents for breeding in order to reduce the feed conversion ratio of pig offspring.
[0008] SEQ ID NO. 1: ttctggtgagttgaattttccgttttccttttcattgaccaatactatttttttgtcaccaatttaagtcttacttagaatttgtttagggcatttcgctgaaatttgaaatgcct ctcttagctggttgataagggtgggttatactgtcaggttac[a / g]cttggaactcctcaccccaacattggctttcactctcccaggcatttattatgatccagactgcagcagcaaa gacctggatcatggtgttttggtggttggctatggctttgaaggaactgattcaaatagcagtaaattttggattgtcaagaacaggtatgaaactccaatgtttacattttaaatt gaaaagggaaatccttgatgttcccgtcatggcttagcgggaacaaagccatgacgggaatccatgaggatgcgggttctgtccctggcctcactcagtaggttaagcatccggtgt.
[0009] Preferably, the method for determining the feed conversion ratio of pigs is as follows: The primer set was used to amplify the pig DNA template by PCR to obtain the PCR product; the primer set included an upstream primer and a downstream primer.
[0010] The PCR products were subjected to agarose gel electrophoresis and sequencing.
[0011] Individuals with the genotype AG at SEQ ID NO. 1 (158bp) had a lower feed conversion ratio than individuals with the genotypes AA or GG.
[0012] Preferably, the method for reducing the feed conversion ratio of pig offspring is as follows: The primer set was used to amplify the pig DNA template by PCR to obtain the PCR product; the primer set included an upstream primer and a downstream primer.
[0013] The PCR products were subjected to agarose gel electrophoresis and sequencing.
[0014] Individuals with the genotype AG at SEQ ID NO. 1 at 158bp were selected as parents for breeding to reduce the feed conversion ratio of pig offspring.
[0015] The base sequence of the upstream primer is shown in SEQ ID NO. 2; the base sequence of the downstream primer is shown in SEQ ID NO. 3.
[0016] Preferably, the PCR amplification reaction system consists of 10 μL of polymerase chain reaction premix, 1.2 μL of DNA, 0.4 μL of upstream primer, 0.4 μL of downstream primer, and ddH2O added to a final volume of 20 μL.
[0017] Preferably, the concentration of the upstream primer is 10 μmol / L; the concentration of the downstream primer is 10 μmol / L.
[0018] Preferably, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing at 61.5℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; extension at 72℃ for 5 min; storage at 4℃.
[0019] Preferably, the pig is a Duroc pig.
[0020] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of an SNP molecular marker related to the feed conversion ratio of pigs, wherein the base sequence of the SNP molecular marker is shown in SEQ ID NO. 1, and the base at the 158th bp position is A or G; The application refers to any one of the following (1) and (2): (1) identifying the feed conversion ratio (FCR) of pigs; (2) reducing the FCR of pig offspring. First, the SNP molecular marker is located in the 6th intron of the CTSL gene in pigs. The site is clear, and the detection method is simple and reliable. The individual genotype can be accurately identified by PCR amplification and sequencing. Second, the experiment of this invention proves that the FCR of individuals with the AG genotype is the lowest and significantly lower than that of the AA genotype. Therefore, this marker can be used to screen breeding pigs in the early stage and select individuals with the AG genotype as parents, thereby effectively reducing the FCR of offspring. Duroc pigs are usually used as terminal sires in pig production. This means that its most important task is to pass on its excellent genes such as fast growth, high feed conversion rate, and high lean meat percentage to commercial pigs. Therefore, in Duroc breeding pigs, the FCR has medium heritability. Even small differences in the FCR will be amplified due to its strong genetic effect, affecting the production efficiency of thousands of commercial pigs. Feed costs account for 70% to 80% of the overall production cost of a pig. A reduction of 0.1 in the feed conversion ratio (FCR) can decrease the feed cost per pig by approximately 30 to 40 yuan. Therefore, reducing the FCR in offspring through the molecular markers of this invention can improve feed conversion efficiency and reduce breeding costs. Finally, these molecular markers provide a new auxiliary selection tool for pig genetic breeding, helping to accelerate the selection process for superior breeds and possessing broad application prospects and economic benefits. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 This is a diagram showing the sequence alignment results of the Duroc CTSL gene mutation site in this invention.
[0023] Figure 2 The peak diagram of the Duroc CTSL gene mutation site with AA genotype is shown in the figure.
[0024] Figure 3 The peak diagram of the Duroc CTSL gene mutation site with AG genotype is shown in the figure.
[0025] Figure 4 The peak diagram shows the GG genotype of the Duroc CTSL gene mutation site in this invention. Detailed Implementation
[0026] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0027] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0028] The beneficial effects of the present invention will be illustrated below through specific embodiments.
[0029] Average Daily Gain (ADG) is a measure of the average daily weight gain.
[0030] Average Daily Feed Intake (ADFI) is a measure of the average daily feed intake.
[0031] The feed / gain ratio, abbreviated as F / G, is the ratio of feed to meat.
[0032] Example 1 1. Materials and Methods 1.1 Collection of experimental animals and samples Twenty-one healthy Duroc pigs, each weighing 70.44 kg, were selected from the pig farm of the Jilin Academy of Agricultural Sciences. Initial weight was recorded at the start of the experiment, and final weight was recorded at the end. The experiment lasted 50 days, during which the pigs had free access to feed and water. Feed intake and uneaten feed were recorded for each pig to calculate average daily weight gain, average daily feed intake, and feed conversion ratio. Ear tissue samples were collected using punch forceps and placed in 1.5 mL centrifuge tubes containing 75% ethanol. The tubes were marked and stored at 4°C for later use.
[0033] 1.2 Genomic DNA Extraction 30 mg of ear tissue was taken from each Duroc pig, minced, and DNA was extracted from the ear tissue using a tissue genomic DNA extraction kit (product number DP304) purchased from TIANGEN, following the instructions. The concentration and purity of the DNA were detected using a NanoDrop One micro-spectrophotometer and stored at -80°C.
[0034] 1.3 Primer Design and Synthesis The transcript number of the porcine CTSL gene is ENSSSCT00110036601.1. The sixth intron of the porcine CTSL gene is labeled as CTSL-6. Primers were designed based on the base sequence of CTSL-6 in the ensemble, as shown in Table 1. The sequence was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.
[0035] Table 1 CTSL-6 primer sequences
[0036] 1.4 PCR Amplification The primers shown in Table 1 were used to perform PCR amplification on the extracted ear tissue DNA.
[0037] PCR reaction system: 10 μL EmeraldAmp polymerase chain reaction premix, 1.2 μL DNA, 0.4 μL 10 μmol / L upstream primer, 0.4 μL 10 μmol / L downstream primer, and ddH2O added to 20 μL.
[0038] PCR reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing at 61.5℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; 72℃ extension for 5 min; store at 4℃.
[0039] After the PCR products were confirmed to have the correct band length by agarose gel electrophoresis, they were sent to Genewiz Biotechnology Co., Ltd. for Sanger sequencing.
[0040] 1.5 CTSL gene polymorphism detection DNAMAN software was used to perform base sequence alignment on the CTSL-6 sanger sequencing results of Duroc pigs to identify mutation sites. Then, Chromas software was used to analyze the sequencing peak diagram to determine the individual genotype.
[0041] 2. Results 2.1 Analysis of sequencing results of Duroc CTSL-6 PCR products The CTSL-6 sequencing results were compared with the pig genomic DNA sequences published by Ensembl using DANMAN software. Figure 1 As shown, there is an A / G SNP mutation at nucleotide 679 in intron CTSL-6 of the porcine CTSL gene. The peak plot was analyzed using Chromas software. Figure 2 As shown, this locus exhibits three genotypes: AA, AG, and GG.
[0042] This invention extracts a sequence containing the SNP site as a reference. The base sequence containing the SNP mutation site is shown in SEQ ID NO.1. An A / G SNP exists at position 158 of the extracted sequence, corresponding to position 679 of the complete CTSL-6 sequence; position 158 is represented by [a / g], specifically: ttctggtgagttgaattttccgttttccttttcattgaccaatactatttttttgtcaccaatttaagtcttacttagaatttgtttagggcatttcgctgaaatttgaaatgcct ctcttagctggttgataagggtgggttatactgtcaggttac[a / g]cttggaactcctcaccccaacattggctttcactctcccaggcatttattatgatccagactgcagcagcaaa gacctggatcatggtgttttggtggttggctatggctttgaaggaactgattcaaatagcagtaaattttggattgtcaagaacaggtatgaaactccaatgtttacattttaaatt gaaaagggaaatccttgatgttcccgtcatggcttagcgggaacaaagccatgacgggaatccatgaggatgcgggttctgtccctggcctcactcagtaggttaagcatccggtgt.
[0043] 2.2 Genetic analysis of Duroc CTSL gene SNP loci 2.2.1 Genotype frequency and gene frequency Genotype frequencies, gene frequencies, and chi-square values of genotype distribution at Duroc CTSL-6 A / G loci 2 See Table 2. The results show that the AA genotype was the most numerous and was the dominant genotype; A was the dominant gene. χ² 2 test p >0.05 indicates that the gene distribution at the A / G loci in Duroc pigs conforms to Hardy-Weinberg equilibrium.
[0044] Table 2 Genotype and gene frequencies of the Duroc CTSL gene
[0045] Note: " / " indicates that this item is not present.
[0046] 2.2.2 Population genetic diversity Table 3 shows the Ho, He, Ne, and PIC loci of CTSL-6 in the population. The SNP locus He is at a moderate level; Ne is close to 2, indicating that these alleles are evenly distributed in the population; PIC shows moderate polymorphism, 0.25 < PIC < 0.5.
[0047] Table 3. Genetic diversity of Duroc CTSL gene SNP sites.
[0048] 2.3 Association analysis between Duroc CTSL gene SNP sites and growth performance Association analysis was performed on the A / G loci of CTSL-6 with daily feed intake, daily weight gain, and feed conversion ratio in Duroc pigs (see Table 4). The results showed that the A679G locus was not significantly correlated with daily feed intake or daily weight gain. p >0.05; but significantly correlated with feed conversion ratio. p <0.05. Compared to the GG and AA types, the AG genotype individuals in this population had the lowest feed conversion ratio, significantly lower than the AA genotype individuals, but no significant difference in traits compared to the GG genotype individuals. The experimental results indicate that the AG genotype individuals had the best traits and the lowest feed conversion ratio, followed by the GG genotype, and the AA genotype had the worst.
[0049] Table 4. Association analysis of Duroc CTSL gene SNP sites and growth performance.
[0050] Note: Different lowercase letters indicate significant differences. p <0.05, where the same letter indicates no significant difference. p >0.05.
[0051] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0052] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.
Claims
1. An application of a SNP molecular marker related to the feed conversion ratio in pigs, characterized in that, The base sequence of the SNP molecular marker is shown in SEQ ID NO. 1, with the base at position 158bp being either A or G; The application refers to any one of the following (1) and (2): (1) Identification of feed conversion ratio in pigs: The feed conversion ratio of individuals with the genotype AG at 158bp of SEQ ID NO. 1 is lower than that of individuals with the genotypes AA or GG; (2) Reduce the feed conversion ratio of pig offspring: Select individuals with the genotype AG at 158bp of SEQ ID NO. 1 as parents for breeding in order to reduce the feed conversion ratio of pig offspring.
2. The application according to claim 1, characterized in that, The method for determining the feed conversion ratio of pigs is as follows: A primer set was used to amplify a pig DNA template by PCR to obtain PCR products; the primer set included an upstream primer and a downstream primer. The PCR products were subjected to agarose gel electrophoresis and sequencing. Individuals with the genotype AG at SEQ ID NO. 1 (158bp) had a lower feed conversion ratio than individuals with the genotypes AA or GG.
3. The application according to claim 1, characterized in that, The following are methods to reduce the feed conversion ratio in pig offspring: A primer set was used to amplify a pig DNA template by PCR to obtain PCR products; the primer set included an upstream primer and a downstream primer. The PCR products were subjected to agarose gel electrophoresis and sequencing. Individuals with the genotype AG at SEQ ID NO. 1 at 158bp were selected as parents for breeding to reduce the feed conversion ratio of pig offspring.
4. The application according to claim 2 or 3, characterized in that, The base sequence of the upstream primer is shown in SEQ ID NO. 2; the base sequence of the downstream primer is shown in SEQ ID NO.
3.
5. The application according to claim 2 or 3, characterized in that, The PCR amplification reaction system consisted of 10 μL of polymerase chain reaction premix, 1.2 μL of DNA, 0.4 μL of upstream primer, 0.4 μL of downstream primer, and ddH2O added to a final volume of 20 μL.
6. The application according to claim 5, characterized in that, The concentration of the upstream primer is 10 μmol / L; the concentration of the downstream primer is 10 μmol / L.
7. The application according to claim 2 or 3, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing at 61.5℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; extension at 72℃ for 5 min; storage at 4℃.
8. The application according to claim 1, characterized in that, The pig in question is a Duroc pig.