Double-stranded RNA for synergistically controlling plutella xylostella with chemical insecticides and application thereof

Abstract

This invention discloses a double-stranded RNA for synergistic control of diamondback moth using chemical insecticides. It also discloses an insecticidal composition for controlling diamondback moth, the application of the aforementioned double-stranded RNA in the preparation of formulations for synergistic control of diamondback moth using chemical insecticides, and a method for synergistic control of diamondback moth using chemical insecticides. The dsRNA of this invention is simultaneously silenced using RNAi technology. ABCB1 and GSTt1 This gene simultaneously weakens the metabolic detoxification and pesticide efflux capabilities of the diamondback moth. Compared with single-target dsRNA, it significantly enhances the lethality of various chemical insecticides such as chlorantraniliprole and spinosad, and can reduce the dosage while maintaining efficacy, thus delaying the development of resistance. This dsRNA sequence is highly specific, targeting only a specific detoxification gene in the diamondback moth, and has good environmental safety.

Description

Technical Field

[0001] This invention belongs to the field of biopesticide technology, specifically, it relates to a double-stranded RNA that synergistically enhances the effect of chemical insecticides in controlling diamondback moth and its application. Background Technology

[0002] Diamondback moth ( Plutella xylostella Diamondback moth (PMS) is one of the major pests of cruciferous vegetables, characterized by rapid reproduction, significant generation overlap, and strong environmental adaptability, allowing it to persist in both open fields and greenhouse agriculture. Its larvae primarily feed on the leaves of host plants, causing perforation, damage, or even leaving only the veins, severely impacting crop yield and market quality. Currently, control of PMS relies mainly on chemical insecticides, including diamides, pyrethroids, organophosphates, and other novel insecticides. However, long-term, single, or repeated use of chemical agents has led to significant resistance in PMS to many insecticides, resulting in a continuous decline in control effectiveness.

[0003] In recent years, RNAi technology has received widespread attention in the field of agricultural pest control due to its high targeting accuracy and relative safety to non-target organisms. Regarding resistance regulation, some studies have attempted to use RNAi technology to target and silence genes related to detoxification in the diamondback moth to restore or enhance pesticide sensitivity.

[0004] Refer to Hu et al. Identification of a novel cytochrome P450 gene, CYP321E1 From the diamondback moth, Plutella xylostella (L.) and RNA interference to evaluate its role in chlorantraniliprole resistance[J]. Bulletin of Entomological Research, 2014, 104(6): 716-723. This study silenced the cytochrome P450 gene in the diamondback moth using RNAi technology. CYP321E1 The expression of this gene significantly increased the sensitivity of the diamondback moth to chlorantraniliprole, confirming the feasibility of using RNAi to silence detoxification genes and restore insecticide efficacy. However, this approach only targets a single P450 gene, limiting the silencing to the P450-mediated oxidative metabolism detoxification pathway, which is insufficient to address the metabolic resistance system of the diamondback moth, which relies on the synergistic action of multiple detoxification pathways.

[0005] CN104610440A discloses a gene targeting the ABC transporter protein of the diamondback moth. ABCH1The specific dsRNA, delivered via microinjection, caused mortality in both larval and pupal stages of Bt Cry1Ac-sensitive and resistant diamondback moth populations, revealing the potential of ABC transporters as RNAi control targets for lepidopteran pests. However, this approach targets only a single ABC subfamily gene, limiting it to Bt insecticidal protein resistance and not addressing metabolic resistance to chemical pesticides.

[0006] CN114716409A discloses a class of small chemical molecule inhibitors targeting glutathione S-transferase (GST). By inhibiting the GST metabolic system in pests, this method can restore the sensitivity of various pesticide-resistant pests, including diamondback moth, rice stem borer, cotton aphid, and thrips, to mainstream insecticides, verifying the feasibility of GST inhibition as a broad-spectrum synergistic strategy. However, this approach uses a small chemical molecule pathway and lacks the sequence specificity advantage of dsRNA.

[0007] The aforementioned existing technologies have explored the application of RNAi or chemical inhibition strategies in resistance management from three targets: P450, ABC transporter and GST, but all of them have obvious limitations.

[0008] In summary, existing technologies have the following main shortcomings in the control of pesticide resistance in diamondback moth: First, existing RNAi protocols all target only a single detoxification gene or a single detoxification pathway (e.g., CN104610440A targets only the ABC transporter, and Hu targets only P450). However, the metabolic resistance of diamondback moth involves the synergistic effects of multiple pathways such as P450, GST, CarE, and ABC transporter, and silencing a single target is unlikely to comprehensively weaken its detoxification ability. Secondly, there is still a lack of dual-target dsRNA strategies that can simultaneously target the ABC transporter efflux pathway and the GST metabolic detoxification pathway, thereby synergistically blocking the pest's detoxification process of pesticides at the two key stages of metabolic detoxification and drug efflux. Third, existing GST-targeting synergistic solutions (such as CN114716409A) use chemical small molecule pathways, and there is still a lack of nucleic acid synergists based on dsRNA that can be used in synergy with various chemical pesticides with different mechanisms of action to universally improve the efficacy of control. Summary of the Invention

[0009] The purpose of this invention is to overcome the shortcomings of existing RNAi technologies, which only target a single detoxification gene or a single detoxification pathway and are unable to comprehensively weaken the metabolic resistance of the diamondback moth. By simultaneously blocking the drug efflux and metabolic detoxification pathways of the diamondback moth, this invention synergistically reduces the pest's detoxification ability against chemical pesticides at two key stages, thereby providing a method to simultaneously silence the diamondback moth. ABCB1 and GSTt1 Double-stranded RNA targeting genes and its insecticidal compositions and applications.

[0010] To achieve the above-mentioned technical objectives, in a first aspect, the present invention provides a double-stranded RNA for synergistically controlling diamondback moth with chemical insecticides, wherein the double-stranded RNA comprises components derived from the diamondback moth. ABCB1 The nucleotide sequence of nucleotides 3430-3629 in the coding region of the gene and the nucleotide sequence derived from the diamondback moth GSTt1 The nucleotide sequence of nucleotides 429-628 in the coding region of a gene, with the two nucleotide sequences linked together; The nucleotide sequence of the DNA template encoding the double-stranded RNA is shown in SEQ ID NO:9.

[0011] According to a preferred embodiment of the present invention, the nucleotide sequence of the sense strand of the double-stranded RNA is shown in SEQ ID NO:16, and the nucleotide sequence of the antisense strand of the double-stranded RNA is shown in SEQ ID NO:17.

[0012] In a second aspect, the present invention provides an insecticidal composition for controlling diamondback moth, comprising the double-stranded RNA as described above.

[0013] According to a preferred embodiment of the present invention, the insecticidal composition further comprises a chemical insecticide.

[0014] Furthermore, the chemical insecticide is selected from one or more of chlorantraniliprole, abamectin, indoxacarb, lufenuron, abamectin, spinosad, and Bacillus thuringiensis.

[0015] According to a preferred embodiment of the present invention, the insecticidal composition is in the form of a lipid nanoparticle formulation.

[0016] Furthermore, the lipid nanoparticle formulation is an octadecylamine-sterol lipid nanoparticle formulation.

[0017] A third aspect of the invention provides the use of the double-stranded RNA described above in the preparation of formulations for synergistic control of diamondback moth by chemical insecticides.

[0018] A fourth aspect of the present invention provides a method for synergistically controlling diamondback moth with chemical pesticides, comprising applying the double-stranded RNA as described above together with a chemical pesticide to the diamondback moth.

[0019] According to a preferred embodiment of the present invention, the method of application is selected from injection, feeding or spraying.

[0020] The beneficial effects of this invention are as follows: 1. The mechanism of action of the dsRNA provided in this invention is to simultaneously inhibit [the virus] through RNAi technology. ABCB1 and GSTt1Gene expression can simultaneously weaken the diamondback moth's metabolic detoxification and pesticide efflux capabilities, thereby reducing the insect's ability to detoxify from pesticides and enhancing lethality. (This is in contrast to targeted therapy.) ABCB1 or GSTt1 Compared with the control dsRNA, the dsRNA provided by this invention can significantly enhance the lethality of various chemical insecticides on diamondback moth.

[0021] 2. The dsRNA provided by this invention can reduce the dosage of pesticides while ensuring the control effect, thereby delaying the further development of pesticide resistance in diamondback moth.

[0022] 3. The dsRNA provided by this invention can be used in combination with a variety of commercially available insecticides (chlorantraniliprole, abamectin·indoxacarb, lufenuron, abamectin, spinosad, Bt, etc.) without the need to develop new chemical pesticides. This invention can serve as an important supplement to existing chemical control systems, providing a new technical approach for the management of diamondback moth resistance, and aligns with the direction of green pest control and sustainable agricultural development.

[0023] 4. The dsRNA described in this invention has sequence specificity and acts only on specific detoxification-related genes of diamondback moth, which is expected to reduce the impact on non-target organisms. Attached Figure Description

[0024] Figure 1 Target genes of diamondback moth ABCB1 and GSTt1 Response levels to different concentrations of chlorantraniliprole stress. Among them, Figure 1 A is a target gene of the diamondback moth. ABCB1 Response levels to different concentrations of chlorantraniliprole stress. Figure 1 B is a target gene of the diamondback moth. GSTt1 Response levels to different concentrations of chlorantraniliprole stress.

[0025] Figure 2 This image shows agarose gel electrophoresis detection of dsRNAs targeting different targets. Lane 1: GoldBand DL5,000 DNA Marker (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., 10504ES60); Lane 2: ABCB1-dsRNA; Lane 3: GSTt1-dsRNA; Lane 4: A+G-dsRNA.

[0026] Figure 3 A comparative graph showing the effects of combining dsRNA targeting different targets with chlorantraniliprole on the mortality rate of diamondback moth.

[0027] Figure 4 A comparison of mortality rates to show the effect of dual-target (A+G) dsRNA injection on the efficacy of chlorantraniliprole.

[0028] Figure 5 This figure shows the relative expression changes of the ABCB1 and GSTt1 genes in the diamondback moth under chlorantraniliprole stress.

[0029] Figure 6 A comparison of concentration-effect fitting curves for chlorantraniliprole used alone and in combination with dual-target dsRNA.

[0030] Figure 7 A comparative graph showing the effects of combining target dsRNA with different chemical pesticides on the mortality rate of diamondback moth larvae.

[0031] Figure 8 A comparative graph showing the effects of different LNPs loaded with dsRNA on the mortality rate of diamondback moth larvae after indoor feeding. Detailed Implementation

[0032] The present invention will be described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are all available through conventional commercial channels.

[0034] To screen key target genes in the detoxification metabolic pathway of the diamondback moth, the inventors designed and synthesized 51 dsRNAs targeting genes in the GST pathway, P450 pathway, ABC transporter family, and Toll and IMD immune-related pathways. Systematic testing revealed that dsRNAs targeting the GST pathway and ABC transporter family were the most effective.

[0035] This application provides a method targeting the detoxification metabolic pathway of the diamondback moth. ABCB1 and GSTt1 A genetically engineered dual-target dsRNA molecule, using RNAi technology, simultaneously silences the expression of two target genes, thereby concurrently weakening the metabolic detoxification capacity and pesticide efflux capacity of the diamondback moth, thus increasing the effective accumulation level of pesticides in the diamondback moth and enhancing its lethal effect. The following detailed description, in conjunction with specific embodiments, further illustrates this application.

[0036] Example 1: Detection of the response level of the target gene to chlorantraniliprole This embodiment aims to detect the diamondback moth under stress from different concentrations of chlorantraniliprole. ABCB1 (GenBank login ID: XM_048622171.1) ） and GSTt1The changes in mRNA expression levels of the gene (GenBank accession number: NM_001309089.1) were analyzed to verify whether the two target genes could be induced to be upregulated by the drug, thus providing a basis for their use as RNAi enhancement targets.

[0037] Healthy, physiologically consistent third-instar diamondback moth larvae were selected and randomly divided into four treatment groups: a control group treated with 0.1% Triton X-100 aqueous solution, a control group treated with 1.25 mg / L (LC50) aqueous solution, and a control group treated with 1.25 mg / L (LC50) aqueous solution. 30 Concentration), 4.3 mg / L (LC) 50 ) and 66 mg / L (LC 80 Three sublethal concentrations of chlorantraniliprole solution were used as experimental groups. All groups were treated with leaf immersion and then fed to larvae. Each treatment group had three biological replicates, with 10 larvae per replicate. Diamondback moth larvae were reared in an artificial climate chamber before and after treatment. The culture conditions in the artificial climate chamber were: temperature 25±1℃, relative humidity 70%±5%, and photoperiod L:D=16:8.

[0038] After 24 h of continuous drug stress treatment, surviving larval samples were randomly collected from each treatment group and immediately flash-frozen in liquid nitrogen. Total RNA was extracted from each sample using the TRIzol reagent method. After DNase I digestion to remove genomic DNA contamination, the concentration, purity, and integrity of the RNA were detected by micro-spectrophotometry and agarose gel electrophoresis. 1 µg of total RNA was used to synthesize first-strand cDNA using a reverse transcription kit. Using the synthesized cDNA as a template, a specific method was employed... ABCB1 Gene-specific primers (q-ABCB1-F / q-ABCB1-R) GSTt1 Gene-specific primers (q-GSTt1-F / q-GSTt1-R) and internal reference genes RPS4 Specific primers (q-RPS4-F / q-RPS4-R) were used, and the primer sequences are shown in Table 1. Amplification was performed on a real-time quantitative PCR instrument. Three technical replicates were set up for each sample, and the reaction system and procedure followed the instructions of the Taq Pro Universal SYBR qPCRMaster Mix (Vazyme, Nanjing) premixed reagent. 2 ΔΔCt The relative expression levels of the gene were calculated using a method that uses the expression level of the control group as a calibration benchmark. The relative expression levels of the target gene in each pesticide treatment group were calculated separately.

[0039] Table 1. RT-qPCR specific primer sequences

[0040] Figure 1Target genes of diamondback moth ABCB1 and GSTt1 Response levels to different concentrations of chlorantraniliprole stress. Figure 1 As shown, with increasing concentrations of chlorantraniliprole, the number of diamondback moth larvae... ABCB1 and GSTt1 The expression levels of all genes showed an upregulation trend. This result indicates that... ABCB1 and GSTt1 The expression of these genes can be induced by chlorantraniliprole, and their upregulation may be related to the enhanced detoxification metabolism or efflux transport of the pesticide by pests, thus revealing the mechanism by which these genes participate in the formation of potential pesticide resistance at the molecular level.

[0041] Example 2: Preparation of target dsRNA This embodiment is based on the diamondback moth from the NCBI database. ABCB1 Genes and GSTt1 Based on the coding sequence (CDS) information of the genes, single-target and dual-target dsRNAs targeting the two target genes mentioned above were designed and synthesized.

[0042] Target sequence selection and synthesis: Target design was performed using the company's AI intelligent algorithm system (refer to CN120126561A). Generally, the target length was set to 200-500 bp, resulting in target sequences with high scores. ABCB1 The target is located in the 3390-3872 bp region of its encoding gene, with a length of 483 bp; GSTt1 The target was located in the 229-679 bp region of its coding gene, with a length of 451 bp. The target length was further adjusted to 200 bp, and the diamondback moth was ultimately selected. ABCB1 The sequence from 3430 to 3629 bp in the gene coding region was selected. GSTt1 The 429-628 bp sequence in the coding region of the gene was concatenated to design a simultaneous silencing mechanism. ABCB1 and GSTt1 Dual-target dsRNA of the gene. Targeting... ABCB1 , GSTt1 DNA sequence synthesis was performed using dual-target A+G sequences (commissioned to Sangon Biotech (Shanghai) Co., Ltd.), resulting in plasmid vectors pUC57-kan-ABCB1, pUC57-kan-GSTt1, and pUC57-kan-A+G carrying the target sequences.

[0043] in, ABCB1 The synthetic DNA sequence of the target (5′→3′) (as shown in SEQ ID NO:7): TGCGCAGACAGCTGGGCGTGGTGCAACAGGAGCCGGTGCTGTTCGACCGGACCCTGGCAGAGAACATCAGCTACGGAGACCACGCCCGAGCAGTCTCCATGCAAGATGTGGTCGAGGCGGCGAAGGCTGCCAATATTCATAGCTTCATCACTTCTTTGCCAAAGGGTTACGACACGCCACTTGGCTCTTCAGGAGCTCAGCTGTCAGGAGGGCAGAAGCAAAGAGTCTGCATCGCACGAGCCCTGATCCGCTCCCCTCGCCTTCTGCTCCTGGATGAGGCCACGTCAGCGCTGGACGCCAGCAGCGAGCAAGCAGTATCGGATGCCCTCGATGCGGCAGCAGTGGGCAGGACGTGCGTCACCATAGCGCATCGACTGACGACCGTACAGAATGCCGACGTCATTTGCGTTGTTGATGAACATAAAATAGTGGAAAAAGGATCA。

[0044] GSTt1 Synthetic DNA sequence of the target (5′→3′), the sequence of which is shown in SEQ ID NO:8: TCCCGAGAGCAGACAAGGTCCTGAACACCAGGCTAGATGAGTTCCTCGAGTGGCAGCATCTCGGCCTCCGCGCTCCGCTGGCCATGTACTTCAGAGTTGTTATGTTCAGTCCAGACTCGGAGAAGATCCCCTCATACCAGAAGCGCATGGAGACAGCTCTGGACGAGTTCAGCACGCTGTGGCTGGGACGAGGGAACCAGTACATCCTGGGAGACACCGTGACGGTAGCCGACTTACTAGCCGCTTGCGAGGTGGAACAACCACGGATGACCGGATACGACTGCACTGCCAACTACCCCGTCATACGAGAGTGGATGGACCGAGTCCGGACCTACTTCAACCCACATTATGCCGAAGCCAGCACCATAGTAGAAAAGATTGCAGCCAAGAGAGTCCCTATGAAGAAAACCCACAGCTAAGTT。

[0045] Synthetic DNA sequence of dual-target A+G (5′→3′) (as shown in SEQ ID NO:9): TGCGCAGACAGCTGGGCGTGGTGCAACAGGAGCCGGTGCTGTTCGACCGGACCCTGGCAGAGAACATCAGCTACGGAGACCACGCCCGAGCAGTCTCCATGCAAGATGTGGTCGAGGCGGCGAAGGCTGCCAATATTCATAGCTTCATCACTTCTTTGCCAAAGGGTTACGACACGCCACTTGGCTCTTCAGGAGCTCAG AGCACGCTGTGGCTGGGACGAGGGAACCAGTACATCCTGGGAGACACCGTGACGGTAGCCGACTTACTAGCCGCTTGCGAGGTGGAACAACCACGGATGACCGGATACGACTGCACTGCCAACTACCCCGTCATACGAGAGTGGATGGACCGAGTCCGGACCTACTTCAACCCACATTATGCCGAAGCCAGCACCATAGT.

[0046] DNA templates containing the T7 promoter were digested: PCR amplification was performed using the synthesized plasmids pUC57-kan-ABCB1, pUC57-kan-GSTt1, and pUC57-kan-A+G as templates, with the primer sequences shown in Table 2. Specifically, primers AF and AR were used to amplify the ABCB1-DNA fragment containing the T7 promoter at both ends; primers GF and GR were used to amplify the GSTt1-DNA fragment containing the T7 promoter at both ends; and primers A+GF and A+GR were used to amplify the A+G-DNA fragment containing the T7 promoter at both ends. After verification by agarose gel electrophoresis, the PCR products were recovered using a DNA purification kit.

[0047] Table 2. Primers for dual-target dsRNA amplification

[0048] Note: Underlined bases are T7 promoter sequences.

[0049] In vitro transcription synthesis of dsRNA: The purified PCR product was used as a template for in vitro transcription using the T7 RNAi transcription kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., TR102). Specific procedures were performed according to the kit's instruction manual. After the reaction, DNase I was added to remove the DNA template, and RNase T1 was added to remove single-stranded RNA. The total RNA concentration was determined using a micro-spectrophotometer, and purity was determined by agarose gel electrophoresis and liquid chromatography.

[0050] The sequence of the A+G dual-target dsRNA obtained by the above in vitro transcription is as follows: The positive strand (5'→3') of the A+G dual-target dsRNA is shown in SEQ ID NO:16: UGCGCAGACAGCUGGGCGUGGUGCAACAGGAGCCGGUGCUGUUCGACCGGACCCUGGCAGAGAACAUCAGCUACGGAGACCACGCCCGAGCAGUCUCCAUGCAAGAUGUGGUCGAGGCGGCGAAGGCUGCCAAUAUUCAUAGCUUCAUCACUUCUUUGCCAAAGGGUUACGACACGCCACUUGGCUCUUCAGGAGCUCAG AGCACGCUGUGGCUGGGACGAGGGAACCAGUACAUCCUGGGAGACACCGUGACGGUAGCCGACUUACUAGCCGCUUGCGAGGUGGAACAACCACGGAUGACCGGAUACGACUGCACUGCCAACUACCCCGUCAUACGAGAGUGGAUGGACCGAGUCCGGACCUACUUCAACCCACAUUAUGCCGAAGCCAGCACCAUAGU.

[0051] The antisense strand (5'→3') of the A+G dual-target dsRNA is shown in SEQ ID NO:17: ACUAUGGUGCUGGCUUCGGCAUAAUGUGGGUUGAAGUAGGUCCGGACUCGGUCCAUCCACUCUCGUAUGACGGGGUAGUUGGCAGUGCAGUCGUAUCCGGUCAUCCGUGGUUGUUCCACCUCGCAAGCGGCUAGUAAGUCGGCUACCGUCACGGUGUCUCCCAGGAUGUACUGGUUCCCUCGUCCCAGCCACAGCGUGCU CUGAGCUCCUGAAGAGCCAAGUGGCGUGUCGUAACCCUUUGGCAAAGAAGUGAUGAAGCUAUGAAUAUUGGCAGCCUUCGCCGCCUCGACCACAUCUUGCAUGGAGACUGCUCGGGCGUGGUCCGUAGCUGAUGUUCUCUGCCAGGGUCCCGGUCGAACAGCACCGGCUCCUGUUGCACCACGCCCAGCUGUCUGCGCA.

[0052] Figure 2 Agarose gel electrophoresis images showing the detection of dsRNAs targeting different targets. Figure 2 As shown, the main band in each lane is single, and the band size is consistent with the theoretical value.

[0053] The electrophoresis experiment used a DNA marker as a reference, but dsRNA migrates more slowly than DNA in electrophoresis. Therefore, the electrophoretic band appeared around 500 bp, which is consistent with the theoretical value.

[0054] The results of liquid chromatography analysis are shown in Table 3. The purity of the three target dsRNAs prepared was greater than 70%. These results indicate that this application has successfully prepared dsRNAs targeting the diamondback moth. ABCB1 and GSTt1 High-quality single-target and dual-target dsRNAs of the gene were obtained. The resulting dsRNA samples were aliquoted and stored at -80°C for subsequent bioassays and efficacy studies.

[0055] Table 3. Results of target dsRNA quality detection

[0056] Example 3: Comparison of the insecticidal efficiency of dsRNA targeting different targets combined with chlorantraniliprole against diamondback moth. This example compares single-target dsRNA (targeting only) ABCB1 Or only target GSTt1 ), hybrid dual-target dsRNA ( ABCB1 + GSTt1The difference in efficacy between the physical mixture and the negative control of chlorantraniliprole was used to verify the advantages of synergistic effect of dual targets.

[0057] Healthy, physiologically consistent third-instar diamondback moth larvae were selected and randomly divided into four groups: the first group was injected with the target gene. ABCB1 The second group of dsRNA injections targets the gene. GSTt1 dsRNA, third group injected ABCB1 and GSTt1 Mixed dsRNA was administered, with the fourth group receiving an equal volume of GFP-dsRNA as a negative control (CK). Using a microinjector, 150 ng of dsRNA was injected into each larval thorax segment, with the third group receiving 75 ng of dsRNA for each of the two targets, in an injection volume of 0.3 µL. The injected larvae were then reared in an artificial climate chamber for 24 h under the following conditions: temperature 25±1℃, relative humidity 70%±5%, and photoperiod L:D=16:8. After the recovery period, a leaf-dipping method was used to prepare a solution containing 1.25 mg / L (sublethal LC50). 30 Cabbage leaves treated with chlorantraniliprole (at a concentration of chlorantraniliprole) were fed to the four groups of larvae. Each treatment group was replicated three times, with 20 larvae per replicate. A solvent control without pesticide was also included to monitor natural mortality. The number of larval deaths in each treatment group was investigated 48 hours after treatment, and the corrected mortality rate was calculated using the Abbott formula.

[0058] Figure 3 A comparative graph showing the effects of combining dsRNA targeting different targets with chlorantraniliprole on the mortality rate of diamondback moth. Figure 3 As shown, data analysis using GraphPad Prism software revealed that the mortality rates of the treatment groups injected with GSTt1-dsRNA or ABCB1-dsRNA alone were not significantly different from those of the negative control group (CK). However, the mortality rate of the treatment group injected with a mixture of ABCB1 and GSTt1 dsRNA was significantly higher than that of the single-target dsRNA treatment group and the control group (P<0.05), indicating that the combination of the two single-target dsRNAs produced a synergistic effect. These results suggest that constructing an A+G dual-target dsRNA fusion of ABCB1 and GSTt1 has potential advantages in improving the efficacy of chemical pesticides against diamondback moth.

[0059] Example 4: Effect of dual-target dsRNA combined with chlorantraniliprole on the insecticidal efficiency of diamondback moth. This embodiment tests the synergistic effect of the dual-target (A+G) fusion dsRNA prepared in this application on chlorantraniliprole by microinjection, including two parts: mortality statistics and gene silencing level detection.

[0060] 4.1 Statistics on the mortality rate of diamondback moth larvae after combined use of chlorantraniliprole and dual-target dsRNA Third-instar larvae of the diamondback moth, of uniform size and physiological condition, were randomly divided into two groups: one group received dual-target (A+G) dsRNA treatment, and the other group served as a negative control (CK) group injected with an equal volume of sterile GFP dsRNA. Using a microinjector, 150 ng of dsRNA was injected into each larva's thorax segment at a volume of 0.3 µL. The injected larvae were then reared in an artificial climate chamber for 24 hours under the following conditions: temperature 25±1℃, relative humidity 70%±5%, and photoperiod L:D = 16:8. After the recovery period, both groups of larvae were fed chlorantraniliprole at a concentration of 1.25 mg / L (sublethal LC50). 30 Fresh cabbage leaves were treated with a chlorantraniliprole solution (at a concentration of [concentration]) by leaf immersion, followed by oral feeding of the treated larvae. Each treatment was repeated in triplicate, with 20 larvae per replicate. Larval mortality was counted 24 hours after feeding, and the corrected mortality rate was calculated using the Abbott formula.

[0061] Figure 4 A mortality comparison graph showing the effect of dual-target (A+G) dsRNA injection on the efficacy of chlorantraniliprole. Data analysis was performed using GraphPad Prism software. Experimental results are shown below. Figure 4 As shown, the corrected mortality rate of diamondback moth larvae pre-injected with dual-target (A+G) dsRNA after ingesting the same concentration of chlorantraniliprole was significantly higher than that of the control group injected with sterile GFP dsRNA (P<0.05), indicating that the dual-target dsRNA provided in this application can significantly enhance the control effect of chlorantraniliprole on diamondback moth.

[0062] 4.2 Detection of gene silencing level in diamondback moth larvae after combined use of chlorantraniliprole and dual-target dsRNA This embodiment was used to detect changes in the expression levels of target genes ABCB1 and GSTt1 in diamondback moths before and after injection of dual-target dsRNA under sublethal concentration chlorantraniliprole stress, in order to verify the gene silencing effect of dsRNA. Diamondback moths were treated according to the method in 4.1 of this embodiment. After being fed a low dose of chlorantraniliprole for 24 h, a certain number of surviving larvae were randomly selected from each group, flash-frozen in liquid nitrogen, and then... Store at 80℃ for total RNA extraction.

[0063] Total RNA was extracted from diamondback moth larvae using the TRIzol method. After DNase I treatment to remove genomic DNA contamination, RNA concentration was detected using a nucleic acid protein analyzer. One µg of total RNA was used to synthesize first-strand cDNA using a reverse transcription kit. Using this cDNA as a template, amplification was performed on a real-time quantitative PCR instrument using specific primers for the ABCB1 and GSTt1 genes (Table 1) and the internal reference gene RPS4 primer. Three technical replicates were set up for each sample, and the reaction system and conditions were performed according to the SYBR Green premixed reagent instructions.

[0064] Figure 5 Diamondback moth under chlorantraniliprole stress ABCB1 Genes and GSTt1 A graph showing the relative expression levels of genes. (Using 2...) ΔΔCt The relative expression levels of the target gene were calculated using a method that used the gene expression level of the control group (GFP dsRNA) as a calibration baseline (set to 1). The relative expression levels of the target gene in each of the other treatment groups were then calculated. ABCB1 and GSTt1 Relative gene expression levels. Using GraphPadPrism software, one-way ANOVA and Tukey's multiple comparison test were employed to analyze the significant differences in gene expression levels among different treatment groups. Figure 5 As shown, compared with the pesticide control group, the dual-target dsRNA + pesticide treatment group had significantly higher pesticide activity. ABCB1 and GSTt1 Gene expression levels all showed a significant decrease (P<0.05). This result indicates that the dual-target dsRNA provided in this application can specifically silence target genes, and the silencing effect of target genes remains significant under pesticide stress. These experimental results confirm at the molecular level the potential mechanism by which dual-target dsRNA enhances the lethality of chemical pesticides by interfering with the expression of genes related to insect detoxification metabolism and efflux.

[0065] Example 5: The combined use of dual-target dsRNA and chlorantraniliprole against diamondback moth larvae (LC50) 50 Impact This embodiment is used to measure and compare the changes in the mortality concentration effect curves of chlorantraniliprole after pre-injection of dual-target dsRNA versus chlorantraniliprole alone on diamondback moth, in order to quantitatively evaluate the synergistic effect of the dual-target dsRNA of this application on chlorantraniliprole.

[0066] The experimental group consisted of larvae injected with dual-target dsRNA followed by feeding with different concentrations of chlorantraniliprole (denoted as the "dsRNA-chlorantraniliprole" group). The specific method was as follows: Third-instar diamondback moth larvae with consistent physiological states were selected, and each larva was pre-injected with the target dsRNA prepared in Example 2 (dose 150 ng). The injection was performed according to the method in Example 3. After injection, the larvae were reared in an artificial climate chamber for 24 hours. The toxicity of chlorantraniliprole was determined after the recovery period. A series of concentration gradients of chlorantraniliprole solution were set (0.0977, 0.391, 1.563, 6.25, 25.00, 100.00 mg / L). The leaves were treated using the leaf-dipping method before feeding the larvae. Each concentration treatment was repeated three times, with 20 larvae per replicate, and a corresponding solvent blank control was set up. The number of larval deaths was investigated 24 hours after feeding, and the corrected mortality rate was calculated using the Abbott formula. Diamondback moth larvae fed only with different concentrations of chlorantraniliprole solution served as the control group (referred to as the "CK-chlorantraniliprole" group). The feeding method and larval mortality calculation method were the same as those of the experimental group.

[0067] Data modeling and analysis were performed using GraphPad Prism software. Mortality data were corrected using the Abbott formula to subtract the mortality rate of the blank control group, thereby eliminating the influence of background mortality. The concentration of chlorantraniliprole was converted to a logarithm based on base 10, and the corrected mortality rate was used as the response value. The 24-hour mortality data of the "CK-chlorantraniliprole" group and the "dsRNA-chlorantraniliprole" group were fitted, and the concentration-response curve equation and coefficient of determination (R²) were solved using a log(inhibitor) vs. response -- variable slope (four parameters) model, and the curves were plotted.

[0068] The analysis results are shown in Table 4. From the fitted curve equation, it can be concluded that the LC50 of chlorantraniliprole alone against this diamondback moth population is... 50 The LC50 of the combined dsRNA and chlorantraniliprole treatment on this diamondback moth population was 4.326 mg / L; while the LC50 of the combined dsRNA and chlorantraniliprole treatment on this diamondback moth population was... 50 The concentration was 2.384 mg / L. The two sets of curves were statistically compared using the "Comparison Curve" function within the software and an F-test.

[0069] Table 4. Concentration-effect curves and parameters of chlorantraniliprole on diamondback moth

[0070] Figure 6 This is a comparison of concentration-effect curves for chlorantraniliprole used alone and in combination with the dual-target dsRNA of this application. Figure 6As shown, the overall curve of the "dsRNA-chlorantraniliprole" group is shifted to the upper left than that of the "CK-chlorantraniliprole" group. The LC values ​​of the two groups are... 50 The significant difference (P<0.0004) indicates that pretreatment with the dual-target dsRNA of this application can significantly enhance the sensitivity of diamondback moth to chlorantraniliprole. This experimental result quantitatively confirms from a toxicological perspective that the dual-target dsRNA provided in this application has a significant synergistic effect on the efficacy of chlorantraniliprole in diamondback moth.

[0071] Example 6: Effects of combined use of target dsRNA and other chemical pesticides on the mortality rate of diamondback moth larvae. This embodiment aims to investigate the effect of dual-target (A+G) dsRNA pretreatment on the sensitivity of various insecticides with different mechanisms of action, and to verify its universality in enhancing the efficacy of chemical pesticides.

[0072] Healthy, uniformly sized, third-instar diamondback moth larvae were randomly divided into experimental and control groups. Each larva in the experimental group was injected with an A+G dsRNA solution (concentration 500 ng / µL, injection volume 0.3 µL) prepared in Example 2 into the mesothoracic tergite. The control group was injected with an equal volume of GFP-dsRNA. After injection, the larvae were transferred to fresh cabbage leaves and reared in an artificial climate chamber for 24 hours. The culture conditions in the artificial climate chamber were: temperature 25±1℃, relative humidity 70%±5%, and photoperiod L:D=16:8.

[0073] The tested insecticides included: abamectin-indoxacarb (acting on sodium ion channels), lufenuron (inhibiting chitin synthesis), avermectin, spinosad, and Bacillus thuringiensis (Bt) wettable powder (its main component is insecticidal crystal protein). Each commercial formulation was diluted 50 times according to its recommended concentration on the label to prepare a 1 / 50th concentration treatment solution. A 0.1% Triton X-100 aqueous solution was used as a solvent control. Leaves were treated using a leaf-immersion method: clean cabbage leaves were immersed in each insecticide solution for 10 seconds, removed, air-dried, and then placed in petri dishes lined with moistened filter paper.

[0074] After the recovery period, larvae from the experimental group injected with dsRNA and larvae from the control group (CK) injected with sterile GFP dsRNA were introduced onto leaves treated with the different agents for diamondback moth rearing. Leaves treated with water were used as a negative control. Each treatment was replicated 10 times, with 10 larvae per replicate. The number of diamondback moths that died in each treatment was investigated 48 hours after treatment.

[0075] The corrected mortality rate for each treatment was calculated using the Abbott formula. Statistical analysis was performed using GraphPad Prism software. Two-way ANOVA was used to test the main effects and interaction between the two factors of "dsRNA treatment" and "type of chemical pesticide". The differences in mortality rates between the dsRNA experimental group and the control group under each pesticide treatment were compared using unpaired t-tests. The significance level for statistical analysis was set at α=0.05.

[0076] Figure 7 This is a comparative graph showing the effects of combining target dsRNA with different chemical pesticides on the mortality rate of diamondback moth larvae. The analysis results are as follows: Figure 7 As shown, compared to single chemical pesticide treatment, five chemical pesticides with different mechanisms of action (emamectin benzoate·indoxacarb, lufenuron, Bt, abamectin, and spinosad) all exhibited significantly enhanced efficacy under the dual-target dsRNA pretreatment conditions described in this application, while there was no significant difference in mortality rate after feeding with plain water (ns). These results indicate that the treatment targets the metabolic efflux pathway of the diamondback moth. ABCB1 and GSTt1 The genetically engineered dual-target dsRNA of this application has a general synergistic effect on chemical pesticides, and its synergistic effect is not limited to specific types or specific mechanisms of action of insecticides.

[0077] Example 7: Indoor feeding experiment of LNP formulation with dual target dsRNA This embodiment aims to verify whether the dual-target dsRNA of this application, after being encapsulated in octadecylamine-sterol lipid nanoparticles (LNPs) and delivered via feeding, can effectively improve the sensitivity of diamondback moth to chemical pesticides, and provide a feasible delivery solution for the field application of dsRNA formulations.

[0078] The specific method is as follows: The dual-target A+G dsRNA obtained in Example 2 was prepared into an octadecylamine-sterol lipid nanoparticle formulation (denoted as "LNP-A+GdsRNA") with a final dsRNA concentration of 100 ng / µL, according to the method in Example 4 of CN111296426A. This formulation solution was evenly sprayed onto both sides of a fresh cabbage leaf tray (approximately 2 cm in diameter), ensuring the surface of the leaf tray was completely wetted without dripping. After air-drying for 10 minutes, the leaf trays were placed in sterile petri dishes (9 cm in diameter) and fed to third-instar larvae of the diamondback moth. The leaf trays were replaced daily with the same treatment, and feeding was continued for 2 consecutive days to ensure sufficient dsRNA intake. The experiment included a negative control ("LNP-GFP dsRNA") with LNP loaded with GFP-dsRNA, a vector control ("LNP empty vector") with unloaded LNP material, and a blank control ("CK") with sterile water sprayed instead of LNP-A+G dsRNA solution. Each group had 5 replicates, and each replicate used 10 larvae.

[0079] After feeding in different treatment groups, all surviving larvae were transferred to new sterile culture dishes (9 cm in diameter) and fed with 1.25 mg / L (LC50). 30 Cabbage leaf discs (approximately 2 cm in diameter) were soaked in chlorantraniliprole at a concentration of 10 s. After 24 h of rearing, the number of diamondback moth larvae that died under different treatments was counted, and the mortality rate was calculated using the Abbott formula.

[0080] Figure 8 This figure compares the effects of different LNP-loaded dsRNAs on the mortality rate of diamondback moth larvae after indoor feeding. Data analysis was performed using GraphPad Prism software. The experimental results are shown below. Figure 8 As shown: The mortality rate of the CK group treated with sterile water was 30±7.1%, which is similar to that of the chlorantraniliprole LC group in Example 5. 30 The efficacy achieved at the desired concentrations was consistent. The mortality rates of the LNP empty vector and LNP-GFP dsRNA groups were 38±8.4% and 40±7.1%, respectively, with no significant difference from the CK group, indicating that the phytotoxicity of the LNP material itself to diamondback moth larvae is controllable and does not produce significant additional lethal effects. However, the mortality rate of the LNP-A+G dsRNA treatment group reached 60±15.8%, significantly higher than that of the CK group (P<0.05). These results demonstrate that the dual-target A+G dsRNA of this application, loaded onto LNP material, can be delivered via feeding and effectively ingested by diamondback moth larvae, significantly enhancing the efficacy of chemical pesticides and providing a feasible delivery method for the field application of dsRNA formulations.

[0081] It should be noted that although the above embodiments only illustrate the delivery method of double-stranded RNA of the present invention using octadecylamine-sterol lipid nanoparticle formulations as exemplary dosage forms, the scope of protection of the present invention is not limited thereto. Any dosage form capable of effectively delivering the double-stranded RNA into the diamondback moth can be used in the present invention. Such dosage forms include, but are not limited to, conventional dosage forms such as nanoparticle formulations (e.g., lipid nanoparticle formulations, polymer nanoparticle formulations, mesoporous silica nanoparticle formulations, metal-organic framework nanoparticle formulations, etc.), wettable powders, water-dispersible granules, suspensions, emulsifiable concentrates, microemulsions, aqueous emulsions, and soluble concentrates. Those skilled in the art can select appropriate dosage forms according to actual application needs.

[0082] The above description is merely a preferred embodiment for explaining the present invention and is not intended to limit the present invention in any way. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included within the scope of protection intended by the present invention.

Claims

1. A double-stranded RNA for synergistic control of diamondback moth using chemical insecticides, characterized in that, The double-stranded RNA contains components derived from the diamondback moth. ABCB1 The nucleotide sequence of nucleotides 3430-3629 in the coding region of the gene and the nucleotide sequence derived from the diamondback moth GSTt1 The nucleotide sequence of nucleotides 429-628 in the coding region of a gene, with the two nucleotide sequences linked together; The nucleotide sequence of the DNA template encoding the double-stranded RNA is shown in SEQ ID NO:

9.

2. The double-stranded RNA according to claim 1, characterized in that, The nucleotide sequence of the sense strand of the double-stranded RNA is shown in SEQ ID NO:16, and the nucleotide sequence of the antisense strand of the double-stranded RNA is shown in SEQ ID NO:

17.

3. An insecticidal composition for controlling the diamondback moth, characterized in that, It contains the double-stranded RNA as described in claim 1 or 2.

4. The insecticidal composition according to claim 3, characterized in that, It also contains chemical pesticides.

5. The insecticidal composition according to claim 4, characterized in that, The chemical insecticide is selected from one or more of chlorantraniliprole, abamectin-indoxacarb, lufenuron, abamectin, spinosad, and Bacillus thuringiensis.

6. The insecticidal composition according to claim 3, characterized in that, The insecticidal composition is in the form of a lipid nanoparticle formulation.

7. The insecticidal composition according to claim 6, characterized in that, The lipid nanoparticle formulation is an octadecylamine-sterol lipid nanoparticle formulation.

8. The use of the double-stranded RNA according to claim 1 or 2 in the preparation of formulations for synergistic control of diamondback moth by chemical insecticides.

9. A method for synergistically controlling diamondback moth with chemical insecticides, characterized in that, This includes applying the double-stranded RNA of claim 1 or 2 in combination with a chemical insecticide to the diamondback moth.

10. The method according to claim 9, characterized in that, The method of application is selected from injection, feeding or spraying.

Images