A bacterial fluorescence detection method based on asymmetric rpa and hydrogel

Abstract

The application discloses a bacterial fluorescence detection method based on asymmetric RPA and hydrogel. The bacterial detection sample, asymmetric RPA reagent, molecular beacon, lysozyme and hydrogel monomer are jointly added into a chip groove to form a hydrogel; the lysozyme first cracks the bacteria and releases DNA, and then the RPA is used for asymmetric amplification to generate a single-stranded amplicon; the single-stranded amplicon is hybridized with the molecular beacon to restore fluorescence, and the hydrogel network restricts the diffusion of bacterial DNA, single-stranded amplicon and hybridization chain, so that the fluorescence hybridization chain forms an aggregation point near the bacteria; the aggregation points are counted by a fluorescence microscope to obtain the number of target bacteria. The application cracks the bacteria and performs asymmetric isothermal amplification in the hydrogel in situ, shortens the detection time, and does not need long bacterial culture and DNA purification steps and complex instruments or professional technical operation. The system is stable, easy to carry, and suitable for rapid detection in a resource-limited scene.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a bacterial fluorescence detection method based on asymmetric RPA and hydrogel. Background Technology

[0002] Pathogenic bacteria are major threats to human health, and bacterial detection has important applications in disease diagnosis, food safety, biosafety, and environmental monitoring. Smear examination, culture methods, biochemical identification, and immunological detection are the main methods for bacterial detection, but they suffer from problems such as false negatives and long processing times. Molecular biology methods determine the presence and type of bacteria by detecting specific gene fragments, offering advantages such as accuracy, sensitivity, and speed, making them the most reliable bacterial detection methods. Real-time quantitative PCR is the most widely used nucleic acid detection technology, but its amplification requires a thermal cycler and highly trained technicians, which is insufficient to meet the current demand for convenience in nucleic acid detection. Recombinase polymerase amplification (RPA), as an isothermal amplification technology, does not rely on a thermal cycler, making it more convenient, faster, and lower in cost, thus becoming a research hotspot in the field of nucleic acid detection.

[0003] Detection of double-stranded DNA amplification products typically requires the addition of free fluorescent molecules, which can intercalate between the bases of the double strands, enhancing fluorescence by hundreds or even thousands of times. When applied to bacterial detection, this method necessitates the separate extraction of the target bacteria from the sample before amplification to eliminate the influence of non-target DNA on the results, making the detection process cumbersome. Furthermore, it cannot detect DNA from certain bacteria that cannot be extracted separately. Asymmetric amplification, on the other hand, amplifies single-stranded DNA using unequal amounts of forward and reverse primers. Nucleic acid probes can be flexibly designed for single-stranded DNA amplicones, triggering a fluorescence signal through hybridization, without requiring the extraction of the target bacteria from the test sample.

[0004] Hydrogels are a type of hydrophilic, three-dimensional network structure that can retain large amounts of water without dissolving. In the field of nucleic acid detection, hydrogels can serve as "containers" for biomolecules, storing primers, probes, enzymes, and ions, and as media for amplification, hybridization, and other reactions. US20190203268A1 reported in-gel LAMP and hydrogel digital nucleic acid amplification, demonstrating that hydrogels can restrict the diffusion of amplification products and form fluorescent amplification spots, thereby enabling digital quantification of microorganisms or nucleic acid templates. However, existing in-gel LAMP typically forms fluorescent spots based on LAMP amplification products, requiring numerous primers and resulting in complex product structures. Existing hydrogel digital RPA chips focus on absolute nucleic acid quantification or chip-partitioned amplification, but do not address the continuous completion of enzymatic in-situ lysis, asymmetric RPA generation of single-stranded amplicon, molecular beacon hybridization to restore fluorescence, and counting of local fluorescent aggregation points near bacteria within the same hydrogel chamber for intact bacterial samples. Therefore, it is necessary to provide a new bacterial fluorescence detection chip that can combine in situ bacterial lysis, single-stranded nucleic acid generation, molecular beacon-specific recognition, and hydrogel spatial confinement without bacterial culture and DNA purification, thereby forming countable fluorescent aggregates related to bacterial quantity in a short time. Summary of the Invention

[0005] To address the aforementioned limitations of existing technologies, the present invention aims to provide a bacterial fluorescence detection method based on asymmetric RPA and hydrogels. This invention utilizes the network structure of the hydrogel to hinder the diffusion of bacteria, bacterial DNA, and amplicones, confining the amplification reaction and amplicon-involved chain hybridization to the vicinity of the bacteria. Lysozyme is used in situ to lyse bacteria within the hydrogel to release DNA. Asymmetric isothermal amplification generates single-stranded amplicones, which hybridize with molecular beacons to restore fluorescence. Hybridization chain aggregation points form near the bacteria, causing fluorescent groups to form fluorescent aggregation points. Bacterial detection is achieved by counting these fluorescent aggregation points.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for detecting bacterial fluorescence based on asymmetric RPA and hydrogel, comprising the following steps: (1) Mix the bacterial sample, forward primer, reverse primer, RPA reaction reagent, molecular beacon, lysozyme and hydrogel monomer, add them to the chip with grooves, let stand to form a hydrogel reaction system, cover with a transparent coverslip to obtain a bacterial fluorescence detection chip; the forward primer and reverse primer are RPA primers targeting specific gene fragments of the target bacteria, and the loop region of the molecular beacon is complementary to a partial sequence of the single-stranded amplicon; (2) The bacterial fluorescence detection chip is kept warm so that the bacteria are lysed by lysozyme and release DNA. Then the temperature is adjusted to cause the bacterial DNA to undergo asymmetric RPA and generate single-stranded amplicon. The single-stranded amplicon hybridizes with the molecular beacon to restore fluorescence and forms fluorescent aggregation points near the bacteria under the confinement of the hydrogel. The fluorescent aggregation points in the hydrogel are read and counted using a fluorescence microscope to achieve the detection of the target bacteria.

[0007] Preferably, the target bacteria in the bacterial sample are at least one of Streptococcus pyogenes, Pseudomonas aeruginosa, Staphylococcus aureus, Klebsiella pneumoniae, Listeria monocytogenes, Acinetobacter baumannii, Streptococcus pneumoniae, Enterococcus faecalis, and Streptococcus mutans.

[0008] The lysin system can include one or more of the following, depending on the target bacterial type: lysozyme, lysostaphin, mutalysin, proteinase K, EDTA, and Triton X-100.

[0009] Preferably, in step (1), the molar ratio of the forward primer to the reverse primer is 2~100:1; the RPA reaction reagent includes RPA enzyme lyophilized powder, reconstitution buffer and magnesium acetate.

[0010] Preferably, in step (1), the hydrogel monomer includes tetra-arm polyethylene glycol acrylate and bis-thiol-terminated polyethylene glycol; the molar ratio of the acrylate contained in the tetra-arm polyethylene glycol acrylate to the thiol contained in the bis-thiol-terminated polyethylene glycol is 1:1.

[0011] After mixing the hydrogel monomers, let them stand at room temperature for 2-5 minutes to complete the reaction.

[0012] Preferably, in step (1), the molecular beacon includes a ring region, a stem region, a fluorescent group at one end, and a quenching group at the other end.

[0013] Preferably, when not hybridizing with a single-stranded amplicon, the fluorescent group and the quenching group are close to each other and the fluorescence is quenched; the circular region is complementary to a portion of the sequence of the single-stranded amplicon, and after hybridization, the molecular beacon conformation is opened and the fluorescence is restored.

[0014] Preferably, in step (2), the temperature of the heat preservation is 30~37℃ and the holding time is 5~60 min; the temperature adjustment is adjusted to 37~42℃ and held for 10~50 min.

[0015] Preferably, in step (2), before counting the fluorescent aggregates, the fluorescent image is subjected to background subtraction and particle size threshold screening to remove free fluorescent points and non-specific bright spots, so that the number of fluorescent aggregates after screening can be used to characterize the number of target bacteria.

[0016] In a second aspect, the present invention provides a detection kit for the above-described method, comprising a grooved chip, and individually packaged RPA forward and reverse primers, molecular beacons, lysozyme, RPA enzyme lyophilized powder, reconstitution buffer, magnesium acetate, four-arm polyethylene glycol acrylate, and bi-terminated mercapto polyethylene glycol.

[0017] A third aspect of the present invention provides the application of the above-described method in the rapid and accurate monitoring of clinical infections, food safety, and environmental microorganisms. This method has detection specificity and low fluorescence background, which can improve detection sensitivity and reduce detection time.

[0018] The beneficial effects of this invention are: (1) This invention shortens the detection time to tens of minutes by in-situ lysis of bacteria and asymmetric isothermal amplification in a hydrogel, eliminating the need for lengthy bacterial culture and DNA purification steps, as well as complex instruments or specialized technical operations. The hydrogel network restricts the diffusion of amplicones, causing the fluorescence signal to concentrate near the bacteria, reducing background fluorescence. By counting the number of bacteria corresponding to the fluorescence aggregation points, detection sensitivity at the individual bacterial level is achieved. The reagents can be lyophilized for storage, the system is stable and easy to carry, making it suitable for rapid detection in resource-limited scenarios.

[0019] (2) The detection system of the present invention does not require pre-extraction of DNA. Bacterial lysis and amplification are completed continuously in the same hydrogel chip, simplifying the operation. Asymmetric RPA generates single-stranded amplicon, which facilitates sequence-specific hybridization with molecular beacons and avoids high background of free double-stranded dyes on non-target DNA. The hydrogel network has a spatial confinement effect on the reaction products, so that the fluorescence signal forms distinguishable aggregation points near the bacteria, which is conducive to quantitative detection by point counting. The detection temperature is mild and the instrument requirements are low, making it suitable for rapid screening of clinical, food and environmental samples. Attached Figure Description

[0020] Figure 1 This is a photograph of the transparent groove chip in an embodiment of the present invention; Figure 2 PAGE image of Streptococcus pyogenes; Figure 3 This is a fluorescence image for nucleic acid detection in Streptococcus pyogenes; Figure 4 PAGE image of Pseudomonas aeruginosa; Figure 5 Fluorescence image for nucleic acid detection of Pseudomonas aeruginosa; Figure 6 This is a fine fluorescence image of mismatched primers / mismatched primers; Figure 7 A fluorescence image for symmetrical RPA detection of Streptococcus pyogenes nucleic acid; Figure 8 This is a fluorescence image of Pseudomonas aeruginosa nucleic acid detection in a hydrogel-free system. Detailed Implementation

[0021] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0022] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0023] Note: The RPA enzyme lyophilized powder and reconstitution buffer used in this invention are from the TwistAmp® Basic kit.

[0024] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels.

[0025] Example 1: Detection of Streptococcus pyogenes (1) RPA primers were designed targeting the slo gene sequence of Streptococcus pyogenes. Asymmetric RPA was performed using the TwistAmp® Basic kit manufactured by TwistDx, following the instructions provided. An excess of the positive primer was used to generate a single-stranded atom with a partial sequence identical to the positive primer, containing 161 nucleotides, for molecular beacon recognition. The target product sequence of this asymmetric amplification is shown in SEQ ID NO.1: TTAGAGCTTGCTCCCAAAGAAATGCCACTAGAATCTGCAGAAAAAGAAGAAAAAAAGTCAGAAGACAAAAAAAAGAGCGAAGAAGATCACACTGAAGAAATCAATGACAAGATTTATTCACTAAATTATAATGAGCTTGAAGTACTTGCTAAAAATGGTGAA. This atomized with the molecular beacon, opening the stem region of the beacon. Specifically, 5 µL of a 1.16 × 10⁻⁶ m³ of the primer was used. 7The following reagents were prepared: physiological saline dispersion of Streptococcus pyogenes cells / mL; 2.4 µL of 10 µM forward primer aqueous solution; 2.4 µL of 2 µM reverse primer aqueous solution; lyophilized enzyme powder (including recombinase, single-strand binding protein, and strand displacement DNA polymerase); 29.5 µL of reconstitution buffer; 2.4 µL of 10 µM molecular beacon aqueous solution; 2 µL of 1 mg / mL lysozyme (in enzyme-free water, purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number: A610308-0005); 3.8 µL of ultrapure water; 2.5 µL of 280 mM magnesium acetate aqueous solution; 1.39 mg of tetraarm polyethylene glycol acrylate (relative molecular mass: 10000, purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: L2308312); and 1.11 mg of β-terminated thiol polyethylene glycol (relative molecular mass: 4000, purchased from Shanghai Maclean Biochemical Technology Co., Ltd., catalog number: S902368) was mixed and added to a flat-bottomed, high-transparency glass slide with grooves of 8 mm in length and width. The mixture was incubated at 20°C for 5 min to form a hydrogel, which was then covered with a coverslip to obtain a bacterial fluorescence detection chip based on asymmetric isothermal amplification and hydrogel. Figure 1 As shown.

[0026] The forward primer sequence for the slo gene RPA is shown in SEQ ID NO.2: TTAAAGCTTGCTCCCAAAGAAATGCCACTAGAA; the reverse primer sequence for the slo gene RPA is shown in SEQ ID NO.3: TTCACCATTTTTAGCAAGTACTTCAAGCTCAT.

[0027] (2) The chip temperature was adjusted to 37℃ and held for 10 min to allow the bacteria to be lysed by lysozyme and release DNA; then the temperature was adjusted to 40℃ and held for 20 min to allow the bacterial DNA to generate single-stranded amplicon via asymmetric RPA. To verify the feasibility of asymmetric RPA in Streptococcus pyogenes DNA, asymmetric RPA was performed without the addition of hydrogel monomers, and the product was subjected to non-denaturing PAGE. The development image is shown below. Figure 2As can be seen, a single amplicon was generated, and the band position matched the theoretical length (approximately 80 bp) (the migration position corresponds to approximately 80 bp of double-stranded DNA marker, but the actual single-stranded amplicon length is 161 nt), proving the feasibility of RPA. The single-stranded amplicon hybridized with a molecular beacon modified with the 5' end of the fluorescent molecule Cy3 and the 3' end of the quencher BHQ-2, resulting in fluorescence recovery. The molecular beacon sequence is shown in SEQ ID NO.4: CAGCGTAGATGATTTCTTCAGTGTGATCTTCTTCGCTCTTATCTACGCTG, where the sequence near the 5' end in the stem region is CAGCGTAGAT, the sequence near the 3' end is ATCTACGCTG, and the complementary sequence between the loop region and the amplicon is GATTTCTTCAGTGTGATCTTCTTCGCTCTT.

[0028] (3) Fluorescence detection of the hydrogel was performed using a fluorescence microscope (instrument model: LSM800, excitation wavelength and emission wavelength: 650 nm and 673 nm, respectively; objective magnification: 20×; laser dwell time on each pixel: 1.03 µs; field of view size: 56.5 µm × 56.5 µm; image processing software: ZEN 2.3 lite; brightness threshold for fluorescent point counting: 100 pixel value; size: 0.5 µm and above). Fluorescent aggregation points were generated at hybridization strand aggregation points, and the number of fluorescent aggregation points was the number of bacteria. The Streptococcus pyogenes dispersion at this concentration was tested in parallel three times, and the obtained fluorescence images are shown below. Figure 3 As shown, the number of distinguishable fluorescent dots in the field of view is 50, 61 and 56, with an average of 55.7, which is close to the theoretical value of 58 bacteria in the field of view. The relative standard deviation of the fluorescent dots is 9.76%, showing good repeatability and proving that the bacterial detection method is feasible.

[0029] Example 2: Detection of Pseudomonas aeruginosa (1) RPA primers were designed targeting the oprL gene sequence of *Pseudomonas aeruginosa*, and asymmetric RPA was performed. An excess of the positive primer was used to generate a single-stranded gene with a partial sequence identical to the positive primer and containing 105 nucleotides for molecular beacon recognition. The sequence is shown in SEQ ID NO. 5: TCACCACCTTCTACTTCGAGTACGACAGCTCCGACCTGAAGCCGGAAGCCATGCGCGCTCTGGACGTACACGCGAAAGACCTGAAAGGCAGCGGTCAGCGCGTAG. Specifically, 5 µL of a 3.84 × 10⁻⁶ primer was used. 6A mixture of physiological saline dispersion of *Pseudomonas aeruginosa* cells / mL, 2.4 µL of 10 µM forward primer aqueous solution, 2.4 µL of 5 µM reverse primer aqueous solution, lyophilized enzyme powder (including recombinase, single-strand binding protein, and strand displacement DNA polymerase), 29.5 µL of reconstitution buffer, 2.4 µL of 10 µM molecular beacon aqueous solution, 2 µL of 1 mg / mL lysozyme aqueous solution, 3.8 µL of ultrapure water, 2.5 µL of 280 mM magnesium acetate, 1.39 mg of four-arm polyethylene glycol acrylate, and 1.11 mg of bis-thiol-terminated polyethylene glycol was added to a flat-bottomed, highly transparent glass slide with grooves of 8 mm in length and width. The mixture was incubated at 20 °C for 5 min to form a hydrogel and then covered with a coverslip.

[0030] The positive primer sequence for the oprL gene RPA is shown in SEQ ID NO.6: TCACCACCTTCTACTTCGAGTACGACAGCTCC; the reverse primer sequence is shown in SEQ ID NO.7: CTACGCGCTGACCGCTGCCTTTCAGGTCTTTC.

[0031] (2) The chip temperature was adjusted to 37℃ and held for 5 min to allow the bacteria to be lysed by lysozyme and release DNA; then the temperature was adjusted to 39℃ and held for 15 min to allow the bacterial DNA to generate single-stranded amplicon via asymmetric RPA. To verify the feasibility of asymmetric RPA in Pseudomonas aeruginosa DNA, asymmetric RPA was performed without the addition of hydrogel monomers, and the product was subjected to non-denaturing PAGE. The development image is shown below. Figure 4 As can be seen, a single amplicon was generated, and the band position matched the theoretical length (approximately 53 bp) (the migration position corresponds to approximately 53 bp of double-stranded DNA marker, but the actual single-stranded amplicon length is 105 nt), proving the feasibility of RPA. The single-stranded amplicon hybridized with a molecular beacon modified with the 5' end of the fluorescent molecule Cy5 and the 3' end of the quencher BHQ-2, resulting in fluorescence recovery. The molecular beacon sequence is shown in SEQ ID NO.8: ACCGTGATTGAGCTGTCGTACTCGAAGTAGAAGGTCAATCACGGT, where the sequence near the 5' end in the stem region is ACCGTGATTGA, the sequence near the 3' end is TCAATCACGGT, and the complementary sequence to the amplicon in the loop region is GCTGTCGTACTCGAAGTAGAAGG.

[0032] (3) Fluorescence detection of the hydrogel was performed using a fluorescence microscope (instrument model: LSM800, excitation wavelength and emission wavelength: 650 nm and 673 nm, respectively; objective magnification: 20×; laser dwell time on each pixel: 1.03 µs; field of view size: 100 µm × 100 µm; image processing software: ZEN 2.3 lite; brightness threshold for fluorescent point counting: 100 pixel value; size: 0.5 µm and above). Fluorescent aggregation points were generated at hybridization strand aggregation points, and the number of fluorescent aggregation points was the bacterial count. The Pseudomonas aeruginosa dispersion at this concentration was measured in parallel three times, and the obtained fluorescence images are shown below. Figure 5 As shown, the number of distinguishable fluorescent dots in the field of view was 57, 63 and 58, with an average of 59.3, which is close to the theoretical value of 60 for the number of bacteria in the field of view. The relative standard deviation of the fluorescent dots was 4.67%, showing good repeatability and proving that the bacterial detection method is feasible.

[0033] Comparative Example 1 To test the specificity and background fluorescence of this method, primers containing the oprL gene sequence for Streptococcus pyogenes and Pseudomonas aeruginosa were added to the detection reaction system. Theoretically, amplification should not occur, and fluorescence should not be restored.

[0034] (1) Take 5 µL of a concentration of 1.0 × 10 7 The following solutions were added to the chip's groove: a Streptococcus pyogenes dispersion (cells / mL), 2.4 μL of 10 μM positive primer aqueous solution for the oprL gene, 2.4 μL of 2 μM reverse primer aqueous solution for the oprL gene, lyophilized enzyme powder (including recombinase, single-stranded binding protein, and strand displacement DNA polymerase), 29.5 µL of reconstitution buffer, 2.4 μL of 10 μM molecular beacon aqueous solution for hybridization with the oprL gene single-stranded amplicon, 2 µL of 1 mg / mL lysozyme aqueous solution, 3.8 μL of ultrapure water, 2.5 µL of 280 mM magnesium acetate aqueous solution, 1.39 mg of tetra-armed polyethylene glycol acrylate, and 1.11 mg of di-terminated mercapto polyethylene glycol. The mixture was incubated at 20 °C for 5 min to form a hydrogel, and then covered with a coverslip.

[0035] (2) Adjust the temperature to 37°C and maintain it for 10 min to allow the bacteria to be lysed by lysozyme and release DNA. Then adjust the temperature to 39°C, where the amplification enzyme has high activity, and maintain it for 15 min.

[0036] (3) Fluorescence detection of the hydrogel was performed using a fluorescence microscope, such as... Figure 6 As shown, there are no detectable fluorescent spots or background fluorescence in the fluorescence image, proving that the detection method has specificity and low fluorescence background.

[0037] Comparative Example 2 To test whether symmetric RPA could open the stem region of the molecular beacon, leading to fluorescence recovery and achieving bacterial detection through fluorescence aggregation point counting, the concentration of the reverse primer in Example 1 was changed to 10 µM. The RPA reactants, molecular beacon, and hydrogel monomer were added to a grooved flat-bottomed glass slide to form a hydrogel at 20°C. The chip temperature was then adjusted to 37°C and held for 10 min to lyse the bacteria, followed by raising the temperature to 40°C and holding for 20 min for symmetric RPA. Fluorescence detection was then performed to obtain the results shown below. Figure 7 The fluorescence image showed no distinguishable fluorescent spots in the field of view, indicating that the fluorescence of the molecular beacon did not recover after the completion of symmetrical RPA. Theoretically, the transiently existing single-stranded amplicon during amplification can hybridize with the molecular beacon, temporarily opening the stem region of the molecular beacon. However, after amplification, all single-stranded amplicon forms double strands, and the temporarily hybridized molecular beacon is displaced. The stem region then undergoes complex cross-linking into a double-stranded structure, quenching the fluorescence.

[0038] Comparative Example 3 Fluorescence images obtained without the addition of hydrogel monomers to the test reaction system. The detection of *Pseudomonas aeruginosa* was performed following the steps of Example 2, except that the reaction system did not contain tetra-armed polyethylene glycol acrylate and bi-thiol-terminated polyethylene glycol, thus preventing hydrogel formation. Fluorescence detection was performed (10× objective, 200 µm × 200 µm field of view), obtaining the following results: Figure 8 The fluorescence image shows a strong fluorescent background in the field of view, but no distinguishable fluorescent spots. This indicates that the hybridization of the molecular beacon with the single-stranded amplicon of the asymmetric RPA product restores the fluorescence, but no aggregation points are formed. Therefore, the number of bacteria cannot be detected by counting the fluorescent aggregation points.

[0039] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A bacterial fluorescence detection method based on asymmetric RPA and hydrogel, characterized in that, Includes the following steps: (1) Mix the bacterial sample, forward primer, reverse primer, RPA reaction reagent, molecular beacon, lysozyme and hydrogel monomer, add them to the chip with grooves, let stand to form a hydrogel reaction system, cover with a transparent coverslip to obtain a bacterial fluorescence detection chip; the forward primer and reverse primer are RPA primers targeting specific gene fragments of the target bacteria, and the loop region of the molecular beacon is complementary to a partial sequence of the single-stranded amplicon; (2) The bacterial fluorescence detection chip is kept warm so that the bacteria are lysed by lysozyme and release DNA. Then the temperature is adjusted to cause the bacterial DNA to undergo asymmetric RPA and generate single-stranded amplicon. The single-stranded amplicon hybridizes with the molecular beacon to restore fluorescence and forms fluorescent aggregation points near the bacteria under the confinement of the hydrogel. The fluorescent aggregation points in the hydrogel are read and counted using a fluorescence microscope to achieve the detection of the target bacteria.

2. The bacterial fluorescence detection method according to claim 1, characterized in that, The target bacteria in the bacterial sample are at least one of the following: Streptococcus pyogenes, Pseudomonas aeruginosa, Staphylococcus aureus, Klebsiella pneumoniae, Listeria monocytogenes, Acinetobacter baumannii, Streptococcus pneumoniae, Enterococcus faecalis, and Streptococcus mutans.

3. The bacterial fluorescence detection method according to claim 1, characterized in that, In step (1), the molar ratio of the forward primer to the reverse primer is 2~100:1; the RPA reaction reagent includes RPA enzyme lyophilized powder, reconstitution buffer and magnesium acetate.

4. The bacterial fluorescence detection method according to claim 1, characterized in that, In step (1), the hydrogel monomer includes tetra-arm polyethylene glycol acrylate and bis-thiol polyethylene glycol; the molar ratio of the acrylate contained in the tetra-arm polyethylene glycol acrylate to the thiol contained in the bis-thiol polyethylene glycol is 1:

1.

5. The bacterial fluorescence detection method according to claim 1, characterized in that, In step (1), the molecular beacon includes a ring region, a stem region, a fluorescent group at one end, and a quenching group at the other end.

6. The bacterial fluorescence detection method according to claim 5, characterized in that, When not hybridizing with a single-stranded amplicon, the fluorescent group and the quenching group are close to each other and the fluorescence is quenched; the circular region is complementary to a portion of the sequence of the single-stranded amplicon, and after hybridization, the molecular beacon conformation is opened and the fluorescence is restored.

7. The bacterial fluorescence detection method according to claim 1, characterized in that, In step (2), the temperature for heat preservation is 30~37℃ and the holding time is 5~60 min; the temperature adjustment is adjusted to 37~42℃ and held for 10~50 min.

8. The bacterial fluorescence detection method according to claim 1, characterized in that, In step (2), before counting the fluorescent aggregates, the fluorescent image is subjected to background subtraction and particle size threshold screening to remove free fluorescent points and non-specific bright spots, so that the number of fluorescent aggregates after screening can be used to characterize the number of target bacteria.

9. A detection kit for use in the bacterial fluorescence detection method according to any one of claims 1 to 8, characterized in that, It includes a chip with a groove, as well as individually packaged RPA forward and reverse primers, molecular beacons, lysozyme, RPA enzyme lyophilized powder, reconstitution buffer, magnesium acetate, four-arm polyethylene glycol acrylate, and bi-terminated mercapto polyethylene glycol.

10. The application of the bacterial fluorescence detection method according to any one of claims 1 to 8 in improving the sensitivity of bacterial detection.

Images