Bacillus siamensis mutant strain for removing transformation barrier, construction method and application thereof

Abstract

The application relates to a bacillus siamensis mutant strain for removing a transformation barrier and a construction method and application thereof, and aims to solve the problems of the exogenous DNA transformation barrier caused by a restriction modification system, complicated preparation of competent cells and extremely low genetic transformation efficiency of wild-type bacillus siamensis. The application first determines that the restriction modification system gene IRC3 is the main transformation barrier and knocks it out, and meanwhile, a xylose-induced comK expression cassette is integrated to obtain the mutant strain. Through strategic cooperation of the "restriction barrier removal" and "controllable induced competence" strategies, the transformation efficiency of the obtained mutant strain to a demethylated CRISPR plasmid reaches 500 CFU / ug DNA after 1.5% xylose induction for 2 hours, and the gene editing positive rate is as high as 90%, thereby fundamentally solving the bottleneck of low transformation efficiency of the wild-type bacillus siamensis, and providing a key platform tool for genetic improvement and functional genomics research of the important industrial / biocontrol strain.

Description

Technical Field

[0001] This invention relates to the field of microbial genetic engineering technology, specifically to a mutant strain of Bacillus sicca that removes the transformation barrier, its construction method, and its application. Background Technology

[0002] Bacillus sicca ( Bacillus siamensis Gram-positive bacteria are widely distributed in nature and can produce a variety of antibacterial active substances and hydrolytic enzymes, showing important application value in fields such as agricultural biological control and industrial enzyme preparations.

[0003] Constructing an efficient and stable genetic manipulation system is the core foundation for carrying out strain genetic improvement, functional genomics analysis, and building cell factories for the aforementioned target active substances. Achieving scarless gene editing using the CRISPR-Cas system is a crucial step in this process. However, due to the inherent multiple exogenous DNA defense barriers of wild-type strains, the efficiency of exogenous DNA introduction and the success rate of subsequent genetic modification are often severely limited, necessitating the development of suitable technical solutions to address these key limiting factors.

[0004] To overcome these obstacles, existing research has explored various strategies: a common approach is the inactivation of host restriction-modification (RM) systems, such as by knocking out restriction endonuclease genes (e.g., hsdR , yhdJ One strategy is to weaken the cell's degradation of exogenous DNA; another strategy is to artificially manipulate the expression of the core transcription factor ComK in the competent state to force the cell into a competent state.

[0005] Although the above strategies have yielded progress in various Bacillus species, existing technologies still have the following shortcomings when targeting Bacillus sicca: ① The target of the RM system is unclear: The composition of the Bacillus sicca RM system is highly species- and strain-specific. It is unclear which specific RM system gene in its genome constitutes the main barrier to exogenous DNA transformation, which makes it impossible for existing technologies to specifically inactivate the gene.

[0006] ② Existing technologies suffer from cognitive biases and lack synergistic optimization strategies: Current research generally holds the one-sided view that knocking out genes related to the RM system can significantly improve transformation efficiency. However, this study confirms that for Bacillus sicca, simply knocking out the RM gene cannot solve the problems of cumbersome competent cell preparation and low efficiency of conventional electroporation transformation. Existing research has failed to recognize the synergistic effect between the removal of the exogenous DNA degradation barrier and the construction of DNA uptake channels, nor has it systematically optimized the adaptation conditions for their synergistic effect.

[0007] Therefore, there is an urgent need in this field to develop a genetic manipulation method for Bacillus sicca that can efficiently transform exogenous DNA and efficiently complete gene editing, as well as a dedicated strain, in order to overcome the bottleneck of genetic modification of this important industrial / biocontrol strain.

[0008] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0009] This invention discloses a mutant strain of Bacillus sicca, its construction method, and its application. It aims to solve the core technical problems of wild-type Bacillus sicca, such as the exogenous DNA transformation barrier caused by the restriction modification system, the cumbersome preparation of competent cells, and the extremely low genetic transformation efficiency, and to break through the technical bottleneck of genetic modification and cell factory construction of this strain.

[0010] Bacillus sicca ( Bacillus siamensis YB-1631 is a superior biocontrol bacterium with clearly defined functions, obtained through systematic screening by the applicant. It exhibits significant antagonistic activity against various plant pathogens. Related research findings were published in the *Journal of Fungi* (Dong) in May 2023. et al, (2023). Furthermore, YB-1631 is also a highly efficient γ-polyglutamic acid (γ-PGA) producing strain. γ-PGA, as a biodegradable, water-soluble polymer, is widely used in agricultural water-retaining agents, food thickeners, drug sustained-release carriers, and cosmetic moisturizers. Therefore, YB-1631 is a high-potential chassis strain. Research on its biocontrol molecular mechanism analysis, precise control of γ-PGA synthesis and molecular weight, and targeted optimization of biocontrol efficacy, leading to the construction of efficient and stable cell factories for the synthesis of biopesticides and functional polymers, possesses significant scientific research value and promising prospects for industrial application.

[0011] However, functional genomics analysis and the construction of cell factories highly depend on mature, stable, and adaptable genetic manipulation systems tailored to the characteristics of specific strains. Further research by the inventors revealed that wild-type Bacillus sicca generally possesses a strong restriction modification system, composed of restriction endonucleases and methyltransferases, which can specifically recognize and degrade exogenous DNA with methylation patterns different from its own, forming a robust barrier to exogenous gene transformation. Simultaneously, the formation of naturally competent cells in Bacillus sicca relies on a complex signal regulatory network, and the competent cell window is extremely short. Conventional genetic manipulation methods such as chemical transformation and electroporation transformation have poor adaptability, generally resulting in extremely low transformation efficiency and difficulty in obtaining positive transformants. These technical deficiencies severely restrict the application of molecular genetic technologies such as gene knockout, gene complementation, and heterologous expression in Bacillus sicca, greatly limiting the genetic improvement of this superior strain and the development of engineered cell factories.

[0012] The inventors discovered genes associated with the Type IV restriction modification system predicted by rebase. IRC3 The transformation efficiency of *Bacillus sicca* to the CRISPR-Cas9 gene editing vector pJOE8999 plasmid is affected. Specifically, it involves a *Bacillus sicca* mutant strain used for efficient transformation of CRISPR plasmids, which knocks out restriction modification system genes in the *Bacillus sicca* YB-1631 genome. IRC3 It integrates a xylose-inducible promoter P into its genome. xylA Strictly regulated competent transcription factor encoding genes comK The present invention also provides a method for transforming exogenous plasmids using this mutant strain, including induction culture with a specific concentration of xylose for a specific duration, so that the mutant strain can efficiently enter competent states and complete transformation.

[0013] Specifically, the present invention adopts the following technical solution: A mutant strain of Bacillus sicca is provided, containing restriction modification system genes in its genome. IRC3 The genome contains genes encoding competent transcription factors regulated by xylose-inducible promoters that have been inactivated or knocked out. comK The expression box.

[0014] Preferably, the mutant strain is Bacillus sicca with accession number CGMCC No. 25784. Bacillus siamensis YB-1631 IRC3 Gene deletion mutant strain.

[0015] Preferably, the expression box is P xylA - comK box, which contains the xylose-inducible promoter P xylA The regulated competent transcription factor encoding gene comK .

[0016] Preferably, the IRC3 The gene has a sequence as shown in SEQ ID NO: 1 or a sequence having more than 95% homology with it; and / or, the expression cassette contains a sequence as shown in SEQ ID NO: 3 or a sequence having more than 95% homology with it.

[0017] Preferably, the IRC3 Gene inactivation or knockout is achieved through homologous recombination, and / or the expression cassette is integrated into the mutant genome. EPR Gene loci.

[0018] The present invention also provides a method for constructing the aforementioned Bacillus sicca mutant strain, comprising the following steps: (1) Constructing a carrier IRC3 Knockout vectors containing upstream and downstream homologous arms of the gene knock out the gene in the Bacillus sicca genome via homologous recombination. IRC3 Genes, Acquisition IRC3 Gene-deleted strains; (3) Construct a carrier P xylA - comK The integration vector containing the box and homologous arm of the genome integration site, through homologous recombination, integrates the P... xylA - comK box integrated into the above IRC3 The genome of gene-deleted strains EPR Gene loci; (3) Screening IRC3 Gene knockout and the P xylA - comK Mutants with stable box integration.

[0019] Preferably, the amplification in step (1) is... IRC3 The primer pairs for the upstream and downstream homologous arms of the gene are as follows: IRC3-Left Arm-F: gcccgctgctctctatcaaa; IRC3-LeftArm-TcR-R:tggcccgtttgttgaactactgagcactgtggaaagcggta; IRC3-TcR-right arm-F: atccgtcgacctgcagatctatcaggaagggacttggcga; IRC3-Right Arm-R:gtggagtgaactagcacaagc.

[0020] The present invention also provides a method for transforming Bacillus sicca with exogenous DNA, or a method for editing Bacillus sicca, wherein the Bacillus sicca mutant strain is used as the recipient strain, and the recipient strain is induced to enter the competent state for 0.5 to 3 h under the condition of xylose concentration of 1% to 2.5%, and then demethylated plasmid DNA is introduced.

[0021] The present invention also provides a kit for genetic transformation of Bacillus sicca, comprising a culture of the aforementioned Bacillus sicca mutant strain or its lyophilized powder, and a method for inducing... comK Gene expression inducers.

[0022] This invention also provides the application of the said Bacillus sicca mutant strain or the said kit in gene editing, metabolic engineering, or agricultural biological control of Bacillus sicca.

[0023] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages: 1. Precise removal of the transformation barrier: First identification of restriction modification system genes in Bacillus sicca. IRC3 This gene is a major barrier to the transformation of exogenous DNA. Knocking out this gene fundamentally removes the restrictive degradation barrier to exogenous DNA from wild-type Bacillus sicca.

[0024] 2. Constructing controllable and efficient competent states: inducing the xylose-inducible promoter P xylA - comK Expression cassettes integrated into the genome of the knockout strain EPR The site was identified to obtain an engineered strain. The competence of this strain is strictly regulated by xylose concentration, overcoming the short window period of natural competence.

[0025] 3. Significant synergistic effects: By removing... IRC3 Mediated transformation barrier and inducible comK The two strategies are systematically combined and conditionally optimized to achieve synergistic effects: knockout IRC3 This eliminates the host's degradation of unmethylated exogenous DNA, allowing the plasmid to survive; while xylose strictly regulates... comK This expression method allows the strain to be synchronously and efficiently induced into competent states under optimal growth conditions, significantly enhancing its ability to take up exogenous DNA. Experiments have confirmed that this approach achieves a positive transformant rate of up to 90% for CRISPR / Cas9 gene knockout, providing a key platform tool for the genetic improvement and functional genomics research of this important industrial / biocontrol strain.

[0026] 4. Retaining excellent chassis traits: The resulting mutant strain retains the original antibacterial activity and γ-PGA production capacity of the wild-type strain, and has the ability to efficiently transform exogenous DNA, making it an ideal recipient strain for gene function research and metabolic engineering. Attached Figure Description

[0027] Figure 1 Genes in the genome of Bacillus sicca in one embodiment of this application IRC3 Nearby sequences and primer design locations.

[0028] Figure 2 As shown in one embodiment of this application IRC3 Homologous recombination knockout fragment.

[0029] Figure 3 As shown in one embodiment of this application IRC3 Gene and primer positions after gene knockout.

[0030] Figure 4 As shown in one embodiment of this application IRC3 The effect of deletion on the transformation of Bacillus sicca YB-1631 into pJOE8999 plasmid; where YB-1631 is wild-type Bacillus sicca, YB-1631 Δ IRC3 For genes IRC3 The deletion mutants are dam- dcm- and demethylated in JM110 and dam+ dcm+ and methylated in JM109.

[0031] Figure 5 In one embodiment of this application, the xylose concentration gradient affects strain YB-1631 Δ IRC3epr ::P xylA - comK The effect of transformation on demethylated plasmid pJOE8999.

[0032] Figure 6 In one embodiment of this application, xylose concentration and induction time affect the Δ of strain YB-1631. IRC3epr ::P xylA - comK Effect of xylose concentration on the efficiency of transformation of demethylated plasmid pJOE8999; A represents the optimization of xylose concentration, and B represents the optimization of induction time (different lowercase letters on the bar chart represent significant differences). P <0.05).

[0033] Figure 7 For example, strain YB-1631 Δ in one embodiment of this application IRC3 With YB-1631 Δ IRC3epr ::P xylA - comK Transformation yisBTransformants after plasmid knockout.

[0034] Figure 8 For example, strain YB-1631 Δ in one embodiment of this application IRC3 With YB-1631 Δ IRC3epr ::P xylA - comK In the transformation yisB Electrophoretic detection of PCR products identified by knockout; from left to right, YB-1631 Δ IRC3epr ::P xylA - comK The 20 transformants (k1~k20) and YB-1631 Δ IRC3 The seven transformants (I1~I7). Detailed Implementation

[0035] The following examples illustrate specific implementations of the present invention. However, these examples are merely for illustrative purposes and do not limit the scope of the invention in any way.

[0036] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents and materials involved are all commercially available conventional products; unless otherwise specified, the test and detection methods involved are all conventional methods.

[0037] Example 1: Homologous recombination knockout IRC3 Gene Test strain: Bacillus sicca YB-1631, its taxonomic name is Bacillus siamensis It was deposited on September 23, 2022 at the China General Microbiological Culture Collection Center (Address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Postcode: 100101), with accession number CGMCC No. 25784; see patent document CN116286504A for details.

[0038] Target gene: Bacillus sicca YB-1631 IRC3 The gene coding sequence is shown in SEQ ID NO: 1; in Bacillus sicca YB-1631 IRC3 The knockout fragment DNA sequence is shown in SEQ ID NO: 2; P xylA - comK box EPR The site-integrated fragment DNA sequence is shown in SEQ ID NO: 3.

[0039] 1. Construction of homologous recombination knockout fragments (1) Amplification of left and right homologous arms: Using YB-1631 genomic DNA as a template, primers IRC3-left arm-F / IRC3-left arm-TcR-R and IRC3-TcR-right arm-F / IRC3-right arm-R were used to amplify approximately 1000 bp DNA fragments on the left and right sides of the IRC3 gene, respectively. Figure 1 ).

[0040] (2) Amplification of resistance marker: pHY300PLK plasmid DNA was used as a template. The tetracycline resistance gene DNA fragment with its own promoter was amplified using primers pHY300-TcR-F / pHY300-TcR-R.

[0041] (3) Ligating the three fragments: Using the overlap extension PCR method, the above three fragments were ligated into a complete homologous recombination knockout fragment. Figure 2 ).

[0042] 2. IRC3 Gene knockout and verification (1) Preparation of competent cells: Competent cells of Bacillus sicca YB-1631 were prepared using the cell wall weakening agent method. Fresh single colonies were picked and cultured overnight in 5 mL of LB medium, and then transferred to LB growth medium at a ratio of 1:10 and cultured at 37℃ and 200 rpm until OD. 600 The concentration should be 0.3-0.5. Add a weakening agent (2% glycine, 1% DL-threonine) and continue culturing for 20 minutes until the OD value reaches 0.3-0.5. 600 Stop the process as soon as the temperature drops, cool the cells in an ice bath, and then centrifuge at 4°C and 8000 rpm for 10 min to collect the cells. Wash the cells repeatedly 4-5 times with pre-cooled electroporation buffer, and finally resuspend them in 1 / 40 volume of the original culture medium and aliquot them to obtain competent cells.

[0043] (2) Electroconversion: Add approximately 0.5 μg of [agent / concentrate] to each 100 μL tube of competent cells. IRC3 After homologous recombination knockout of the DNA fragment, a 1 mm pre-cooled electroporation cuvette was added and electroporated once at a voltage of 1.5 kV to 2.3 kV. Immediately after electroporation, 900 μL of 37°C preheated recovery medium was added. After recovery and incubation at 37°C and 160 rpm for 5 to 8 h, the medium was spread onto LB agar plates containing 15 μg / mL tetracycline and incubated upside down at 37°C for 16 to 24 h.

[0044] (3) Purification and screening: single colonies were picked and purified by streaking on LB plates with the same concentration of tetracycline, and passaged for 2 generations.

[0045] (4) PCR verification: Genomic DNA was extracted from and purified transformants, and PCR amplification was performed using primers WKQC-IRC3-F and WKQC-IRC3-R. The products were analyzed by agarose gel electrophoresis. The results showed that the knockout strain (Δ IRC3 The amplification band of ) was approximately 3917 bp, and the band of wild-type YB-1631 (WT) was approximately 4734 bp, both consistent with theoretical expectations.

[0046] (5) Sequencing confirmation: Sequencing was performed on PCR products of the expected size to confirm the results. IRC3 The gene has been successfully knocked out as designed. See the diagram of the knockout gene. Figure 3 .

[0047] Example 2: P xylA -comK Box integration into strain YB-1631 Δ IRC3 In the genome 1. Preparation of integrated fragments (1) Linearization vector: using restriction endonuclease Mlu I and Xba The plasmid pBE-S was double-digested with enzyme I, and the linearized vector (fragment 1) of approximately 5785 bp was purified and recovered.

[0048] (2) Amplification of the left homologous arm: Using YB-1631 genomic DNA as a template, the left homologous arm (fragment 2) of the epr gene was amplified by primer pair pBE-linked XL-epr left-F / XL-epr left-linked P(xylA)-R. ​​This fragment overlaps with the upstream and downstream junctions by about 20 bp.

[0049] (3) Amplification of P xylA -comK box: Using pUBXC plasmid DNA as a template, amplify P using primer pair P(xylA)-F / PUBXC-Operon-R. xylA -comK box fragment (fragment 3).

[0050] (4) Amplification of chloramphenicol resistance fragment: Using pAD43-25 plasmid DNA as a template, the chloramphenicol resistance fragment (fragment 4) with its own promoter was amplified using primer pair pub operon-cm-F / PAD-cm-R.

[0051] (5) Amplification of the right homologous arm: Using YB-1631 genomic DNA as a template, the right homologous arm of the epr gene (fragment 5) was amplified by primer pair cm-linked XL-epr right-F / XL-epr right-linked pBE-R. This fragment overlaps with the upstream and downstream junctions by about 20 bp.

[0052] (6) Seamless ligation: Take 0.03 pmol of each of the above 5 fragments and ligate them using a seamless cloning kit. Transform the ligation products into E. coli JM109 competent cells.

[0053] (7) Verification of recombinant plasmid: Transformants were picked and PCR was performed using primers pBE-S sequencing-F1 / pBE-S sequencing-R1 for verification. Correct transformants could amplify a 4325 bp band, and sequencing confirmed that the ligation was correct. The correct recombinant plasmid was extracted and named pBE-epr-comK box.

[0054] (8) Amplification of the final integrated fragment: Using the recombinant plasmid pBE-epr-comK box as a template, PCR amplification was performed using primer pair XL-epr left-F / XL-epr right-R to obtain “epr left arm-P”. xylA -comK-cm r The "-epr right arm" integrated fragment was confirmed by sequencing. Successful ligation was confirmed. The verified recombinant plasmid was extracted and named pBE-epr-comK box. Using this plasmid as a template, PCR amplification with primer pairs XL-epr left-F / XL-epr right-R yielded the "epr left arm-P" fragment. xylA -comK-cm r -epr right arm" integrated fragment.

[0055] 2. YB-1631 Δ IRC3epr ::P xylA - comK Obtaining strains (1) Preparation of competent cells: Strain YB-1631 Δ was prepared using the cell wall weakening agent method. IRC3 competent cells.

[0056] (2) Electroconversion: Take about 0.5 μg of the above integrated fragment and add it to 900 μL of competent cells for electroconversion. The voltage is set to 1.5~2.3 kV.

[0057] (3) Resuscitation and plating: Immediately after electric shock, add 900 μL of resuscitation medium preheated at 37℃ and incubate at 37℃ and 160 rpm for 5-8 h. Placing the resuscitation solution onto LB plates containing 5 μg / mL chloramphenicol and incubating upside down at 37℃ for 16-24 h.

[0058] (4) Purification and screening: Select the single colonies that have grown and streak them twice on LB plates containing 5 μg / mL chloramphenicol.

[0059] (5) PCR verification: Genomic DNA was extracted from the transformants and PCR amplification was performed using primers XL-epr left-F / XL-epr right-R. Transformants that amplified a 4325 bp fragment were considered positive transformants.

[0060] (6) Sequencing confirmation: The successful construction of the mutant strain was finally confirmed by sequencing.

[0061] Example 3: Strain YB-1631 Δ IRC3 With YB-1631 Δ IRC3epr ::P xylA - comK Transformation efficiency of plasmid pJOE8999 1. Strain YB-1631 Δ IRC3 Transformation of plasmid pJOE8999 Using the above method, competent cells were prepared with a cell wall weakening agent, and plasmids pJOE8999, extracted from Escherichia coli JM109 (dam+dcm+, methylated) and JM110 (dam-dcm-, demethylated), were introduced into strain YB-1631 Δ via electroporation transformation. IRC3 The electroporation conditions were: 1 mm electroporation cuvette, 1.8 kV voltage, 1 electroporation. After transformation, the resuscitation solution was plated on LB agar plates containing 50 μg / mL kanamycin and incubated upside down at 30 °C for 48 h. Single colonies were picked, purified twice by streak plating, and then verified by PCR using primers pJOE-YZ-F and pJOE-YZ-R to confirm the presence of the plasmid. The results are as follows: Figure 4 As shown: Wild-type Bacillus sicca YB-1631 failed to produce transformants regardless of whether it was transformed with either methylated or demethylated plasmid pJOE8999; while the gene... IRC3 Deletion mutant (YB-1631 Δ) IRC3 Transformants were obtained when transforming the demethylated plasmid pJOE8999, with a transformation efficiency of 32.78 ± 2.36 CFU / μg DNA, but the methylated plasmid pJOE8999 could not be transformed. This indicates that knockout... IRC3 The degradation barrier was successfully removed, but the conversion efficiency remained limited.

[0062] 2. Optimization of transformation conditions Because the process of preparing competent cells using cell wall weakening agents is cumbersome, and the transformation efficiency is greatly affected by the strain's growth state, the effect of cell wall weakening, and the voltage during electroporation, it severely limits the subsequent use of plasmid pJOE8999 (Bacillus subtilis CRISPR-Cas9 editing system) to edit genes in the genome. Therefore, referring to the method of inducing natural competent cells, the inventors used xylose to induce the expression of the gene comK, prompting cells to enter the natural competent state.xylA - comK Box integration into strain YB-1631 Δ IRC3 Genes in the genome EPR Mutations in this gene at this site also benefit the later construction of chassis cells.

[0063] The effects of different xylose concentrations on the Δ of the obtained strain YB-1631 were tested. IRC3epr ::P xylA - comK The transformation of demethylated plasmid pJOE8999 was investigated using the following steps: Strains YB-1631 Δ... IRC3epr ::P xylA - comK Single colonies were inoculated into 3 mL LB medium containing 5 mg / mL chloramphenicol and cultured overnight at 37°C with shaking at 180 r / min. 60 μL of the seed culture was then transferred to 3 mL LB medium containing 5 μg / mL chloramphenicol and cultured under the same conditions until OD (digesterone) was reached. 600nm ≈0.5. Subsequently, xylose was added to final concentrations of 1%, 1.5%, 2%, and 2.5% (w / v) for 2 h induction. 200 μL of the inducing bacterial culture was transferred to a 2 mL sterile centrifuge tube as competent cells. The demethylated plasmid pJOE8999 was added to the competent cells, and the cells were incubated at 30℃ and 100 r / min for 8 h. The incubation solution was evenly spread onto two LB agar plates containing 50 μg / mL kanamycin and incubated upside down at 30℃ for 36–48 h. The same treatment group without plasmid was used as a negative control (CK). Transformation results are shown in [link to relevant documentation]. Figure 5 .

[0064] The negative control (CK) showed no colony growth on LB agar plates containing kanamycin (50 μg / mL), while the experimental group showed abundant colony growth. Statistical results indicated that the transformation efficiency was highest under 1.5% xylose induction conditions. Further optimization of the induction time at a 1.5% xylose concentration revealed that the highest number of transformants was achieved after 2 hours of induction. Under these optimal conditions, strain YB-1631 Δ IRC3epr ::P xylA - comK The transformation efficiency of the demethylated plasmid pJOE8999 can reach over 500 CFU / μg DNA. Figure 5 , Figure 6 ).

[0065] This result indicates that simply knocking out the RM gene (YB-1631 Δ) is effective. IRC3The previous method only achieved single-digit to double-digit transformation efficiencies. However, by introducing artificial competent cells and precisely optimizing the induction kinetics (1.5% xylose, 2 hours), the transformation efficiency increased by nearly 20-fold. This result overturns the conventional wisdom that "efficient genetic transformation can be achieved simply by removing the RM restriction modification barrier," demonstrating a significant synergistic effect between the removal of the exogenous DNA degradation barrier and the activation of DNA uptake and transport pathways. The specific combination of 1.5% xylose and 2 hours of induction produces unexpectedly superior technical results.

[0066] Example 4: Strain YB-1631 Δ IRC3 With YB-1631 Δ IRC3epr ::P xylA - comK right yisB Number of CRISPR knockout transformants and positive rate 1. Constructing genes yisB CRISPR-Cas9 knockout plasmid Take 5 μL of each yisB -sgRNA-F (100 μM) and yisB 100 μM sgRNA-F was added to 30 mM 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES) buffer and annealed to form double strands in a PCR instrument. The annealing program was: 95 °C for 5 min, then decreasing to 4 °C at 0.1 °C / s. This double strand was then ligated to plasmid pJOE8999 using the Golden Gate assembly method. The reaction system and program for the Golden Gate assembly are shown in Table 1.

[0067] Table 1. Kinmen Assembly Reaction System and Reaction Procedure

[0068] After the reaction, the reaction solution was transformed into E. coli JM109 competent cells. Transformants were screened on LB agar plates containing 50 μg / mL kanamycin. The transformants were then ligated into sgRNA-YZ-F / using primer PJOE. yisB sgRNA-YZ-R was used for colony PCR to verify successful sgRNA ligation. Plasmids were extracted from transformants with correct bands. Sfi The plasmid was digested with an I restriction enzyme to obtain a linearized fragment connecting the left and right arms of the target gene.

[0069] Genes were amplified from the genomic DNA of Bacillus sicca YB-1631 using primers osXLKOyisB-left-F / osXLKOyisB-left-R and osXLKOyisB-right-F / osXLKOyisB-right-R, respectively. yisBThe left and right homologous arm DNA fragments were obtained. Following the instructions, the left and right homologous arms were ligated to the linearized fragment using a seamless cloning kit. The reaction product was transformed into *E. coli* JM110 competent cells. Transformants were screened on LB agar plates containing 50 μg / mL kanamycin. Colony PCR was performed using primers pJOE-sequencing-F / pJOE-sequencing-R to verify successful ligation (PCR product: positive transformant 2195 bp; unligated: approximately 610 bp). Sequencing of the PCR product confirmed successful ligation of the sgRNA and the left and right homologous arms. Plasmids were extracted from the correctly verified transformants for later use.

[0070] 2. Strain YB-1631 Δ IRC3 With YB-1631 Δ IRC3epr ::P xylA - comK Knockout yisB Comparison of the number of transformants and positive rate Strain YB-1631 Δ was prepared using a cell wall weakening agent. IRC3 The competent cells were treated with 1.5% xylose as described in Example 3 and induced for 2 hours to prepare strain YB-1631 Δ. IRC3epr ::P xylA - comK competent cells. Add 2 μg of gene to each. yisB The CRISPR-Cas9 knockout plasmid was transformed, and the transformed resuscitation solution was plated on LB solid plates containing 50 μg / mL kanamycin and 0.3% mannose. The plates were inverted and incubated at 30°C for 36–48 h.

[0071] The results of the transformation experiment showed that ( Figure 7 ), strain YB-1631 Δ IRC3epr ::P xylA - comK The number of transformants obtained was 57, while strain YB-1631 Δ IRC3 Only 8 were obtained, far more than the former (Table 2).

[0072] To verify the knockout effect, YB-1631 Δ was randomly selected. IRC3epr ::P xylA - comK 20 transformants and YB-1631 Δ IRC3 Seven transformants were identified by colony PCR using primers XLKO-yisB-WKQC-F / R. yisB Successful gene knockout resulted in the amplification of a specific band of 1952 bp; failure to knock out resulted in the amplification of a band of 2267 bp, consistent with the wild-type strain YB-1631. The electrophoresis results of the PCR products are shown below. Figure 8 As shown: In YB-1631 Δ IRC3epr ::P xylA - comK Of the 20 transformants (k1~k20), only k5 and k18 amplified the same 2267 bp band as the wild type, while the remaining 18 were positive transformants (1952 bp), with a positive rate of 90%; in YB-1631 Δ IRC3 Of the seven transformants, all except I7 showed positive bands, with a high positive rate (Table 2). This further demonstrates that the mutant strains constructed and the optimized method of this invention have extremely high transformation efficiency and positive rate in practical gene editing applications, fully meeting the needs of industrial gene editing platforms.

[0073] Table 2. Strain YB-1631 Δ IRC3 and YB-1631 Δ IRC3epr ::P xylA - comK Knockout gene yisB Number of transformants and positive rate

[0074] The primer sequences used in the above experiments are shown in Table 3.

[0075] Table 3 Primer sequences involved

[0076]

[0077] Note: The sequence marked by a straight underline coincides with the adjacent segment to be ligated, while the sequence marked by a curved underline is the sticky end required for ligating the sgRNA to the vector.

[0078] Although some preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0079] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from the spirit and scope of its inventive concept. Therefore, if these modifications and variations of the invention fall within the scope of the claims of this application and their equivalents, the invention is also intended to include these modifications and variations.

Claims

1. A mutant strain of Bacillus sicca, characterized in that, Restriction modification system genes in its genome IRC3 The genome is inactivated or knocked out, and contains genes encoding competent transcription factors regulated by xylose-inducible promoters. comK The expression box.

2. The Bacillus sicca mutant strain according to claim 1, characterized in that, The mutant strain is Bacillus sicca with accession number CGMCC No. 25784. Bacillus siamensis YB-1631 IRC3 Gene deletion mutant strain.

3. The Bacillus sicca mutant strain according to claim 1, characterized in that, The expression box is P. xylA - comK box, which contains the xylose-inducible promoter P xylA The regulated competent transcription factor encoding gene comK .

4. The Bacillus sicca mutant strain according to claim 1, characterized in that, The IRC3 The gene has a sequence as shown in SEQ ID NO: 1 or a sequence having more than 95% homology with it; and / or, the expression cassette contains a sequence as shown in SEQ ID NO: 3 or a sequence having more than 95% homology with it.

5. The Bacillus sicca mutant strain according to claim 1, characterized in that, The IRC3 Gene inactivation or knockout is achieved through homologous recombination, and / or the expression cassette is integrated into the mutant genome. EPR Gene loci.

6. A method for constructing a *Bacillus sicca* mutant strain according to any one of claims 1-5, characterized in that, Includes the following steps: (1) Constructing a carrier IRC3 Knockout vectors containing upstream and downstream homologous arms of the gene knock out the gene in the Bacillus sicca genome via homologous recombination. IRC3 Genes, Acquisition IRC3 Gene-deleted strains; (2) Construct a device carrying P xylA - comK The integration vector containing the box and homologous arm of the genome integration site, through homologous recombination, integrates the P... xylA - comK box integrated into the above IRC3 The genome of gene-deleted strains EPR Gene loci; (3) Screening IRC3 Gene knockout and the P xylA - comK Mutants with stable box integration.

7. The construction method according to claim 6, characterized in that, In step (1), the amplification of the IRC3 The primer pairs for the upstream and downstream homologous arms of the gene are as follows: IRC3-Left Arm-F: gcccgctgctctctatcaaa; IRC3-LeftArm-TcR-R:tggcccgtttgttgaactactgagcactgtggaaagcggta; IRC3-TcR-right arm-F: atccgtcgacctgcagatctatcaggaagggacttggcga; IRC3-Right Arm-R:gtggagtgaactagcacaagc.

8. A method for transforming Bacillus sicca with exogenous DNA, or a method for editing Bacillus sicca, characterized in that, Using the Bacillus sicca mutant strain of any one of claims 1-5 as the recipient strain, the recipient strain is induced and cultured for 0.5-3 h under xylose concentration of 1%-2.5% to induce the recipient strain into competent state, and then demethylated plasmid DNA is introduced.

9. A kit for genetic transformation of Bacillus sicca, characterized in that, Cultures of the Bacillus sicca mutant strain according to any one of claims 1-5, or lyophilized powder thereof, and for induction comK Gene expression inducers.

10. The use of the Bacillus sicca mutant strain according to any one of claims 1 to 5, or the kit according to claim 9, in gene editing, metabolic engineering, or agricultural biological control of Bacillus sicca.

Images