Application of LrAHL15 gene in regulating growth of Lycium ruthenicum

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to application of LrAHL15 gene in regulating growth of Lycium ruthenicum Murr. The number of roots of overexpression strain significantly reduces, the number of roots of inhibition expression strain significantly increases, and the branch significantly increases, which proves that the gene has the functions of inhibiting root generation and branch generation. The new branch generation of overexpression strain reduces, small lateral branch does not occur, the number of leaf of thorny branch reduces, the degree of lignification of thorny branch enhances, and the width of thornless branch increases; the inhibition expression strain has the opposite trend, that is, the new branch and small lateral branch generation significantly increase, the number of leaf of thorny branch significantly increases, the degree of lignification of thorny branch significantly reduces, the width of thornless branch increases, and the occurrence rate of branch thorn also reduces. It is proved that the gene has the functions of inhibiting new branch generation, inhibiting branch thorn transforming into small lateral branch and inhibiting the number of leaf of thorny branch, and simultaneously has the functions of promoting the degree of lignification of thorny branch and the width of thornless branch.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the LrAHL15 gene in regulating the growth of black goji berries. Background Technology

[0002] Black goji berry (Lycium ruthenicum Murr.) is an economic shrub unique to the arid regions of Northwest my country, possessing both ecological restoration value and extremely high health and medicinal value. However, with the advancement of industrialization, the inherent thorny characteristics of wild black goji berry germplasm resources have become a core bottleneck restricting its large-scale cultivation. The thorns of black goji berry are hard and sharp, easily injuring the fruit and workers during manual harvesting and mechanized operations. More critically, existing cultivated plants generally suffer from numerous hard thorns and almost no lateral branches. The hard thorns severely hinder manual harvesting and mechanized operations; while the lack of effective nutrient-rich lateral branches results in fewer fruit-bearing sites. Therefore, cultivating black goji berry with fewer thorns and more branching is a technical problem that the industry urgently needs to solve.

[0003] Although the AHL (AT-HOOK MOTIF CONTAINING NUCLEAR LOCALIZED) transcription factor family plays an important role in plant growth, development and stress response, there are no reports to date on whether AHL family genes, especially the plant AHL15 gene, are involved in regulating the conversion of thorns into lateral branches. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides the application of the LrAHL15 gene in regulating the growth of black goji berries.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides the application of the LrAHL15 gene in regulating the growth of black goji berries, and the CDS sequence of the LrAHL15 gene is shown in SEQ ID No. 1.

[0007] Preferably, inhibiting the expression of the LrAHL15 gene suppresses the thorn production rate of thorny branches.

[0008] Preferably, overexpression of the LrAHL15 gene inhibits root development and branching in black wolfberry.

[0009] Preferably, overexpression of the LrAHL15 gene reduces the occurrence of new shoots in black goji berries and reduces the number of leaves on thorny branches of black goji berries.

[0010] Preferably, overexpression of the LrAHL15 gene prevents the formation of small lateral branches in black goji berries.

[0011] Preferably, overexpression of the LrAHL15 gene enhances the lignification degree of thorny branches of black goji berries.

[0012] Preferably, overexpression of the LrAHL15 gene increases the width of thornless branches of black goji berries.

[0013] Preferably, inhibiting the expression of the LrAHL15 gene increases the occurrence of new shoots and small lateral branches in black wolfberry.

[0014] Preferably, inhibiting the expression of the LrAHL15 gene increases the number of leaves on thorny branches of black goji berries and increases the width of thornless branches of black goji berries.

[0015] Preferably, inhibiting the expression of the LrAHL15 gene reduces the lignification degree of thorny branches of black goji berries.

[0016] The beneficial effects of this invention are:

[0017] Three overexpression lines and four repressed expression lines of black wolfberry were obtained using Agrobacterium-mediated stable genetic transformation. Phenotypic analysis under tissue culture conditions showed that the overexpression lines had a significantly reduced root number, while the repressed expression lines had a significantly increased root number and branching, demonstrating that the gene inhibits root and branching. Phenotypic analysis of transplanted potted seedlings showed that the overexpression lines exhibited reduced new shoot development, no small lateral branches, and fewer leaves on thorny branches, while increasing the lignification of thorny branches and the width of thornless branches. The repressed expression lines showed the opposite trend: significantly increased new shoot and small lateral branch development, significantly increased leaves on thorny branches, significantly reduced lignification of thorny branches, and suppressed increase in the width of thornless branches. This demonstrates that the gene inhibits the development of new shoots and small lateral branches and the number of leaves on thorny branches, while simultaneously promoting lignification of thorny branches and increasing the width of thornless branches. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0019] Figure 1 The structure diagram of the LrAHL15 overexpression vector of black wolfberry;

[0020] Figure 2 The structure diagram of the LrAHL15 inhibitory expression vector of black wolfberry;

[0021] Figure 3 Representative images of wild-type black wolfberry (A) and tissue culture plants with LrAHL15 overexpression (B) and suppressed expression (C);

[0022] Figure 4The images show representative main branches of wild-type black wolfberry plants with LrAHL15 overexpression and LrAHL15 suppression in potted plants. A is the wild type; B is the LrAHL15 overexpression type; C is the LrAHL15 suppression type; and D is a magnified detail of the red dashed box in C. Detailed Implementation

[0023] This invention provides the application of the LrAHL15 gene in regulating the growth of black goji berries, and the CDS sequence of the LrAHL15 gene is shown in SEQ ID No. 1. In this invention, inhibiting the expression of the LrAHL15 gene suppresses the thorn production rate of thorny branches.

[0024] SEQ ID No.1 (5'-3'):

[0025] ATGGCTAACCGATGGTGGGCTGGAAATATAGCTATGAATCCAATGGTTTCATCAAGAAGCAACACAGAAGAAGAAAATAACCCCAGAAGAGAGCAAGAATTCATGGATACAACGACTATCGAACCCATCACAACTACCACCACAAATAGCAGTGGAAGCAACAACACAAAATCCAAACCCCTAATGAAGGAGATGAGAATATCCAGAGTCCTGGAGGTCTGTCCTCGGGACCGTCGTCCAGTGGAGGACGTAGACCCAGAGGAAGAGACCTCCAGGCTCAAAGAACAAAACCCAAACCACCAATAGTAGTTACTAAGGAAACCCCAAATTCCCTTAAGAGCCACGTGTTGGAAATTAAAACGGGTAGTGACATAATTGAAAAGCATAGCCACGTTCGCTAATAGTCGCGGACGTGGCGTGTCCGTTTTTGAGCGGAAGTGGGATAGTGACAAAATGTGAAATTACGCCAACCGGCCATGGCCGGGGGGCGTAATTACACTACATGGCAGATTCGAGATATTATTATCTCTCTCGGGGAGCGTTTTTTGCCTTCATCGAATTCACCAGTTTGGAGCTACGGCTACTGGACTAACGGTGTACTTAGGTGGAAGTCAAGGACAAGTTGTTGGTGGAAATGTTTGTGGGGTGAATTAATTGCGTCAGGGCCAGTTATGGTAATTGCAGCAACTTTTTCAAATGCTACATTTTGATAGATTACCATTAGAGGATGAAGAGGAGGAGGAATAATGTAAGTGAAGGGGATGCAAATGCAATTACCTACAAATGCAGGGGGTTTGGTAATGGTGGTACTGGTAGTTTTGCAGGGGTGATGATCCATCTCCCTCCTGCTTCTATGGCTATGTACAATTTTGCCCACTAATGTTTTTGCCTAATGGTCAAATGCCCCCATGAAGTTTTTCTGGGCTACTCCTCCTTTCAAGGCCTCCTCCATCCTATTAA。

[0026] In this invention, overexpression of the LrAHL15 gene preferably inhibits root development and branching in black goji berries. In this invention, overexpression of the LrAHL15 gene preferably reduces the occurrence of new shoots and the number of leaves on thorny branches of black goji berries. In this invention, overexpression of the LrAHL15 gene preferably prevents the formation of small lateral branches in black goji berries. In this invention, overexpression of the LrAHL15 gene preferably enhances the lignification of thorny branches of black goji berries. In this invention, overexpression of the LrAHL15 gene preferably increases the width of thornless branches of black goji berries. In this invention, inhibiting the expression of the LrAHL15 gene preferably increases the occurrence of new shoots and small lateral branches in black goji berries. In this invention, inhibiting the expression of the LrAHL15 gene preferably increases the number of leaves on thorny branches and the width of thornless branches of black goji berries. In this invention, inhibiting the expression of the LrAHL15 gene preferably reduces the lignification degree of the thorny branches of black goji berries.

[0027] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1

[0029] 1. Experimental Procedure

[0030] 1.1 Construction and Transformation of Overexpression Vectors into Agrobacterium

[0031] Using pRI101-AN as the original vector, the pRI101-LrAHL15 fusion vector was constructed by inserting homologous recombination of the LrAHL15 gene into the CDS through SmaI and XbaI double digestion.

[0032] 1.1.1 Extraction and Enzyme Digestion of pRI101-AN Vector

[0033] E. coli containing the original pRI101-GFP vector were streaked onto LB solid medium supplemented with 50 mg / L Kan for activation. Single colonies were picked and cultured in LB liquid medium supplemented with 50 mg / L Kan at 37°C with shaking at 180 rpm for 12–16 h. Plasmids were extracted using the plasmid mini-prep kit from Tiangen Biotech Co., Ltd., following the manufacturer's instructions.

[0034] After determining the plasmid mass and concentration using 1% gel electrophoresis and a NanoDrop One micro spectrophotometer (Thermo), the plasmid was stored at -20°C for later use.

[0035] The pRI101-AN vector was digested with SmaI and XbaI. The reaction mixture consisted of 1 µg pRI101-AN, 2 µL SmaI, 2 µL XbaI, 6 µL 10x CutSmart buffer, and ultrapure water to a final volume of 40 µL. The mixture was incubated at 25˚C for 4 h. The product was then verified by 1% agarose gel electrophoresis. After confirming the vector digestion, the correct target band was excised using a UV gel imaging system and placed in a clean 1.5 mL centrifuge tube. The plasmid was recovered using the agarose gel DNA recovery kit from Kangwei Century Biotechnology Co., Ltd., following the manufacturer's instructions. After determining the plasmid mass and concentration, the plasmid was stored at -20℃.

[0036] 1.1.2 Amplification and Recovery of the LrAHL15 Target Fragment

[0037] Using pRI101-AN as the original vector, primers OE-LrAHL15-F (SEQ ID No. 2: 5'-AGAACACGGGGGACTCTAGAATGGCTAACCGATGGTGGGC-3') and OE-LrAHL15-R (SEQ ID No. 3: 5'-TCGGATCCGGTACCCCCGGGTTAATAGGATGGAGGAGGC C-3') were designed to amplify LrAHL15 with Sma I and Xba I as restriction sites.

[0038] 0.5 μL cDNA template, 0.5 μL GFP-LrAHL15-F (10 μM), 0.5 μL GFP-LrAHL15-R (10 μM), 6.25 μL 2×Rapid Taq Master Mix, 4.25 μL ultrapure water, total volume 12.5 μL.

[0039] The PCR reaction system is as follows: cDNA 0.5 μL, OE-LrAHL15-F (10 μM) 0.5 μL, OE-LrAHL15-R (10 μM) 0.5 μL, 2×Rapid Taq Master Mix 6.25 μL, ultrapure water 4.25 μL, total volume 12.5 μL.

[0040] PCR reaction program settings: 95℃ for 3 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for a total of 35 cycles; 72℃ for 5 min; store at 4℃. After successful electrophoresis detection, select the PCR product with the correct band position for gel recovery.

[0041] 1.1.3 Connection of target segments

[0042] Homologous recombination was used to ligate the target fragment and the enzyme-digested pRI101-AN vector. The ligation system consisted of 100 ng of enzyme-digested pRI101-AN, 37.2 ng of the LrAHL15 target fragment, 5 μl of 2 x CE Mix V3, and ultrapure water to a final volume of 10 µL. The ligation procedure was 50 °C for 10 min.

[0043] 1.1.4 Transformation of Escherichia coli DH5α with recombinant vector

[0044] The constructed plasmid was heat-shocked and transformed into *E. coli* DH5α competent cells, following the instructions of the Sangon Biotech competent cell manufacturer. After single colonies formed on the culture medium, multiple single colonies were selected using a sterile white pipette tip and added to 1 mL of LB liquid medium containing Kan resistance (100 mg / L). The cells were then incubated at 37°C and 180 rpm for 12–16 h.

[0045] Take the above-mentioned single-clone bacterial culture and use vector primers 35S-F (SEQ ID No. 4: 5'-ATGACGCACAATCCCACTATCCT-3') and M13-R (SEQ ID No. 5: 5'-GTCATAGCTGTTTCCTG-3') to perform bacterial culture PCR to verify whether the vector has been successfully ligated into the DNA fragment.

[0046] PCR reaction system: 0.5 μL of single-clone bacterial culture, 0.5 μL of 35S-F (10 μM), 0.5 μL of M13-R (10 μM), 6.25 μL of 2×Rapid Taq Master Mix, 4.25 μL of ultrapure water, total volume 12.5 μL.

[0047] The PCR reaction procedure was the same as in section 1.1.2, with the extension time changed to 60 s. After successful electrophoresis, the bacterial culture corresponding to the product with a single band and the correct position was selected for sequencing. The successfully sequenced bacterial cultures were then added with an equal volume of 50% glycerol and stored in an ultra-low temperature freezer at -80°C.

[0048] The constructed recombinant vector was named pRI101-LrAHL15. Figure 1 ).

[0049] 1.1.5 Transformation of Agrobacterium GV3101 with recombinant vector

[0050] The recombinant plasmid was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method.

[0051] 100 μL of Agrobacterium GV3101 competent cells were thawed on ice for 10–20 min. 10 μL of the ligation product was added to the competent cells using a pipette, and the mixture was gently tapped and incubated on ice for 5 min. The cells were then placed in liquid nitrogen for 1 min, immediately followed by a 37°C water bath for 5 min, and then rapidly incubated on ice for 2–5 min, ensuring careful and stable handling throughout. 800 μL of YEP liquid medium was added, mixed, and incubated at 28°C and 180 rpm with shaking for 4 h. The cells were centrifuged at 5000 rpm for 5 min, and most of the supernatant was discarded, leaving approximately 100 μL of supernatant to resuspend the cells. This resuspended supernatant was then evenly spread onto YEP (containing 50 mg / L Kan and 50 mg / L Rif) solid medium. The incubator was set to 28°C, and the YEP plates were inverted and incubated for approximately 48 h. White colonies were then selected from the plates and placed in YEP liquid (containing 50 mg / L Kan and 50 mg / L Rif) medium, and incubated at 28°C and 220°C. Incubate on a shaker at rpm for 24 hours.

[0052] Primers 35S-F and M13-R from the vector were used for bacterial culture PCR verification. The PCR reaction system consisted of: 0.5 μL of single-clone bacterial culture; 0.5 μL of 35S-F (10 μM), 0.5 μL of M13-R (10 μM), 6.25 μL of 2×Rapid Taq Master Mix, and 4.25 μL of ultrapure water, for a total volume of 12.5 μL.

[0053] The PCR reaction procedure is as described in section 1.1.2. After successful electrophoresis verification, add an equal volume of 50% glycerol to the bacterial culture and mix thoroughly. Finally, store the mixture at -80°C for long-term use in subsequent experiments.

[0054] 1.2 Construction and transformation of the inhibition expression vector into Agrobacterium

[0055] Using pRNAi-E (Song Mengru, Chen Keqin, Guo Yunna, et al. Construction of a novel RNAi vector for plant gene silencing [J]. Journal of Shenyang Agricultural University, 2017, 48(6):719-724.) as the original vector, the Sma I restriction site was selected. The LrAHL15 sense strand was inserted upstream of the intron of the vector, and the LrAHL15 antisense strand was inserted downstream of the intron of the vector, using Kpn I as the restriction site. The sequences of the sense and antisense strands inserted into the vector are shown in Table 2. Primers for amplifying the LrAHL15 sense and antisense strands were designed using Sma I and Kpn I restriction sites, respectively (Table 3).

[0056] Table 2. Sensitivity and antisense strand sequences of the LrAHL15 repressed expression vector.

[0057]

[0058] Table 3. Primer sequence listing for LrAHL15 forward and antisense strands

[0059]

[0060] The amplification and recovery of the target gene are as described in 1.1.2. The PCR reaction system is as follows: 0.5 μL cDNA (template acquisition is as described in 1.1.2), 0.5 μL LrAHL15P-F / LrAHL15N-F (10 μM), 0.5 μL LrAHL15P-R / LrAHL15N-R (10 μM), 6.25 μL 2×Mix, 4.25 μL ultrapure water, and a total volume of 12.5 μL.

[0061] The PCR reaction procedure was the same as in section 1.1.2, with the extension time changed to 10 s. The gel was then recovered after electrophoresis.

[0062] pRNAi-E vector extraction: *E. coli* containing the original pRNAi-E vector were streaked onto LB solid medium supplemented with 50 mg / L Kan for activation. Single colonies were picked and cultured in LB liquid medium supplemented with 50 mg / L Kan at 37°C with shaking at 180 rpm for 12–16 h. Plasmids were extracted using the plasmid mini-prep kit from Tiangen Biotech Co., Ltd., following the manufacturer's instructions.

[0063] After determining the plasmid mass and concentration using 1% gel electrophoresis and a NanoDrop One micro spectrophotometer (Thermo), the plasmid was stored at -20°C for later use.

[0064] For detailed steps, please refer to 1.1.1.

[0065] The pRNAi-E vector was digested with Kpn I. The reaction mixture consisted of pRNAi-E (1 µg), Kpn I (2 µL), 10 x CutSmart buffer (6 µL), and ultrapure water to a final volume of 40 µL. The mixture was incubated at 37°C for 4 h. The product was then verified by 1% agarose gel electrophoresis. DNA was purified and recovered after the vector digestion.

[0066] The target gene (antisense strand) and vector were ligated using homologous recombination. The ligation mixture consisted of 100 ng of digested pRI101-GFP, 37.2 ng of the target fragment LrAHL15, 5 μL of 2x CE Mix V3, and ultrapure water to a final volume of 10 µL. Ligation was carried out at 50 °C for 10 min.

[0067] The constructed plasmid (named pRNAi-LrAHL15N) was transformed into E. coli DH5α competent cells.

[0068] pRNAi-LrAHL15N vector extraction, the specific steps are the same as above.

[0069] The pRNAi-LrAHL15N vector was digested with Sma I. The reaction mixture consisted of pRNAi-LrAHL15N (1 µg), Sma I 2 µL, 10 x CutSmart buffer 6 µL, and ultrapure water to a final volume of 40 µL. The mixture was incubated at 25˚C for 4 h. The product was verified by 1% agarose gel electrophoresis. DNA was purified and recovered after vector digestion.

[0070] The target gene (sense strand) and vector are ligated, following the same steps as above. The constructed plasmid is then transformed into E. coli DH5α competent cells.

[0071] Using primers 35S-F and LrAHL15N-R, bacterial culture PCR was performed to verify whether the vector was successfully ligated into the antisense strand; using primers LrAHL15P-F and M13-R, bacterial culture PCR was performed to verify whether the vector was successfully ligated into the sense strand. The PCR reaction system was as follows: 0.5 μL of single-clone bacterial culture, 0.5 μL of 35S-F / LrAHL15P-F (10 μM), 0.5 μL of LrAHL15N-R / M13-R (10 μM), 6.25 μL of 2×Rapid Taq Master Mix, and 4.25 μL of ultrapure water, for a total volume of 12.5 μL.

[0072] The PCR reaction procedure was as described in section 1.1.2, with the extension time changed to 44 s. The detection and strain preservation methods were as described in section 2.1.4. The constructed recombinant vector was named pRNAi-LrAHL15. Figure 2 ).

[0073] Refer to section 1.1.5 for the Agrobacterium-mediated transformation procedure.

[0074] 1.3 Stable genetic transformation of black goji berries

[0075] (1) Explant pre-culture: Select vigorous black wolfberry tissue culture seedlings, take the leaf tips as explants in a clean bench, and inoculate them on MS solid medium without plant growth regulators with the leaf back facing up. Pre-culture for 3 days under the conditions of 12 h light / 12 h dark and 25±2℃.

[0076] (2) Preparation of Agrobacterium infection solution: Agrobacterium GV3101 containing pRI101-LrAHL15 or pRNAi-LrAHL15 recombinant plasmids was taken out from -80℃, thawed on ice, and the bacterial solution was picked up with an inoculation loop and streaked on YEP solid medium supplemented with 50 mg / L Kan and 100 mg / LRif for activation. The culture was inverted at 28℃ for 2-3 days. Single colonies were picked and cultured in YEP liquid medium supplemented with the same antibiotics at 28℃ and 180 rpm until OD600=0.4. The cells were centrifuged at 3500 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in an equal volume of liquid MS supplemented with 100 μmol / L acetylsalicylic acid (AS) and incubated on ice for 1 h for later use.

[0077] (3) Infection and co-culture: The leaf tip explants that have been pre-cultured for 3 days were placed in the infection solution for 10 min. After taking them out, the surface bacterial solution was dried, and the leaf was inoculated on MS solid medium with 100 μmol / L AS added, with the leaf back facing up. The inoculation was sealed with sealing film and cultured in the dark at 25℃ for 2 days.

[0078] (4) Screening Culture: After dark culture, the leaf tip explants were gently shaken and rinsed 4-5 times in sterile water containing 500 mg / L cephalosporin (Cef). The surface liquid was then blotted dry with sterile filter paper. The explants were then inoculated onto MS solid medium supplemented with 3 mg / L Kan and 300 mg / L Cef with the leaf back facing up for screening culture. The medium was changed every 7 days. Once the explants produced resistant plants (roots first, then shoots to form complete plants), they were transferred to tissue culture bottles for further screening culture.

[0079] (5) Rooting culture: When the resistant plants grow to 4-5 cm, cut off the top 3 cm and inoculate them into 1 / 2 MS solid medium supplemented with 5 mg / L Kan and 300 mg / L Cef for rooting culture. Molecular identification is performed after 1 month of culture.

[0080] 1.4 Molecular detection of stable transformation to resistant black goji berries

[0081] 1.4.1 DNA-level identification

[0082] DNA was extracted from wild-type and transgenic black wolfberry using the CAS Saitu Plant Genomic DNA Extraction Kit according to the instructions. After determining the concentration and quality, PCR amplification was performed using this DNA as a template. Successful plasmids were used as positive controls, and wild-type cells were used as negative controls. Electrophoresis bands were used to determine whether the corresponding regions of the vector had been successfully inserted into the genome of the transformed lines.

[0083] The PCR reaction system was as follows: DNA (25 ng) 0.5 μL, 35S-F / LrAHL15P-F (10 μM) 0.5 μL, M13-R (10 μM) 0.5 μL, 2×Rapid Taq Master Mix 6.25 μL, ultrapure water 4.25 μL, total volume 12.5 μL.

[0084] The PCR reaction procedure is the same as in section 1.1.2, except the extension time is changed to 34 s.

[0085] 1.4.2 RNA Level Identification

[0086] After DNA level identification confirmed successful insertion of the vector into the genome of the transformed line, RNA was extracted from wild-type and transgenic black wolfberry. RNA quality and concentration were measured. Quality-compliant RNA was reverse transcribed into cDNA using 1st Strand cDNA Synthesis SuperMix (gDNA Purge). This cDNA was then used as a template for subsequent qRT-PCR. The reverse transcription reaction system consisted of: 10 μL of 2x1st Strand cDNA Synthesis SuperMix, 1 μg of RNA, 1 μL of gDNA Purge, and RNase-free water to a final volume of 20 μL. The reaction program was: 50℃ for 15 min; 85℃ for 5 s; and storage at 4℃.

[0087] To investigate the changes in the expression levels of LrAHL15 and LrTPP3 in successfully transformed plants using overexpression and repression vectors, primer pairs LrAHL15-DL-F (SEQ ID No. 12: 5'-TGGATACAACGACTATCGAACC-3') and LrAHL15-DL-R (SEQ ID No. 13: 5'-CCCAAACCACCAATAGTAG-3'), LrTPP3-DL-F (SEQ ID No. 14: 5'-TTTACACCGAGACTACTGA-3') and LrTPP3-DL-R (SEQ ID No. 15: 5'-TCTTTAGCCTGACACGATC-3'), and GAPDH-F (SEQ ID No. 16: 5'-TTCAATCGTCCGTCTTC G-3') and GAPDH-R (SEQ ID No. 15: 5'-TGGATACAACGACTATCGAACC-3') were designed based on the LrAHL15 and LrTPP3 gene sequences, respectively. No. 17: 5'-TACCAACCCTTGTCTTCC-3' was used as the internal control primer for qRT-PCR.

[0088] qRT-PCR reaction system: 2x Universal SYBR qPCR Mix (10 μL); 10 μM forward primer (0.5 μL); 10 μM reverse primer (0.5 μL); cDNA (50 ng / μL) (1 μL); ultrapure water to a final volume of 20 μL. The qRT-PCR program was: 95 ℃ for 2 min; 95 ℃ for 15 s, 60 ℃ for 30 s, 72 ℃ for 30 s, 40 cycles; Melt (melting curve) for 15 s.

[0089] The Ct value obtained by qRT-PCR was used in 2... -△△Ct The relative DNA levels of LrAHL15 and LrTPP3 in each sample were calculated using SPSS 20.0, and the gene expression levels were analyzed using an independent samples t-test (P < 0.01).

[0090] 1.5 Phenotypic Analysis of Transgenic Black Goji Berries Before and After Transplanting

[0091] Phenotypic parameters of wild-type and transgenic plants in tissue culture bottles were determined. Three tissue culture seedlings were randomly selected from each line in the experiment. Leaf length, leaf width, stem diameter, stem length, and root length were measured using calipers. The number of stems, leaf clusters, roots, leaves, and leaf color were also visually observed and recorded. The number of leaves per cluster (total number of leaves / number of leaf clusters) and the average internode length (stem length / number of leaf clusters + 1) were calculated based on the data. Three biological replicates were set up for each group, with each replicate containing three plants. Independent samples t-tests were performed on the plant phenotypic data using SPSS 20.0 (P < 0.05).

[0092] Wild-type and transgenic lines were propagated and transplanted for acclimatization. After approximately 50 days of growth to form complete plants, the tissue-cultured seedlings were placed under natural light for 7 days to improve seedling vigor. The seedlings were then removed from the tissue culture bottles, and the roots were gently rinsed with slow-flowing water to remove residual culture medium. After washing, they were immersed in a 0.33% (m / v) carbendazim solution for 30 minutes to reduce the risk of fungal diseases after transplanting. The seedling substrate was autoclaved at 121 ℃ for 1 hour, cooled, and then mixed with perlite and vermiculite for subsequent transplanting. After transplanting, the plants were covered with perforated disposable plastic cups to maintain humidity. All materials were cultured in a seedling room at a temperature of 25 ± 2 ℃ and a light intensity of 48 μmol / m² / s. Single-plant, single-pot transplanting was used, with all experimental plants using identical pot sizes and equal substrate volumes to ensure a uniform and controllable cultivation environment and growth space. About half a month later, after the plants had grown vigorously and sprouted new leaves, the plastic cups were removed. After transplanting and growing for approximately 50 days, wild-type and transgenic plants with consistent growth were selected, and their branches were pruned. During pruning, all stems were kept with the same number of nodes (6). Three months after transplanting, the phenotypic characteristics of branches, thorns, and stems and leaves were analyzed. Branch length was measured using a measuring tape (2 m range), and branch thickness, leaf length and width of the main leaves, and thorn length and width were measured using calipers. One-way ANOVA analysis (P < 0.05) was performed on the plant phenotypic data using SPSS 26.0, and multiple comparisons were conducted using LSD and Duncan's method.

[0093] The following are the statistical methods for each indicator:

[0094] ① Indicators related to the number of branches

[0095] Total number of new branches per plant = Total number of new lateral branches / Number of plants per pot.

[0096] Number of new lateral branches on a single branch: Total number of new lateral branches on a single plant / Number of branches pruned on the plant.

[0097] ② Indicators related to the proportion of branch thorns

[0098] The percentage of newly developed thornless lateral branches is calculated as follows: (Number of completely thornless branches / Total number of newly developed branches) × 100%.

[0099] The proportion of newly grown thorny lateral branches is calculated as follows: (Number of thorny branches / Total number of newly grown branches) × 100%.

[0100] The thorn emergence rate of newly sprouted thorny lateral branches is calculated as follows: (Number of thorny leaf axils / Total number of leaf axils) × 100%.

[0101] ③ Branch thorn morphology indicators

[0102] Select mature large thorns in the middle of newly sprouted thorny lateral branches, and measure the length and width of the thorns. Measure each thorn once, and take the average of the measurements of 3 to 5 thorns on a single branch as the data for the thorn length and width of that branch.

[0103] ④ Morphology of thornless lateral branches and leaf indices

[0104] Leaf parameters: Select the main leaf in the middle of the thornless lateral branch and measure its length and width; measure the leaf thickness using the clamping method, avoiding the midrib and leaf edge, and repeat the measurement for each leaf at least 3 times, taking the average value. Count the total number of leaves and leaf clusters on the thornless lateral branches, calculate the number of leaves per cluster by dividing the total number of leaves by the number of leaf clusters, and take pictures of representative leaf clusters.

[0105] Average internode length = lateral branch length / (number of leaf clusters + 1).

[0106] Lignification degree = (length of white stem / total stem length) × 100%.

[0107] ⑤ Morphology of thorny lateral branches and leaf indices

[0108] The leaf indicators (leaf length, leaf width, leaf thickness, number of leaves per cluster), branch morphology indicators (branch length, branch width, internode length), and lignification degree of thorny lateral branches are measured using methods that are completely consistent with those of thornless lateral branches, ensuring data comparability.

[0109] 2. Results

[0110] Table 4. Effects of LrAHL15 gene overexpression in black goji berries on phenotype of tissue culture seedlings

[0111]

[0112] The data in the table are the mean ± standard deviation of three repeated trials. There are significant differences between data in the same column labeled with different letters (P < 0.05).

[0113] Table 5. Effects of suppressed LrAHL15 gene expression in black goji berries on phenotype of tissue culture seedlings.

[0114]

[0115] The data in the table are the mean ± standard deviation of three repeated trials. There are significant differences between data in the same column labeled with different letters (P < 0.05).

[0116] Table 6. Effects of LrAHL15 gene overexpression on the phenotype of potted seedlings of black goji berries.

[0117]

[0118] Table 7. Effects of suppressed expression of the LrAHL15 gene in black wolfberry on the phenotype of potted seedlings.

[0119]

[0120] Three overexpression lines and four repressed expression lines of black goji berry were obtained through Agrobacterium-mediated stable genetic transformation. Phenotypic analysis under tissue culture conditions showed that the overexpression lines had a significantly reduced root number, while the repressed expression lines had a significantly increased root number and branching, demonstrating that the gene has the function of inhibiting root and branching. Inhibiting gene expression yields transgenic lines with well-developed root systems and vigorous branching. This will enhance plant adaptability and increase the number of fruiting branches, showing potential application in breeding high-yielding and highly resistant black goji berry plants; the overexpression lines can provide experimental materials for selecting plants with fewer branches.

[0121] Phenotypic analysis of transplanted potted seedlings showed that overexpression lines exhibited reduced new shoot development, no small lateral branches, and fewer leaves on thorny branches, while increasing lignification of thorny branches and width of thornless branches. Conversely, suppressed expression lines showed the opposite trend: significantly increased new shoot and small lateral branch development, reduced thorn formation, and significantly increased leaves on thorny branches, while significantly reduced lignification of thorny branches and suppressed increase in thornless branch width. This demonstrates that the gene inhibits the development of new shoots and small lateral branches, as well as the number of leaves on thorny branches, while simultaneously promoting lignification of thorny branches and increasing the width of thornless branches. Overexpression lines, with fewer branches and higher lignification, can be used to cultivate breeding materials with strong stress resistance; suppressed expression lines, with well-developed new and lateral branches and fewer thorns, provide a germplasm basis for breeding high-yielding and easy-to-harvest black goji berry varieties.

[0122] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of the LrAHL15 gene in regulating the growth of black goji berries, characterized by, The CDS sequence of the LrAHL15 gene is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, Inhibiting the expression of the LrAHL15 gene suppresses the thorn production rate of thorny branches.

3. The application according to claim 1, characterized in that, Overexpression of the LrAHL15 gene inhibits root development and branching in black wolfberry.

4. The application according to claim 1, characterized in that, Overexpression of the LrAHL15 gene reduces the occurrence of new shoots and the number of leaves on thorny branches of black goji berries.

5. The application according to claim 1, characterized in that, Overexpression of the LrAHL15 gene resulted in the absence of small lateral branches in black wolfberry.

6. The application according to claim 1, characterized in that, Overexpression of the LrAHL15 gene enhances the lignification of thorny branches of black goji berries.

7. The application according to claim 1, characterized in that, Overexpression of the LrAHL15 gene increases the width of thornless branches of black goji berries.

8. The application according to claim 1, characterized in that, Inhibiting the expression of the LrAHL15 gene increases the occurrence of new shoots and small lateral branches in black wolfberry.

9. The application according to claim 1, characterized in that, Inhibiting the expression of the LrAHL15 gene increases the number of leaves on thorny branches of black goji berries and increases the width of thornless branches of black goji berries.

10. The application according to claim 1, characterized in that, Inhibiting the expression of the LrAHL15 gene reduces the lignification degree of thorny branches of black goji berries.

Images