Rice immune receptor os tni gene and its application in rice resistance to rice blast
By knocking out or overexpressing the OsTN1 gene, the problem of rice varieties easily losing their resistance to rice blast fungus was solved, providing genetic resources and breeding improvement programs, and enhancing the disease resistance of rice.
Patent Information
- Application Number
- CN202611543424.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-10-08
- Publication Date
- 2026-11-03
AI Technical Summary
Existing rice varieties are prone to losing resistance to rice blast pathogens, making it difficult to meet actual production needs, and there is a lack of effective genetic resources and breeding improvement programs.
By studying the function of the OsTN1 gene, we can use genetic engineering techniques to knock out or overexpress the OsTN1 gene in rice, thereby enhancing the rice's resistance to rice blast fungus and providing the OsTN1 gene as a gene resource for rice blast resistance, which can then be used to breed rice varieties resistant to rice blast.
Knockout or overexpression of the OsTN1 gene significantly affects rice resistance to rice blast fungus. Knockout reduces resistance, while overexpression increases resistance. This provides genetic resources and technical ideas for breeding rice blast resistance and enhances the disease resistance of rice.
Smart Images
Figure CN123027280A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the rice OsTN1 gene and its application in rice blast resistance. Background Technology
[0002] Rice blast, caused by Magnaphaltheoryzae, is a widespread rice disease that poses a significant threat to food security. Current main strategies for controlling this disease include chemical control and the development of resistant varieties. Selecting suitable resistant rice varieties based on local conditions is one of the effective measures for controlling rice blast. Continuously screening and cultivating highly resistant rice varieties can effectively reduce the incidence and severity of rice blast. However, due to the genetic diversity developed by Magnaphaltheoryzae during evolution, resistant varieties lose their resistance after 3-5 years of promotion, and the currently bred resistant varieties are far from meeting actual production needs. Therefore, in-depth analysis of the mechanisms of action of rice resistance genes and the discovery of potential resistance genes for the creation of new resistant varieties are important scientific issues that urgently need to be addressed in actual rice production.
[0003] In the long-term interaction and co-evolution between plants and pathogenic microorganisms, plants have gradually evolved two hierarchical immune defense systems to cope with the threat of pathogen infection. The first layer of immunity is the pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), which is activated by pattern recognition receptors (PRRs) located on the cell membrane after recognizing PAMPs. Under the pressure of plant-pathogen co-evolution, pathogens have evolved various strategies to evade host recognition, such as secreting effectors into plant cells to interfere with the host's normal physiological and biochemical processes, suppress plant defense pathways, and thus facilitate their own infection and proliferation. Correspondingly, plants have evolved intracellular immune receptors to recognize pathogen effector proteins, thereby activating effector-triggered immunity (ETI), which constitutes the second layer of immune defense for plants. ETI immunity typically involves a strong immune response and high disease specificity, often accompanied by hypersensitivity reactions and cell necrosis. Elucidating its mechanism can provide a theoretical basis and practical ideas for improving the utilization efficiency of disease-resistant germplasm.
[0004] The vast majority of intracellular immune receptors are nucleotide-binding leucine-rich repeat receptors (NLRs). A classic NLR contains a variable N-terminal domain, a conserved central nucleotide-binding domain (NB-ARC), and a C-terminal leucine-rich repeat sequence (LRR). Based on the different N-terminal domains, NLRs can be divided into: NLRs containing an N-terminal interleukin-1 receptor (TIR) domain (TIR-NLR, TNL) and NLRs containing an N-terminal coil-coil (CC) domain (CC-NLR, CNL). After recognizing pathogen effectors, NLR receptors typically undergo conformational changes and assemble into oligomers, initiating corresponding immune signaling through their different types of N-terminal domains: CNL receptors, upon activation, assemble into pentamers, and conformational changes lead to the insertion of their CC domains into the plasma membrane, forming calcium channels that induce extracellular calcium absorption. 2+ Rapid influx of NDL receptors initiates a series of downstream immune responses; unlike CNL, TNL receptors assemble into tetramers upon activation, with their TIR domains undergoing oligomerization to acquire fully catalytically active NADases, enabling efficient cleavage of NAD+. + Various nucleotide derivatives with signaling functions are generated, thereby activating the immune signaling network dependent on downstream EDS1 components. Current research shows that different TIR enzymatic products can activate two relatively independent EDS1 signaling branches: pRib-AMP and pRib-ADP mainly bind to and activate the EDS1-PAD4-ADR1 complex, while ADPr-ATP and di-ADPR preferentially activate the EDS1-SAG101-NRG1 complex, ultimately mediating different types of disease-fighting immune responses.
[0005] Most cloned rice blast resistance genes encode CNL, and the complete rice genome does not contain a gene encoding the full-length TNL. One gene, OsTIR, which encodes only the TIR domain, has been reported to play an important role in rice immunity. OsTN1, a rice gene encoding a protein containing both TIR and NB-ARC domains, shows that knocking out OsTN1 reduces rice blast resistance, while overexpression of OsTN1 significantly enhances resistance. This indicates that OsTN1 regulates rice blast resistance and reflects its important role in the disease resistance process. Summary of the Invention
[0006] To address the aforementioned problems, this invention provides an atypical NLR gene, OsTN1, containing a TIR-NB-ARC domain, and its application in controlling rice blast disease. The OsTN1 gene, when deleted in rice, significantly increases the infection rate of rice blast fungus and reduces rice's resistance to the fungus. Conversely, transgenic plants overexpressing this gene exhibit significant resistance to rice blast fungus. Through genetic engineering, the OsTN1 gene, associated with rice resistance, was screened out for use in the breeding of rice blast-resistant varieties. This provides genetic resources and technical insights for rice blast resistance breeding and improvement, and offers a solution for cultivating blast-resistant materials.
[0007] This invention discovered that OsTN1 gene knockout mutations result in rice exhibiting a susceptible phenotype. Conversely, transgenic rice with OsTN1 gene overexpression shows significant resistance to rice blast fungus. This leads to the completion of this invention.
[0008] The present invention first provides an atypical NLR receptor OsTN1 gene for rice resistance to rice blast fungus, the amino acid sequence of which is shown in SEQ ID NO:3.
[0009] Furthermore, the OsTN1 gene has the nucleotide sequence shown in SEQ ID NO:1, or its cDNA nucleotide sequence shown in SEQ ID NO:2.
[0010] The present invention further provides the protein encoded by the atypical NLR receptor OsTN1 gene of rice blast fungus, the amino acid sequence of which is shown in SEQ ID NO:3.
[0011] Meanwhile, the present invention also provides a method for improving the resistance of rice to rice blast fungus, which involves overexpressing the atypical NLR receptor OsTN1 gene for rice resistance to rice blast fungus in rice. The atypical NLR receptor OsTN1 gene for rice resistance to rice blast fungus is a gene encoding a protein with the amino acid sequence shown in SEQ ID NO:3.
[0012] Specifically, the overexpression method is as follows: the OsTN1 gene is cloned and a plant expression vector is constructed, the plant expression vector is transformed into Agrobacterium, and then rice is inoculated. Overexpression lines or their progeny with rice blast resistance are selected.
[0013] Preferably, the cDNA nucleotide sequence of the OsTN1 gene is shown in SEQ ID NO:2.
[0014] More specifically, the plant expression vector is pXQ, and the Agrobacterium is EHA105.
[0015] Meanwhile, the present invention also provides the application of the atypical NLR receptor OsTN1 gene for rice resistance to rice blast fungus, or the protein encoded by the OsTN1 gene, in the breeding of rice varieties with enhanced resistance to rice blast fungus; by overexpressing the OsTN1 gene or increasing the expression level of the OsTN1 protein.
[0016] The present invention also provides the application of the atypical NLR receptor OsTN1 gene for rice resistance to rice blast fungus in identifying rice varieties or plants with enhanced resistance to rice blast fungus, wherein the rice varieties or plants with enhanced resistance to rice blast fungus are obtained by the above method.
[0017] This invention relates to the application of OsTN1, an atypical nucleotide-binding leucine-rich repeat receptor (NLR) containing a Toll / interleukin-1 receptor (TIR) and an NB-ARC domain, in the control of rice blast disease. The OsTN1 gene provided by this invention significantly increases the infection rate of rice blast fungus and reduces the resistance of rice to the fungus when deleted in rice, while transgenic plants overexpressing this gene exhibit significant resistance to rice blast. Therefore, it can be used for the breeding of rice varieties resistant to rice blast, providing genetic resources and technical ideas for the breeding and improvement of rice varieties resistant to rice blast. This invention is beneficial for the breeding of disease-resistant rice varieties and provides a basis for the later screening of highly resistant rice varieties. For example, this invention can provide rice varieties overexpressing the atypical NLR receptor OsTN1 gene, and through hybridization, obtain transgenic rice materials with higher resistance. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly introduced below.
[0019] Figure 1 This study aims to detect the disease resistance of rice with the atypical NLR receptor OsTN1 gene knockout. In this study, A represents the construction of the target sequence for the OsTN1 gene knockout mutant obtained using CRISPR / Cas9 technology and the sequencing results of the knockout gene; B represents the results of the Punch inoculation assay on the resistance and susceptibility of OsTN1 gene knockout rice to *Strombus haemolyticus* under the ZH11 (ZH11) background, along with the statistical results of the size of lesions on leaves and the percentage of leaf area affected by *Strombus haemolyticus*; C represents the results of the spray inoculation assay on the resistance and susceptibility of OsTN1 gene knockout rice to *Strombus haemolyticus* under the ZH11 background, along with the statistical results of the biomass of *Strombus haemolyticus* on leaves and the percentage of leaf area affected by *Strombus haemolyticus*.
[0020] Figure 2This study aims to detect the disease resistance of rice plants overexpressing the atypical NLR receptor OsTN1 gene. In the table, A represents Western spectroscopy verification of OsTN1 protein overexpression in Nipponbare (NIP) rice; B represents Western spectroscopy verification of OsTN1 protein overexpression in ZH11 rice; C represents the results of the Punch inoculation method on the resistance and susceptibility of OsTN1 gene overexpression rice to rice blast fungus in the NIP background, along with the statistical results of leaf lesion size and the percentage of leaf area affected by rice blast fungus; D represents the results of the Punch inoculation method on the resistance and susceptibility of OsTN1 gene overexpression rice to rice blast fungus in the ZH11 background, along with the statistical results of leaf lesion size and the percentage of leaf area affected by rice blast fungus. Detailed Implementation
[0021] The present invention will be described below through specific embodiments to provide a better understanding of the invention, but these embodiments do not constitute a limitation thereof.
[0022] Example 1: Obtaining the knockout mutant tn1 rice
[0023] In this invention, the gDNA nucleotide sequence of the OsTN1 gene is shown in SEQ ID No. 1 (OsZH11G0821146900.01(LOC_Os08g38970)), specifically as follows:
[0024] In this invention, the CDS nucleotide sequence of the OsTN1 gene is shown in SEQ ID No. 2, and is as follows:
[0025] In this invention, the amino acid sequence of the protein encoded by the OsTN1 gene is shown in SEQ ID No. 3, as follows: 。
[0026] The transgenic rice obtained in this invention comes from Baige Biotechnology (germplasm number: BG101270H05), and the specific construction steps are as follows:
[0027] (1) Design of gRNA target sequence: GTGAAGGACACCCGCGGCACGGG (SEQ ID No. 4);
[0028] (2) Prepare Oligo dimer and construct it into a CRISPR / Cas vector, transform it into E. coli and extract plasmid according to standard procedures;
[0029] (3) The plasmid obtained in step (2) is transformed by Agrobacterium to obtain Agrobacterium with CRISPR / Cas vector plasmid carrying OsTN1;
[0030] (4) The transformant bacteria obtained in step (3) are used to transform the ZH11 rice strain, and gene identification is performed to obtain knockout transgenic rice (e.g., rice). Figure 1 (As shown in A).
[0031] The gene identification was further confirmed by PCR to determine whether the T0 generation rice was a homozygous mutant line.
[0032] Example 2: Obtaining rice with overexpression of the atypical NLR receptor OsTN1 gene
[0033] This invention utilizes homologous recombination to construct the coding region of the target gene OsTN1 into a pXQ vector. During primer design, homologous arms near the SmaI restriction site in the pXQ vector are first added to the upstream and downstream primers for OsTN1 (pXQ-OsTN1F: taggtagaagaggtacccgggATGGAGGAAGAGAAGGAGGCTG (SEQ ID No. 5), pXQ-OsTN1R: atccttgtaatccatcccgggAATCTTACTCCTGTATCTGACCAGCTT (SEQ ID No. 6) to amplify the OsTN1 gene. Then, the target gene and the linearized pXQ vector digested with SmaI are ligated using homologous recombination enzyme to construct the pXQ-OsTN1 vector. Because the vector contains a built-in flag tag, it can be used for later validation. The pXQ-OsTN1 vector is transformed into Agrobacterium EHA105 via chemical transformation, and positive single colonies are selected to prepare OD. 600Rice callus was infected with a 0.2% bacterial solution for 15 minutes, then cultured at 20°C for 48-72 hours. Single-clone callus tissue was then selected and cultured on a selection medium at 26°C in the dark. After 25 days, positive single-clone callus tissue was selected and subcultured at 26°C in the dark. After 7-10 days of culture, the positive callus tissue was inoculated onto a differentiation medium and cultured at 27°C under light for 15 days. Then, 3-5cm differentiated shoots were inoculated onto a rooting medium and cultured at 30°C under light for 7 days. When the seedlings reached about 8cm in length, plants with well-developed root systems and normal growth were selected and cultured indoors for 7 days before being transferred to the field for propagation. After two propagation cycles, plants overexpressing the OsTN1 gene under ZH11 and NIP backgrounds were obtained. Two overexpression lines were selected from the obtained transgenic plants, and Western spectroscopy was used to detect the overexpression of this gene in rice (e.g., ...). Figure 2 As shown in Figures A and B), this demonstrates that the obtained transgenic plants can be used for subsequent experiments.
[0034] Example 3: Identification of rice blast resistance phenotype in OsTN1 knockout rice
[0035] The transgenic rice obtained in Example 1 was subjected to blast disease resistance phenotype identification, including spray inoculation and Punch inoculation. The specific steps of the spray inoculation method are as follows:
[0036] (1) Inoculate rice blast fungus Guy11 by spraying during the 12-14 day seedling stage of rice. That is, spray about 5 μL of the prepared spore suspension evenly onto the tender leaves of rice using a misting sprayer. Inoculate more than 30 seedlings for each line and attach a label indicating the spraying date and sample number.
[0037] (2) After inoculation in step (1), the rice is placed in a dark box for about 24 hours of dark and sealed moisturizing treatment. After taking it out, it is placed in a transparent box with alternating light and dark for 12 hours and sealed and moisturized daily.
[0038] (3) Investigate the area of diseased lesions on each leaf on the 5th day after inoculation of rice seedlings in step (1).
[0039] The phenotypic identification was performed using ImaginJ to evaluate the infection phenotype.
[0040] The Punch inoculation method, the specific steps are as follows:
[0041] (1) Inoculate rice plants with live Punch method at 20-30 days old, that is, inoculate the young leaves of rice with a culture medium block containing Guy11 spores and fix it with tape to facilitate infection. Inoculate more than 10 seedlings for each line and attach a label indicating the spraying date and sample number.
[0042] (2) After inoculation in step (1), the rice is placed in a dark box for about 24 hours of dark and sealed moisturizing treatment. After taking it out, it is placed in a transparent box with alternating light and dark for 12 hours and sealed and moisturized daily.
[0043] (3) Investigate the area of diseased lesions on each leaf on the 7th day after inoculation of rice seedlings in step (1).
[0044] The phenotypic identification was performed using Imagin J to evaluate the infection phenotype.
[0045] Identification revealed that under high temperature and humidity conditions (28℃), the severity of leaf disease in ostn1-ko was significantly higher than that in the wild type ZH11 (e.g., ...). Figure 1 China B and Figure 1 (As shown in C).
[0046] Example 4: Identification of rice blast resistance phenotype in OsTN1 overexpressing rice
[0047] The transgenic rice obtained in Example 2 was subjected to blast disease resistance phenotype identification, and the specific steps are as follows:
[0048] (1) Inoculate rice plants with live Punch method at 20-30 days old, that is, inoculate the young leaves of rice with a culture medium block containing Guy11 spores and fix it with tape to facilitate infection. Inoculate more than 10 seedlings for each line and attach a label indicating the spraying date and sample number.
[0049] (2) After inoculation in step (1), the rice is placed in a dark box for about 24 hours of dark and sealed moisturizing treatment. After taking it out, it is placed in a transparent box with alternating light and dark for 12 hours and sealed and moisturized daily.
[0050] (3) Investigate the area of diseased lesions on each leaf on the 7th day after inoculation of rice seedlings in step (1).
[0051] The phenotypic identification was performed using Imagin J to evaluate the infection phenotype.
[0052] Identification showed that under high temperature and humidity conditions of 28℃, the severity of leaf disease in OE-OsTN1 was significantly lower than that in wild-type ZH11 and NIP (e.g., Figure 2 (As shown in C and D).
Claims
1. A method for improving the resistance of rice to rice blast fungus, characterized in that, Overexpression of the atypical NLR receptor OsTN1 gene, which is resistant to rice blast fungus, in rice was carried out to obtain rice with enhanced resistance to rice blast fungus. The amino acid sequence encoded by the OsTN1 gene is shown in SEQ ID NO:
3.
2. The method according to claim 1, characterized in that, The nucleotide sequence of the OsTN1 gene is shown in SEQ ID NO:1, or the cDNA nucleotide sequence of the OsTN1 gene is shown in SEQ ID NO:
2.
3. The method according to claim 1 or 2, characterized in that, The overexpression method is as follows: the OsTN1 gene is cloned and a plant expression vector is constructed. The plant expression vector is then transformed into Agrobacterium and rice is inoculated. Overexpression lines or their progeny with rice blast resistance are selected.
4. The method according to claim 3, characterized in that, The plant expression vector is pXQ.
5. The method according to claim 3, characterized in that, The Agrobacterium was EHA105.
6. The application of an atypical NLR receptor OsTN1 gene for rice resistance to rice blast fungus, or the protein encoded therein, in the breeding of rice varieties with enhanced resistance to rice blast fungus; By overexpressing the OsTN1 gene or increasing the expression level of the protein encoded by the OsTN1 gene, the amino acid sequence encoded by the OsTN1 gene is shown in SEQ ID NO:
3.
7. The application according to claim 6, characterized in that, The nucleotide sequence of the OsTN1 gene is shown in SEQ ID NO:1, or the cDNA nucleotide sequence of the OsTN1 gene is shown in SEQ ID NO:
2.
8. Application of an atypical NLR receptor OsTN1 gene for rice resistance to rice blast fungus in identifying rice varieties or plants with enhanced resistance to rice blast fungus; By overexpressing the OsTN1 gene or increasing the expression level of the protein encoded by the OsTN1 gene, the amino acid sequence encoded by the OsTN1 gene is shown in SEQ ID NO:
3.
9. The application according to claim 8, characterized in that, The nucleotide sequence of the OsTN1 gene is shown in SEQ ID NO:1, or the cDNA nucleotide sequence of the OsTN1 gene is shown in SEQ ID NO:
2.
10. The application according to claim 9, characterized in that, The rice variety or plant with enhanced resistance to rice blast fungus is obtained by the method according to any one of claims 1 to 5.