KASP molecular markers related to stem diameter, main stem node number and hundred seed weight of soybean and their application

Abstract

The application provides a KASP molecular marker related to stem thickness per 100 grains, node number of main stem and 100-grain weight of soybean and application thereof, a nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and an A / G base mutation exists at 54054705 bp of the sequence shown in SEQ ID NO. 1. The KASP molecular marker can be used for sensitive, efficient and low-cost identification and prediction of high and low of stem thickness per 100 grains, node number of main stem and 100-grain weight of soybean, and through assisted soybean molecular breeding, breeding time is shortened, soybean production cost is reduced, and finally soybean yield is improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a KASP molecular marker related to soybean stem diameter, number of main stem nodes and 100-grain weight and its application. Background Technology

[0002] Soybean (Glycine max (L.) Merr.) is an important dual-purpose crop for grain and oil, as well as a source of plant protein in my country, playing a vital role in ensuring food security, feed supply, and the development of the plant protein industry. With the continuous improvement of high and stable soybean yields and mechanized production levels, breeding new soybean varieties with excellent plant type, strong stem support capacity, and high yield potential has become an important goal of soybean genetic breeding.

[0003] Soybean stem diameter is one of the important agronomic traits reflecting the development of the plant stem and its plant type. Suitable stem diameter is usually closely related to traits such as the mechanical support capacity of the stem, lodging resistance, and field community structure. The number of nodes on the main stem is an important agronomic trait constituting soybean plant type and yield, and is closely related to plant growth and development, branching, and pod formation. 100-seed weight is an important indicator for evaluating soybean seed size and yield composition, and is also one of the main agronomic traits commonly used in soybean breeding and variety evaluation. Therefore, rapid and accurate genetic identification of important agronomic traits such as soybean stem diameter, number of nodes on the main stem, and 100-seed weight is of great significance for screening superior soybean germplasm resources and molecular-assisted breeding.

[0004] Currently, the identification of agronomic traits in soybeans, such as stem diameter, number of main stem nodes, and 100-seed weight, mainly relies on field planting and phenotypic surveys. For example, different soybean materials are evaluated by measuring plant stem diameter, counting the number of main stem nodes, and determining the 100-seed weight after harvest. However, these traits are all quantitative traits, and their phenotypic expression is usually influenced by both genetic and environmental factors, and there can be significant differences between different ecological environments, cultivation conditions, and years. Therefore, relying solely on field phenotypic identification is not only time-consuming, labor-intensive, and costly, but also easily affected by environmental conditions, making it difficult to quickly and accurately screen superior materials with target traits in large-scale breeding populations.

[0005] With the development of molecular biology and modern genetic breeding techniques, identifying genetic loci controlling or influencing important agronomic traits using molecular markers and further applying them to marker-assisted selection has become an important technical means to improve breeding efficiency. Compared with traditional phenotypic selection, marker-assisted selection can identify target genotypes at earlier generations or even seedling stages, reducing the influence of environmental factors on selection results to a certain extent, thereby improving the efficiency of screening and aggregation of superior genotypes. Kompetitive allele-specific PCR (KASP) is a genotyping technique based on allele-specific primers, characterized by accurate detection, high throughput, relatively simple operation, low cost, and suitability for large-scale sample genotyping. In recent years, KASP technology has been widely used in the development of molecular markers for genetic loci related to important agronomic traits in crops and for molecular-assisted selection. However, for important agronomic traits such as stem diameter, number of main stem nodes, and 100-seed weight in soybeans, there is still a need to develop stable, specific, and practically applicable KASP molecular markers to meet the needs of soybean germplasm resource identification and molecular-assisted breeding.

[0006] In existing technologies, some molecular markers related to soybean agronomic traits are mainly used for genetic mapping or association analysis, and their marker types, detection methods, and ease of practical breeding applications vary. In particular, for candidate variants obtained through genetic analysis related to soybean stem diameter, main stem node number, and 100-seed weight, how to convert them into KASP molecular markers that are easy to operate, stable in detection, and suitable for large-scale material screening, and further use them for rapid identification of genotypes related to target traits, remains a problem to be solved in soybean molecular-assisted breeding.

[0007] Therefore, it is necessary to develop a KASP molecular marker associated with soybean stem diameter, number of main stem nodes, and 100-grain weight, and to establish corresponding genotyping and application methods to achieve rapid and accurate identification of related genotypes in soybean materials, providing an efficient molecular technique for screening superior soybean germplasm resources, assisted selection of target traits, and breeding of new varieties. Summary of the Invention

[0008] In view of this, the purpose of this invention is to provide a KASP molecular marker related to soybean stem diameter, main stem node number and 100-grain weight and its application.

[0009] The specific technical solution of the present invention is as follows:

[0010] In a first aspect, the present invention provides a molecular marker related to soybean stem diameter, number of main stem nodes and 100-grain weight, the nucleotide sequence of which is shown in SEQ ID NO.1, and an A / G base mutation exists at position 54054705bp in the sequence shown in SEQ ID NO.1.

[0011] Secondly, the present invention provides a primer set for detecting the molecular marker, the primer set comprising:

[0012] The A / G site at 54054705 bp of the sequence shown in SEQ ID NO.1 was detected, which includes: upstream primer F1', upstream primer F2', and universal downstream primer R2. The nucleotide sequence of upstream primer F1' is 5'TTCGAAACCCTAGCCATGGATAA3', the nucleotide sequence of upstream primer F2' is 5'TTCGAAACCCTAGCCATGGATAG3', and the nucleotide sequence of universal downstream primer R2 is 5'CTCTTTTCCGTTCTGGAACGTGT3'.

[0013] Furthermore, the 5' ends of the upstream primers F1' and F2' are respectively connected to tags used to distinguish the base types of their corresponding molecular marker sites.

[0014] Furthermore, adapter sequences are connected between the upstream primer F1', the upstream primer F2', and their respective tags;

[0015] Preferably, the linker sequence between the 5' end of the upstream primer F1' and the tag is gaaggtgaccaagttcatgct;

[0016] The linker sequence between the 5' end of the upstream primer F2' and the tag is gaaggtcggagtcaacggatt;

[0017] Furthermore, the tag is a fluorescein;

[0018] Preferably, the fluorescein linked to the upstream primer F1' is 6-carboxyfluorescein;

[0019] The fluorescein linked to the upstream primer F2' is hexachloro-6-methylfluorescein.

[0020] Thirdly, the present invention provides a detection kit comprising the aforementioned primer set.

[0021] Fourthly, the present invention also provides the application of a molecular marker, a primer set for detecting the molecular marker, or a detection kit in any of the following:

[0022] (1) Identification, selection and improvement of soybean stem diameter, number of nodes in the main stem and weight per 100 seeds;

[0023] (2) Early prediction of traits such as stem diameter, number of nodes on the main stem, and weight per 100 seeds in soybeans;

[0024] (3) Marker-assisted breeding of soybeans;

[0025] (4) Screening or breeding high-yield soybeans.

[0026] Fifthly, the present invention also provides a method for identifying traits such as soybean stem diameter, number of main stem nodes, and 100-seed weight, comprising the following steps:

[0027] Using the genomic DNA of the soybean sample to be tested as a template, the template is amplified by real-time PCR using the primer set of any one of claims 3-5 or the detection kit of claim 6. The fluorescence signal is read and analyzed to identify the genotype of the molecular marker. The stem diameter, number of main stem nodes and weight of 100 seeds of soybean are determined based on the genotype.

[0028] When the base at Chr18_54054705bp is A, the soybean is judged to have high stem diameter, high number of main stem nodes, and high 100-seed weight; when the base at Chr18_54054705bp is G, the soybean is judged to have low stem diameter, low number of main stem nodes, and low 100-seed weight.

[0029] The Chr18_54054705bp site is located at 54054705bp on chromosome 18 of the soybean genome, and the whole genome sequence version of the soybean genome is Wm82.a2.v1.

[0030] Furthermore, the real-time PCR reaction system for labeling the Chr18_54054705bp site in this invention is as follows: 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers, wherein F3:F4:R2=2:2:5 (V / V / V); 2 μL of soybean sample DNA template at 50 ng / μL; and sterile water added to a total volume of 10 μL.

[0031] Furthermore, the fluorescence quantitative PCR reaction conditions for labeling the Chr18_54054705bp site in this invention are as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃~55℃ for 40 s, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 95℃ for 20 s, annealing at 55℃ for 45 s, for 26 cycles; fluorescence acquisition at 35℃ for 1 min. Beneficial effects

[0032] This invention is the first to reveal a KASP marker (Chr18_54054705bp) located on soybean chromosome 18 associated with stem diameter, number of main stem nodes, and 100-seed weight traits. This invention confirms that the marker Chr18_54054705bp can be used independently for screening for soybean stem diameter, number of main stem nodes, and 100-seed weight traits, and that its A allele variant is a superior allele that enhances stem diameter, number of main stem nodes, and 100-seed weight. Attached Figure Description

[0033] Figure 1 This is a genome-wide association analysis (GWAS) result diagram of stem diameter, number of main stem nodes, and 100-seed weight traits in a natural soybean population in 2024, based on the present invention.

[0034] Figure 2 This is a graph showing the results of genome-wide association analysis of stem diameter, number of main stem nodes, and 100-seed weight traits in a natural soybean population in 2025 according to this invention.

[0035] Figure 3 This is the molecular marker typing diagram of the present invention. Detailed Implementation

[0036] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0037] This invention utilizes genome-wide association analysis (GWAS) to discover major loci associated with soybean stem diameter, main stem node number, and 100-seed weight in high throughput, and develops molecular markers based on significantly associated SNPs for early selection of soybean stem diameter, main stem node number, and 100-seed weight to screen for high-quality and high-yielding soybean germplasm. This has a significant effect on reducing the workload of soybean breeding and accelerating the progress of soybean breeding, and provides a reference for soybean yield increase research and the breeding of high-yielding new varieties.

[0038] The development and application of the above-mentioned molecular markers are further illustrated below with specific examples.

[0039] Example 1: Identification of SNP loci significantly associated with soybean stem diameter, number of main stem nodes, and 100-seed weight.

[0040] (1) Experimental materials and genotype data

[0041] The 274 natural resource populations of this invention were obtained from the National Crop Germplasm Bank (Shanxi) Mid-term Collection, and 30× depth sequencing was performed on each genotype of the 274 natural resource populations.

[0042] (2) Phenotypic statistics

[0043] In 2024 and 2025, 274 seed resources were planted at the Dongyang Demonstration Base of Shanxi Agricultural University. Each resource was planted in 4 rows with a row spacing of 45cm and a plant spacing of 15cm. Water, fertilizer, and pest and disease control were managed uniformly for all materials in the field. After the materials reached maturity, the edge row plants were removed from each material, and 10 plants with consistent growth in the middle two rows were selected. The number of plants and grain weight of each individual plant were counted. Finally, the stem diameter, number of nodes on the main stem, and weight per 100 grains were counted.

[0044] (3) Genome-wide association analysis

[0045] This invention performed a genome-wide association study (GWAS) on stem diameter, main stem node number, and 100-seed weight phenotypic data from 274 soybean resequencing materials. Two-year association analysis results showed that a significant region was co-located on chromosome 18. Figure 1 and Figure 2 The specific physical location of the SNP (referencing soybean genome Wm82.a2.v1) is: located at 54054705 bp on chromosome 18, where a substitution of base A to G occurs. The nucleotide sequence of the SNP is shown in SEQ ID NO.1.

[0046] SEQ ID NO.1: TGGAACAAGGAAAGTCGTTGAAATTAAAGAACCGGCAGCTGAAGCTGTACACCAACAGCTGTCACACCAGTTGGGGCGGATACAGAAAATCCAAGTGGAGCCATGTTGTCTTCGAGCACCCTGCGAGGTTCGAAACCCTAGCCATGGATA[A / G]AAAAGCTA AAGAAGAGATTATAGACGATCTTGACACGTTCCAGAACGGAAAAGAGTATTATAAAAAGATTGGAAAAGCTTGGAAGCGTGGTTATTTGCTGTATGGCCCTCCGGGTACTGGGAAATCTACCATGATAGCTGCTATGGCGAA (No. 151 bp of the sequence is a SNP site, and there is an A / G mutation).

[0047] (4) Genotype and haplotype analysis

[0048] Analysis of the Chr18_54054705bp locus in an association study of 274 soybean accessions (Table 1) showed the following: For the 167 soybean accessions with the Chr18_54054705bp genotype A, the average stem diameter, number of main stem nodes, and 100-seed weight in 2024 were 8.81 cm, 19.84, and 17.97 g, respectively; and in 2025, the average stem diameter, number of main stem nodes, and 100-seed weight were 7.57 cm, 20.33, and 18.53 g, respectively. For the 107 soybean accessions with the Chr18_54054705bp genotype G, the average stem diameter, number of main stem nodes, and 100-seed weight in 2024 were 7.78 cm, 18.18, and 16.62 g, respectively; and in 2025, the average stem diameter, number of main stem nodes, and 100-seed weight were 7.16 cm, 18.91, and 17.01 g, respectively.

[0049] Table 1. Phenotypic Contribution Analysis of Chr18_54054705bp

[0050] Example 2 Development of molecular marker-specific primers

[0051] A set of KASP molecular marker primers was designed targeting the SNP mutation site of Chr18_54054705bp and the sequence of SEQ ID NO.1. These primers consist of upstream primer F1, upstream primer F2, and a universal downstream primer R2. Upstream primer F1 has a FAM fluorescent tag and adapter sequence (lowercase letters) attached to its 5' end. Upstream primer F2 has a HEX fluorescent tag and adapter sequence (lowercase letters) attached to its 5' end, followed by a binding sequence (uppercase letters). The 3' end contains the allelic variant gene. Downstream primer R2 is a universal reverse binding sequence. The primer sequences are as follows:

[0052] Upstream primer F3: 5'-gaaggtgaccaagttcatgctTTCGAAACCCTAGCCATGGATAA-3' (SEQ IDNO.2);

[0053] Upstream primer F4: 5'-gaaggtcggagtcaacggattTTCGAAACCCTAGCCATGGATAG-3' (SEQ IDNO.3);

[0054] Downstream primer R2: CCTTTTCCGTTCTGGAACGTGT (SEQ ID NO.4).

[0055] Example 3: Genotyping of SNP loci in different soybean varieties using molecular markers and its application in the selection of soybean varieties based on stem diameter, number of main stem nodes, and 100-seed weight.

[0056] Ninety soybean samples were randomly selected, and genomic DNA was extracted from each sample. Using the genomic DNA as a template, PCR amplification was performed using molecular marker-specific primers to obtain the PCR amplification products.

[0057] The reaction system for Chr18_54054705bp was as follows: 5 μL of 2×KASP Master mix; 0.14 μL of KASP mixed primers, in which F3:F4:R2=2:2:5 (V / V / V); 2 μL of soybean sample DNA template at 50 ng / μL; and sterile water was added to bring the total volume to 10 μL.

[0058] The fluorescence quantitative PCR reaction conditions were as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing at 61℃~55℃ for 40 s, decreasing by 0.6℃ for each cycle, for 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 45 s, for 26 cycles; fluorescence acquisition at 35℃ for 1 min.

[0059] PCR amplification is performed using an ABI QuantStudio3 real-time quantitative PCR instrument. The sample binds to specific FAM detection primers and releases a blue fluorescent group, while the sample binds to specific HEX detection primers and releases a red fluorescent group. After PCR, the instrument can perform genotyping based on the fluorescence signal (e.g., ...). Figure 3 ).

[0060] Based on the typing results, 13 varieties of type Hap1 (AA), 4 varieties of type Hap2 (GG), and 53 varieties of type Hap3 (AG) were obtained. The phenotypic values ​​of stem diameter, number of main stem nodes, and 100-seed weight over two years are shown in Table 2. The results show that the stem diameter, number of main stem nodes, and 100-seed weight of Hap1 soybean varieties / germplasm are generally higher than those of Hap2 varieties / germplasm. Using the molecular markers designed in Example 2, germplasm materials with different stem diameters, number of main stem nodes, and 100-seed weight can be quickly and efficiently distinguished from the population.

[0061] Table 2. Phenotypic and genotyping results of stem diameter, main stem node number, and 100-seed weight of 90 soybean varieties / germplasm.

[0062] .

Claims

1. A molecular marker associated with soybean stem diameter, main stem node number, and 100-seed weight, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and an A / G base mutation exists at position 54054705 bp in the sequence shown in SEQ ID NO.

1.

2. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes: The A / G site at 54054705 bp of the sequence shown in SEQ ID NO.1 was detected, which includes: upstream primer F1', upstream primer F2', and universal downstream primer R2. The nucleotide sequence of upstream primer F1' is 5'TTCGAAACCCTAGCCATGGATAA3', the nucleotide sequence of upstream primer F2' is 5'TTCGAAACCCTAGCCATGGATAG3', and the nucleotide sequence of universal downstream primer R2 is 5'CTCTTTTCCGTTCTGGAACGTGT3'.

3. The primer set according to claim 2, characterized in that, The 5' ends of the upstream primers F1' and F2' are respectively connected to tags used to distinguish the base types of their corresponding molecular marker sites.

4. The primer set according to claim 3, characterized in that, A connector sequence is connected between the upstream primer F1', the upstream primer F2' and their respective tags; Preferably, the linker sequence between the 5' end of the upstream primer F1' and the tag is gaaggtgaccaagttcatgct; The linker sequence between the 5' end of the upstream primer F2' and the tag is gaaggtcggagtcaacggatt.

5. The primer set according to claim 3 or 4, characterized in that, The label is a fluorescent agent; Preferably, the fluorescein linked to the upstream primer F1' is 6-carboxyfluorescein, and the fluorescein linked to the upstream primer F2' is hexachloro-6-methylfluorescein.

6. A test kit, characterized in that, The kit contains the primer set as described in any one of claims 3-5.

7. The use of the molecular marker as described in claim 1 or 2, the primer set as described in any one of claims 3-5, or the detection kit as described in claim 6 in any of the following: (1) Identification, selection and improvement of soybean stem diameter, number of nodes in the main stem and weight per 100 seeds; (2) Early prediction of traits such as stem diameter, number of nodes on the main stem, and weight per 100 seeds in soybeans; (3) Marker-assisted breeding of soybeans; (4) Screening or breeding high-yield soybeans.

8. A method for identifying traits such as soybean stem diameter, number of main stem nodes, and 100-seed weight, characterized in that, Includes the following steps: Using the genomic DNA of the soybean sample to be tested as a template, the template is amplified by real-time PCR using the primer set of any one of claims 3-5 or the detection kit of claim 6. The fluorescence signal is read and analyzed to identify the genotype of the molecular marker. The stem diameter, number of main stem nodes and weight of 100 seeds of soybean are determined based on the genotype. When the base at Chr18_54054705bp is A, the soybean is judged to have high stem diameter, high number of main stem nodes, and high 100-seed weight; when the base at Chr18_54054705bp is G, the soybean is judged to have low stem diameter, low number of main stem nodes, and low 100-seed weight. The Chr18_54054705bp site is located at 54054705bp on chromosome 18 of the soybean genome, and the whole genome sequence version of the soybean genome is Wm82.a2.v1.

Images