A micro-channel based gene chip rapid hybridization reaction device
By designing a gene chip device with an independently sealed U-shaped microchannel and a built-in temperature control module, the problems of complex microchannel design, low efficiency, and cross-contamination in existing technologies have been solved, achieving efficient and sensitive multiplex sample detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Utility models(China)
- Current Assignee / Owner
- BIOISLAND LAB
- Filing Date
- 2025-05-30
- Publication Date
- 2026-07-03
AI Technical Summary
Existing microfluidic technology combined with gene chips has a complex device design, low hybridization efficiency within the flow channel, easy cross-contamination of samples, difficulty in controlling hybridization temperature, and inability to perform multiple sample, multi-gradient, and multiple-repetition detection.
Design a rapid hybridization device for gene chips based on microfluidic design, employing 4-8 independent sealed continuous U-shaped microchannels, equipped with a liquid drive module and a built-in temperature control module, combined with PDMS and a glass substrate, to achieve sample back-and-forth flow and precise temperature control within the microchannels.
It enables rapid detection with multiple gradients and repetitions, avoids cross-contamination, improves hybridization efficiency and sensitivity, can detect multiple different targets simultaneously, and reduces sample consumption.
Smart Images

Figure CN224450686U_ABST
Abstract
Description
Technical Field
[0001] This invention discloses a high-efficiency hybridization device for gene chips, belonging to the field of nucleic acid detection technology. Background Technology
[0002] DNA microarray chips, also known as gene chips, are biochemical analysis tools that use microarray technology to allow DNA probes fixed on the surface of a specific substrate to hybridize with sample targets, generating fluorescence and performing optical signal scanning analysis. Currently, various solid substrate materials can be used to prepare DNA microarray chips, such as glass, silicon wafers, polymer materials (polystyrene), gold, optical fibers, microbeads, and paper films. Based on the number of probes, gene chips can be divided into low-density chips (less than 1000 probes on a standard 25×75mm glass substrate) and high-density chips (several thousand to tens of thousands of probes). Gene chips are now widely used in various biological fields such as microbial detection, food safety analysis, disease diagnosis, drug screening, gene sequencing, and gene mutation expression.
[0003] Traditional gene chips rely on the free diffusion of DNA target molecules in solution to bind with probes at the interface during sample hybridization. This often results in several drawbacks: long hybridization time (>12 hours), low hybridization efficiency (some probes fail to effectively contact the target molecules during diffusion), high reagent consumption (requiring coverage of all probe sites on the chip), susceptibility to cross-contamination during sample hybridization, and relatively cumbersome chip cleaning. To improve hybridization efficiency, reduce sample consumption, and optimize the hybridization system, researchers have begun applying microfluidic technology to DNA microarray chip hybridization systems, focusing on developing integrated biogene chip hybridization systems that combine microfluidic chips with DNA microarrays to meet the needs of high-throughput, high-sensitivity, and portable clinical testing applications. Current existing devices based on the above primarily utilize a combination of specific polydimethylsiloxane (PDMS) microchannels and glass-based microarray chips for probe spotting. These are categorized into centrifugal microfluidic chips and U-shaped microfluidic chips. In this process, specific microchannels or microcavities on the PDMS module cover the spotted probe points. The PDMS module and glass substrate are then sealed using non-chemical bonding to create a sample-injectable microenvironment (Nucleic Acids Research, 2005, Vol. 33, No. 8 e78, doi:10.1093 / nar / gni078), thus enabling hybridization with probes using only a small amount of target sample. Simultaneously, gene chips in microfluidic mode can integrate automated sample handling, hybridization temperature control, and post-hybridization buffer cleaning into a single device, achieving a degree of integration.
[0004] Current methods combining microfluidic chip design with gene chips tend to employ single-channel or microgroove regions (L. Wang, PCH Li. Analytica Chimica Acta). 687 (2011) 12–27 The first approach involves completely covering the probe, failing to consider the isolation layout of the microchannels. This design cannot prevent cross-contamination between samples and multi-gradient, reproducible analysis on the same chip. Furthermore, the large-area microgrooves of the PDMS pose a challenge to sealing the space, easily causing the PDMS to collapse and come into contact with the probes, leading to probe damage. Another approach involves designing U-shaped microchannels of a certain width to cover the DNA spotting probes, further reducing the amount of target sample used and avoiding cross-contamination between adjacent probe columns (Nucleic Acids Research, 2005, Vol. 33, No. 8 e78, doi:10.1093 / nar / gni078). However, this initial microchannel DNA chip still can only complete the detection of a single sample at a time and only validates single-stranded DNA as a simulated target. The actual hybridization effect is unclear for double-stranded DNA in real samples. Additionally, the lack of a liquid path module results in inconsistent flow rates during sample injection within the microchannels and the generation of air bubbles, affecting hybridization performance. The lack of a temperature control module prevents the provision of precise hybridization temperatures, affecting hybridization efficiency; secondly, centrifugal microfluidic gene chips are also being continuously explored (L. Wang, PCH Li . Analytica Chimica Acta). 687 (2011) 12– 27 However, such chips are relatively complex to design and cannot perform round-trip driving of liquid samples, resulting in limited improvement in hybridization efficiency.
[0005] In view of the many shortcomings and defects in the design of existing microfluidic technology combined with microarray gene chips, the purpose of this utility model is to provide a microchannel hybridization device to solve the problems of complex microchannel design, low hybridization efficiency in the channel, easy cross-contamination of samples, and difficulty in achieving hybridization temperature control in existing devices. Utility Model Content
[0006] Based on the above objectives, this utility model first provides a gene chip rapid hybridization reaction device based on a microfluidic pattern. The device includes a microfluidic layer based on microfluidic technology, a DNA probe microarray chip layer corresponding to the microfluidic layer arranged in a dotted pattern, a built-in temperature control module for providing the hybridization temperature between the DNA probes and DNA in the sample, and a fixing device that fixes and seals the microfluidic layer, the DNA probe microarray chip layer, and the built-in temperature control module from top to bottom. The microfluidic layer has 4-8 independently sealed microchannels, each microchannel forming a continuous U-shaped flow (positive-negative-positive U-shaped). The microfluidic layer is equipped with a liquid flow driving module for driving the DNA solution to flow back and forth within the microchannels. After sealing, all probe array points in the DNA probe microarray chip layer are located within an independent microchannel. A sample application well is provided at the upper end of the fixing device for adding samples to each independent microchannel.
[0007] In a preferred embodiment, the width of the microchannel is 200-500 micrometers, which can be 200, 300, 400, or 500 micrometers, preferably 400 micrometers; the height is 100-300 micrometers, which can be 100, 200, or 300 micrometers, preferably 200 micrometers; the single linear length is 12-14 millimeters, which can be 12, 13, or 14 micrometers, preferably 13 micrometers; and the diameter of the microarray probe points is 80-120 micrometers, which can be 80, 90, 100, 110, or 120 micrometers, preferably 100 micrometers.
[0008] In a preferred embodiment, the microfluidic layer is made of polydimethylsiloxane or other flexible polymer material, the DNA probe microarray chip layer is made of glass, and the temperature control module is a thermosensitive heating element made of polyimide film, which has a maximum temperature resistance of 150°C.
[0009] In a preferred embodiment, the fixing device consists of an upper cover and a base. The base is used to support the built-in temperature-controlled heating element and the DNA probe microarray chip layer stacked thereon, and has blind screw holes on its edge. The upper cover is used to press the microchannel layer to fit the DNA probe microarray chip layer located below it, so that each microchannel is sealed. Screw through holes corresponding to the blind screw holes of the base are provided on the edge of the upper cover. During sealing, the upper and lower components of the gene chip rapid hybridization device based on the microchannel pattern are tightly fitted through the screws, screw through holes, and screw blind holes, and the microchannels are sealed.
[0010] In a preferred embodiment, the microchannel-based gene chip rapid hybridization device is further equipped with a sample loading module for loading or cleaning samples into the microchannels through each loading well.
[0011] In practical applications, the pretreatment method for detecting DNA content in samples using the microfluidic-based rapid hybridization device for gene chips of this invention includes the following steps:
[0012] (1) After sample collection, DNA is extracted from the sample and the concentration of the extracted nucleic acid is calibrated. Then, fluorescent staining is performed and the stained target sample is purified and recovered. Fluorescently labeled DNA target solution is added to each microchannel through the sample loading module via the loading well.
[0013] (2) Turn on the built-in temperature-controlled heating plate, set the hybridization reaction temperature and reaction time according to the designed probe Tm value, and drive the DNA target solution in the microchannel to flow back and forth at the set flow rate with the help of the liquid path drive module so that the fluorescently labeled DNA can hybridize with the DNA probe on the chip quickly and effectively.
[0014] (3) After hybridization, the cleaning fluid is driven to flow back and forth to clean the chip at a flow rate of 50 uL / min to 250 uL / min by the liquid drive module;
[0015] A more preferred flow rate is 200 μL / min.
[0016] More preferably, the cleaning solution is divided into two parts: Cleaning Solution I: 1 mL containing 20×SSC (10%) and 10% SDS (2%), 1 tube; and Cleaning Solution II: 1 mL containing 20×SSC (1%), 2 tubes. The two parts are cleaned three times at the set flow rate, each time for 10 minutes. (SSC is a sodium hydroxide and sodium citrate buffer solution, pH 7.0; SDS is a sodium dodecyl sulfate standard solution).
[0017] (4) Remove the thoroughly cleaned gene chip from the device and dry it with compressed nitrogen to keep the chip surface dry. Then place it in a chip scanner and scan it under excitation light conditions. Read the signal values of each array point for analysis. In a preferred embodiment, the fluorescent labeling group is Cy5, and a wavelength of 640 nm can be selected as the excitation light source.
[0018] In a preferred embodiment, the sample addition rate of the DNA target solution in step (1) and the flow rate of the DNA solution in the microchannel driven by the liquid path drive module in step (2) are 50 µL / min-200 µL / min, preferably 60-190, 70-180, 80-170, or 90-160. In a specific embodiment of this invention, the sample addition rate is 100 µL / min, and the concentration of the fluorescently labeled DNA solution is 5-250 pM.
[0019] In a preferred embodiment, the DNA probe is 33-100 bp in length. In a specific embodiment of this invention, the DNA probe is 33 bp in length.
[0020] In a preferred embodiment, the hybridization reaction temperature in step (2) is 42-55℃, preferably 43-54, 45-53, 47-52, or 49-51℃, and in a specific embodiment of this invention, it is 50℃. The reaction time is 5-50 minutes, preferably 6-40, 7-30, or 8-20 minutes, and in a specific embodiment of this invention, it is 10 minutes.
[0021] This invention designs and develops an integrated chip hybridization detection device that combines an isolated partitioned PDMS microfluidic chip with a low-density glass-based gene chip. It is sealed using a 3D metal module with an embedded heating element. A syringe pump drives the sample liquid to flow back and forth, contacting the DNA probes on the glass substrate. This reduces the diffusion distance of target molecules and increases the probability of contact and collision between the probes and target molecules, improving hybridization efficiency while reducing sample consumption and avoiding cross-contamination. Simultaneously, a heating element embedded in the metal sealing clamp module controls and monitors the hybridization temperature in real time. Under adjustable hybridization temperature conditions, it enables simultaneous and repeated detection of multiple samples and multiple gradients of the same sample, effectively detecting single-base mismatches.
[0022] Compared with the prior art, this utility model (1) can quickly realize multi-gradient, multiple repetition and rapid detection and analysis of various different targets on the same integrated chip; (2) can monitor the hybridization temperature in real time with the help of the temperature control feedback of the heating plate, and refine the hybridization conditions; (3) can achieve the automation of gene chip hybridization and cleaning by precise control of flow rate; (4) the design of the partitioned U-shaped channel with specific width and height can improve the rapid binding and reaction of the target and probe, and also avoid cross-contamination between adjacent probes. Attached Figure Description
[0023] Figure 1 Design of microchannel and microarray dot arrangement layout on PDMS chip;
[0024] Figure 2 Schematic diagram of the designed microchannel chip spacing;
[0025] Figure 3 A schematic diagram of the vertical / horizontal spacing of the designed microarray probe points;
[0026] Figure 4 A schematic diagram of a 3D metal clamping module used to fix and seal PDMS microfluidic chips and glass-based gene chips after probe spotting;
[0027] Figure 5 Observation and characterization of the cross-sectional profile of the microchannels of the PDMS module after curing under an optical microscope;
[0028] Figure 6 A laser confocal scanning characterization image of a gene chip with a fluorescent probe array.
[0029] Figure 7 Schematic diagram of the machining structure of the metal fixture module;
[0030] Figure 8 Hybridization signals of simulated target fragments in microchannels at different flow rates;
[0031] Figure 9 Fluorescence scanning signals at probe sites after simulated target fragment hybridization under different temperature conditions;
[0032] Figure 10 Fluorescence scanning signals at probe sites after hybridization of simulated target fragments under different hybridization time conditions;
[0033] Figure 11 Fluorescence signals within microchannels of simulated target fragments of different sequence lengths;
[0034] Figure 12 Analysis of different sequence lengths and fluorescence signals under 10-minute hybridization conditions;
[0035] Figure 13 Array spot fluorescence signals after hybridization of simulated target fragments with different mutation lengths within microchannels at 250 pM;
[0036] Figure 14 Analysis and comparison of fluorescence signal values after hybridization of simulated targets with the same concentration but different mutation lengths (MM3, MM5, MM7, MM9) with the same probe;
[0037] Figure 15 Fluorescence signal scans of single-chain simulated targets with different concentration gradients hybridized with probes in microchannels under optimal temperature and flow rate conditions;
[0038] Figure 16Quantitative analysis of fluorescence intensity values of single-chain simulated targets with different concentration gradients after hybridization with probes in microchannels under optimal temperature and flow rate conditions;
[0039] Figure 17 Signal-to-noise ratio (SNR) analysis of single-chain simulated targets with different concentration gradients hybridized with probes in microchannels under optimal temperature and flow rate conditions;
[0040] Figure 18 Comparison of fluorescence scanning signals between probe chip hybridization with a back-and-forth flowing simulated target within a microchannel and traditional static hybridization;
[0041] Figure 19 Analysis of fluorescence scanning signal values between probe chip hybridization in microchannels and traditional static hybridization methods;
[0042] Figure 20 Comparison of the effects of microchannel cleaning and centrifuge tube cleaning after hybridization of targets with different concentration gradients;
[0043] Figure 21 Fluorescence signal scans of multiple simulated targets after hybridization on corresponding multiple probe design chips;
[0044] Figure 22 Layout design diagram of multiple probes on a microarray glass chip. Detailed Implementation
[0045] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.
[0046] Example 1. Preparation of a gene hybridization system based on PDMS microchannels and microarray gene chips
[0047] 1. Fabrication of microfluidic chip layers
[0048] (1) Design of microfluidic chips
[0049] Designed based on SolidWorks software, such as... Figure 1 The required microchannel layout diagram with corresponding width and length is obtained, and then a high-resolution mask is printed for photolithography.
[0050] The microfluidic chip design, microarray dot chip design, and 3D chip metal sealing fixture design of this utility model are as follows: Figure 1As shown; the microchannels consist of six identical U-shaped channels, one U-shaped and one U-shaped, with a channel width of 200-500 micrometers (200, 300, 400, 500 micrometers). In a preferred embodiment, the channel width is 400 micrometers. The single linear length is 12-14 millimeters (12, 13, 14 millimeters), with 13 millimeters in a preferred embodiment. The height during photolithography is 100-300 micrometers (100, 200, 300 micrometers), with 200 micrometers in a preferred embodiment. The channel spacing is as follows... Figure 2 As shown; the standard size of the gene chip is 75mm × 25mm, and the diameter of the microarray probe points on the chip is 80-120 micrometers, which can be 80, 90, 100, 110, or 120 micrometers. In a preferred embodiment of this invention, it is 100 micrometers. The horizontal / vertical spacing between array points is as follows. Figure 3 As shown, within a single array point region, the vertical spacing between array points is 500 micrometers, the horizontal spacing is 2 millimeters, and the spacing between each array point region is 5 millimeters. The distance from the left array point to the outermost edge of the glass chip is 6.01 millimeters, the distance from the right array point to the edge of the glass chip is 7.99 millimeters, the distance from the top edge is 6.98 millimeters, and the distance from the bottom edge is 6.52 millimeters. The 3D metal structure module fixture (including the upper plate and base) for fixing and sealing the PDMS and the glass-based microarray chip constructs an integrated chip system as follows: Figure 4 As shown, this metal module can securely seal the heating element, probe chip, and PDMS module using screws to prevent leakage within the flow channel.
[0051] (2) Photolithography template
[0052] Using the printed photomask, the designed microchannels are photolithographically patterned on the silicon wafer using standard soft lithography. The specific steps are as follows:
[0053] 1) Substrate preparation
[0054] The 2.5-inch silicon wafer substrate is placed in a vacuum plasma cleaner to treat the surface of the silicon wafer with plasma for 2 minutes. The plasma-treated silicon wafer is then quickly sent to the center of the spin coater stage for vacuum adsorption and fixation.
[0055] 2) Spin coating
[0056] Pour an appropriate amount of SU-8 2075 photoresist onto the center of the silicon substrate. Set the spin coater speed to 500 rpm and the spin coater time to 15 s as needed for the required spin coating thickness.
[0057] 3) Pre-baking
[0058] Transfer the silicon wafer coated with photoresist to a heating plate and bake at 65 ℃ for 7 min to allow the photoresist to cure appropriately.
[0059] 4) Secondary spin coating and pre-baking
[0060] Repeat steps 2) and 3): Place the pre-baked silicon wafer on the spin coater stage, fix it under vacuum, pour an appropriate amount of photoresist into the center of the silicon wafer, set the spin coater speed to 2150 rpm, and the spin coater time to 45 s; place the spin-coated silicon wafer on a heating plate for pre-baking treatment, set the baking temperature to 65 ℃, and the time to 7 min.
[0061] 5) Post-baking
[0062] The heating plate temperature is set to 95 ℃ and the time is set to 40 min. The silicon wafer that has been pre-baked is placed on the heating plate for post-baking.
[0063] 6) Exposure
[0064] Place the fully cured silicon wafer on the tray of the contact lithography machine. Align the printed photomask with the silicon wafer, ensuring there are no air bubbles in the microchannel pattern area. Make the mask as close to the film surface as possible (to reduce diffraction and achieve better exposure results). Adjust the exposure according to the specific light intensity of the lithography machine (100 µW / cm²). 2 Calculate the required exposure dose, set the UV exposure time to 34.1 s, and perform the exposure treatment;
[0065] 7) Post-baking
[0066] The exposed silicon wafers were placed on a hot plate for baking; the first baking parameters were set to 65 ℃ for 5 min; the second baking parameters were set to 95 ℃ for 14 min.
[0067] 8) Development
[0068] The baked silicon wafer is placed in negative photoresist developer (PGMEA), shaken to clean and develop, and the development time is set to 15 min according to the microchannel height; finally, the developed silicon wafer is cleaned with isopropanol, and then cleaned several times with deionized water to ensure that there is no residual negative photoresist developer and SU-8 2075 photoresist on the surface of the silicon wafer.
[0069] 9) Characterization
[0070] The photolithographically etched silicon wafer was characterized on a profilometer to ensure that the microchannel height met the experimental requirements (200 mm).
[0071] (3) Casting PDMS
[0072] Using a photolithographically etched silicon wafer template, PDMS is poured to prepare a cured chip. The specific steps are as follows:
[0073] 1) Rubber Mixing
[0074] Place the plastic cup on the balance and zero it. Take 40 g of A glue and add 4 g of B glue in a 10:1 ratio using a dropper. Stir the AB glue with a stirring rod until the glue has a uniform frosty texture.
[0075] 2) Exhaust
[0076] Place the mixed PDMS (AB glue) in a vacuum pot and repeatedly vacuum for about 15 minutes until the PDMS is clear and transparent.
[0077] 3) Making a foil tray
[0078] Cut aluminum foil to a suitable length, fold it in half, place it in a disc mold and press it into a disc shape. Trim the edges of the aluminum foil with scissors, cover it with the mold cover, and press the bottom flat to obtain an aluminum foil disc.
[0079] 4) Pouring glue
[0080] Place the silicon wafer mold in the center of the foil tray and gently press the mold until the edges are flat and adhered. Remove PDMS from the vacuum pot and slowly and evenly pour it into the center of the foil tray. Use a syringe to blow out any air bubbles on the surface. Let it stand for a few minutes to allow the adhesive to become even and smooth.
[0081] 5) Thermosetting
[0082] The foil tray containing PDMS was placed horizontally on a 120℃ intelligent constant temperature heater and heated for 8 minutes to cure.
[0083] 6) Demolding and cutting
[0084] After the chip is formed, peel off the tin foil tray and gently lift the chip from the mold along the edge of the silicon wafer mold; after removing it, use a guillotine to trim it neatly along the edge of the chip, preserving the edge and pattern; use a hole punch to vertically drill holes at the inlet and outlet of the flow channel; attach a dust-free sticker to the flow channel surface of the chip to prevent dust;
[0085] 7) PDMS microchannel characterization
[0086] The prepared PDMS module was cut along the cross-section and the flow channel profile was observed under an optical microscope. The width and depth of the microchannels were then characterized and measured. Figure 5 As shown, the microchannel cross-sectional width is 399.9 micrometers and the microchannel depth is 201 micrometers, which fully meets the parameter settings during photolithography, ensuring that the microchannel meets the standards for subsequent chip hybridization experiments.
[0087] 2. Characterization of DNA probe spotting effect on gene chip
[0088] Based on existing and tested DNA probe sequences in the literature, a simulated single probe, probe A (gctatacatt cttactattt tatttaatcc cag, 33bp), and a Cy5-labeled simulated target PM (ctgggattaaataaaatagt aagaatgtat agc, 33bp), were artificially synthesized. A microarray probe chip was then fabricated, and the size of the fluorescent array dots on the fabricated gene chip was characterized by confocal scanning. The results are as follows: Figure 6 As shown, the DNA probe molecule array dots are uniform in size and distribution, meeting the requirements. The specific steps for probe dotting are as follows:
[0089] 1) Preparation of probe solution
[0090] Take 20 µL of the probe (concentration of 50 µM) provided by Meggene and mix it with the spotting solution (50% dimethyl sulfoxide) at a 1:1 ratio to prepare the probe dilution solution (concentration of 25 µM).
[0091] 2) Probe dotting
[0092] Using PersonalArrayer TM The 16-spotting instrument spots the probes onto the Boao Optical-grade amino substrate according to the array design parameters;
[0093] 3) Hydration
[0094] After the chip is spotted, place it in a 65℃ water bath with the front side facing down, 10 cm above the liquid surface, and treat it twice for 10 seconds, with natural air drying in between.
[0095] 4) UV crosslinking fixation
[0096] After hydration treatment, the sample was placed face up in an ultraviolet crosslinker with a crosslinking strength of 600 mJ.
[0097] 5) Chip storage
[0098] After fixing, the chip should be stored in the dark at 4°C for no more than 6 months.
[0099] 3. Design, fabrication, and embedding of heating elements for 3D metal clamping modules used to seal and fix chips.
[0100] Based on the 3D metal fixture model designed in AutoCAD, the metal fixture was machined. The internal structure is shown in the diagram below. Figure 7 As shown, a temperature-controlled heating element of a fixed size (made of polyimide film, with a maximum temperature resistance of 150°C) is then embedded inside the metal module to build a real-time temperature control module for monitoring the real-time temperature of hybridization.
[0101] 4. Align and calibrate the PDMS microfluidic chip with the pre-dotted DNA microarray chip, then seal and assemble to construct an integrated chip hybridization system.
[0102] The gene chip with completed probe dotting was aligned with the cast and solidified PDMS chip module under an optical microscope to ensure that all probe array points were within the microchannels. The aligned and tightly fitted PDMS-glass gene chip was then placed in a fabricated metal clamp module and sealed with screws. A 1 mL syringe was connected and installed after the injection pump. The microchannels were rinsed with a buffer, and the seal between the PDMS and the probe chip was checked to ensure that there was no leakage when the liquid flowed back and forth.
[0103] Example 2. Functional optimization of a microfluidic-based gene chip rapid hybridization device
[0104] The assembled microfluidic-based gene chip rapid hybridization device was tested and its functions optimized using a single representative simulated probe and target. This included adjusting the liquid flow rate of the injection pump in the liquid drive module, hybridization time, hybridization temperature, detection sensitivity, and post-hybridization cleaning of the chip.
[0105] 1. Optimization of liquid flow velocity in microchannels under the action of the liquid circuit drive module
[0106] Liquid flow rate has a significant impact on hybridization efficiency and results, and its control affects the laminar flow state of the liquid within the microfluidic chip. Excessive flow rate can cause the laminar flow within the microchannel to become turbulent. High flow rates can significantly enhance mass transfer efficiency, accelerate the time for the simulated target to reach the probe surface, increase the contact frequency between the target molecule and the probe, and shorten the hybridization time. However, excessively high flow rates can shorten the contact time between the target and the probe, leading to incomplete hybridization. At low flow rates, liquid mass transfer mainly relies on diffusion, increasing the mass transfer time and reducing hybridization efficiency. A moderate flow rate can balance mass transfer and hybridization time, improving hybridization efficiency.
[0107] Figure 8 The hybridization signals of simulated target fragments in the microchannel are shown at different flow rates under the action of the liquid-driven module. The hybridization temperature is 50℃, and the hybridization time is 10 minutes. At a flow rate of 50 µL / min (C), the hybridization signal is weak, possibly due to two factors: firstly, the low flow rate leads to laminar flow formation, increasing mass transfer time and resulting in insufficient hybridization; secondly, the number of simulated targets pumped in at the same hybridization time is relatively smaller compared to higher flow rates. At a flow rate of 200 µL / min (A), the hybridization signal is also weak, possibly because the excessively high flow rate results in a shorter contact time between the simulated target and the probe points on the chip, leading to insufficient hybridization. At a flow rate of 100 µL / min (B), the trend is obvious, and the fluorescence signal is good. Therefore, a flow rate of 100 µL / min was selected for system optimization in subsequent studies.
[0108] 2. Optimization of hybridization temperature between a single simulated probe and target
[0109] Hybridization temperature is one of the key factors affecting the hybridization reaction between probes and targets on a microarray chip; a suitable temperature can enhance the hybridization signal. For subsequent research, different concentration gradients are needed to simulate appropriate fluorescence intensity during target hybridization, preventing overexposure and the absence of hybridization signal. In this experiment, the hybridization temperature gradients were set to 42, 50, and 55 °C, while other conditions remained consistent. Cleaning and fluorescence signal detection were performed 10 min after hybridization. The optimal hybridization temperature was determined by observing and comparing the fluorescence signal intensity emitted from the probe sites on the microarray chip surface using a chip scanner.
[0110] Figure 9 Fluorescence scanning signals at probe sites after hybridization of simulated target fragments were measured under different temperature conditions. The hybridization time was 10 minutes, the flow rate was 100 μl / min, and the hybridization temperatures were 55℃ (A), 50℃ (B), and 42℃ (C). The hybridization signal was best at 50℃, with no overexposure observed in high-concentration simulated targets and successful detection of fluorescence signals in low-concentration simulated targets. Subsequent studies used a hybridization temperature of 50℃ for system optimization.
[0111] 3. Optimization of hybridization time between a single simulated probe and the target
[0112] Hybridization time has a significant impact on the hybridization effect of simulated targets. If the hybridization time is too short, the hybridization will be incomplete and the hybridization signal will be weak. If the hybridization time is too long, non-specific hybridization will increase and the background signal will be too high. The appropriate hybridization time can maximize the signal-to-noise ratio performance of the chip. Figure 10 To simulate the fluorescence scanning signal on the probe site after hybridization of the target fragment under different hybridization time conditions, the hybridization time gradients in this experiment were designed as 5 min (A), 10 min (B), 30 min (C), and 50 min (D), while other hybridization conditions remained unchanged (hybridization temperature was 50 ℃, and flow rate was 100 μl / min). After hybridization, the chip was cleaned and scanned, and the optimal hybridization time was determined based on the chip hybridization signal performance.
[0113] When the hybridization time was 5 min, the hybridization signal of the low-concentration simulated target channel was weak, indicating that the hybridization time was too short and the hybridization was insufficient. As the hybridization time increased, the hybridization reaction became more complete, and the hybridization signal became stronger. When the hybridization time was 50 min, the fluorescence signal of the high-concentration simulated target channel became oversaturated. The purpose of this study was to shorten the detection time and maximize detection efficiency. When the hybridization time was 10 min, the trend was obvious, and the fluorescence signal was good. Therefore, a hybridization time of 10 min was selected for system optimization in subsequent studies.
[0114] 4. Verification of the effect of hybridization of the capture probe with simulated targets of different lengths on hybridization time.
[0115] Generally, the target sequence length has a certain impact on hybridization efficiency, and different sequence lengths require different hybridization times. Therefore, we explored the hybridization of the same concentration (250 pM) with different lengths of perfectly complementary simulated target sequences (33 bp, 50 bp, 70 bp, 100 bp) with the same capture probe. The hybridization temperature was 50 ℃, the flow rate was 100 μL / min, and the hybridization time was 10 minutes (A) or 50 minutes (B). The fluorescence scanning results are shown below. Figure 11 As shown, the fluorescence signal intensity analysis results are as follows. Figure 12 As shown, the results indicate that, under the same experimental conditions, the microchannel hybridization method is less dependent on hybridization time, and the effects of hybridization for 10 minutes and 50 minutes are similar, demonstrating the high efficiency of the channel hybridization method.
[0116] 5. The effect of hybridization between simulated target fragments with different base number mutations and the same capture probe.
[0117] Nucleic acid detection is of great significance in disease diagnosis and biological research. Therefore, the specific detection of nucleic acid fragments is particularly important. The hybridization platform built by this invention should be able to achieve highly specific capture of target genes.
[0118] This invention designs simulated targets with different numbers of mutated bases for hybridization detection. The mutated base numbers are 3, 5, 7, and 9 bp (MM3, MM5, MM7, MM9). The hybridization results of the simulated probe A with the simulated target PM, and the simulated target mutants MM3 (ctgggattaa ataaatatgt aagaatgtat agc), MM5 (ctgggattaa ataattatct aagaatgtatagc), MM7 (ctgggattaa atagctatcg aagaatgtat agc), and MM9 (ctgggattaa attgctatcgtagaatgtat agc) are shown below. Figure 13 As shown, even with a target concentration as high as 250 PM, the fluorescence intensity gradually weakens with increasing number of mutated bases, and the signal intensity drops significantly when three bases are mutated, showing a significant difference from the fluorescence intensity of the perfectly complementary simulated target (PM). Figure 14 This demonstrates that the hybridization platform has a good auxiliary effect on the specific identification of target sequences, can effectively identify base mismatches, and has the potential to improve the accuracy of disease diagnosis in subsequent actual samples.
[0119] 6. Sensitivity analysis of simulated target hybridization under optimal hybridization temperature and flow rate conditions with perfectly matched gradients.
[0120] To study the high-efficiency hybridization performance of this gene chip hybridization device, we tested six simulated target concentration gradients of 5, 12.5, 25, 50, 100, and 250 pM. Under the optimal hybridization temperature and sample flow rate conditions, the hybridization test was completed in one go on the same probe chip. The hybridization temperature was 50℃, the hybridization time was 10 minutes, and the flow rate was 100 μl / min. Figure 15 The results are from a fluorescence signal scan of the hybridization chip. Figure 16 The corresponding fluorescence signal value, Figure 17 The results show the signal-to-noise ratio (SNR) analysis. The results indicate that even at the lowest concentration of 5 pM, the SNR is >4.7. Gene chips generally consider a signal-to-background ratio (SNR) greater than or equal to 3 as a positive signal. This demonstrates that this invention possesses highly efficient hybridization performance.
[0121] Example 3. Comparison of efficiency between microchannel hybridization and traditional static hybridization
[0122] To verify the hybridization efficiency of the developed integrated gene chip hybridization device, we performed hybridization validation on simulated targets of the same volume (500 μL) but different concentration gradients. Hybridization was performed for 10 minutes at the optimal hybridization temperature of 50 °C (B) within the gene chip rapid hybridization system, compared with the traditional static hybridization method (A) for 24 hours. Fluorescence scanning results were analyzed. Figure 18 ) and fluorescence array point signal intensity ( Figure 19 The study found that higher sample concentrations resulted in higher hybridization efficiency in the flow channel, leading to better signal gradients. This indicates that during hybridization within the microchannel, the hybridization signal at each probe point can be rapidly and effectively enhanced while simultaneously ensuring signal uniformity across all probe points, resulting in higher consistency and preventing individual probe points from failing to light up.
[0123] Example 4: Comparison of Cleaning Methods (Cleaning of Hybridization Device vs. Cleaning of Traditional Shaker)
[0124] After hybridizing simulated targets of different concentrations under the same conditions, the chips were cleaned using both the microfluidic cleaning process within the hybridization device and the overall chip shaking process, followed by chip scanning and signal extraction analysis. The results are as follows: Figure 20 The average signal-to-noise ratio (SNR) of probes after cleaning in the hybridization apparatus was generally higher than that after cleaning in the shaker; moreover, the amount of cleaning solution used in the hybridization apparatus (3 mL) was much lower than that used in centrifuge tubes (150 mL). This indicates that the microchannel cleaning mode of the hybridization apparatus has more stable fluid movement, making it less likely for probes to fall off and cause signal loss.
[0125] Example 5. Specific hybridization detection of multiple different simulated targets and probes within the same flow channel region.
[0126] To verify the specific qualitative detection capability of the microarray chip for multiple samples and to identify specific gene categories, this invention designed a probe sequence containing positive and negative control probes and six target genes for detecting liver cancer (PA, NC, 4R1, 5R1, 6R1, 7R1, 6F1, 7F1, with 12 replicates for each probe) based on the gene sequences used in early liver cancer screening. Plasmid fragments (500 ng) paired with these probes were artificially synthesized by a gene company. After fluorescent staining, labeling, purification, and recovery of the plasmid fragments, multiple groups of fluorescently labeled samples were simultaneously added to the corresponding six microchannels for on-chip hybridization and cleaning, followed by scanning to verify the chip's specific detection capability. After cleaning the hybridized glass chip within the on-chip microchannels, the fluorescence signal of each probe point was scanned in a scanner to obtain the results shown below. Figure 21 The results showed that the hybridization probes were highly specific in the microchannel mode, and all the lit probes could effectively capture the target sequence, which was completely consistent with the position of the dot array. Figure 22 The calculated average SNR value is above 8, and cross-contamination between samples is effectively avoided, reducing the occurrence of false positives.
Claims
1. A microchannel-based gene chip rapid hybridization reaction device, characterized in that, The microfluidic-based gene chip rapid hybridization device includes a microfluidic layer based on microfluidic technology, a DNA probe microarray chip layer corresponding to the microfluidic layer arranged in a dotted pattern, a built-in temperature control module for providing the hybridization temperature between the DNA probes and DNA in the sample, and a fixing device. The fixing device fixes and seals the microfluidic layer, the DNA probe microarray chip layer, and the built-in temperature control module from top to bottom. The microfluidic layer has 4-8 independently sealed microchannels, each microchannel arranged in a continuous U-shaped pattern (positive-negative-positive). The microfluidic layer is equipped with a liquid flow drive module for driving the DNA solution to flow back and forth within the microchannels. After sealing, all probe array points in the DNA probe microarray chip layer are located within an independent microchannel, and a sample application well is provided at the upper end of the fixing device for adding samples to each independent microchannel.
2. The microfluidic channel-based gene chip rapid hybridization reaction device according to claim 1, characterized in that, The microchannel has a width of 200-500 micrometers, a height of 100-300 micrometers, a single linear length of 12-14 millimeters, and a microarray probe point diameter of 80-120 micrometers.
3. The microfluidic-based gene chip rapid hybridization reaction device according to claim 2, characterized in that, The microchannel layer has 6 independent microchannels, each with a width of 400 micrometers, a height of 200 micrometers, a single linear length of 13 millimeters, and a microarray probe point diameter of 100 micrometers.
4. The microfluidic-based gene chip rapid hybridization reaction apparatus according to claim 1, wherein The microfluidic layer is made of polydimethylsiloxane, the DNA probe microarray chip layer is made of glass, and the built-in temperature control module is a thermosensitive heating element made of polyimide film.
5. The microfluidic-based gene chip rapid hybridization reaction device according to claim 4, characterized in that, The fixing device consists of an upper cover and a base. The base is used to support the built-in thermosensitive heating element and the DNA probe microarray chip layer stacked on it, and has blind screw holes on its edge. The upper cover is used to press the microchannel layer to fit the DNA probe microarray chip layer located below it, so that each microchannel can be sealed. Screw through holes corresponding to the blind screw holes of the base are provided on the edge of the upper cover. When sealing, the upper and lower components of the gene chip rapid hybridization device based on the microchannel pattern are tightly fitted through the screws, screw through holes, and screw blind holes, and the microchannels are sealed.
6. The microfluidic-based gene chip rapid hybridization reaction device according to any one of claims 1 to 5, characterized by The aforementioned microchannel-based gene chip rapid hybridization device is also equipped with a sample loading module for loading samples into the microchannel through each loading well.