Methods for detecting endometrial carcinoma subtype CN high

Abstract

The present invention relates to a method for detecting high-copy-number (CN high) endometrial carcinoma by determining a copy number variation (CNV) of a CNV chromosomal region comprising a panel of analytes. Thus, the present invention provides a novel analyte panel suitable for identifying CN high-copy-number endometrial carcinoma, as well as a novel analyte panel suitable as a biomarker for diagnosing CN high-copy-number endometrial carcinoma. The invention further relates to suitable primers and probes for use in this method, as well as to kits for the detection of CN high-copy-number endometrial carcinoma.

Description

[0001] The present invention relates to a method for detecting endometrial carcinoma of the high copy number (CN high) molecular subtype by determining a copy number variation (CNV) of a CNV chromosomal region comprising a panel of analytes. Thus, the present invention provides a novel analyte panel suitable for identifying endometrial carcinoma of the high CN subtype, as well as a novel analyte panel suitable as biomarkers for diagnosing endometrial carcinoma of the high CN subtype. The invention further relates to suitable primers and probes for use in this method, as well as to kits for detecting endometrial carcinomas of the high CN subtype.

[0002] Uterine carcinoma was initially divided according to its site of origin into tumors of the uterine body that originate from the endometrium (endometrial carcinoma, EC, ICD-11 C54.1) and those that originate from the cervix (cervical carcinoma, ICD-11 C53). In 1983, Bokhman [1] recognized two subtypes of EC based on clinical and histopathological features: Type I EC were mostly endometrioid histotype and lower grade, associated with unopposed estrogenic stimulation and with a favorable prognosis. Type II EC (non-endometrioid) were histologically high-grade tumors with clinically aggressive growth behavior. According to the Cancer Genome Atlas Research Network (TCGA) [2], EC can be divided into four classes (subtypes) based on their molecular genetic profiles, which were generated using next-generation sequencing (NGS) technologies: 1. MSI / MMRd hypermutated: Microsatellite instability (MSI) is found in 25-30% of endometrial carcinomas. Tumors with microsatellite instability contain alterations in genes of the DNA repair system (MMRd - mismath repair dysfunctional: mutations in MLH1, MSH2, MSH6, PMS1, PMS2), which render replication errors ineffective. This leads, among other things, to changes in the length of short, repetitive DNA segments, the so-called microsatellites or short tandem repeats (STRs). STRs with repeat units of 1 or 2 nucleotides are frequently used for MSI detection (EP1478781 B1) as a surrogate marker for MMRd gene mutations. 2. POLE ultramutated (POLEmut EC): Mutations in the POLE gene occur in 7-10% of EC tumors. Hotspot mutations are found in the exonuclease domain of the POLE gene, which is essential for chromosomal DNA replication and DNA repair. Mutations in POLE lead to an ultramutated phenotype, meaning that a large number of other mutations occur throughout the genome. POLE ultramutated EC tumors are copy number stable. 3. High copy number (CN high, or p53abn): 25-30% of tumors exhibit a "high copy number" (CN high) subtype. These tumors contain numerous chromosomal aberrations, meaning large segments of chromosomes are either deleted or duplicated (also referred to as "somatic copy number plasticity," "somatic copy number alterations (SCNA)," or "somatic copy number variation (SCNV)"). Furthermore, they frequently contain mutations in the tumor suppressor gene TP53 (p53abn - abnormal). Clinically, patients with these tumors have a poor prognosis, with a 5-year progression-free survival rate of only 50%. 4. Low copy number (or NSMP - no specific molecular profile): The low copy number (CN low) subtype accounts for 15-40% of endometrial carcinomas. These tumors are characterized by the absence of a TP53 mutation but exhibit mutations in a variety of other genes. Mutations in exon 3 of CTNNB1 are associated with a poor prognosis. This group primarily includes atypical endometrial hyperplasia / endometrioid neoplasia (EAH / EIN histological grading) with high expression of estrogen and progesterone receptors (ER, PR). They often remain in a precursor stage for years before developing into invasive carcinomas and can be treated with hormone therapy.

[0003] The four groups have prognostic value and represent a promising tool for clinical decision-making in adjuvant treatment. Endometrial scrapings (curettage) or surgical biopsies are the main specimens for histopathological examination (FFPE - formalin-fixed, paraffin-embedded tissue sections and / or immunohistochemical staining) or molecular analysis. Despite advances in the morphological and immunohistochemical characterization of EC, the histological subtyping of EC remains subject to considerable interobserver variability, even among experts and when using immunohistochemistry (IHC).Therefore, several approaches have been undertaken to create and validate molecular risk classifiers (MRCs) based on TCGA results, which have been correlated with the early EC type I and II categories or the more detailed FIGO staging scheme recommended by the International Federation of Gynecology and Obstetrics ([3], [4], [5]). Furthermore, clinically applicable surrogate markers for the four molecular subtypes have been developed ([6], [7], [8]). As a result, the ProMisE (Proactive Molecular Risk Classifier for Endometrial Cancer) classifier was developed, which has a high degree of interobserver reproducibility [5]. However, ProMisE still uses combinations of IHC for MSH6, PSM2, and TP53 and focuses its sequencing on mutations in POLE exons 9-14 (exonuclease domain).However, a uniform molecular protocol without individual errors would be beneficial for standardization and laboratory automation. Furthermore, there is still a need to obtain more specific molecular markers for early diagnosis, risk stratification of EC, and treatment decision-making ([9],

[10] ,

[11] ).

[0004] Therefore, the aim of the present invention is to provide a uniform molecular protocol without individual errors, enabling standardization and laboratory automation. A further aim of the present invention is to provide more specific molecular analytes (synonym: analytes molecular markers), in particular molecular biomarkers, for early diagnosis, risk stratification of EC, and for therapy decisions. A further aim of the present invention is to provide a more specific and limited analyte panel, a molecular biomarker panel, for early diagnosis, risk stratification of EC, and therapy decisions. The aim of the present invention is to provide suitable primers and probes for the detection of said analytes for the detection of high copy number subtype endometrial carcinomas.Furthermore, the present invention provides instructions for the preparation of primers and probes for the detection of CNH with high specificity and to meet the required sensitivity. The aim is to provide an automatable method for rapid detection.

[0005] In summary, the present invention solves the problems of the prior art with the novel non-surrogate molecular diagnostic test presented here, which improves the sensitivity of genotyping of the CN high subtype (molecular EC type 3). This enables better prognostic and therapeutic stratification of the most aggressive endometrial carcinomas

[12] . After extensive development, the method presented here, in particular the assay, preferably a multiplex test method / assay, is based on a series of new molecular analytes suitable as biomarkers, identified by bioinformatic analysis of next-generation sequencing (NGS) data ([3]), and proven suitable for the detection of CN high endometrial carcinomas / tumors.Since biomarkers are preferably detected by relative quantification using polymerase chain reaction (PCR) technologies, it was also necessary to identify reference regions that are genomically stable (or: have constant, physiologically normal copy numbers) in endometrial carcinomas.

[0006] In the development of a PCR-based multiplex test, the technology of cleavable oligonucleotide probes is used in combination with a capillary electrophoresis (CE) device, here the MODAPLEX device, and an analysis of the results using the delta-Ct method - in which the Ct values ​​of unstable and stable genomic regions are averaged and the difference is then calculated - to distinguish CN high from non-CN high tumor samples, as described in the example.

[0007] There is no prior art disclosing or indicating the analyte panel of the present invention comprising a reference comprising a reference sequence encoding within the regions of the ZRANB2 and ZRANB2-AS1 genes on chromosome 1, reference sequences encoding within the region of the TMEM169 gene on chromosome 2, and reference sequences encoding within the region of the HCAR1 gene on chromosome 12, in combination with target sequences encoding the COX10, ARHGAP44, ELAC2, and MYOCD gene regions in cytoband 17p12, respectively, and target sequences encoding the ZNF555, TLE6, ZNF57, and ZNF77 gene regions in cytoband 19p13.3, respectively, for the detection of CN high endometrial carcinomas and tumors.

[0008] Finally, the object of the present invention is achieved with the unique and novel analyte panel according to the invention, which is highly suitable as a biomarker for the identification, detection, and diagnosis of endometrial carcinomas of the CN subtype. Accordingly, the inventive solution is realized by target sequence determination, labeling, amplification, and detection of the aforementioned biomarkers. For all embodiments of the method described here, the reference and target sequences defined here are applicable, which include the reference sequence encoding the ZRANB2 and ZRANB2-AS1 gene regions on chromosome 1, the reference sequence encoding the TMEM169 gene region on chromosome 2, and the reference sequence encoding the HCAR1 gene region on chromosome 12.This reference is used to detect at least one CNV of at least one target sequence encoding the COX10, ARHGAP44, ELAC2 and / or MYOCD genes in cytoband 17p12 and of target sequences encoding the ZNF555, TLE6, ZNF57 and / or ZNF77 genes in cytoband 19p13.3.

[0009] The object of the invention is achieved by the method according to claim 1, the probe according to claim 22, and the kit according to claim 27. Embodiments of the invention are disclosed in detail in the dependent claims and in the description. All definitions apply to all embodiments.

[0010] In a first aspect of the present invention, a method, preferably a multiplex method, is provided for detecting endometrial carcinoma of a high copy number (CN high) molecular subtype, wherein at least one copy number variation (CNV) is detected for a CNV chromosomal region comprising at least one cytoband on chromosome 17 and / or chromosome 19, the method comprising the steps of: - Providing a test sample of a subject containing at least one predetermined target sequence in the CNV chromosomal region, - if necessary, providing at least one second test sample containing at least one reference sequence which is in particular CNV-negative (“relatively stable” or “rarely affected by CNV”, as defined here), optionally determining the copy number of the at least one or more reference sequences, - providing a reference comprising at least one or more reference sequences with a known copy number, wherein the reference is preferably negative for a CNV as defined herein, - Determination of a CNV from at least one predetermined target sequence in the CNV chromosomal region, preferably by amplification or based on suitable probes as defined herein, - Evaluation of the CNV of the at least one predetermined target sequence in the CNV chromosomal region, preferably for at least one predetermined target sequence in at least one cytoband on chromosome 19 and / or for at least one predetermined target sequence in at least one cytoband on chromosome 17, particularly preferably for at least one target sequence in cytoband 19p13.3 and / or 17p12, in relation to the copy number of the reference, preferably on the basis of Ct values ​​and delta Ct values ​​as defined herein (Example 1, Table 5 and Table 6), - Identification of an endometrial carcinoma of the subtype CN high, wherein the CNV for the CNV chromosomal region is determined as CN high, preferably for at least one predetermined target sequence in at least one cytoband on chromosome 19 and / or for at least one predetermined target sequence in at least one cytoband on chromosome 17, particularly preferably for at least one target sequence in cytoband 19p13.3 and / or 17p12, compared to the copy number of the reference.

[0011] The "subject" within the meaning of the present invention is a human patient suffering from endometrial carcinoma. The human patient is of female sex, transgender sex, transgender woman, or a human patient carrying the genetic predisposition to at least one CNV, as defined herein, from at least one target sequence, as defined herein. The "subject" may carry a native endometrium, a transplanted endometrium, or any transplanted endometrial tissue capable of carrying the genetic predisposition to at least one CNV in the CNV chromosomal region defined herein.

[0012] The "CNV chromosomal region" is defined by a copy number variation as defined herein. Preferably, the CNV chromosomal region is a CN high region (with high copy number variation) in which at least one or more target sequences are determined for an altered (increased or decreased) copy number compared to a suitable reference. For the purposes of the present invention, the "CNV chromosomal region" is therefore a "CN high region." Preferably, the "CNV chromosomal region" is a CN high region comprising cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3, and / or 19p13.2, or a combination thereof. The remaining definitions apply accordingly.

[0013] In the method, the CNV is determined as CN high on average across all predetermined target sequences in the CNV chromosomal region compared to the copy number of the at least one reference sequence. Preferably, the average CNV is determined for at least one predetermined target sequence in at least one cytoband on chromosome 19 and / or for at least one predetermined target sequence in at least one cytoband on chromosome 17, preferably for at least one target sequence in cytoband 19p13.3 and / or 17p12, compared to the average copy number of the reference.

[0014] The assessment of CNV and the subsequent identification of endometrial carcinomas of the CN high subtype is based on Ct values ​​and delta Ct values ​​(Example 1, Table 5 and Table 6). Preferably, the assessment of CNV according to the present invention—and in any embodiment of the method—comprises the calculation of the delta Ct value for the corresponding target sequences, as defined herein, by subtracting the average Ct value of the reference, as defined herein, from the arithmetic mean of the corresponding target sequences (see Table 6).

[0015] In one embodiment of the present invention, the method, preferably the multiplex method, comprises the CNV chromosomal region of cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3, and / or 19p13.2, or any combination thereof. Preferably, the CNV is determined for at least one or more predetermined target sequences in cytoband 17p12 and / or for at least one or more predetermined target sequences in 19p13.3, preferably in cytoband 19p13.3 on chromosome 19 and in cytoband 17p12 or chromosome 17. In one embodiment, the target sequence may be a target sequence that overlaps with at least two cytobands.

[0016] In a further embodiment of the invention, in the step of determining a CNV of at least one predetermined target sequence in the CNV chromosomal region of the method, preferably the multiplex method, the CNV is determined for at least one or more predetermined target sequences in at least one cytoband of the cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3 and / or 19p13.2 or in any combination of one or more of the aforementioned cytobands.

[0017] In a further embodiment of the invention, in the step of determining a CNV of at least one or more predetermined target sequences in the CNV chromosomal region of the method, preferably a multiplex method, the CNV is determined for at least one or more predetermined target sequences in cytoband 19p13.3 on chromosome 19 and for at least one or more predetermined target sequences in cytoband 17p12 on chromosome 17.

[0018] Preferably, in the method according to the invention, preferably in the multiplex method, the at least one CNV in the CNV chromosomal region is detected for at least one or more target sequences in the region of the genes COX10, ARHGAP44, ELAC2 and / or MYOCD in cytoband 17p12 and / or for at least one or more target sequences in the region of the genes ZNF555, TLE6, ZNF57 and / or ZNF77 of cytoband 19p13. Preferably, a CNV is detected for a combination of at least two, at least three or for all four gene regions from the group of COX10, ARHGAP44, ELAC2 and / or MYOCD. Preferably, a CNV is detected for a combination of at least two, at least three or for all four gene regions from the group of ZNF555, TLE6, ZNF57 and / or ZNF77. Even more preferred is the detection of a CNV for any combination of the above-mentioned target sequences.

[0019] In a further embodiment of the invention, in the method, preferably a multiplex method, the reference, which comprises at least one or more reference sequences, is compared with a test sample, in particular with a second test sample, of the same subject - as defined herein - wherein the method comprises further steps, in particular in addition to the steps described above, - Determination of the copy number of at least one or more reference sequences and - preferably simultaneous determination of the copy number of at least one or more reference sequences and at least one or more target sequences, - Evaluation of the CNV of the at least one predetermined target sequence in the CNV chromosomal region in relation to the determined copy number of the at least one or more reference sequences of the reference, preferably on the basis of Ct values ​​and Delta-Ct values ​​as defined herein (Example 1, Table 5 and Table 6), - Identification of an endometrial carcinoma of subtype CN high, determined as CN high compared to the determined copy number of the reference.

[0020] The test sample may be the same sample containing both at least one or more reference sequences and at least one or more target sequences, or two separate test samples may be provided, each containing either reference sequences or target sequences. Preferably, two separate test samples are provided for the reference and target sequences, respectively.

[0021] In a further embodiment of the invention, in the method, preferably the multiplex method, the reference is provided as a digital reference independent of the subject having the at least one predetermined target sequence and independent of each test sample of a subject. Thus, the reference can be a reference nucleic acid sequence material (synonym: reference material)—measured by performing the method of the present invention—or digital reference nucleic acid sequence information (synonym: digital reference sequence or digital reference)—which can be provided / loaded onto the respective analytical instrument, such as the MODAPLEX device. The reference can be a digitally processed reference sequence or a digitally processed reference.

[0022] In a preferred embodiment, the reference is a digital reference or the respective signal representing the released hydrolysis products of the reference. With respect to this reference, the released hydrolysis products are detected and the presence of at least one CNV is confirmed.

[0023] Preferably, in the method according to the invention, preferably a multiplex method, the reference - digital or real - comprises at least one reference sequence on chromosome 1, and / or at least one reference sequence on chromosome 2 and / or at least one reference sequence on chromosome 12. Particularly preferably, the reference - digital or real - in the method of the present invention comprises at least one reference in the cytobands 1p32.3, 1p32.2, 1p32.1, 1p31.3, 1p31.2, 1p31.1, 1p22.3, 1p22.2, 1p22.1, 1p21.3, 1p21.2 and / or 1p21.1 on chromosome 1 and / or in the cytobands 2q32.1, 2q32.2, 2q32.3, 2q33.1, 2q33.2, 2q33.3, 2q34, 2q35, 2q36.1, 2q36.2, 2q36.3 and / or 2q37.1 on chromosome 2 and / or in the cytobands 12q24.13, 12q24.21, 12q24.22, 12q24.23, 12q24.31, 12q24.32 and / or 12q24.33 on chromosome 12 or any combination thereof.In a preferred embodiment of the invention, the reference in the method - digital or real - comprises at least one or more reference sequences in the cytoband 1p31.3 on chromosome 1, at least one or more reference sequences in the cytoband 2q35 on chromosome 2 and at least one or more reference sequences in the cytoband 12q24.31 on chromosome 12. Preferably, the reference comprises at least one reference sequence within the region of the ZRANB2 gene and at least one reference sequence within the region of the ZRANB2-AS1 gene on chromosome 1 and / or at least one reference sequence within the region of the TMEM169 gene on chromosome 2 and / or at least one reference sequence within the region of the HCAR1 gene on chromosome 12.

[0024] In a preferred embodiment of the present invention, the reference—as defined herein—is negative for a CNV. Preferably, the reference is negative for CNV of at least one or more of the sequences comprising sequences in the ZRANB2 and ZRANB2-AS1 gene regions on chromosome 1, and / or at least one reference sequence in the TMEM169 gene region on chromosome 2, and / or at least one reference sequence in the HCAR1 gene region on chromosome 12.

[0025] The detection of the new analytes, in particular the complete analyte panel (biomarker set), using a PCR-based method requires the definition of at least one reference sequence, synonymously known as a control region, in order to normalize the signals for the target sequences on chromosomes 17 and 19 as described here. The identification of uncorrelated controls is performed by agglomerative cluster analysis. Independent control regions were selected by minimizing either the squared expression or the absolute expression across the samples. Sufficient control regions were selected so that at least one of the controls shows no chromosomal aberration in all samples of the analyzed dataset. Negative for CNV is based on a statistical evaluation that allows a reference to be considered "relatively stable" or "affected by CNV in rare cases."As set forth in the present invention, the above-mentioned reference sequences were compared with the target sequences based on NGS data (according to The Cancer Genome Atlas Research Network (TCGA) [2]) from 232 patients with endometrial cancer. In contrast to the target sequences, the control regions of the assay are characterized by their relatively high genomic stability. Approximately 80% were "negative for a CNV" or "relatively stable" within the meaning of the present invention. Negative for a CNV, in particular (synonym: negative for CN high), therefore means that no copy number variation (CNV) is detected for at least one reference sequence, preferably no CNVs are detected for at least two reference sequences, particularly preferably no CNVs are detected for the reference sequences encoding ZRANB2, ZRANB2-AS1, TMEM169 and / or HCAR1.

[0026] In a further embodiment of the invention, the method comprises a step of providing suitable primers for amplifying the at least one or more predetermined target sequences in the CNV chromosomal region and, optionally, suitable primers for amplifying at least one or more reference sequences. Preferably, suitable primers are provided for amplifying the at least one or more predetermined target sequences in the cytobands 19p13.3 and / or 17p12. In one embodiment, suitable primers are additionally provided for amplifying at least one or more reference sequences. Suitable primers within the meaning of the present invention are preferably those that have the technical feature comparable to the primers in Table 2. The skilled person is capable of producing any suitable primer according to the instructions described here.Particularly preferably, suitable primers within the meaning of the present invention, particularly preferably for the amplification of the analyte panel according to the invention, have the sequences of Seq ID No. 1 to Seq ID No. 28. Therefore, a further aspect of the present invention is a combination of primer pairs for the amplification of the analyte panel - ZRANB2, ZRANB2-AS1, TMEM169, HCAR1, COX10, ARHGAP44, ELAC2, MYOCD, ZNF555, TLE6, ZNF57, ZNF77, wherein the primers have the sequences of Seq ID No. 1 to Seq ID No. 28 (Table 2).

[0027] Thus, if a digital reference is used in any embodiment of the present invention, at least one primer is provided for at least one target sequence. In another embodiment - and as illustrated in the examples herein - a forward primer and a reverse primer are provided for the at least one target sequence. Preferably, suitable primers are provided for the amplification of at least one or more predetermined target sequences in at least one cytoband of the cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3 and / or 19p13.2 or in any combination of one or more of the aforementioned cytobands. Even more preferably, the primers according to the present invention are suitable for preferentially amplifying gene regions located in the cytobands 19p13.3 and / or 17p12, and more preferably for at least one or more target sequences within the regions of the genes COX10, ARHGAP44, ELAC2 and / or MYOCD in the cytoband 17p12 and / or for at least one or more target sequences within the regions of the genes ZNF555, TLE6, ZNF57 and / or ZNF77 of the cytoband 19p13.

[0028] The same applies accordingly to suitable primers. According to the present invention, suitable primers are provided for the amplification—where a reference is determined within the scope of the method—of at least one reference sequence on chromosome 1, and / or at least one reference sequence on chromosome 2, and / or at least one reference sequence on chromosome 12. Preferably, these primers are suitable for the amplification of at least one reference sequence in the cytobands 1p32.2, 1p32.1, 1p31.3, 1p31.2, 1p31.1, 1p22.3, 1p22.2, 1p22.1, 1p21.3, 1p21.2 and / or 1p21.1 on chromosome 1 and / or in the cytobands 2q32.1, 2q32.2, 2q32.3, 2q33.1, 2q33.2, 2q33.3, 2q34, 2q35, 2q36.1, 2q36.2, 2q36.3 and / or 2q37.1 on chromosome 2 and / or in the cytobands 12q24.13, 12q24.21, 12q24.22, 12q24.23, 12q24.31, 12q24.32 and / or 12q24.33 on chromosome 12 or any combination thereof. Preferably, suitable primers are used for at least one reference sequence in cytobands 1p31.3 on chromosome 1, 2q35 on chromosome 2 and 12q24.31 on chromosome 12. Preferably, the reference primers are suitable for amplifying at least one reference sequence at the location of the ZRANB2 and ZRANB2-AS1 gene on chromosome 1 and / or at least one reference sequence at the location of the TMEM169 gene on chromosome 2 and / or at least one reference sequence at the location of the HCAR1 gene on chromosome 12. Within the scope of the present invention, any combinations or primers are suitable for both reference sequences and target sequences to detect endometrial carcinoma (EC).

[0029] In a further embodiment of the invention, the method, in particular a method for the sole amplification (NAT) of the target sequence and optionally of reference sequences, further comprises a step such as - contacting the test sample with the appropriate primers, in particular as described herein, which are specific for the at least one or more target sequences and optionally for the at least one or more reference sequences, - Hybridization of the at least one primer, preferably at least one primer pair, with its respective complementary sequence on the target sequence and optionally on the reference sequence, preferably the at least one primer, at least one primer of the at least one primer pair, is labelled - Amplification of at least one target sequence and optionally the reference sequence, - Separation of the amplified target sequences and optionally the reference sequences, - Detection of the amplified target sequences and optionally the amplified reference sequences, and - Evaluation of the CNV of the at least one target sequence in comparison to the copy number of the at least one reference sequence, preferably on the basis of the amplicons obtained.

[0030] In this embodiment, no probes are required. Detection and evaluation are based on labeled amplicons obtained using a desired NAT and the primers mentioned. Preferably, in the method, particularly in the sole amplification method, the amplification and detection of the at least one or more target sequences and optionally at least one or more reference sequences is carried out by real-time PCR, endpoint PCR, digital PCR, geometric multiplexing PCR, digital droplet (or emulsion) PCR (ddPCR), or next-generation sequencing (NGS).

[0031] In a further embodiment of the invention, the method determines the at least one CNV for the CNV chromosomal region by the at least one amplified target sequence in comparison to the at least one reference. The sequences of the amplicons are listed in Table 4. Thus, the detection of at least one or more of the amplicons listed in Table 4 is suitable for identifying endometrial carcinomas of the CN subtype. Shorter sequences of the aforementioned amplicons are also suitable. The development of suitable primers for each of the aforementioned amplification methods is well known to the person skilled in the art.

[0032] In another embodiment of the present invention, the method detects endometrial carcinoma of subtype CN high without amplifying a target or reference sequence, but with at least one suitable probe for at least one target sequence and with at least one suitable probe for at least one reference sequence. Preferably, the method is an imaging method for each nucleic acid in the test sample.

[0033] Thus, in a further embodiment of the present invention, the method comprises the steps - bringing the test sample, in particular a solid biopsy sample, of the subject into contact with at least one oligonucleotide probe, in particular a not necessarily cleavable probe, which is specific for the at least one target sequence, and with at least one oligonucleotide probe which is specific for the at least one reference sequence, - Hybridization of the respective probes with their respective complementary sequences in the test sample, - detecting an emitted signal of each hybridized probe, wherein at least one probe for the at least one target sequence and the at least one probe for the at least one reference sequence comprise mutually different fluorophores, - Evaluation of the fluorescence signal for the at least one predetermined target sequence in the chromosomal CNV chromosome region in relation to the fluorescence signal for the at least one reference sequence, - optional measurement of fluorescence intensity and / or - optionally creating images of at least one or more layers of the test sample, and - Identification of endometrial carcinoma of subtype CN high, where the CNV for the CNV chromosomal region is determined as CN high compared to the copy number of the reference.

[0034] In this embodiment, the test sample is a human test sample containing the at least one target sequence and at least one reference sequence that are still present in a sample, i.e., not isolated from it. Particularly suitable for the embodiment of the method that includes an imaging procedure are the sample and primary sample, such as a biopsy from a living body or an autopsy dissected after death, a discrete portion of a body fluid or tissue from the subject. The test sample can originate from an endometrial scraping (curettage) or from surgical biopsies, which represent the primary specimen for histopathological examination (FFPE - formalin-fixed, paraffin-embedded tissue sections and / or immunostaining) or subsequent molecular analysis.

[0035] In this embodiment, spatial multiplex analysis is possible. The method of the present invention is suitable for generating deep contextual datasets that visualize molecular interactions at subcellular resolution while preserving the sample tissue. Thus, it is no longer necessary to process the tissue; no tissue brightening is required. The non-cleavable embodiment of the probe of the present invention can be combined with other means for high resolution, e.g., of transcriptomic activity. The present method enables the observation of DNA and RNA with the required sensitivity and specificity for the detection of endometrial carcinomas, e.g., using FISH and other spatial analysis techniques.One example is the molecular mapping platform from Resolve BioSciences GmbH (Monheim am Rhein, Germany), which enables the solution of complex biological challenges in fields such as oncology, neuroscience, and infectious diseases. In the embodiment of non-cleavable probes, all embodiments of the target sequences and the reference sequence apply accordingly. The sequences of the forward and reserve primers are also suitable for generating non-cleavable probes for imaging.

[0036] In another embodiment of the method, cleavable probes are used, and the released hydrolysis products of the respective probe are the signal intended for measurement, in particular a signal of a released hydrolysis product of a cleavable probe. In a further embodiment of the present invention, the method, preferably the multiplex method, comprises the steps - optionally providing a test sample of a subject containing at least one predetermined target sequence in the CNV chromosomal region, - optionally providing a reference comprising at least one or more reference sequences with a known copy number, - contacting the subject's test sample - as defined herein - with suitable primers - as defined herein - specific for the at least one target sequence and optionally for the at least one reference sequence, and contacting the test sample with at least one cleavable oligonucleotide probe (probe) specific for the at least one target sequence and optionally with at least one cleavable oligonucleotide probe specific for the at least one reference sequence, - Hybridization of the at least one primer with its respective complementary sequence on the same strand of the same target sequence, wherein the cleavable probe hybridizes 3' upstream of the respective primer, and optionally hybridization of the at least one primer with its respective complementary sequence on the same strand of the same reference sequence, wherein the cleavable probe hybridizes 3' upstream of the respective primer, or the reference is a digital reference as described herein, - Amplification of at least one target sequence and optionally of at least one reference sequence, - Cleavage of the hybridized cleavable probes with a template-dependent 5' to 3' nuclease activity to release a cleavable hydrolysis product of the respective cleavable probe, - Separation of the released hydrolysis product(s) and - Detection of the released hydrolysis products. - preferably determining at least one CNV of at least one predetermined target sequence in the CNV chromosomal region by detecting the released hydrolysis product(s), - preferably evaluating the CNV of the at least one predetermined target sequence of the CNV chromosomal region, based on the at least one released hydrolysis product of the specific probe for the at least one predetermined target sequence, relative to the copy number of the reference, in particular based on the at least one released hydrolysis product of the specific probe for the at least one reference sequence, - preferably identification of an endometrial carcinoma of the subtype CN high, where the CNV for the CNV chromosomal region is determined as CN high compared to the copy number of the reference.

[0037] The assessment of CNV and the subsequent identification of endometrial carcinomas of the CN high subtype is based on Ct values ​​and delta Ct values ​​as defined herein (Example 1, Table 5 and Table 6). This embodiment of the method according to the invention may comprise a step of isolating and / or purifying the one potential nucleic acid comprising target sequences and at least one reference sequence prior to providing a test sample.

[0038] In a preferred embodiment of the above method, the cleavable hydrolysis product and the released hydrolysis product further comprise at least one modification of at least one nucleotide, which comprises modifications of the DNA backbone, modifications outside the DNA backbone and / or artificial bases, wherein - DNA backbone modification - which involves artificial changes to the 2' and / or 4' position of the five-carbon sugar of a nucleotide and - Non-DNA backbone modification comprises an artificial chemical modification coupled to the 5' end and / or the 3' end of the nucleotide.

[0039] Examples of cleavable probes for target sequences and for reference sequences with modifications according to the present invention are listed in Table 3.

[0040] In another embodiment of the above method, the non-DNA backbone modification comprises spacers, which are chemical structures coupled to the 3' and / or 5' end of a nucleotide or between two nucleotides and are preferably selected from a) Alkyl alcohol of (C n )-OH, wherein n is an integer and at least 3, preferably 3, 6, 9 or 12, comprising propanyl (spacer C3), hexanyl (spacer C6), nonanyl (spacer C9) and dodecanyl (spacer C12). b) Glycol ether of (-CH2-O-CH2-CH2) n-OH, where n is an integer and at least 1, preferably comprising triethylene glycol (spacer 9), tetraethylene glycol (spacer 12) and hexaethylene glycol (spacer 18) and / or c) a tetrahydrofuran derivative containing a methylene group in the 1-position of 2'-deoxyribose.

[0041] In another embodiment of the above method, multiple cleavable probes comprising multiple analyte-specific 3' sequences are used, wherein all respective cleavable hydrolysis products comprise the same label coupled to the at least one nucleotide of each cleavable hydrolysis product and each comprise a different linker and / or at least one different modification. Examples of cleavable probes for target sequences and for reference sequences with modifications according to the present invention are listed in Table 3.

[0042] In another embodiment, the cleavable probe of the present invention, preferably its cleavable hydrolysis product, comprises an analyte-nonspecific 5' sequence (FLAP) located 5' upstream of the at least one internal nuclease blocker, and wherein the label is coupled via a linker to - the 5' end of the FLAP of the cleavable probe (5' linker), or - an internal nucleotide 5' upstream of the at least one internal nuclease blocker.

[0043] According to the present invention, the cleavable hydrolysis product of the cleavable probe preferably comprises at least one modification of at least one nucleotide comprising DNA backbone modifications, non-DNA backbone modifications and / or artificial bases, wherein - the DNA backbone modification comprises an artificial modification at the 2' and / or 4' position of the five-carbon sugar of a nucleotide and - Non-DNA backbone modification involves an artificial chemical modification coupled to the 5' end and / or the 3' end of the nucleotide.

[0044] In the embodiment of the cleavable probes, at least one primer pair is provided for each target sequence and optionally at least one primer pair for at least one reference sequence. All embodiments of target sequences and reference sequences apply accordingly to any embodiment in which a cleavable probe is used. Preferably, the primers were optimized to have the same melting temperatures, a similar GC content, and, if possible, to avoid repeating nucleotide motifs. Cleavable probes based on the teaching of EP4074839A1 were placed close to a primer whenever possible to obtain stronger fluorescence signals. Furthermore, the PCR buffer and polymerase were optimized to obtain the broadest possible linearity of all 14 PCR products of the examples presented here.

[0045] While in the embodiment of not necessarily cleavable probes for detection by imaging at least two different labels are used to ensure differentiated detection of the reference and target sequence, in this embodiment only one label is sufficient.

[0046] In all embodiments of the present invention relating to cleavable probes, the reference may be a reference nucleic acid sequence material (synonym: reference material) – measured by performing the method of the present invention (“real reference”) – or a digital reference nucleic acid sequence information (synonym: digital reference sequence) – which can be provided / loaded onto the respective analytical instrument, such as a MODAPLEX device. In a preferred embodiment, the reference is a digital reference or the corresponding signals representing its hydrolysis products. With respect to this reference, the released hydrolysis products are detected, and the presence of at least one copy number variation is confirmed.

[0047] In one embodiment of the present invention, the CNV of the at least one predetermined target sequence is determined by the respective released hydrolysis product in comparison to the at least one respective, in particular released, reference hydrolysis product of the reference. In a further embodiment of the method according to the invention, the respective reference hydrolysis product of the at least one reference is released from at least one reference sequence according to the method of the preceding claims or it is a digital reference hydrolysis product.By comparison, the CNV of the at least one predetermined target sequence of the CNV chromosomal region is evaluated based on the at least one released hydrolysis product of the specific probe for the at least one predetermined target sequence, relative to the copy number of the reference, in particular based on the at least one released hydrolysis product of the specific probe for the at least one reference sequence, as defined herein.

[0048] In another embodiment of the method according to the invention, the amplification of the at least one target sequence and optionally the at least one reference sequence is carried out by real-time PCR and the separation of the hydrolysis product(s) by capillary electrophoresis. Preferably, the method is carried out using a CE analysis instrument as defined herein, particularly preferably using the MODAPLEX device.

[0049] A further aspect of the present invention is a specific oligonucleotide probe suitable for hybridization to at least one predetermined target sequence in the CNV chromosomal region comprising the cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3 and / or 19p13.2, preferably to at least one predetermined target sequence in the cytoband 19p13.3 and to at least one predetermined target sequence in the cytoband 17p12, and / or to at least one reference sequence in the cytobands 1p31.3 and / or 2q35 and / or 12q24.31, each comprising - a 3' sequence which is inversely complementary to a sequence of the at least one predetermined target sequences or to a sequence of the at least one reference sequences.

[0050] In a preferred embodiment of these probes, the 3' sequences for at least one predetermined target sequence are selected from the forward and / or reverse primers of Table 2 and the 3' sequences for at least one reference sequence are selected from the forward and / or reverse primers of Table 2. The cleavable probes of Table 3 are also suitable. Starting from SEQ ID NOS. 29 to 42, the underlined sequences are suitable for converting the specific cleavable probe - which is specific for use in a CE device in combination with real-time PCR - into any suitable embodiment and into a probe for use in a method for detecting endometrial carcinomas of the CN high subtype by imaging, e.g. FISH probe or similar. In particular for adapting the probes to not necessarily cleavable probes for use in a method for detecting endometrial carcinomas of the CN high subtype by imaging, e.g. B. FISH probe or similar.The skilled person is able to adapt the underlined sequences to a probe for imaging in a tissue.

[0051] One approach for translating the "cleavable probe" or MOPAPLEX assay (probe and primer from Table 2 and Table 3) into an imaging method would be to use FISH probes bearing a suitable fluorophore at the 5' end of the oligonucleotide. A person skilled in the art can copy the sequence of the forward primer, probe, and / or reverse primer and then add an appropriate combination of fluorophores. Using the cleavable probes presented here as a sequence template would remove the 3'-end quencher and all 5'-end modification chemistry, as defined herein, and replace them with a standard FISH fluorophore.

[0052] As a specific example, one could take the target sequences of the invention and then modify the 5' end by adding a Cy3 and Cy5 fluorophore for a target and reference sequence, respectively.

[0053] It would also be suitable to limit the 14 targets, as used in the present example, to one target each on chr17, chr19 and one reference sequence each on chr1, 2, and 12. This would result in a 5-plex FISH that does not require cleavable probes or time-consuming stripping of the sample. The latter is necessary if one wishes to stain more than 5 targets with 5 different fluorophores. Alternatively, it would be useful to use only one fluorophore for all target sequences and only one fluorophore for all reference sequences, since the assessment of CNV and the identification of CNH are based on the average copy number in the entire detected region, i.e., the target region compared to the reference region. The same applies to any other suitable imaging method.

[0054] Preferably, the specific oligonucleotide probe of the present invention is a non-cleavable probe, wherein the at least one probe contains a detectable label, preferably a fluorophore or a hapten of a specific hapten pair. In this way, a fluorescent signal is detected upon hybridization or, upon addition of a further agent, a detectable signal is obtained (indirect imaging). Preferably, each probe comprises a combination of at least one probe for at least one predetermined target sequence and for at least one reference sequence, differentiating fluorophores. Such non-cleavable probes, e.g., FISH probes, are well known to those skilled in the art. However, FISH probes can also be cleavable to increase the degree of multiplexing of the imaging method; e.g., "photocleavable" or "selectively chemically cleavable" linkers are combined to release the fluorophore.This allows the probe to remain hybridized to its target sequence, but is no longer detectable and invisible. This allows for labeling a different sequence with a different probe and subsequent overlay of a series of images.

[0055] In another embodiment, the specific oligonucleotide probe is a cleavable probe, preferably for use in the method according to the invention and preferably in a multiplex method of the present invention, comprising in each case - a 3' sequence that is inversely complementary to a sequence of the at least one predetermined target sequences within a region located 3' downstream of a complementary sequence of at least one primer, preferably at least the forward primer; more preferably, the at least one primer or forward primer is the appropriate primer for amplifying the respective predetermined target sequence for which the specific probe is intended; the primer and probe combinations defined herein are suitable and accordingly preferred, - a protecting group (3'-blocker) at the 3'-end of the analyte-specific 3'-sequence that inhibits a primer extension reaction, and - at least one internal nuclease blocker at the 5' region of the hybridizing sequence of the probe, which confers resistance to nuclease activity and structurally separates the cleavable hydrolysis product from the 3' downstream cleavable probe, and wherein the cleavable hydrolysis product comprises • at least one nucleotide of the 5' end of the cleavable probe, and • a label, preferably a fluorophore, which is linked to the cleavable hydrolysis product via a linker.

[0056] A further aspect of the present invention is a combination of probes, in particular one of the described embodiments of not necessarily cleavable or cleavable probes, each probe being specific for - the reference sequence encoding within the region of the gene ZRANB2 and ZRANB2-AS1 on chromosome 1, wherein the probes preferably comprise the sequences of Seq ID No. 39 and Seq ID No. 40, - the reference sequence encoding within the region of the TMEM169 gene on chromosome 2, preferably the probes have the sequences of Seq ID No. 41 and Seq ID No. 42, - the reference sequence encoding within the region of the HCAR1 gene on chromosome 12, preferably the probes have the sequences of Seq ID No. 37 and Seq ID No. 38, - the target sequences encoding the COX10, ARHGAP44, ELAC2 and MYOCD genes, respectively, in cytoband 17p12, wherein preferably the probe for COX10 comprises the sequences of SEQ ID No. 29, the probe for ARHGAP44 comprises the sequences of SEQ ID No. 30, the probe for ELAC2 comprises the sequences of SEQ ID No. 31 and the probe for MYOCD comprises the sequences of SEQ ID No. 32, and - the target sequences encoding within the region of the genes ZNF555, TLE6, ZNF57 and ZNF77 in cytoband 19p13.3, wherein preferably the probe for ZNF555 has the sequences of SEQ ID NO: 33, the probe for TLE6 has the sequences of SEQ ID NO: 34, the probe for ZNF57 has the sequences of SEQ ID NO: 35 and the probe for ZNF77 has the sequences of SEQ ID NO: 36.

[0057] Preferably, the above combination is realized as a combination of cleavable probes suitable for use in a CE device, preferably for use in a MODAPLEX device. Particularly preferably, the probes described in Table 3 are combined according to the present invention. These probes may comprise the sequences underlined in Table 3, but may also have other modifications. In one embodiment of the present invention, any combination of the above-mentioned probes is combined with suitable primers for amplifying the target and reference sequences. Preferably, the probes are combined with suitable primers that have the technical feature comparable to the primers of Table 2. Even more preferably, suitable primers according to the present invention, particularly preferred for amplifying the analyte panel according to the invention, have the sequences from Seq ID No. 1 to Seq ID No. 28.A further aspect of the present invention is therefore a combination of primer pairs of Seq ID No. 1 to Seq ID No. 28 with a specific probe or a specific probe combination as defined herein, preferably of Seq ID No. 29 to Seq ID No. 42.

[0058] Another aspect of the present invention is a specific probe or a specific combination of probes, wherein the at least one probe or a combination thereof comprises the underlined sequences of SEQ ID NO: 29 to SEQ ID NO: 42. In one embodiment, the probes are not necessarily cleavable probes. Alternatively, the at least one probe or a combination thereof comprising the underlined sequences of SEQ ID NO: 29 to SEQ ID NO: 42 are cleavable probes. Preferably, these probes are suitable for use in a CE device, preferably for use in a MODAPLEX device. Various modifications, as disclosed herein or in the teaching of EP4074839A1, can be combined with the underlined sequences of SEQ ID NO: 29 to SEQ ID NO: 42 to create alternative probes according to the present invention.

[0059] Another aspect of the present invention is the use of at least one specific oligonucleotide probe as disclosed herein, or any combination thereof as disclosed herein, in a method for detecting endometrial carcinoma of a high copy number (CN high) subtype according to any of the preceding embodiments.

[0060] Another aspect of the present invention is a kit for detecting endometrial carcinoma of a high copy number molecular subtype (CN high), wherein at least one copy number variation (CNV) is detected for a CNV chromosomal region comprising at least one cytoband on chromosome 17 and / or chromosome 19, comprising - at least one suitable primer or primer pair for the amplification of one or more target sequences within the CNV chromosomal region, and - optionally at least one suitable primer or primer pair for the amplification of at least one reference sequence in the chromosomal cytobands 1p32.3, 1p32.2, 1p32.1, 1p31.3, 1p31.2, 1p31.1, 1p22.3, 1p22.2, 1p22.1, 1p21.3, 1p21.2 and / or 1p21.1 on chromosome 1 and / or 2q32.1, 2q32.2, 2q32.3, 2q33.1, 2q33.2, 2q33.3, 2q34, 2q35, 2q36.1, 2q36.2, 2q36.3 and / or 2q37.1 on chromosome 2 and / or 12q24.13, 12q24.21, 12q24.22, 12q24.23, 12q24.31, 12q24.32 and / or 12q24.33 on chromosome 12.

[0061] The kit for detecting endometrial carcinoma of a high copy number molecular subtype (CN high), wherein at least one copy number variation (CNV) is detected for a CNV chromosomal region comprising at least one cytoband of chromosome 17 and / or chromosome 19, comprising - at least one suitable primer or primer pair for the amplification of one or more target sequences within the CNV chromosomal region, preferably for the amplification of at least one or more target sequences selected from the positions of the genes COX10, ARHGAP44, ELAC2 and / or MYOCD in cytoband 17p12 and / or from the positions of the genes ZNF555, TLE6, ZNF57 and / or ZNF77 in cytoband 19p13.3, and - optionally at least one suitable primer or primer pair for the amplification of at least one reference sequence in the chromosomal cytobands 1p32.3, 1p32.2, 1p32.1, 1p31.3, 1p31.2, 1p31.1, 1p22.3, 1p22.2, 1p22.1, 1p21.3, 1p21.2 and / or 1p21.1 of chromosome 1 and / or 2q32.1, 2q32.2, 2q32.3, 2q33.1, 2q33.2, 2q33.3, 2q34, 2q35, 2q36.1, 2q36.2, 2q36.3 and / or 2q37.1 of chromosome 2 and / or 12q24.13, 12q24.21, 12q24.22, 12q24.23, 12q24.31, 12q24.32 and / or 12q24.33 of chromosome 12, preferably from at least one reference sequence in the chromosomal cytobands 1p31.3, 2q35 and 12q24.31, respectively.

[0062] Preferably, the kit or any embodiment thereof comprises the primer or combination of primer pairs having the technical property comparable to the primers of Table 2. Most preferably, the kit comprises suitable primers for amplifying the analyte panel of the invention and has the sequences from Seq ID No. 1 to Seq ID No. 28.

[0063] Preferably, the kit defined herein further comprises at least one probe or a combination of probes as described herein. More specifically, the kit for detecting endometrial carcinoma of a high copy number molecular subtype (CN high) comprises - at least one suitable primer or primer pair for the amplification of one or more target sequences within the CNV chromosomal region, and - optionally at least one suitable primer or primer pair for the amplification of at least one reference sequence in the chromosomal cytobands 1p32.3, 1p32.2, 1p32.1, 1p31.3, 1p31.2, 1p31.1, 1p22.3, 1p22.2, 1p22.1, 1p21.3, 1p21.2 and / or 1p21.1 on chromosome 1 and / or 2q32.1, 2q32.2, 2q32.3, 2q33.1, 2q33.2, 2q33.3, 2q34, 2q35, 2q36.1, 2q36.2, 2q36.3 and / or 2q37.1 on chromosome 2 and / or 12q24.13, 12q24.21, 12q24.22, 12q24.23, 12q24.31, 12q24.32 and / or 12q24.33 on chromosome 12, respectively. - at least one specific probe or a specific combination of probes, wherein the at least one probe or combination thereof comprises the underlined sequences of Seq ID Nos. 29 to 42, preferably a panel of probes comprising 8 probes for the target sequences and 6 for the reference sequences.

[0064] Another aspect of the present invention is a kit comprising the probes having the sequences of SEQ ID NO: 29 to SEQ ID NO: 42 alone or in combination with primers of SEQ ID NO: 1 to SEQ ID NO: 28. In another embodiment, the kit for detecting endometrial carcinoma of a high copy number molecular subtype (CN high) comprises - at least one specific probe, preferably a specific combination of probes, wherein the at least one probe or combination thereof comprises the underlined sequences of Seq ID No. 29 to Seq ID No. 42, - preferably, the combination of probes is suitable for detecting the analyte panel, which comprises 8 probes for the target sequences and 6 for the reference sequences.

[0065] In one embodiment, the probes are not necessarily cleavable probes. Preferably, the probes are suitable for use in a CE analysis instrument, preferably for use in a MODAPLEX device. Various modifications, as disclosed herein or in the teachings of EP4074839A1, can be combined with the underlined sequences from Seq ID No. 29 to Seq ID No. 42 to create alternative cleavable probes according to the present invention.

[0066] The invention is explained in more detail with reference to the figures, without limiting the invention to these embodiments. The figures show: Fig.: Distribution of target regions of the high copy number analysis kit. The CNH molecular subtype is assessed by evaluating the CNV of several target regions in two different unstable regions on chromosomes 17 (n = 4) and 19 (n = 4) compared to several nearly unchanging genomic regions on chromosomes 1, 2, and 12 (n = 2 for each chromosome). Fig.: XY plot showing the output data of the high copy number Analysis Kit from 79 analyzed endometrial cancer (EC) patient samples. The delta Ct values ​​for chromosome 19 (x-axis, dChr19) and 17 (y-axis, dChr17) were plotted, and the cut-off values ​​(thresholds) for determining the high copy number subtype were shown as dotted lines on both axes. Samples within the black rectangle were classified as high copy number negative. Conversely, samples with delta Ct values ​​for chromosome 17 and / or chromosome 19 outside the black rectangle were assigned to a high copy number subtype. (A) The filled black dots represent EC patient samples in which a mutated IHC p53 staining pattern was detected. (B) The filled black dots correspond to EC patient samples in which a high level of CNVs was detected by low-coverage whole-genome sequencing. Fig.: Representative representation of hematoxylin-eosin (H&E) staining (A, C) and immunohistochemistry (IHC) p53 staining (B, D) of two endometrial carcinoma specimens classified as high copy number positive and negative according to the present invention. (A and C) H&E staining was performed and analyzed by certified pathologists to confirm endometrial carcinoma in the two cases presented. Consistent with the present invention, the CNH-positive specimen (upper panels, AB) showed a nuclear accumulation p53 staining pattern in the IHC staining (B, arrows). No pathogenic phenotype for TP53 was observed in the CNH-negative specimen (lower panels, CD) (D). TP53 is similar to the current surrogate biomarker for CNH, and the nuclear accumulation phenotype is known to be associated with the respective molecular subtype. Nuclear accumulation of TP53 is caused by loss-of-function mutations in the TP53 gene.TP53 loss-of-function mutations are often associated with the loss of the second allele (wild type). Fig. : Low-coverage whole-genome sequencing (WGS) of two endometrial carcinoma samples classified as high-copy number positive and high-copy number negative according to the present invention. (A) Low-coverage WGS confirmed the high-copy number subtype identified by the present invention as well as by immunohistochemical (IHC) p53 nuclear staining ( Fig. was determined. (B) The opposite was true for the second sample, where no accumulation of CNVs was observed by low-coverage WGS. Accordingly, this sample was classified as negative for high copy number by both the present invention and IHC p53 nuclear staining (Figure 3D). Fig.: Cleavable probe according to the present invention (1) and hydrolysis product (3) after hybridization to the target DNA. A cleavable probe (1) consists of a single-stranded oligonucleotide (symbolized by a series of "T") whose sequence specifically hybridizes to a DNA strand of a target nucleic acid (2) and which has the following modifications: a PCR blocker (white, upward-pointing triangle) at its 3'-end and a nuclease-cleavable fluorophore (white diamond) that can be released as a hydrolysis product located at its 5'-end upstream of an internal nuclease blocker (white square, (4)). The hydrolysis product contains at least one target DNA-specific nucleotide (T) linked to an internal nuclease blocker via a phosphodiester bond.In addition, it may additionally consist of a modification (white circle) that does not hybridize with the target nucleic acid and / or a fluorophore (white diamond) that is linked via a linker (zigzag line) and can be quantified by a detection unit of a nucleic acid electrophoresis device. Fig.: Schematic design of various cleavable probe forms of the present invention. In the schematic representation, the cleavable probe (dark gray T) is hybridized to a target sequence (light gray T). F in a circle represents the label, preferably the fluorophore, which is attached via a linker (zigzag line) as defined herein. The linker can be an internal linker [c), f) and g)] or a 5'-terminal linker [a), b), d), e)]. S in a circle represents a spacer, and M in a circle represents another DNA backbone or non-DNA backbone modification that does not hybridize to the target sequence. The position of the internal nuclease blocker is indicated by a labeled black T, and the 3'-blocker (polymerase) is shown as a black rectangle.The cleavable hydrolysis product contains at least one target-specific nucleotide (shown) or several (not shown) linked to an internal nuclease blocker via a phosphodiester bond (T). The nuclease blocker is located at position -1 downstream of the 5' end of the hybridizing sequence (shown), but can also be located at position -2 or -3, or at -1 and -3 (not shown). The cleavable probe shown consists of 10 nucleotides, but 9, 8, 7, or 6 are sufficient, and more than 10 are also within the scope of the invention. Definitions

[0067] Unless defined above, definitions are given below for all aspects and all embodiments of the present invention.

[0068] An analyte is generally defined as a component of a sample with a measurable property (ISO 18113-1:2009). Molecular diagnostics of nucleic acids is a collection of techniques for analyzing nucleic acid sequence variations (e.g., genotyping of alleles such as single nucleotide polymorphisms, deletion-insertion polymorphisms, inversions, translocations between chromosomes, splice variants of RNA, repetitive sequences such as short tandem repeats), epigenetic modifications (such as CpG methylation or hydroxymethylations), post-transcriptional variants (e.g., RNA editing and alternative splicing, maturation of RNA by polyadenylation, ADP-ribosylation, conversion of adenine to inosine, ribonuclease degradation, etc.) or quantitative changes of certain DNA (e.g., copy number variants) or RNA sequences (e.g., mRNA in gene expression).Nucleic acid sequence variants are surrounded by unique stretches of constant nucleic acid sequences that define their position within reference genomes and thus their specificity in complex genomes or DNA mixtures of different organisms (e.g., analysis of microbiomes, environmental samples). Constant DNA stretches of up to 35 bp, defined here as target sequences, are almost sufficient (depending on sequence complexity and the specifics of the detection technology) to define nucleic acid primers and / or probes that can be used to analyze the presence of a unique DNA variant in a complex test sample of purified DNA.Taking these features into account, each nucleic acid sequence variation (synonym “variant”, “molecular variation”), epigenetic modification or quantitative nucleic acid alteration together with at least one unique addressing sequence defines a specific molecular genetic analyte (synonym “analyte”).

[0069] Copy number variations (CNVs) are structural variations in the (human) genome and the result of deletions or amplifications of chromosomal segments. Consequently, the absolute copy number of a subset of genes varies between (healthy) individuals within a population. It is well known that CNVs have played and continue to play a key role in the evolution of novel gene variants, which in turn can increase the overall fitness of a population. In the context of malignant diseases, pathological copy number variations can lead to growth / fitness advantages for the affected transformed cells, e.g., when chromosomal segments encoding tumor suppressor or proto-oncogenes are deleted (on one or both alleles) or amplified.

[0070] In the context of the present invention, molecular subtyping of (malignant) diseases describes the process of grouping tumors of one and the same entity based on their profile of genetic alterations. The observation that cancer patients suffering from a malignant disease of the same entity respond differently to standard therapy led to the development of the concept of molecular subtyping. Molecular subtypes of malignant cancers have been described and established in the last decade, as the costs of whole-genome / transcriptome sequencing have decreased significantly, leading to a substantial increase in sequencing data. For many tumor entities, molecular stratification has prognostic value for patients, as different molecular subtypes are associated with different progression-free and overall survival rates.Furthermore, treatment protocols tailored to molecular subtypes have been shown to improve patient outcomes. However, patient-specific stratification of cancer subtypes using whole genome / exome or transcriptional profiling is not feasible in routine diagnostics because it is time-consuming and relatively expensive. Therefore, determining molecular subtypes in cancers based on a much smaller subset of biomarkers is one of the greatest challenges in translational cancer research.

[0071] The high copy number (CNH) molecular subtype of endometrial cancer (EC) is one of the numerous discovered and characterized molecular subtypes in EC. CNH is associated with the accumulation of a large number of chromosomal aberrations caused by either deletions or amplifications (also referred to as somatic copy number plasticity, somatic copy number alterations (SCNA), or somatic copy number variation (SCNV)). In endometrial cancer, the high copy number subtype is associated with a poor prognosis. Furthermore, an abnormal staining pattern (nuclear accumulation) of the tumor suppressor gene TP53 (p53 protein) in immunohistochemistry (IHC) is characteristic of CNH in EC. Accordingly, p53 is a surrogate biomarker in molecular diagnostics for the determination of CNH.

[0072] A target sequence (synonyms: target, target nucleic acid, or template sequence or template) is a nucleic acid sequence that contains all the information required for the detection of a molecular genetic analyte using a specific technology. This includes the molecular variant (sequence and / or quantitative variant), the addressing sequence(s), and all other sequence information that is critical for technical reasons such as sequence amplification (e.g., primer binding sites in the polymerase chain reaction, accessory primer binding sites in loop-mediated isothermal amplification) or selective enrichment and / or detection by probe hybridization. Currently, a distinction is made between predetermined target sequences for the detection of CN high and reference sequences.

[0073] Biomarkers are analytes with scientific validity, where "scientific validity of an analyte" means the association of an analyte with a biological condition. Biomarkers are used, for example, for the detection of pathogens, the evaluation of environmental or bioprocess conditions, food quality testing, plant and animal breeding, forensics, veterinary medicine, and human medicine. In in vitro medical diagnostics, they serve as indicators of a normal or pathogenic biological process in a human (or patient), in this case endometrial carcinoma (EC). They also enable the evaluation of the pharmacological response to a therapeutic invention. A medical biomarker indicates a specific physical characteristic or a measurable biologically induced change in the body that is associated with a disease.The scientific validity of clinical biomarkers must be demonstrated in extensive clinical exploratory and validation studies. Furthermore, it is important to note that preanalytical (e.g., patient conditioning, sample collection, sample storage and transport, and test sample preparation) and analytical conditions (capabilities of the applied nucleic acid amplification and detection technology) have significant impacts on the scientific validity of biomarkers as well as the robustness and reproducibility of a diagnostic assay.

[0074] For the purposes of the present invention, cytoband is defined as encoded by the UCSC Genome Browser (https: / / genome.ucsc.edu / ; University of California, Santa Cruz, US-CA; date of online access: September 8, 2023) according to the human genome version T2T-CHM13 v2.0 / hs1. Table 1 shows the cytobands according to the present invention as defined in the claims. Certain suitable coding regions within these preferred cytobands are described below.These are also suitable target sequences within the meaning of the present invention and are encompassed by the present invention: MYH13, MYH8, MYH4, MYH1, MYH2, MYH3, SCO1, ADPRM, TMEM220, PIRT, RN7SL601P, SHISA6, DNAH9, ZNF18, MAP2K4, MIR744, LINC00670, MYOCD, ARHGAP44, MIR1269B, ELAC2, HS3ST3A1, MIR548H3, COX10, CDRT15, ​​HS3ST3B1, CDRT7, CDRT8, PMP22, MIR4731, TEKT3, RN7SL792P, CDRT4, TVP23C, CDRT1, TRIM16, ZNF286A, TBC1D26, RNA5SP436, ADORA2B, ZSWIM7, TTC19, NCOR1, RN7SL442P, PIGL, MIR1288, CENPV, UBB, TRPV2, ZNF287, ZNF624, CCDC144A, RN7SL620P, USP32P1, KRT16P2, KRT17P1, TNFRSF13B, MPRIP, RN7SL775P, PLD6, FLCN, COPS3, NT5M, MED9, RASD1 and / or PEMT or any combination of two or more thereof. Even more preferred are DNAH9, ZNF18, MAP2K4, MIR744, LINC00670, MYOCD, ARHGAP44, MIR1269B, ELAC2, HS3ST3A1, MIR548H3 and / or COX10 or any combination of two or more thereof.Particularly preferred and used in the present experiments are MYOCD, ARHGAP44, ELAC2 and COX10. Furthermore, and TMPRSS9, TIMM13, LMNB2, GADD45B, GNG7, RN7SL121P, DIRAS1, SLC39A3, SGTA, THOP1, ZNF554, ZNF555, ZNF556, ZNF57, ZNF77, TLE6, TLE2, GNA11, GNA15, S1PR4, NCLN, CELF5, NFIC, DOHH, FZR1, MFSD12, C19orf71, HMG20B, GIPC3, TBXA2R, CACTIN, PIP5K1C, TJP3, APBA3, MRPL54, RAX2, MATK, ZFR2, ATCAY, RN7SL202P, NMRK2, DAPK3, MIR637, EEF2, PIAS4 and / or ZBTB7A or Any combination of two or more thereof is also suitable. Even more preferred are THOP1, ZNF554, ZNF555, ZNF556, ZNF57, ZNF77, TLE6, and / or TLE2, or any combination of two or more thereof. Particularly preferred, and as used in the present experiments, are ZNF555, ZNF57, ZNF77, and TLE6.Within the scope of the present invention, any combination of at least two or more of the regions comprising the above-mentioned genes has been identified that is suitable for identifying the CN high subtype of endometrial carcinoma (EC). Particularly preferred are MYOCD, ARHGAP44, ELAC2, COX10, and ZNF555, ZNF57, ZNF77, and TLE6. The CNV chromosomal region according to the present invention comprises at least one of the aforementioned genes or combinations thereof, most preferably MYOCD, ARHGAP44, ELAC2, COX10, and ZNF555, ZNF57, ZNF77, and TLE6.

[0075] Suitable reference sequences lie within the cytobands described in Table 1 and are preferably the reference sequences described in Table 3. These reference sequences are combined with all target sequences as described above.

[0076] A test sample, particularly a human test sample, is defined as the final product of the preanalytical process that flows directly into the analytical reaction. It contains the target sequences of interest (used as analytes) in a mixture together with matrix chemicals, the composition and concentration of which depend on the sample composition (see next definition) and the possible purification steps. Matrix chemicals can interfere with the analysis of the analyte or biomarker (matrix effect). The test sample contains the analyte or biomarker of interest and / or controls (water or nucleic acid-free sample buffer as a negative control, positive controls with spike-in reference standards, and / or internal amplification control). Test samples must be distinguished from samples and primary samples. Therefore, any embodiment of the method of the present invention may comprise a step for providing a test sample.

[0077] A sample encompasses all conceivable starting materials with a biological quantity, including an analyte or biomarker or an artificial barcode sequence (e.g., for traceability). In clinical diagnostics, a sample (also referred to as a biopsy from a living body or an autopsy after death) is a discrete portion of a body fluid or tissue taken for examination, study, or analysis of one or more quantities or properties assumed to apply to the whole (ISO 18113-1:2009 and ISO 21474-1:2019). Therefore, any embodiment of the method of the present invention may comprise a step of isolating and / or purifying the one potential nucleic acid comprising target sequences and at least one reference sequence prior to providing a test sample.

[0078] The primary sample (or a subsample thereof) is the sample that is prepared for shipment to or received by the laboratory and is intended for examination (ISO 21474-1:2019).

[0079] Nucleic acid sequencing encompasses any technology that allows the primary structure of nucleic acids to be encoded and is defined in detail in the teaching of EP4074839A1. The present invention is suitable for combination with such technologies, and the applicability of the invention disclosed herein is not limited to this combination of nucleic acid sequencing technologies.

[0080] The MODAPLEX device (Hlousek et al. 2012), as used in this invention, is a closed system for real-time multiplex nucleic acid analysis that combines two methods: i) polymerase chain reaction (PCR) and simultaneous ii) capillary electrophoresis (CE). It is defined in detail in the teaching of EP4074839A1. Suitable fluorophores for MODAPLEX devices (for channel 1 and channel 2) are listed below: Channel 1 (blue channel) Channel 2 (red channel) Atto465, Cyanine 2, Dy-478, Oregon Green 488, Dy-488, Dy-490, Alexa Fluor 488, (5), 6-FAM / Fluorescein / FITC, Dy-495, Atto488, Abbrerior STAR 488, Alexa Flour 500, Atto 495, Dy-505 AttoRho14, Abberior STAR 635, Abberior STAR RED, Atto633, Dy-630, Dy-631, Dy-632, Dy-633, Dy-634, Dy-635, Dy-641, Atto647N, Atto643, Alexa Fluor 647, Quasar 670, Cyanine 5, TYE665, LC Red 670, Dy-636, Dy-647, Dy-647P1, Dy-648, Dy-648P1, Dy-649, Dy-649P1, Dy-650, SiR, SPY650, Dy-651, Dy-652, Dy-654, LIZ, LC Red 670,

[0081] However, other fluorophores and combinations are also possible for channels 1 and 2. Other cyanines include CY3, CY3.5, CY5, CY5.5, CY7; Alexa 488, Rhodamine, and derivatives such as Texas Red, R6G, R110, TAMRA, ROX; Fluorescein and derivatives such as 5-bromomethylfluorescein, 2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE), 6-carboxylfluorescein (6-FAM), 1,2',4',1,4,-tetra-chlorofluorescein (TET), 2',4',5',7',1,4-hexa-chlorofluorescein (HEX), Lucifer Yellow, IAEDANS, benzophenoxazine, 7-Me-2N-coumarin-4-acetate, 7-OH-4-CH-3-coumarin-3-acetate, aminomethylcoumarin acetate (AMCA), monobromobimane, pyrene trisulfonates such as Cascade Blue, Oregon Green, and monobromomethylammoniobimane. Further examples of fluorescent dyes can be found, for example, in: E.g., in Johnson I and Spent MY (2010), and updates thereto, each of which is incorporated by reference. Fluorescent dyes are generally readily available from various commercial suppliers, including, for example, Molecular Probes, Inc.(Eugene, OR), Amersham Biosciences Corp. (Piscataway, NJ), Atto-Tec GmbH (Siegen, DE), Dyomics GmbH (Jena, DE), Applied Biosystems (Foster City, CA), etc. Fluorescein dyes and their derivatives are particularly preferred in the methods described herein. The same aforementioned labels, fluorescent dyes, are suitable for probes that are not necessarily cleavable and for use in the method of the invention, which comprises the detection of an endometrium by imaging.

[0082] In the present invention, fluorescently labeled and cleavable oligonucleotide probes were developed based on the teachings disclosed in EP4074839A1. The general structure of the cleavable probes is shown in Fig. shown and examples are shown in Fig.shown. In combination with the MODAPLEX instrument, the custom-designed cleavable probes represent a powerful tool that enables the construction of high-quality multiplex PCR assays. In the present invention, probes were custom-designed as disclosed in EP4074839A1, which are detected in both detection channels using the full resolution range of the electrophoresis instrument and are suitable for the detection of CN high according to the present invention.

[0083] Nucleic acid amplification technologies (NAT) refer to enzymatic methods for the in vitro amplification of nucleic acids, in particular of target sequences according to the invention. According to the invention, the target sequence is amplified in a repeated amplification reaction, preferably in a polymerase chain reaction (PCR) amplification reaction, which requires thermal cycling. PCR is well known to those skilled in the art. RNA can be amplified by reverse transcriptase after conversion to complementary DNA (cDNA). EP0506889B1, EP0632134B1, EP1152062B1, and WO2014023318A1 further disclose various real-time reverse transcriptase-PCR technologies for the amplification of RNA in individual reaction vessels. Other NATs proceed isothermally (iNAT).LAMP (loop-mediated isothermal amplification), HDA (helicase-dependent amplification), RPA (recombinase polymerase amplification), SIBA (strand invasion-based amplification), and RCA (rolling circle amplification) are examples of isothermal DNA amplification. Finally, real-time NASBA (nucleic acid sequence-based amplification) describes an iNAT for the direct amplification of RNA in combination with a hydrolysis probe (Keigthley et al. 2005). Experts in this field are aware of other technologies, such as NGS, that can be based on NAT.

[0084] Multiplex NAT, or more commonly multiplex testing (synonym: multiplexing approach), describes the ability of an assay to query or detect more than one analyte or biomarker simultaneously in each test sample, ideally within a single reaction. Multiplex testing offers advantages in terms of time, cost, and information content, thus enabling more reliable results than singleplex testing ("monoplex" and "singleplex" are synonymous). Furthermore, the reduced number of steps reduces the risk of sample mix-ups or cross-contamination.Preferably, “multiplex” (synonym multiplexing) refers to the detection of several different analytes, preferably within different target sequences of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30 or more targets, e.g., at least 50, at least 100, at least 250 or more targets. Preferably at least 20, more preferably at least 30.

[0085] Nucleic acid electrophoresis, as defined in detail in the teaching of EP4074839A1 and applicable here accordingly. These technologies are applicable according to the present invention to separate nucleic acid amplification products and / or hydrolysis products by combining mass and charge within an electric field.

[0086] The MODAPLEX device (Hlousek et al. 2012) used in this invention is an automated system that combines a PCR thermal cycler with a denaturing capillary electrophoresis (CE) system to enable multiplexed amplification of DNA sequence targets and simultaneous quantification of DNA analytes or biomarkers. Other examples of CE devices that also support the invention and feature various optical detection units (see definition of fluorophores for MODAPLEX detector properties) with one to six channels are Applied Biosystems 3500 / 3500xL Genetic Analyzers and Applied Biosystems SeqStudio instruments (Thermo Fisher Scientific Inc., Waltham, MA), Applied Biosystems RapidHIT ID System, and Spectrum CE Systems (Promega Corp.)., Madison, US-WI), Beckmann Coulter CEQ™ 8000 Genetic Analysis System (Fullerton, US-CA), QIAxcel Advanced System (Qiagen GmbH, Hilden, DE), Nanofor® 05M (Syntol, Moscow, RU), CEQ8800 DNA Sequencer (Beckman Coulter, Brea, US-CA) and various nucleic acid fragment analyzers from Agilent Technologies Inc. (Santa Clara, US-CA) such as TapeStation, Bioanalyzer, Fragment Analyzer System, ZAG DNA Analyzer System, Femto Pulse System. The cleavable probes are suitable for any of the above methods.

[0087] MODAPLEX calibrators, as used herein, are at least one, preferably two or more non-replicable size standards detected in capillary electrophoresis in at least one fluorescence channel in a multiplex setup and that are unrelated to the analytes or biomarkers of interest (unrelated or artificial templates and primers). They consist of short DNA fragments 1–5 nucleotides in length, with a fluorophore attached to the 5' end, but can also be attached to an internal nucleotide. They define the range of amplicon detection by the MODAPLEX instrument's analysis software. In the examples described in this invention, MODAPLEX Size Standard 4 (SST4; Biotype GmbH, Germany) was used at a single final concentration. It consists of three size standards whose signal intensity is constant during PCR cycles.The SST4 also contains an amplification control calibrator (AC), which consists of an artificial template (not related to human DNA), the corresponding PCR primer pairs, and the corresponding probes. The AC and the three non-amplifying size standards run in the 6-FAM channel (blue channel). The calculated lengths are 114.5 bp, 169.18 bp, and 277.5 bp in the blue channel. The calculated length of the AC is 58.6 bp. However, the apparent length may vary slightly by a maximum of 5 bp without affecting the assay analysis. The AC calibrator also represents a template-independent PCR control and should be added to all sample, negative, and positive control wells. Alternatively, the PCR setup can be spiked with calibrators at an appropriate endpoint concentration. In this case, other markers must be used as template-independent PCR controls.The regions between the MODAPLEX calibrators can be divided into regions for target, allele, or profile calling of the amplicons of interest. However, an exact determination of the amplicon size is not possible.

[0088] Migration time is defined here as the time required for a labeled analyte, which according to the invention is labeled nucleic acids, to reach the detection point after electrokinetic injection in each of the respective PCR cycles. The MODAPLEX device uses "scans" as a unit for migration time, which corresponds to approximately 150 ms due to the detector's scanning rate of approximately 6.66 Hz. Migration times can be converted into migration lengths by linearly fitting the known migration lengths of the calibrator system components with their respective migration times (see the definition of the MODAPLEX calibrator above).

[0089] FLAP endonucleases (FEN) are structure- and strand-specific endonucleases that cleave the single-stranded DNA or RNA sequence of a forked, unpaired 5' end (5'-FLAP) of a DNA double helix. The nuclease preferentially cleaves after the first 5'-hybridized nucleotide, but is not restricted to this cleavage site. It can also cleave after the second, third, fourth, and fifth hybridized nucleotides of 5'-flapped nucleotides. Thus, the hydrolysis reaction primarily produces hydrolysis products of size n+1, but also n+2, n+3, n+4, n+5, and n, n-1, n-2, n-3, n-4, etc., with the minimum fragment size being one. By combining the modifications described here, the desired cleavage site, as defined above, and thus the activity of the nuclease, can be determined and controlled. Examples of FEN within the meaning of the invention are based on the teaching of EP4074839A1.

[0090] Hydrolysis (cleavage) product. At least one 5'-terminal nucleotide of an oligonucleotide that is fully hybridized to the target sequence and that is hydrolyzed by a nuclease, preferably the FEN activity of a DNA-dependent DNA polymerase (e.g., Taq DNA polymerase). The resulting hydrolysis fragment (synonym for "hydrolysis (cleavage) product") always consists of at least one nucleotide (conventional or non-conventional) with a 3'-OH group and a fluorophore coupled via a linker. It may also contain further modifications, which may include additional nucleotides if they have not hybridized to the target DNA strand (flapped nucleotides). Before hydrolysis by the FEN, the "hydrolysis (cleavage) product" or hydrolysis fragment is part of the probes from alternatives a) or c), as defined below. It is hydrolyzed, cleaved or cleaved by the cleavable probes of the present invention.a) or c) released after the probes have hybridized or annexed to a DNA strand of a target nucleic acid. In a preferred embodiment of the invention described herein, each hydrolysis product has or is characterized by a unique migration pattern that results in a peak (curve) in the separation during, preferably capillary, electrophoresis, as defined herein. Specificity of the signal according to the present invention means and is defined identically as in the teaching EP4074839A1 in combination with the present invention. Fig. 5a ( Fig. 1 A in EP4074839A1).

[0091] Oligonucleotide cleavable probes according to the invention (see also Fig. 5, Fig.6) are based on the teaching of EP4074839A1 and comprise an oligonucleotide (preferably with a minimum length of 5 nucleotides) whose sequence specifically hybridizes to a complementary nucleic acid strand, preferably DNA, of a target nucleic acid ( Fig. 5. (2)) and further include: - A PCR blocker at its 3'-end (synonym protecting group), as described here - an internal nuclease blocker as described here, and - a cleavable hydrolysis product ( Fig. 5, (3)) to be released by a nuclease, preferably FEN, as described herein, wherein the cleavable hydrolysis product is located at the 5' end upstream of the internal nuclease blocker and comprises - at its 3'-end at least one target-specific (complementary) nucleotide (complementary to the strand of the target sequence to which it belongs) bound to the internal blocker via a phosphodiester bond. - it may additionally contain at least one modification described here which does not hybridise with the target sequence and / or - a label, preferably a fluorophore (e.g., for use with the MODAPLEX device described here or Applied Biosystem from Thermo Fisher Scientific), which is bound via a linker to the cleavable hydrolysis product, either to the at least one modification or to the at least one target-specific (complementary) nucleotide, wherein the label can be quantified by a detection unit of a nucleic acid electrophoresis device, preferably a MODAPLEX device. In one embodiment of the invention, the cleavable hydrolysis product does not contain a label (e.g., for use with CE / MS systems from Agilent), but remains detectable and quantifiable. In this embodiment, the gel contains an intercalating dye, e.g., SYBR Green.

[0092] The function of the cleavable probe is to enable the detection of at least one analyte in a test sample and to provide a cleavable hydrolysis product to generate a specific signal. The released hydrolysis product thus confirms that the respective cleavable probe has specifically hybridized to its complementary sequence on the target and allows visualization of the specific hybridization through the migration pattern with peaks (curves) of the hydrolysis products. Nucleic acid hybridization (syn. hybridization) is the binding of two complementary single-stranded deoxyribonucleic acid molecules to an antiparallel double-stranded DNA sequence (non-covalent DNA double helix formation). The two strands are stabilized primarily by hydrogen bonds between the corresponding nucleic acid bases (Watson-Crick), London dispersion forces, and the hydrophobic stacking of neighboring base pairs (Altun et al.2021). The thermodynamics of the process have been extensively studied, and the most suitable sequence-specific prediction method is based on the nearest neighbor (NN) model (SantaLucia 1998). For synthetic nucleic acid bases (e.g., C5-propynyl derivatives of pyrimidine bases, He and Seela 2002) or backbone modifications such as locked nucleic acid (LNA; McTigue et al. 2002), different parameters must be considered.

[0093] DNA backbone modifications of (synthetic) nucleotides or oligonucleotides or nucleic acid analogues as defined in the present invention are based on the teaching of EP4074839A1 (comprising artificial modifications at the 2' and / or 4' position of the five-carbon sugar (ribose or deoxyribose): The backbone of oligonucleotides refers to the internal nucleotide linkage and / or the sugar part. In bridged nucleic acids (BNAs), the sugar ring is modified by a bridge or a third ring structure. ENA (2'-0,4'-C-ethylene-bridged nucleic acid), BNA3 (2'-O,4'-aminoethylene-bridged nucleic acid), and LNA (Locked Nucleic Acid, ribose part modified with an additional bridge connecting the 2' oxygen and the 4' carbon) are well-established examples. But there are others as well. Other neutral backbones include phosphorodiamidate morpholino oligomers (PMO) or peptide nucleic acid modifications (PNA).DNA backbone modifications that form an internal bridge are summarized in the group of "bridging DNA backbone modifications" and may differ from those listed here. The above-mentioned DNA backbone modifications are known to confer resistance to nucleases and can increase the duplex stability of primers and probes with target nucleic acids. Modifications at the 2'-sugar position with methyl and methoxyethyl groups are also possible. Modifications at the 2'-position are well tolerated in oligonucleotide duplexes. The modifications of the probes used in the examples of the present invention are described in Table 3.

[0094] The feasibility of the inventive internal nuclease blocker LNA is demonstrated here by rendering the hybridized cleavable probe resistant to nuclease activity at the defined position. Similar or improved resistance can be achieved with ENA, BNA3, PMO, PNA, ortho-TINA, or para-TINA nucleotides.

[0095] A further embodiment of the cleavable probe is that the at least one nuclease blocker is located either at position -1 (downstream) or at position -2 (downstream) from the 5' end of the hybridizing sequence of the probe, which in particular hybridizes with its target sequence, thereby conferring resistance as defined herein. Examples 8 and 9 of EP4074839A1 demonstrate the use of LNA and also other blockers suitable for probes, in particular cleavable probes, of the present invention, and their use in the method of the present invention for detecting endometrial carcinoma.

[0096] A further aspect of the present invention is the cleavable probe, wherein the cleavable hydrolysis product comprises a non-specific 5' sequence (FLAP) of the analyte located 5' upstream of the at least one internal nuclease blocker, preferably LNA, ENA, BNA3, PMO, PNA, ortho-TINA or para-TINA nucleotides, and wherein the label is attached via a linker to - the 5' end of the FLAP of the probe (5' linker), or - an internal nucleotide 5' upstream of the at least one internal nuclease blocker.

[0097] Non-degradable probes, especially for imaging procedures, may also include FLAPs.

[0098] Non-DNA backbone modifications of synthetic nucleotides or oligonucleotides are artificial chemical modifications that are coupled to the ends (5' or 3') of an oligonucleotide or to internal nucleotide bases. This can occur during solid-phase synthesis of oligonucleotides at the 5' end or internally using specifically modified phosphoramidite building blocks, or at the 3' end by starting the oligonucleotide synthesis cycle with specifically modified solid supports such as controlled porous glass (CPG) or macroporous polystyrene (MPPS). Alternatively, reactive chemical groups (e.g., thiol, amino, carboxyl, terminal alkyne) can be introduced during solid-phase synthesis by non-nucleoside phosphoramidites or added by postsynthetic processing steps (after completion of automated synthesis and cleavage from the support) to be available for a variety of chemical coupling reactions.One or two non-bridging oxygen atoms of the phosphate group can be replaced by sulfur, resulting in phosphorothioates (PTO) and phosphorodithioates (diPTO), respectively. In alkyl or aryl phosphonates, which are uncharged analogues of phosphodiesters, one non-bridging oxygen atom of the phosphate group has been replaced by an alkyl or aryl group. This non-DNA backbone modification confers resistance to nuclease activity on the nucleotide bearing the at least one modification. The teaching of non-DNA modifications of synthetic nucleotides or oligonucleotides is based on the teaching of EP4074839A1 and applies accordingly to probes, in particular cleavable probes, for use in the present invention. Examples are shown here.

[0099] Spacers, as defined in this invention, are based on the teaching of EP4074839A1 and are a subgroup of non-DNA backbone modifications and are defined as chemical structures that are coupled to the 3' and / or 5' end of a nucleotide or between two nucleotides ( Fig. ). Spacers consist of a) Alkyl alcohol of (C n )-OH, wherein n is an integer and at least 3, preferably 3, 6, 9 or 12, comprising propanyl (spacer C3), hexanyl (spacer C6), nonanyl (spacer C9) and dodecanyl (spacer C12), b) Glycol ether of (-CH2-O-CH2-CH2) n -OH where n is an integer and at least 1, preferably comprising triethylene glycol (spacer 9), tetraethylene glycol (spacer 12) and hexaethylene glycol (spacer 18) and / or c) a tetrahydrofuran derivative with a methylene group in the 1-position of 2'-deoxyribose, also known as abasic furan, abasic spacer or dSpacer.

[0100] The chemical structures mentioned above are just a few examples of the most suitable spacers, but other spacers are also possible, and these examples are covered by the above definition. The spacer is coupled during phosphoramidite synthesis and flanked by two phosphodiester bonds or other backbone modifications. The next 5' building block can be a conventional nucleotide, a non-conventional nucleotide, an additional spacer, or a linker with a fluorophore.

[0101] Modified or artificial bases that replace their natural 2'-deoxynucleoside or ribonucleoside counterparts are a subset of backbone-less modifications that increase the stability of the nucleic acid duplex due to internal interactions with other bases via H-bonding. Modified bases include 2-amino-deoxyadenosine (2-amino-dA), 5-methyl-deoxycytidine (5-Me-dC), aminoethyl-phenoxazine-deoxycytidine (AP-dC, G-clamp), C-5-propynyl-deoxycytidine (pdC), and C-5-propynyl-deoxyuridine (pdU). In addition, there are intercalating nucleic acids such as oTINA (orthotwisted intercalating nucleic acid; (S)-1-O-[2-(1-pyrenylethynyl)phenylmethyl]glycerol} and (S)-1-O-(4,4'-dimethoxytriphenylmethyl)-3-O-(1-pyrenylmethyl)glycerol intercalating pseudonucleotides (IPN) or 3'-Minor Grove Binder (MGB, WO1996032496A2) serve as DNA duplex stabilizers and / or polymerase blockers.The teaching of modified or artificial bases is based on the teaching of EP4074839A1 and applies accordingly to probes, in particular cleavable probes, for use in the present invention. Internal nuclease blocker (synonym internal blocker or nuclease blocker) is defined as a nucleotide with at least one artificial modification that confers resistance to nuclease activity, in particular to nucleases, on that nucleotide. In other words, certain modifications described herein serve the function of blocking the nuclease at the position of the modification and thereby defining the cleavage site for the nuclease, which is located 5' upstream of the at least one internal nuclease blocker of the hybridization sequence. The addition of a second (or more) nuclease blockers downstream of the first does not change the cleavage site but reduces undesirable artifacts in the method described herein.In the event that the cleavable hydrolysis product of the invention comprises a FLAP as described herein, a nuclease blocker may be attached to the FLAP and a second internal nuclease blocker may be placed 3' downstream of the at least one hybridizing nucleotide of the 5' end sequence of the cleavable product as described herein (see . Fig.5A). A suitable modification is a DNA backbone modification, preferably a modification at the 2'-position of the sugar backbone, as defined above. These are particularly preferably 2'-O-methyl and 2'-O-methoxyethyl. Modifications outside the sugar backbone, as defined above, preferably a modification of the phosphate group in which one or two non-bridging oxygen atoms of the phosphate group are replaced by a sulfur, alkyl, and / or aryl group, confer resistance to nuclease activity, in particular to nucleases. Finally, any artificial modification or combination of two or more of the aforementioned modifications of a nucleotide that confers resistance to nuclease activity functions as an internal nuclease blocker within the meaning of the invention. The internal nuclease blocker is preferably a bridged or intercalating nucleic acid, such as LNA, TINA, orothers described herein or known from the prior art. The teaching of the internal nuclease blocker is based on the teaching of EP4074839A1 and applies accordingly to probes, in particular cleavable probes, for use in the present invention.

[0102] The at least one internal blocker has different functions. It contributes to the specificity of the signal or it contributes to the stringency of the signal without influencing the specificity. Depending on the label, preferably the fluorophore, selected for the specific design of the cleavable product of the cleavable probe within the framework of the method according to the invention, the signal (peak) achieved is distinct and clear (without undesired artifacts) and therefore specific within the meaning of the invention, but may, depending on the label, be accompanied by weak or indistinct, lower-migrating artifacts. In such cases, it is preferable to combine at least two or three nuclease blockers in the cleavable hydrolysis product of the cleavable probe. The first blocker has the function described here and in Fig. shown position, and the second and third blockers can be located immediately downstream of the above-mentioned position in Fig.The internal blocker also facilitates higher multiplexing by combining with flapped (mismatched) nucleotides upstream of the cleavage site. To ensure signal specificity (see further definitions), the first flapped nucleotide, the position immediately before the cleavage site, contains an internal nuclease blocker. The addition of flapped nucleotides beyond the blocked flapped position allows for tight control of the size of the cleavable hydrolysis product and its migration. This, in turn, allows for an increase in the degree of multiplexing that the cleavable technology can support.

[0103] The at least one modification and / or the internal nuclease blocker of the cleavable probe is intended to ensure that a defined hydrolysis product is released from the cleavable probe by an enzyme with nuclease activity described herein at a defined cleavage site and is suitable for use in the method of the present invention, which is suitable for combining a plurality of cleavable probes.

[0104] Linkers are the result of coupling reactions: Coupling reactions, as defined here, are based on the teaching of EP4074839A1 and are all chemical reactions used to introduce a backbone, non-backbone modifications and / or a label into the probe, in particular into a nucleotide, and which are compatible with solid-phase phosphoramidite synthesis and / or the postsynthetic processing steps (e.g. release from the solid support, alkaline deprotection with inorganic bases or amines, HPLC) of oligonucleotides.A subset of established chemical processes are reactions of (a) activated organic acids [acid anhydrides, acid chlorides, N-hydroxysuccinimide (NHS) esters] or isothiocyanates with amino groups, (b) hydrazide or aminooxy groups with aldehyde groups, (c) iodoacetamide or maleimide (2,5-pyrroledione) with thiol groups, (d) cyanobenzothiazoles with cysteine ​​groups, (e) click chemistry (azide-alkyne cycloaddition; El-Sagheer and Brown, 2012) without and with metal ion catalysis (e.g., copper ions), and (f) retro- (or reverse) Diels-Alder (rDA) reactions (e.g., reaction pairs tetrazine - trans-cyclooctene or tetrazine - norbornene). The various coupling reactions lead to chemical structures, referred to in this patent application as linkers, which are positioned between the (oligo)nucleotide and its modification or between the nucleotide and the label, preferably the fluorophore. Linkers currently available as reactive phosphoramidite regents include, for example,2-(3-aminopropyl)-1,3-dihydroxypropane phosphoramidite 2,2-di(e-aminopropyl)-1,3-dihydroxypropane phosphoramidite 3-amino-1,2-dihydroxypropane phosphoramidite 6-amino-1,2-dihydroxyhexane phosphoramidite.

[0105] Other technologies suitable for detecting and quantifying copy number variations include: - Next-generation sequencing (NGS): Illumina Next Seq, Thermo Fisher Ion Torrent, Oxford Nanopore - qPCR (quantitative) and dPCR (digital): Suitable primers are preferably used for the amplification of the at least one target sequence and at least one reference sequence. No probes, neither cleavable nor non-cleavable, are necessary for this embodiment. - FISH (flourescent in situ hybridization): Suitable probes, in particular cleavable and / or non-cleavable probes, are preferably used to detect the at least one target sequence and at least one reference sequence. No primers are required for this embodiment. - Array CGH (comparative genomic analysis): Affimetrix Thermo Fisher GeneChip™ (Santa Clara, US-CA), Agilent GenetiSure Cancer CGH+SNP Microarray (Santa Clara, US-CA) - NanoString Technologies nCounter ® (Seattle, US-WA) - DNA combing or optical genome mapping: Bionano ® Genomics Saphyr (San Diago, US-CA), Genomic Vision Fiber Comb® (Bagneux, FR) - Spatial biology imaging or in situ sequencing (3D genomics) or Hi-C (3C, 4C, etc.) technologies: Resolve Biosciences Molecular Cartography™ technology (Monheim am Rhein, Germany), Arima Genomics (Carlsbad, CA): Suitable probes, in particular cleavable probes and / or non-cleavable probes, are preferably used to detect the at least one target sequence and at least one reference sequence. No primers are required for this embodiment.

[0106] Finally, the teaching of the present invention is based on the unique and inventive new analyte panel for the identification and detection of endometrial carcinoma subtype CN high.

[0107] Finally, the teaching of the present invention and the novel and inventive analyte panel are highly suitable as biomarkers for the identification and diagnosis of endometrial carcinoma of subtype CN. Accordingly, the inventive solution is realized by targeting, labeling, amplification, and / or detection of the biomarker. The means for visualizing a signal as evidence of the detection of the biomarker are variable. At least three different concepts are disclosed herein. - Methods in which amplification of the target sequences and, where appropriate, the reference sequences is performed and CN high endometrial carcinoma is detected on the basis of the amplicons obtained. - Methods in which hybridisation of specifically labelled probes, in particular non-cleavable probes, with the at least one target sequence and the at least one reference sequence is carried out and a CN high endometrial carcinoma is detected by imaging on the basis of a fluorescence signal in the test sample or the sample comprising a tissue. - Methods in which hybridization of specific cleavable probes (as disclosed in EP4074839A1) to the at least one target sequence and optionally to the at least one reference sequence and amplification of these sequences are performed, whereby a CN-high endometrial carcinoma is detected based on the hydrolysis products released in each case. Amplicons are obtained, but are not relevant for the identification of the CN-high endometrial carcinoma.

[0108] For all of the above-mentioned methods, all embodiments of the reference and target sequences defined herein are applicable. Preferably, the analyte panel comprises a reference comprising a reference sequence encoding the ZRANB2 and ZRANB2-AS1 gene locus on chromosome 1, as well as the reference sequence encoding the TMEM169 gene locus on chromosome 2, and the reference sequence encoding the HCAR1 gene locus on chromosome 12. This reference is used to detect the target sequences encoding the COX10, ARHGAP44, ELAC2, and MYOCD genes in cytoband 17p12, as well as the target sequences encoding the ZNF555, TLE6, ZNF57, and ZNF77 genes in cytoband 19p13.3. By targeting, labeling, amplification and detection of the analyte panel - ZRANB2, ZRANB2-AS1, TMEM169, HCAR1, COX10, ARHGAP44, ELAC2, MYOCD, ZNF555, TLE6, ZNF57, ZNF77 - as a suitable biomarker, CN high endometrial carcinoma is qualitatively identified and preferably quantified. Referenzen [1] Bokhman JV. Two pathogenetic types of endometrial carcinoma. Gynecol Oncol. 1983 Feb;15(1):10-7. doi: 10.1016 / 0090-8258(83)90111-7. PMID: 6822361 [2] Cancer Genome Atlas Research Network et al. Integrated genomic characterization of endometrial carcinoma. Nature. 2013 May 2;497(7447):67-73. doi: 10.1038 / nature12113. [3] Hoang LN, Kinloch MA, Leo JM, Grondin K, Lee CH, Ewanowich C, Köbel M, Cheng A, Talhouk A, McConechy M, Huntsman DG, McAlpine JN, Soslow RA, Gilks CB. Interobserver Agreement in Endometrial Carcinoma Histotype Diagnosis Varies Depending on The Cancer Genome Atlas (TCGA)-based Molecular Subgroup. Am J Surg Pathol. 2017 Feb;41(2):245-252. doi: 10.1097 / PAS.0000000000000764. PMID: 28079598. [4] Soslow RA, Tornos C, Park KJ, Malpica A, Matias-Guiu X, Oliva E, Parkash V, Carlson J, McCluggage WG, Gilks CB. Endometrial Carcinoma Diagnosis: Use of FIGO Grading and Genomic Subcategories in Clinical Practice: Recommendations of the International Society of Gynecological Pathologists. Int J Gynecol Pathol. 2019 Jan;38 Suppl 1(Iss 1 Suppl 1):S64-S74. doi: 10.1097 / PGP.0000000000000518. PMID: 30550484; PMCID: PMC6295928. [5] Plotkin A, Kuzeljevic B, De Villa V, Thompson EF, Gilks CB, Clarke BA, Köbel M, McAlpine JN. Interlaboratory Concordance of ProMisE Molecular Classification of Endometrial Carcinoma Based on Endometrial Biopsy Specimens. Int J Gynecol Pathol. 2020 Nov;39(6):537-545. doi: 10.1097 / PGP.0000000000000654. PMID: 32281774. [6] Concin N, Matias-Guiu X, Vergote I, Cibula D, Mirza MR, Marnitz S, Ledermann J, Bosse T, Chargari C, Fagotti A, Fotopoulou C, Gonzalez Martin A, Lax S, Lorusso D, Marth C, Morice P, Nout RA, O'Donnell D, Querleu D, Raspollini MR, Sehouli J, Sturdza A, Taylor A, Westermann A, Wimberger P, Colombo N, Planchamp F, Creutzberg CL. ESGO / ESTRO / ESP guidelines for the management of patients with endometrial carcinoma. Int J Gynecol Cancer. 2021 Jan;31(1):12–39. doi:10.1136 / ijgc-2020-002230. Epub 2020 Dec 18. PMID: 33397713. [7] Chang Z, Talukdar S, Mullany SA, Winterhoff B. Molecular characterization of endometrial cancer and therapeutic implications. Curr Opin Obstet Gynecol. 2019 Feb;31(1):24-30. doi: 10.1097 / GCO.0000000000000508. PMID: 30507624. [8] Jamieson A, Thompson EF, Huvila J, Gilks CB, McAlpine JN. p53abn Endometrial Cancer: understanding the most aggressive endometrial cancers in the era of molecular classification. Int J Gynecol Cancer. 2021 Jun;31(6):907-913. doi: 10.1136 / ijgc-2020-002256. Epub 2021 Feb 15. PMID: 33589443. [9] Huvila J, Pors J, Thompson EF, Gilks CB. Endometrial carcinoma: molecular subtypes, precursors and the role of pathology in early diagnosis. J Pathol. 2021 Apr;253(4):355-365. doi: 10.1002 / path. 5608. Epub 2021 Feb 6. PMID: 33368243.

[10] Aguilar M, Zhang H, Zhang M, Cantarell B, Sahoo SS, Li HD, Cuevas IC, Lea J, Miller DS, Chen H, Zheng W, Gagan J, Lucas E, Castrillon DH. Serial genomic analysis of endometrium supports the existence of histologically indistinct endometrial cancer precursors. J Pathol. 2021 May;254(1):20-30. doi: 10.1002 / path.5628. Epub 2021 Mar 9. PMID: 33506979; PMCID: PMC8252414.

[11] Mitric C, Bernardini MQ. Endometrial Cancer: Transitioning from Histology to Genomics. Curr Oncol. 2022 Jan 31;29(2):741-757. doi: 10.3390 / curroncoI29020063. PMID: 35200562; PMCID: PMC8870297.

[12] Jamieson A, Thompson EF, Huvila J, Gilks CB, McAlpine JN. p53abn Endometrial Cancer: understanding the most aggressive endometrial cancers in the era of molecular classification. Int J Gynecol Cancer. 2021 Jun;31(6):907-913. doi: 10.1136 / ijgc-2020-002256. Epub 2021 Feb 15. PMID: 33589443.

[0109] Aktuelle Veröffentlichung 3D Genomics: Payne AC, Chiang ZD, Reginato PL, Mangiameli SM, Murray EM, Yao CC, Markoulaki S, Earl AS, Labade AS, Jaenisch R, Church GM, Boyden ES, Buenrostro JD, Chen F. In situ genome sequencing resolves DNA sequence and structure in intact biological samples. Wissenschaft. 2021 Feb 26;371(6532):eaay3446. doi: 10.1126 / science.aay3446. Epub 2020 Dec 31. PMID: 33384301; PMCID: PMC7962746.

[0110] Hi-C paper: Lieberman-Aiden E, van Berkum NL, Williams L, Imakaev M, Ragoczy T, Telling A, Amit I, Lajoie BR, Sabo PJ, Dorschner MO, Sandstrom R, Bernstein B, Bender MA, Groudine M, Gnirke A, Stamatoyannopoulos J, Mirny LA, Lander ES, Dekker J. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 2009 Oct 9;326(5950):289-93. doi: 10.1126 / science.1181369. PMID: 19815776; PMCID: PMC2858594. ExampleMaterials and MethodsHuman endometrial carcinoma samples and patient cohorts

[0111] All medical research involving human subjects, including research on identifiable human material and data, was conducted in accordance with the applicable ethical standards of the Declaration of Helsinki of the World Medical Association (WMA, Ferney-Voltaire, FR), relevant legislation, and with the informed consent of the participants. The invention described here for the multiplex PCR-based identification of CNH-positive EC samples was developed using artificial template DNA and further optimized and verified using genomic DNA purified from primary EC tissue samples. The latter was obtained from two different sources: (1) 41 fresh-frozen EC samples were obtained from Indivumed GmbH (Hamburg, Germany) and (2) 38 FFPE EC samples from the Institute of Pathology of the Carl-Gustav-Carus University Hospital Dresden (Dresden, Germany).The mean ischemia time of the 41 fresh frozen tissue sections obtained was 16 min (min = 2 min, max = 95 min, median = 12 min). Additionally, information on age (mean = 68), BMI (mean = 31.3), and detailed clinical data were provided by Indivumed GmbH. All samples from the Indivumed cohort were diagnosed with C54.1 (ICD code for malignant neoplasms of the endometrium). The TNM classification of the cohort is as follows: 24 of 41 samples were classified as pT1a or pT1b, 10 samples as pT2, and 7 samples as pT3 or pT3b. Infiltration of draining lymph nodes was detected in 6 of 41 patients (n pN1(a) = 3; n pN2a = 3). In 5 patients, the lymph node status was unclear (pNX), and in 30 cases, no tumor cell infiltration into the lymph nodes was detected (pN0). Distant metastases were detected in only 2 of 41 cases.All patients in the Indivumed cohort did not receive neoadjuvant chemotherapy (= systemic therapy before surgery).

[0112] Very limited patient and sample data are available for the 38 FFPE-RBC samples from the Institute of Pathology at the Carl-Gutav-Carus University Hospital Dresden. However, endometrial cancer was confirmed for all 38 patient samples by certified pathologists. The FFPE-RBC samples from which gDNA was isolated are between 3 and 10 years old and were stored at room temperature. DNA purification from human EC FFPE samples

[0113] The 41 frozen EC samples from Indivumed GmbH were further processed at the Institute of Pathology at the Carl-Gustav-Carus University Hospital Dresden. The fresh-frozen EC samples were fixed in formaldehyde, dehydrated, and embedded in paraffin (FFPE) according to standard protocols. The FFPE samples from both cohorts, Indivumed and the Institute of Pathology at the Carl-Gustav-Carus University Hospital Dresden, were subsequently analyzed for their individual tumor content (TC). This was done by hematoxylin and eosin staining (H&E) of 4 µM microtome sections from FFPE. Subsequently, the starting material for DNA isolation was extracted directly from the FFPE tissue samples exclusively from tumor regions using a scalpel. DNA isolation was performed using the QIAamp DNA Micro Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions.The DNA purification protocol includes proteinase K digestion and is based on DNA binding to a silica matrix. DNA concentration was determined using a QuBit Fluorometer (ThermoFisher Scientific Inc., Waltham, MA) and the QuBit dsDNA BR Assay Kit (ThermoFisher Scientific Inc., Waltham, MA). Design and synthesis of PCR primers and cleavable probes

[0114] Primers and cleavable probes were designed within the respective target and reference sequence regions of the analytes on chromosomes 1, 2 and 12 (stable reference regions) and chromosomes 17 and 19 (unstable target regions) using the software Geneious 10.2.6 (Biomatters Ltd., Auckland, NZ) ( Fig. , Table 1). All oligonucleotides are summarized in Table 2 and Table 3. All oligonucleotides were purchased in HPLC-purified quality from commercial manufacturers. The amplicon lengths vary between 75 nt and 103 nt (Table 4). Table 1 - Definition of target regions and reference regions based on the human genome assembly T2T-CHM13 v2.0 / hs1 (GenBank Assembly GCA_009914755.4, as of January 24, 2022: https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_009914755.1 / ). Target regions (unstable regions) Reference regions (stable control regions) Chr17 Chr19 Chr1 Chr2 Chr12 17p13.3 1 - 3,288,940 19p13.3 1-6,889,318 1p32.3 50,078,975 - 55,482,505 2q32.1 182,589,081 - 188,988,809 12q24.13 111,876,910 - 113,875,849 17p13.2 3,288,941 - 6,400,012 19p13.2 6,889,319 - 12,724,341 1p32.2 55,482,506 - 58,377,946 2q32.2 188,988,810 - 191,589,136 12q24.21 113,875,850 - 116,381,153 17p13.1 6,400,013 - 10,707,908 1p32.1 58,377,947 - 60,678,767 2q32.3 191,589,137 - 197,084,040 12q24.22 116,381,154 - 117,687,226 17p12 10,707,909 - 16,002,309 1p31.3 60,678,768 - 68,377,386 2q33.1 197,084,041 - 202,981,065 12q24.23 117,687,227 - 120,287,197 17p11.2 16,002,310 - 23,892,419 1p31.2 68,377,387 - 69,177,517 2q33.2 202,981,066 - 204,581,908 12q24.31 120,287,198 - 125,408,188 1p31.1 69,177,518 - 84,240,464 2q33.3 204,581,909 - 208,679,779 12q24.32 125,408,189 - 128,730,796 1p22.3 84,240,465 - 87,743,231 2q34 208,679,780 - 214,984,516 12q24.33 128,730,797 - 133,324,548 1p22.2 87,743,232 - 91,344,645 2q35 214,984,517 - 221,185,014 1p22.1 91,344,646 - 94,148,241 2q36.1 221,185,015 - 224,783,144 1p21.3 94,148,242 - 99,147,340 2q36.2 224,783,145 - 225,681,833 1p21.2 99,148,341 - 101,649,187 2q36.3 225,681,834 - 230,582,566 1p21.1 101,649,188 - 106,737,488 2q37.1 230,582,567 - 235,189,048

[0115] The target and control regions, consisting of target and reference sequences, overlap cytobands. The cytobands highlighted in bold correspond to the binding sites of the respective primers and probes. However, the assay also works for primers / probes that bind to the adjacent cytobands.

[0116] Target sequences in chromosomal regions were identified and subsequently defined as target sequences for CNH determination using a comprehensive bioinformatics analysis of the publicly available sequencing dataset (whole genome sequencing) of 232 endometrial cancer patients from the TCGA-UCEC database. Two genomic regions that are highly unstable exclusively in the respective EC CNH-positive subcohort were found in the chromosomal regions 17p12 and 19p13.3. Within the EC patient cohort, all samples are affected by CNV in either the chromosomal region 17p12, 19p13.3, or both regions. In the analyzed patient cohort, deletions in these chromosomal regions are present in a significant proportion, while amplifications are rare.Subsequently, four molecular genetic analyses were established on both chromosomal regions, encompassing the target sequences of the MYOCD, ARHGAP44, and COX10 genes on chromosome 17 and the target sequences of the ZNF77, ZNF57, TLE6, and ZNF555 genes on chromosome 19. Within the scope of the invention described here, suitable PCR primers and suitable oligonucleotide probes, as defined herein, were produced, which enable the amplification of the respective predefined target sequences. Together with reference sequences, identification of the CNH subtype is possible with high accuracy.

[0117] Reference within the meaning of the invention comprises chromosomal reference regions (reference regions) and at least one or more reference sequences therein, which were identified analogously to the above-mentioned target regions. Within the same EC sequencing dataset, genomic regions were identified that are relatively stable with regard to the presence of CNVs. A total of three reference regions were combined to form the invention reference, located on the cytobands 1p31.3, 2q35, and 12q24.31. None of the three reference regions proved to be 100% stable in all CNH-positive samples of the 232 patient samples examined. CNVs in one of the three control regions were detected in 7.33%, 7.76%, and 3.02% for Chr1, Chr12, and Chr2, respectively. Two target regions affected by CNV were identified in 3.45% (Chr1 + Chr12), 0.86% (Chr2 + Chr12), and 0.43% (Chr1 + Chr2) of cases.Within the cohort, none of the datasets showed CNV in all three control regions within a single patient sample. The absence of CNV in all control regions within a sample was observed in 77.16% of the cohort. Overall, all three reference regions are required in combination to form a suitable reference region. Table 2 - Primers used in the examples. All oligonucleotides included in the high-copy-number assay are listed. The primer annealing temperature (Ta) of the primers was calculated using the IDT OligoAnalyzer tool (Na+ Conc. (monovalent cations) = 70 mM, Mg++ Conc. (bivalent cations) = 3 mM) (Integrated DNA Technologies, Coralville, IA, USA, now Danaher, Washington, DC). The position of the oligonucleotide target sites was defined based on the T2T-CHM13 v2.0 / hs1 (Jan 2022) genome and the UCSC Genome Browser (https: / / genome.ucsc.edu / index.html). SeqID No. . Oligo-type Sequence (5' → 3' end) Length [nt] Destination (location) T a [°C] Position guide (T2T-CHM13 v2.0 / hs1 (Jan 2022)) Gene location (T2T-CHM13 v2.0 / hs1 (Jan 2022)) 1 Forward primer 3F 25 COX10 (Chr17) 65.4 14,100,323 - 14,100,347- 13,977,314 - 14,116,468 2 Reverse Primer 3R GTGAGACGAAACCCCTTTGA 20 COX10 (Chr17) 63.3 14,100,394-14,100,413 3 Forward primer 4F 20 ARHGAP44 (Chr17) 63.8 12,816,357-12,816,376 12,696,996 - 12,899,110 4 Reverse Primer 4R 21 ARHGAP44 (Chr17) 64.3 12,816,418-12,816,438 5 Forward primer 5F 25 ELAC2 (Chr17) 66.5 12,899,537-12,899,561 12,899,079 - 12,925,488 6 Reverse Primer 5R 25 ELAC2 (Chr17) 66.3 12,899,610-12,899,634 7 Forward primer 6F TCTCATGGACCGGCTTCGAC 20 MYOCD (Chr17) 66.9 12,659,974-12,659,993 12,573,362 - 12,676,443 8 Reverse Primer 6R 21 MYOCD (Chr17) 63.1 12,660,044-12,660,064 9 Forward primer 7F CATTCAGCCAGTTGGACCAG 20 ZNF555 (Chr19) 64.1 2,825,359-2,825,378 2,816,764 - 2,835,759 10 Reverse Primer 7R 22 ZNF555 (Chr19) 62.5 2,825,430-2,825,451 11 Forward primer 8F CCATGGAGGGCTTCAGACAG 20 TLE6 (Chr19) 65.3 2,957,206-2,957,225 2,951,060 - 2,968,675 12 Reverse Primer 8R 22 TLE6 (Chr19) 66.1 2,957,259-2,957,280 13 Forward primer 9F 25 ZNF57 (Chr19) 64.7 2,889,249-2,889,273 2,876,161 - 2,892,538 14 Reverse Primer 9R 25 ZNF57 (Chr19) 64.2 2,889,327-2,889,351 15 Forward primer 10F 21 ZNF77 (Chr19) 63.4 2,912,800-2,912,820 2,906,814 - 2,918,459 16 Reverse primer 10R 24 ZNF77 (Chr19) 66.2 2,912,857-2,912,880 17 Forward primer 1F AAAAGCCCAGTGTCTACGTC 20 HCAR1 (Chr12) 63.3 122,725,475-122,725,494 122,721,459-122,726,228 18 Reverse Primer 1R CCTTTTCAATTTGGCCGTGG 20 HCAR1 (Chr12) 63.5 122,725,546-122,725,565 19 Forward primer 2F CTGCGTCTGACTTCATCA 20 HCAR1 (Chr12) 63.2 122,725,818-122,725,837 122,721,459-122,726,228 20 Reverse primer 2R AGTTTCTCTTCTCGCTGCTG 20 HCAR1 (Chr12) 63.3 122,725,879-122,725,898 21 Forward primer 11F 25 ZRANB2 (Chr1) 65.7 70,944,850-70,944,874 70,941,322 - 70,959,068 22 Reverse Primer 11R 25 ZRANB2 (Chr1) 65.4 70,944,926-70,944,950 23 Forward primer 12F 21 ZRANB2-AS1 (Chr1) 63.3 70,939,674-70,939,694 70,936,307 - 70,944,959 24 Reverse Primer 12R 22 ZRANB2-AS1 (Chr1) 63.7 70,939,743-70,939,764 25 Forward primer 13F AAGGCTTCCTCACCCAACTTC 21 TMEM169 (Chr2) 65.5 216,580,825-216,580,845 216,567,299-216,588,187 26 Reverse Primer 13R 25 TMEM169 (Chr2) 67.0 216,580,891-216,580,915 27 Forward primer 14F 23 TMEM169 (Chr2) 66.9 216,585,672-216,585,694 216,567,299-216,588,187 28 Reverse Primer 14R CTGGACCACAGCAGCGTAGA 20 TMEM169 (Chr2) 66.9 216,585,732-216,585,751 Table 3 - Overview of all cleavable probes used in the examples. All probes (based on the teachings of EP4074839A1) included in the high copy number detection assay are listed. The primer annealing temperature was calculated using the IDT OligoAnalyzer tool (Na+ Conc. (monovalent cations) = 70 mM, Mg++ Conc. (bivalent cations) = 3 mM). The position of the oligonucleotide target sites was defined based on the T2T-CHM13 v.20 genome and the UCSC Genome Browser (https: / / genome.ucsc.edu / index.html). Locked nucleic acids (LNAs) were denoted with a "+" (e.g., +T). Seq. ID No. Oligo-type Sequence (5' → 3' end) Length [nt] Destination (location) Feature / Change T a [°C] Position of probe binding (T2T-CHM13 v2.0 / hs1 (Jan 2022)) Location type 29 probe 24 COX10 (Chr17) (1) (1) (3) (4) (24) Atto643 (NHS ester) LNA(+C) LNA(+G) LNA(+A) 3' blocker C3 71.7 14,100,361 - 14,100,383 30 probe 23 ARHGAP44 (Chr17) (1) (2) (23) Dy649 (CuAAC) LNA(+T) 3' blocker C3 70.9 12,816,386 - 12,816,408 31 probe 21 ELAC2 (Chr17) (1) (2) (3) (21) Dy631 (NHS ester / C5 amino link) C12 LNA(+C) LNA(+A) 3' blocker C3 70.4 12,899,573 - 12,899,593 32 probe 22 MYOCD (Chr17) (1) (1) (3) (4) (22) Atto643(NHS ester / C5 amino link) LNA(+A) LNA(+C) LNA(+A) 3' blocker C3 71.3 12,660,013 - 12,660,033 33 probe 21 ZNF555 (Chr19) (1) (2) (21) 6-FAM - Pro (phosphoramidite) LNA(+A) 3'-blocker C3 69.3 2,825,388 - 2,825,408 34 probe 20 TLE6 (Chr19) (1) (2) (20) FAM(Hex) LNA(+C) 3' blocker C3 70.9 2,957,235 - 2,957,254 35 probe 20 ZNF57 (Chr19) (1) (2) (20) Dy495 (NHS ester / C5 amino link) LNA(+A) 3' blocker C3 69.4 2,889,280 - 2,889,299 36 probe 21 ZNF77 (Chr19) (1) (2) (3) (21) Atto488 (CuAAC) dSp LNA(+A) LNA(+G) 3'-blocker C3 70.4 2,912,831 - 2,912,851 37 probe 24 HCAR1 (Chr12) (1) (2) (3) (24) Atto643 (click over 5'-linker / ACH) C3 LNA(+C) LNA(+G) 3'-blocker C3 70.4 122,725,511 - 122,725,534 38 probe 20 HCAR1 (Chr12) (1) (2) (3) (20) Dy495 (ACH) LNA(+C) LNA(+C) 3' blocker C3 72.5 122,725,851-122,725,870 39 probe 25 ZRANB2 (Chr1) (1) (1) (3) (4) (7) (25) Dy649P1 (CuAAC) LNA(+T) LNA(+T) LNA(+C) LNA(+C) 3'-blocker C3 70.9 70,944,888 - 70,944,911 40 probe 21 ZRANB2-AS1 (Chr1) (1) (2) (6) (21) 6FAM-Hex (phosphoramitide) LNA(+C) LNA(+C) 3'-blocker C3 68.4 70,939,722 - 70,939,742 41 probe 21 TMEM169 (Chr2) (1) (2) (3) (21) Dy631(NHS ester / C5 amino link) C3 LNA(+T) LNA(+G) 3' blocker C3 70.1 216,580,855 - 216,580,874 42 probe 22 TMEM169 (Chr2) (1) (1) (3) (5) (6) (22) 6-FAM - Pro (phosphoramidite) LNA(+T) LNA(+G) LNA(+C) LNA(+C) 3'-blocker C3 75.5 216,585,708 - 216,585,728

[0118] The underlined sequences are suitable for adapting the above-mentioned specific cleavable probes to any suitable embodiment and not necessarily cleavable probes for use in a method involving detection of CN high endometrial carcinoma by imaging, e.g., FisH probe or the like. Table 4 - Overview of the amplicons of the copy number high detection assay Seq ID Target sequence Sequence ID Sequence amplicon Amplicon length [bp] P for P rev Sond e 43 Unstable region Chr17 (COX10) 1 2 29 91 44 Unstable region Chr17 (ARHGAP4 4) 3 4 30 82 45 Unstable region Chr17 (ELAC2) 5 6 31 98 46 Chr17 Unstable Region (MYOCD) 7 8 32 91 47 Unstable region Chr19 (ZNF555) 9 10 33 93 48 Unstable region Chr19 (TLE6) 11 12 34 75 49 Unstable region Chr19 (ZNF57) 13 14 35 103 50 Unstable region Chr19 (ZN F77) 15 16 36 81 51 Control region Chr12 (HCAR1) 17 18 37 91 52 Control region Chr12 (HCAR1) 19 20 38 81 53 Control region Chr1 (ZRAN B2) 21 22 39 101 54 Control region Chr1 (ZRANB2-AS1) 23 24 40 91 55 Control region Chr2 (TMEM169) 25 26 41 91 56 Control region Chr2 (TMEM169) 27 28 42 80

[0119] Polymerase chain reaction (PCR) protocol for the MODAPLEX 2.0 system: The PCR was performed in a final volume of 25 µL and contained 1× MODAPLEX Buffer 11 (Biotype GmbH, Dresden, DE; critical components in final concentrations of 20 mM Tris HCl buffer pH 8.8 at 25 °C, 50 nM KCl, 0.2 mM dNTPs and 3.0 mM MgCl2), 2.0 units of Hot Start Taq DNA Polymerase (Biotechrabbit, Berlin, DE), oligonucleotides (Table 2, Table 3) in an individually optimized concentration (0.05 - 0.4 µM), MODAPLEX Calibrator SST4 (Biotype GmbH, Dresden, DE) and 10 ng of human genomic DNA as template input. Before starting the PCR, the multiwell plates were sealed with aluminum sealing film (Biotype), spun in a tabletop centrifuge with a plate adapter, and the seal was carefully removed. Additionally, 40 µL of mineral oil (Merck - SIGMA-Aldrich, Darmstadt, Germany) was added to each well before starting the PCR.

[0120] PCR cycling combined with capillary electrophoresis using the MODAPLEX 2.0 system: The MODAPLEX 2.0 (Biotype GmbH, Dresden, Germany) is a modular device consisting of a PCR thermal cycler, an autosampler, a capillary gel electrophoresis device, and a fluorescence detector with two analysis channels (US7445893, US7081339, US7674582, US8182995; Hlousek et al. 2012). The MODAPLEX 2.0 was operated entirely with reagents from the manufacturer and according to the manufacturer's instructions.

[0121] The PCR was performed using the manufacturer's chemicals, with the final concentrations of the PCR primers and probes corresponding to those of standard PCR. The PCR program included a 2-minute hot-start enzyme activation at 98°C, followed by 2 cycles of 45 s at 60°C, 45 s at 73°C, and 5 s at 98°C, 4 cycles of 45 s at 59.5°C, 45 s at 72.5°C, and 5 s at 98°C, 10 cycles of 45 s at 59.0°C, 45 s at 72.0°C, and 5 s at 98°C, and 24 cycles, including 12 injections for CE separation, of 45 s at 58.5°C, 220 s at 71.5°C, and 10 s at 96°C. Real-time analysis by capillary gel electrophoresis was performed 12 times during the elongation phase at 72 °C using electrokinetic injection (10,000 V, 15 s) from cycles 17 to 39 (every other cycle). The detection unit records the fluorescence, expressed in relative fluorescence units (RFU), and provides an electropherogram as output based on the recorded migration time.Real-time PCR amplification curves are generated from all electropherograms recorded during different PCR cycles. Non-amplifying internal calibrators (see the MODAPLEX Size Standard 4 mentioned above), detected in the blue channel, are used in each assay to calculate the migration lengths of the hydrolysis fragments of the cleavable probes. The materials and methods were used for all patient samples analyzed in the presented example of the present invention. Immunohistochemical (IHC) p53 staining and evaluation

[0122] Determination of the high-copy-number subtype in endometrial cancer was performed by IHC staining of the surrogate marker p53, which harbors genomic mutations in approximately 90% of CNH-positive cases. IHC p53 staining of FFPE endometrial carcinoma tissue sections was performed according to standard protocols, including a deparaffinization step in xylene, rehydration of the samples with various dilutions of ethanol, multiple washes in 1x TBST buffer, a neutralization step of endogenous peroxidases in methanol with H2O2, a boiling step in sodium citrate buffer, blocking, incubation with anti-p53 antibodies, and a detection step with horseradish peroxidase. The IHC p53 staining of all 79 EC patient samples was evaluated and interpreted by certified pathologists from the Institute of Pathology at the Carl-Gustav-Carus University Hospital in Dresden.The staining patterns were divided into three distinct groups: (1) single-cell, (2) nuclear accumulation, and (3) loss. The single-cell pattern resembles the phenotype found in tissues without alterations of the TP53 gene (= non-pathogenic phenotype). However, nuclear accumulation is typical of loss-of-function mutations that lead to increased translation and reduced ubiquitinylation of p53 (= mutated TP53). Deletion of both TP53 alleles can lead to negative IHC p53 staining (= pathogenic phenotype). Whole genome sequencing (WGS) with low coverage of endometrial cancer samples

[0123] In addition to IHC p53 staining, low-coverage whole-genome sequencing (0.9x to <1.3x) was performed on genomic DNA from 47 of 79 FFPE tissue samples (Genewiz / Azenta Life Sciences, Leipzig, Germany) as an additional method to determine copy number and molecular subtype. Low-coverage WGS allows the detection of copy number variations in larger genomic regions with a resolution of approximately 10 kb. The genome-wide copy numbers of all samples were used for hierarchical clustering analysis. All samples with strong genomic aberrations fell into one cluster and were defined as high-copy-number samples (Nature 497, 67-73, 2013 and https: / / doi.org / 10.1038 / nature12325, "Erratum: Integrated genomic characterization of endometrial carcinoma").

[0124] A further aspect of the present invention is a combination of amplicons, in particular achieved by the method according to the present invention, preferably by any method or embodiment thereof comprising an amplification step, wherein the amplicons have the sequences Seq ID No. 43, Seq ID No. 44, Seq ID No. 45, Seq ID No. 46, Seq ID No. 47, Seq ID No. 48, Seq ID No. 49, Seq ID No. 50, Seq ID No. 51, Seq ID No. 52, Seq ID No. 53, Seq ID No. 54, Seq ID No. 55 and / or Seq ID No. 56. In particular, any combinations of the sequences are part of the invention. Preference is given to the combination of all of the aforementioned sequences. Alternatively, a combination of amplicons is also part of the invention, wherein each of the amplicons does not have the identical sequence, but a homology of at least 70%, 75%, 80%, at least 90%, at least 95%, 96, 97, 98, 99% to the respective Seq ID No. Example 1 - Comparison of high copy number determination of 79 human endometrial carcinoma samples using IHC staining of p53, low coverage sequencing, and the multiplex PCR-based MODAPLEX high copy number assay.

[0125] Genomic DNA isolated from 79 human EC tissue samples was analyzed using the invention presented here on the MODAPLEX 2.0 platform. Subsequently, primer efficiency correction was performed for all Ct values ​​(raw data are summarized in Table 5). The resulting Ct values ​​were averaged (arithmetic mean) for targets on 17p12, 19p13.3, and the reference sequences. Subsequently, the delta Ct value for 17p12 and 19p13.3 was calculated by subtracting the average Ct value of the control regions from the arithmetic mean for 17p12 and 19p13.3 (see Table 6). The plotting of the delta Ct values ​​obtained for 17p12 and 19p13.3 led to the identification of a larger cluster and a subset of samples with larger delta Ct values ​​for chromosome 17 and / or chromosome 19 compared to the main cluster (not shown).In one case, the delta Ct value for chromosome 19 was lower than in the sample population within the main cluster. The IHC p53 staining results were incorporated into the recorded delta Ct values ​​and show that 14 of 22 EC samples with TP53 mutations (according to IHC staining pattern) lie outside the main delta Ct17 / 19 cluster and 8 lie within it (Fig. Fig. Conversely, 55 of the 57 samples with a wild-type-associated pattern in IHC p53 staining were located within the major delta chromosome 17 / 19 cluster. Two of the 57 samples with a non-suspicious p53 staining pattern had high delta Ct values ​​for chromosomes 17 and 19, respectively. These data led to the assumption that the major cluster within the delta chromosome 17 / 19 plot might resemble the population of highly negative, high-copy-number samples. Table 5 - Summary of primer efficiency-corrected Ct values ​​of 79 genomic DNA samples from EC patients analyzed with the invention presented here. A total of 14 genomic targets were analyzed by simultaneous PCR amplification in one reaction. The raw Ct data were corrected based on the previously determined primer efficiencies. The targets can be divided into targets in the unstable regions on chromosomes 17 and 19 and stable control regions on chromosomes 1, 2, and 12. Sample ID Targets on 17p12 Targets on 19p13.3 Ref Goals 1p31.1 Ref Targets 2q35 Ref Targets 12q24.31 COX10 ARHGAP 44 ELAC2 MYOCD ZNF555 TLE6 ZNF57 ZNF77 ZRANB2 ZRANB2-AS TMEM 169 TMEM 169 HCAR1 HCAR1 1 23,65 22,87 22,57 22,60 24,76 22,88 26,22 26,09 25,08 24,96 22,09 24,43 24,46 27,11 2 23,98 23,25 23,00 23,03 25,27 23,26 26,52 26,28 25,40 25,25 22,42 25,03 24,99 27,17 3 24,08 23,32 23,51 23,55 25,74 23,79 27,10 27,13 26,08 25,96 22,75 24,90 24,72 27,19 4 24,01 23,00 23,78 23,82 26,17 24,15 27,18 27,42 26,35 26,02 22,43 24,43 25,72 28,41 5 23,99 23,03 22,98 23,18 25,39 23,23 26,53 26,32 25,54 25,22 22,75 24,80 24,96 27,09 6 24,27 23,43 23,32 23,34 25,57 23,40 26,81 26,59 25,84 25,51 22,24 24,33 24,58 26,51 7 23,08 22,15 22,53 22,70 24,43 22,52 25,99 25,20 24,98 24,31 22,75 24,57 24,49 26,19 8 24,49 23,44 23,11 22,97 25,44 23,52 26,45 26,43 25,42 25,56 22,64 24,96 25,20 27,20 9 24,08 23,24 23,29 23,38 25,49 23,42 26,76 26,79 25,75 25,61 22,80 24,89 25,00 27,22 10 23,96 23,24 22,89 22,97 25,16 23,21 26,39 26,32 25,40 25,42 22,49 24,90 24,70 26,67 11 24,00 23,13 22,67 22,55 25,24 23,17 26,11 26,51 25,13 25,29 21,93 24,11 24,86 26,89 12 23,62 22,73 22,10 22,24 24,68 22,69 25,70 25,94 24,72 24,93 21,44 23,65 24,43 26,41 13 23,55 22,74 22,48 22,62 24,59 22,65 25,95 25,80 24,84 24,90 22,27 24,68 24,09 26,13 14 22,95 21,98 22,61 22,78 24,81 22,79 26,89 26,44 25,73 25,41 22,87 25,24 24,82 26,72 15 22,99 22,08 22,21 22,41 24,23 22,17 25,70 25,26 24,49 24,03 22,38 24,51 24,26 26,03 16 23,35 22,33 22,51 22,74 24,48 22,55 26,02 25,28 24,92 24,64 22,62 25,21 24,50 26,37 17 22,06 21,10 22,91 23,30 24,92 23,06 26,48 25,66 25,52 24,69 22,23 24,35 24,91 27,30 18 22,77 22,06 22,20 22,52 24,08 22,19 25,65 25,22 24,67 24,22 22,04 24,42 24,15 26,11 19 23,56 22,76 22,63 22,79 24,78 22,74 26,01 25,87 25,17 24,72 22,31 24,41 24,57 26,58 20 23,34 22,31 23,33 23,34 25,52 23,48 26,40 26,31 25,54 25,03 22,50 24,54 24,45 26,49 21 23,58 22,65 22,83 23,04 24,88 22,83 26,23 25,86 25,23 24,69 22,63 24,56 24,73 26,65 22 23,90 23,07 22,98 23,18 25,08 23,10 26,33 26,06 25,46 24,95 21,88 24,30 24,89 27,07 23 23,09 22,25 23,66 23,94 25,76 23,72 27,18 26,34 26,03 25,79 22,70 25,28 25,15 26,87 24 23,73 22,89 22,93 23,08 25,22 23,08 26,30 25,97 25,34 24,80 22,86 25,14 24,81 26,77 25 22,95 22,17 22,93 22,84 25,20 22,86 26,27 25,61 25,33 24,77 21,90 24,12 24,10 26,33 26 23,54 22,84 22,83 22,99 24,89 22,83 26,14 26,05 25,22 24,66 22,72 24,93 24,66 26,61 27 22,76 21,95 22,04 22,52 24,08 22,22 25,54 25,00 24,57 23,93 22,46 24,35 24,08 25,95 28 23,96 22,90 24,62 25,03 26,67 24,72 27,03 26,94 26,08 25,63 23,03 25,39 24,65 26,83 29 23,78 22,79 23,79 23,83 26,15 24,05 27,42 27,72 26,66 26,20 23,21 25,52 25,25 27,43 30 22,44 21,45 22,52 22,86 24,29 22,60 25,95 25,13 24,97 24,17 22,84 24,63 24,55 26,27 31 22,89 22,16 22,51 22,78 24,37 22,36 25,89 25,21 24,89 24,13 22,89 24,89 24,53 26,16 32 23,64 22,86 22,30 22,77 24,68 22,70 26,10 26,00 24,97 25,00 22,63 24,99 24,88 26,68 33 23,08 22,34 22,82 23,06 24,99 22,97 26,49 26,41 25,42 25,25 22,28 24,50 24,31 26,66 34 23,57 22,88 22,38 22,63 24,70 22,78 25,91 26,19 25,14 24,92 22,44 24,86 24,52 26,77 35 22,91 22,05 22,19 22,55 24,09 22,24 25,64 25,12 24,68 24,04 22,47 24,50 24,09 25,98 36 22,81 21,87 22,21 22,52 24,00 22,06 25,58 24,97 24,40 23,79 22,42 24,53 24,11 25,97 37 23,72 22,81 22,84 22,92 25,09 23,02 26,27 26,12 25,23 24,99 22,54 24,64 24,81 26,71 38 24,02 23,12 22,79 22,68 25,31 23,24 26,08 26,41 25,32 25,20 22,11 24,41 24,79 26,78 39 22,78 21,82 22,52 22,96 24,41 22,50 26,04 25,46 25,02 24,58 22,96 25,01 24,79 26,33 40 24,01 23,23 23,09 23,33 25,12 23,25 26,60 26,39 25,53 25,24 23,09 25,52 25,04 27,06 41 23,19 22,52 22,04 22,29 24,36 22,35 25,76 25,73 24,72 24,63 21,94 24,08 24,17 26,23 42 24,05 22,93 23,88 24,14 25,54 23,63 27,56 25,44 26,61 24,75 24,91 26,58 26,37 26,87 43 24,50 23,75 23,29 23,29 25,51 23,58 26,87 26,64 25,93 25,61 22,73 25,17 25,25 27,33 44 23,68 22,83 23,16 23,42 25,13 23,14 26,77 25,73 25,86 24,86 23,16 25,34 25,20 26,85 45 22,91 21,98 22,82 23,16 24,55 22,35 26,82 24,95 25,76 24,10 23,31 25,16 25,25 26,05 46 23,00 22,08 22,83 23,26 24,54 22,46 26,55 25,06 25,46 24,00 23,38 25,00 25,74 26,64 47 25,44 24,74 24,13 24,13 26,55 24,86 27,45 27,23 26,57 26,12 23,48 25,78 25,96 28,08 48 23,92 22,90 23,38 23,89 25,48 23,53 27,03 25,99 26,00 25,01 23,64 25,41 25,53 26,93 49 25,26 24,52 24,02 24,11 26,30 24,69 27,53 27,29 26,69 26,21 23,72 25,72 25,80 28,04 50 23,01 22,19 23,22 23,49 24,67 22,38 26,83 24,60 25,76 23,84 24,00 26,09 25,08 25,88 51 24,73 23,80 23,73 23,71 25,80 24,17 27,26 26,61 26,26 25,70 23,53 25,58 25,82 27,56 52 24,97 24,20 24,13 24,18 26,24 24,42 28,23 27,67 27,47 26,27 24,08 26,23 26,18 27,86 53 24,29 23,34 23,69 23,77 25,84 24,08 27,09 26,55 26,25 25,45 23,65 25,59 25,59 27,27 54 25,16 24,33 23,88 24,13 26,23 24,39 27,61 27,45 26,52 26,16 23,55 25,65 25,97 27,73 55 23,71 22,63 23,74 24,53 26,45 24,47 27,75 25,76 26,85 25,64 24,24 26,14 25,86 27,03 56 23,09 22,08 23,01 23,40 24,79 22,76 26,81 25,13 25,46 24,29 23,42 25,41 24,92 26,33 57 23,55 22,40 23,57 23,78 25,47 23,13 27,25 25,31 26,35 24,79 23,91 26,21 25,59 26,64 58 25,08 23,96 24,35 24,32 26,32 24,59 27,85 26,33 26,99 25,68 24,66 26,82 26,55 27,93 59 24,13 22,98 24,23 23,99 25,99 23,55 27,91 25,69 27,19 24,79 24,46 26,32 25,97 26,79 60 24,09 23,39 23,30 23,27 25,46 24,00 26,48 25,69 25,71 25,08 23,01 25,44 25,26 27,20 61 24,12 23,18 23,87 23,87 26,01 23,59 27,36 25,36 26,70 24,60 24,10 25,86 25,87 26,84 62 24,74 23,72 24,35 24,58 26,59 24,49 27,74 26,33 26,75 25,57 24,37 26,21 26,56 27,61 63 24,67 23,51 24,57 24,68 26,44 24,14 28,17 26,19 27,29 25,44 24,96 26,71 26,75 27,55 64 23,56 22,53 23,54 23,78 25,39 22,92 27,44 25,33 26,25 24,70 23,94 26,36 25,73 26,39 65 24,17 23,11 23,90 23,98 25,94 23,75 27,55 25,84 26,72 25,01 24,23 26,21 26,18 27,01 66 26,01 25,26 24,77 24,66 26,92 25,57 27,86 27,46 27,07 26,47 24,31 26,83 26,59 28,73 67 23,76 22,87 23,87 24,01 25,53 23,34 27,32 25,25 26,75 24,54 24,45 26,00 25,68 26,61 68 24,93 24,09 25,24 25,12 26,62 24,33 28,17 25,56 27,46 24,62 25,74 27,53 26,21 27,12 69 24,28 23,33 23,93 24,07 26,07 23,95 27,51 26,20 26,61 25,49 23,95 25,95 26,10 27,55 70 25,00 24,01 24,91 24,92 26,57 24,63 28,52 26,55 27,80 25,48 26,06 27,57 26,84 27,69 71 23,96 22,98 24,05 24,21 25,74 23,61 27,62 25,66 26,82 25,04 24,43 26,13 26,18 26,99 72 23,51 22,51 23,43 23,83 25,36 23,08 27,12 25,20 26,16 24,39 23,81 25,70 25,61 26,27 73 24,16 23,32 24,13 24,29 26,16 24,09 27,60 25,85 26,60 25,00 24,44 26,47 26,08 27,27 74 24,02 23,17 23,83 23,75 25,49 23,43 27,29 25,64 26,47 24,52 24,37 26,50 25,45 26,75 75 23,58 22,86 24,00 24,05 25,61 23,68 27,57 25,90 26,81 24,98 23,48 25,78 25,30 26,41 76 23,98 23,16 23,88 24,08 25,85 23,70 27,55 25,68 26,97 25,11 24,35 26,37 26,17 26,93 77 23,32 22,42 23,53 23,80 25,00 22,71 27,31 25,10 26,27 24,52 24,12 25,93 25,61 26,34 78 22,78 21,89 22,62 23,25 24,32 22,28 26,56 24,92 25,30 24,14 23,53 25,42 24,94 25,94 79 23,25 22,22 23,64 23,85 25,31 23,26 27,31 25,68 26,50 24,87 23,08 24,88 25,21 25,94

[0126] To determine the high copy number status, low-coverage WGS was performed as an independent, precise molecular biological method. The genomes of all samples with particularly high or low Delta-Ct values ​​for chromosome 17 and / or 19 (n = 16), as well as 31 samples from the potential high-copy-number negative cluster, were sequenced (low-coverage WGS). Analysis of the sequencing data revealed that 16 of 18 samples with high positive copy number (according to low-coverage WGS) lay outside the main cluster plotted in the Delta-Ct17 / 19 diagram, which was previously considered to be the high negative copy number population ( Fig.For two samples with a characteristic cluster of CNVs of larger chromosomal fragments, the Delta Ct values ​​were neither particularly high nor low compared to the main cluster within the graph. For all samples (n = 29) for which no high-copy genotype was detected by low-coverage WGS, subtyping was consistent with the results of the invention.

[0127] The results of IHC staining, WGS and multiplex PCR of a representative example of a high copy number positive and negative EC sample are shown in Fig. shown.

[0128] Based on the data obtained from the analysis of the 79 patient samples and the determination of the blank and precision limits of the assay, Delta-Ct cut-off values ​​for chromosome 17 (-0.49 & -1.3) and 19 (0.75 & 1.73) were defined, which allow to determine the high copy number subtype in endometrial cancer based on PCR data generated with the primers and probes of the invention presented here.

[0129] The experimental data were further statistically analyzed using a confusion matrix calculation. Comparison with the IHC data resulted in the invention's sensitivity, specificity, and accuracy of 64%, 96%, and 87%, respectively. However, since WGS yielded several false-positive and negative ICH staining results, a confusion matrix analysis was additionally performed using the WGS dataset. The result: The invention's sensitivity (89%), specificity (100%), and accuracy (96%) were comparable to the WGS method.

[0130] Based on the given primary tissue sample set, the invention presented here outperformed IHC staining of p53, which is now considered a surrogate marker for high copy number in endometrial cancer. Furthermore, the sensitivity, specificity, and accuracy of the invention were comparable to WGS, which resembles a precise method for CNH detection but can take at least several days or weeks and requires up to 20 to 50 times more genomic DNA starting material. QUOTES CONTAINED IN THE DESCRIPTION

[0000] This list of documents submitted by the applicant was generated automatically and is included solely for the convenience of the reader. This list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions. Cited patent literature

[0000] EP 1478781 B1

[0002] EP 4074839A1 [0044, 0058, 0065, 0079, 0080, 0082, 0085, 0089, 0090, 0091, 0093, 0095, 0098, 0099, 0101, 0104, 0107]. EP 0506889B1

[0083] EP 0632134B1

[0083] EP 1152062B1

[0083] WO 2014023318A1

[0083] WO 1996032496A2

[0101] US 7445893

[0120] US 7081339

[0120] US 7674582

[0120] US 8182995

[0120] Zitierte Nicht-Patent Literature

[0000] ISO 18113-1:2009

[0077] ISO 21474-1:2019

[0077] Keigthley et al. 2005

[0083] According to Hlousek et al. 2012

[0086] Altun et al. 2021

[0092] LNA; According to McTigue et al. 2002

[0092] [ PubMed ] Bokhman JV. Two pathogenetic types of endometrial carcinoma. Gynecol Oncol. 1983 Feb;15(1):10-7. doi: 10.1016 / 0090-8258(83)90111-7. PMID: 6822361

[0108] Cancer Genome Atlas Research Network et al. Integrated genomic characterization of endometrial carcinoma. Nature. 2013 May 2;497(7447):67-73. doi: 10.1038 / nature12113

[0108] Hoang LN, Kinloch MA, Leo JM, Grondin K, Lee CH, Ewanowich C, Köbel M, Cheng A, Talhouk A, McConechy M, Huntsman DG, McAlpine JN, Soslow RA, Gilks CB. Interobserver Agreement in Endometrial Carcinoma Histotype Diagnosis Varies Depending on The Cancer Genome Atlas (TCGA)-based Molecular Subgroup. Am J Surg Pathol. 2017 Feb;41(2):245-252. doi: 10.1097 / PAS.0000000000000764. PMID: 28079598

[0108] Soslow RA, Tornos C, Park KJ, Malpica A, Matias-Guiu X, Oliva E, Parkash V, Carlson J, McCluggage WG, Gilks CB. Endometrial Carcinoma Diagnosis: Use of FIGO Grading and Genomic Subcategories in Clinical Practice: Recommendations of the International Society of Gynecological Pathologists. Int J Gynecol Pathol. 2019 Jan;38 Suppl 1(Iss 1 Suppl 1):S64-S74. doi: 10.1097 / PGP.0000000000000518. PMID: 30550484; PMCID: PMC6295928

[0108] Plotkin A, Kuzeljevic B, De Villa V, Thompson EF, Gilks CB, Clarke BA, Köbel M, McAlpine JN. Interlaboratory Concordance of ProMisE Molecular Classification of Endometrial Carcinoma Based on Endometrial Biopsy Specimens. Int J Gynecol Pathol. 2020 Nov;39(6):537-545. doi: 10.1097 / PGP.0000000000000654. PMID: 32281774

[0108] Concin N, Matias-Guiu X, Vergote I, Cibula D, Mirza MR, Marnitz S, Ledermann J, Bosse T, Chargari C, Fagotti A, Fotopoulou C, Gonzalez Martin A, Lax S, Lorusso D, Marth C, Morice P, Nout RA, O'Donnell D, Querleu D, Raspollini MR, Sehouli J, Sturdza A, Taylor A, Westermann A, Wimberger P, Colombo N, Planchamp F, Creutzberg CL. ESGO / ESTRO / ESP guidelines for the management of patients with endometrial carcinoma. Int J Gynecol Cancer. 2021 Jan;31(1):12–39. doi:10.1136 / ijgc-2020-002230. Epub 2020 Dec 18. PMID: 33397713

[0108] Chang Z, Talukdar S, Mullany SA, Winterhoff B. Molecular characterization of endometrial cancer and therapeutic implications. Curr Opin Obstet Gynecol. 2019 Feb;31(1):24-30. doi: 10.1097 / GCO.0000000000000508. PMID: 30507624

[0108] Jamieson A, Thompson EF, Huvila J, Gilks CB, McAlpine JN. p53abn Endometrial Cancer: understanding the most aggressive endometrial cancers in the era of molecular classification. Int J Gynecol Cancer. 2021 Jun;31(6):907-913. doi: 10.1136 / ijgc-2020-002256. Epub 2021 Feb 15. PMID: 33589443

[0108] Huvila J, Pors J, Thompson EF, Gilks CB. Endometrial carcinoma: molecular subtypes, precursors and the role of pathology in early diagnosis. J Pathol. 2021 Apr;253(4):355-365. doi: 10.1002 / path. 5608. Epub 2021 Feb 6. PMID: 33368243

[0108] Aguilar M, Zhang H, Zhang M, Cantarell B, Sahoo SS, Li HD, Cuevas IC, Lea J, Miller DS, Chen H, Zheng W, Gagan J, Lucas E, Castrillon DH. Serial genomic analysis of endometrium supports the existence of histologically indistinct endometrial cancer precursors. J Pathol. 2021 May;254(1):20-30. doi: 10.1002 / path.5628. Epub 2021 Mar 9. PMID: 33506979; PMCID: PMC8252414

[0108] Mitric C, Bernardini MQ. Endometrial Cancer: Transitioning from Histology to Genomics. Curr Oncol. 2022 Jan 31;29(2):741-757. doi: 10.3390 / curroncoI29020063. PMID: 35200562; PMCID: PMC8870297

[0108] Payne AC, Chiang ZD, Reginato PL, Mangiameli SM, Murray EM, Yao CC, Markoulaki S, Earl AS, Labade AS, Jaenisch R, Church GM, Boyden ES, Buenrostro JD, Chen F. In situ genome sequencing resolves DNA sequence and structure in intact biological samples. Wissenschaft. 2021 Feb 26;371(6532):eaay3446. doi: 10.1126 / science.aay3446. Epub 2020 Dec 31. PMID: 33384301; PMCID: PMC7962746

[0109] Hi-C Papier: Lieberman-Aiden E, van Berkum NL, Williams L, Imakaev M, Ragoczy T, Telling A, Amit I, Lajoie BR, Sabo PJ, Dorschner MO, Sandstrom R, Bernstein B, Bender MA, Groudine M, Gnirke A, Stamatoyannopoulos J, Mirny LA, Lander ES, Dekker J. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Wissenschaft. 2009 Oct 9;326(5950):289-93. doi: 10.1126 / science.1181369. PMID: 19815776; PMCID: PMC2858594

[0110] Nature 497, 67-73, 2013 und https: / / doi.org / 10.1038 / nature12325, „Erratum: Integrated genomic characterization of endometrial carcinoma

[0123]

Claims

[1] A method for detecting endometrial carcinoma of a high copy number molecular subtype (CN high), wherein at least one copy number variation (CNV) is detected for a CNV chromosomal region comprising at least one cytoband on chromosome 17 and / or chromosome 19, the method comprising the steps of - Providing a test sample of a subject containing at least one predetermined target sequence in the CNV chromosomal region, - Providing a reference comprising at least one or more reference sequences with a known copy number, - Determination of a CNV of at least one predetermined target sequence in the CNV chromosomal region, - Evaluation of the CNV of the at least one predetermined target sequence in the CNV chromosomal region in relation to the copy number of the reference, - Identification of endometrial carcinoma of subtype CN high, where the CNV for the CNV chromosomal region is determined as CN high compared to the copy number of the reference. [2] The method of claim 1, wherein the CNV chromosomal region comprises cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3 and / or 19p13.2 or a combination thereof. [3] The method according to claim 1 or 2, wherein in the step of determining a CNV of at least one predetermined target sequence in the CNV chromosomal region, the CNV is determined for at least one or more predetermined target sequences in at least one cytoband of the cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3 and / or 19p13.2 or in any combination of one or more of the aforementioned cytobands. [4] The method according to any one of claims 1 to 3, wherein in the step of determining a CNV of at least one or more predetermined target sequences in the CNV chromosomal region, the CNV is determined for at least one or more predetermined target sequences in cytoband 19p13.3 on chromosome 19 and for at least one or more predetermined target sequences in cytoband 17p12 on chromosome 17. [5] Method according to one of claims 1 to 4, wherein the at least one CNV is detected in the CNV chromosomal region for at least one or more target sequences within the region of the genes COX10, ARHGAP44, ELAC2 and / or MYOCD in cytoband 17p12 and / or for at least one or more target sequences within the region of the genes ZNF555, TLE6, ZNF57 and / or ZNF77 in cytoband 19p13. [6] The method according to any one of claims 1 to 5, wherein the reference comprising at least one or more reference sequences is provided with a test sample from the same subject, the method further comprising the steps - Determination of the copy number of at least one or more reference sequences, - Evaluation of the CNV of the at least one predetermined target sequence in the CNV chromosomal region in relation to the determined copy number of the at least one or more reference sequences of the reference, - Identification of an endometrial carcinoma of subtype CN high, determined as CN high compared to the determined copy number of the reference. [7] The method of any one of claims 1 to 6, wherein the reference is provided as a digital reference independent of the subject containing the at least one predetermined target sequence and independent of any test sample of any subject. [8] Method according to one of claims 1 to 7, wherein the reference comprises at least one reference sequence on chromosome 1 and / or at least one reference sequence on chromosome 2 and / or at least one reference sequence on chromosome 12. [9] Method according to one of claims 1 to 8, wherein the reference is at least one reference in the cytobands 1p32.3, 1p32.2, 1p32.1, 1p31.3, 1p31.2, 1p31.1, 1p22.3, 1p22.2, 1p22.1, 1p21.3, 1p21.2 and / or 1p21.1 on chromosome 1 and / or in the cytobands 2q32.1, 2q32.2, 2q32.3, 2q33.1, 2q33.2, 2q33.3, 2q34, 2q35, 2q36.1, 2q36.2, 2q36.3 and / or 2q37.1 on chromosome 2 and / or in the Cytobands 12q24.13, 12q24.21, 12q24.22, 12q24.23, 12q24.31, 12q24.32 and / or 12q24.33 on chromosome 12 or any combination thereof. [10] The method according to any one of claims 1 to 9, wherein the reference comprises at least one reference sequence in the cytoband 1p31.3 on chromosome 1, at least one reference sequence in the cytoband 2q35 on chromosome 2 and at least one reference sequence in the cytoband 12q24.31 on chromosome 12. [11] Method according to one of claims 1 to 10, wherein the reference comprises at least one reference sequence within the region of the ZRANB2 gene and at least one reference sequence within the region of the ZRANB2-AS1 gene on chromosome 1 and / or at least one reference sequence within the region of the TMEM169 gene on chromosome 2 and / or at least one reference sequence within the region of the HCAR1 gene on chromosome 12. [12] A method according to any one of claims 1 to 11, wherein the reference is negative for a CNV. [13] The method according to any one of claims 1 to 12, wherein the method comprises a step of providing suitable primers for the amplification of the at least one or more predetermined target sequences in the CNV chromosomal region and optionally suitable primers for the amplification of at least one or more reference sequences. [14] A method according to any one of claims 1 to 13, wherein the method further comprises a step of - contacting the test sample with the appropriate primers specific for the at least one or more target sequences and optionally for the at least one or more reference sequences, - Hybridization of at least one primer with its respective complementary sequence in the target sequence and optionally in the reference sequence, - Amplification of at least one target sequence and optionally the reference sequence, - Separation of the amplified target sequences and optionally the reference sequences, - Detection of the amplified target sequences and optionally the amplified reference sequences, and - Evaluation of the CNV of at least one target sequence in comparison to the copy number of at least one reference sequence. [15] Method according to one of claims 1 to 14, wherein the amplification and the detection of each of the at least one or more target sequences and optionally at least one or more reference sequences is carried out by means of real-time PCR, end-point PCR, digital PCR, geometric multiplexing PCR, digital droplet (or emulsion) PCR (ddPCR) or next generation sequencing (NGS). [16] The method according to any one of claims 1 to 15, wherein the at least one CNV for the CNV chromosomal region is determined by the at least one amplified target sequence in comparison to the at least one reference. [17] A method according to any one of claims 1 to 12, wherein the method comprises the steps - contacting the subject's test sample with at least one oligonucleotide probe (probe), each specific for the at least one target sequence, and with at least one oligonucleotide probe specific for the at least one reference sequence, - Hybridization of the respective probes with their respective complementary sequences in the test sample, - detecting an emitted signal of each hybridized probe, wherein at least one probe for the at least one target sequence and the at least one probe for the at least one reference sequence comprise mutually different fluorophores, - evaluating the fluorescence signal for the at least one predetermined target sequence in the CNV chromosomal region in relation to the fluorescence signal for the at least one reference sequence, and - Identification of endometrial carcinoma of subtype CN high, where the CNV for the CNV chromosomal region is determined as CN high compared to the copy number of the reference. [18] A method according to any one of claims 1 to 13, wherein the method comprises the steps - contacting the subject's test sample with suitable primers which are specific for the at least one target sequence and optionally for the at least one reference sequence, and contacting the test sample with at least one cleavable oligonucleotide probe (probe) which is specific for the at least one target sequence and optionally with at least one cleavable oligonucleotide probe which is specific for the at least one reference sequence, - hybridization of the at least one primer with its respective complementary sequence on a same strand of the same target sequence, wherein the cleavable probe hybridizes 3' upstream of the respective primer, and optionally hybridization of the at least one primer with its respective complementary sequence on a same strand of the same reference sequence, wherein the cleavable probe hybridizes 3' upstream of the respective primer, - Amplification of at least one target sequence and optionally of at least one reference sequence, - Cleavage of the hybridized cleavable probes with a template-dependent 5'-to-3' nuclease activity to release a cleavable hydrolysis product of the respective cleavable probe, - Separation of the released hydrolysis product(s) and - Detection of released hydrolysis products. [19] The method of claim 18, wherein the CNV of the at least one predetermined target sequence is determined by the respective released hydrolysis product in comparison to the at least one respective reference hydrolysis product of the reference. [20] Method according to claim 19, wherein the respective reference hydrolysis product of the at least one reference from at least one reference sequence is released according to the method of the preceding claims or is a digital reference hydrolysis product. [21] Method according to one of claims 18 to 20, wherein the amplification of the at least one target sequence and optionally of the at least one reference sequence is carried out by means of real-time PCR and separation of the hydrolysis product(s) by capillary electrophoresis. [22] A specific oligonucleotide probe suitable for hybridization to at least one predetermined target sequence in the CNV chromosomal region comprising the cytobands 17p13.3, 17p13.2, 17p13.1, 17p12, 17p11.2, 19p13.3 and / or 19p13.2, preferably to at least one predetermined target sequence in the cytoband 19p13.3 and to at least one predetermined target sequence in the cytoband 17p12, and / or to at least one reference sequence in the cytobands 1p31.3 and / or 2q35 and / or 12q24.31, each comprising - a 3' sequence which is inversely complementary to a sequence of the at least one predetermined target sequences or to a sequence of the at least one reference sequences. [23] The specific oligonucleotide probe of claim 22, wherein the at least one probe comprises a detectable label, preferably a fluorophore or a hapten of a specific hapten pair. [24] The specific oligonucleotide probe of claim 22, wherein the probe is a cleavable probe each comprising - a 3' sequence which is inversely complementary to a sequence of the at least one predetermined target sequences within a region located 3' downstream of a complementary sequence of at least one primer, - a protecting group (3'-blocker) at the 3'-end of the analyte-specific 3'-sequence, which inhibits a primer extension reaction, and - at least one internal nuclease blocker at the 5' region of the hybridizing sequence of the probe, which confers resistance to nuclease activity and structurally separates the cleavable hydrolysis product from the 3' downstream cleavable probe, and wherein the cleavable hydrolysis product comprises • at least one nucleotide of the 5' end of the cleavable probe, and • a label, preferably a fluorophore, which is linked to the cleavable hydrolysis product via a linker. [25] A combination of probes according to any one of the preceding claims, wherein each probe is specific for - the reference sequence encoding within the region of the ZRANB2 gene and at least one reference sequence within the region of the ZRANB2-AS1 gene on chromosome 1, - the reference sequence encoding within the region of the TMEM169 gene on chromosome 2, - the reference sequence encoding within the region of the HCAR1 gene on chromosome 12, - the target sequences encoding within the region of the genes COX10, ARHGAP44, ELAC2 and MYOCD in cytoband 17p12, and - the target sequences encoding within the region of the genes ZNF555, TLE6, ZNF57 and ZNF77 in the cytoband 19p13.

3. [26] A kit for detecting endometrial carcinoma of a high copy number molecular subtype (CN high), detecting at least one copy number variation (CNV) for a CNV chromosomal region comprising at least one cytoband on chromosome 17 and / or chromosome 19, comprising - at least one suitable primer or primer pair for the amplification of one or more target sequences within the CNV chromosomal region, and - optionally at least one suitable primer or primer pair for the amplification of at least one reference sequence in the chromosomal cytobands 1p32.3, 1p32.2, 1p32.1, 1p31.3, 1p31.2, 1p31.1, 1p22.3, 1p22.2, 1p22.1, 1p21.3, 1p21.2 and / or 1p21.1 on chromosome 1 and / or 2q32.1, 2q32.2, 2q32.3, 2q33.1, 2q33.2, 2q33.3, 2q34, 2q35, 2q36.1, 2q36.2, 2q36.3 and / or 2q37.1 on chromosome 2 and / or 12q24.13, 12q24.21, 12q24.22, 12q24.23, 12q24.31, 12q24.32 and / or 12q24.33 on chromosome 12. [27] The kit of claim 26, further comprising at least one probe or a combination of probes according to any one of claims 21 or 22 to 25. [28] A combination of amplicons obtained by the method according to any one of the method claims, wherein the amplicons have the sequences of Seq ID No. 43, Seq ID No. 44, Seq ID No. 45, Seq ID No. 46, Seq ID No. 47, Seq ID No. 48, Seq ID No. 49, Seq ID No. 50, Seq ID No. 51, Seq ID No. 52, Seq ID No. 53, Seq ID No. 54, Seq ID No. 55 and Seq ID No. 56.

Images