IFIT POLYPEPTIDES AND USES FOR THE TREATMENT OF TUBERCULOSIS INFECTIONS

Abstract

An in vitro method for increasing the cellular concentration of an interferon-induced protein with tetratricopeptide repeats (IFIT) polypeptide in a cell infected with a mycobacterium, wherein the method comprises introducing an expression vector comprising a polynucleotide encoding an exogenous IFIT polypeptide into the cell, wherein the exogenous IFIT polypeptide is selected from at least one exogenous IFIT1, IFIT2 or IFIT3 polypeptide, and wherein increasing the cellular concentration of the IFIT polypeptide reduces the number of viable mycobacteria in the cell.

Description

BACKGROUND OF THE INVENTION

[0001] Tuberculosis (TB) is a disease that defies effective clinical treatment. The robust nature of the disease, combined with outdated diagnostic methods, has made point-of-care treatment increasingly difficult, especially given the ever-increasing prevalence of drug-resistant strains.

[0002] Tuberculosis is the most serious poverty-related disease and a leading cause of infection-related mortality worldwide. The disease affects the most vulnerable and typically has a severe impact on the poorest and most marginalized groups, including migrants, prisoners, the homeless, smokers, drug and alcohol abusers, and people with weak immune systems.

[0003] According to the World Health Organization's (WHO) 2018 Global TB Report, tuberculosis is the leading cause of death worldwide. An estimated 1.5 million HIV-negative people died from TB in 2018.

[0004] Nearly one-third of the world's population is estimated to be infected with TB. Of those infected, an estimated 5-10% develop active TB during their lifetime, while the remaining 90% successfully control the bacteria. Some close household contacts of TB patients also remain uninfected and healthy, suggesting that the immune system is capable of controlling TB. Studying the host immune response to Mycobacterium tuberculosis (M. tb) may reveal the reasons for the mystery of infection and active disease.

[0005] The host immune response has been extensively studied in recent years, and it has been found to vary between different mycobacterial strains. It is known that pathogenic mycobacteria can survive in the host by inhibiting phagosome maturation. The pathogen survives in the optimal environment of the phagosome, and the mechanism responsible for its growth and survival in the host remains unknown.

[0006] The pathogen that causes tuberculosis, Mycobacterium tuberculosis, is able to survive in the host's defense cells (macrophages), which are supposed to destroy it. Current drug treatment for tuberculosis continues to lead to the emergence of drug-resistant strains of Mycobacterium tuberculosis. The increasing emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains suggests the need for new treatment approaches. This has motivated research into the development of new anti-TB drugs. A detailed understanding of this response to Mycobacterium tuberculosis infection is necessary to explore the host components and pathways manipulated by Mycobacterium tuberculosis to ensure its survival. Host-directed therapeutics (HDTs) have the potential to improve tuberculosis therapy because resistance to host mechanisms is unlikely.

[0007] Conventional TB treatment regimens consist of multiple drugs taken over extended periods. These drugs, which target the mycobacterium, have a number of negative side effects, and the development of TB strains resistant to these drugs is a major problem.

[0008] For example, WO 2017 / 123161 A1 proposes an alternative therapeutic method for preventing, treating, or inhibiting an intracellular mycobacterial infection in a patient. The method comprises administering a compound that activates the activity of an NAD+-dependent deacetylase such as sirtuins 1, 2, 3, 4, 5, 6, and 7. The use of sirtuin enhancers in combination with other anti-tuberculosis drugs for the treatment of mycobacterial infections is also disclosed.

[0009] Interferon-induced proteins with tetratricopeptide repeats (IFIT) and 2'-5'-oligoadenylate synthetase (OAS) proteins are a family of antiviral proteins that have been shown to confer immunity against viral infections. The OAS gene family, consisting of OAS1, OAS2, and OAS3, belongs to the interferon-induced genes and has cellular functions such as the induction of apoptosis, modulation of immune cell receptors, and autophagy. IFIT proteins have been shown to be conserved in vertebrates, and homologs have been identified in several organisms. These proteins are generally produced during viral infections, upon treatment with interferon (IFN), and / or upon recognition of pathogens by the immune system. The mechanism of action of these proteins during the course of a viral infection has been extensively studied.IFIT1 binds to non-self RNA, particularly capped non-self RNA transcripts that lack methylation at the first proximal nucleotide. IFIT1 thus inhibits the translation or replication of non-self RNA in an organism.

[0010] IFITs are known to prevent viral replication by binding viral proteins and RNAs and controlling their function, but their role against bacteria is not well understood. The human IFIT family comprises four members clustered on chromosome 10: IFIT1 (ISG56), IFIT2 (ISG54), IFIT3 (ISG60 or IFIT 4), and IFIT5 (ISG58) (Fensterl & Sen, 2011). The first discovered member of the IFIT family was human IFIT1 (a 56-kDa protein synthesized against IFN stimulation); its corresponding gene is ISG56 and was the first human ISG to be cloned (Kusari & Sen, 1987). IFITs are weakly induced in response to type III IFN (IFN-γ) and strongly induced in response to type I IFNs (IFN-α / β) and type III IFNs (IFN-λs) (Der, Zhou, Williams, & Silverman, 1998).The IFIT protein can distinguish between cellular and viral RNAs and binds to viral mRNA 5' ends whose caps lack 2'-O-methylation of the first ribose (Kumar et al., 2014).

[0011] IFIT1, IFIT2, and IFIT3 form a complex and bind to the 5'-ppp end of vesicular stomatitis virus (VSV). Conversely, VSV replication was restored when the genes expressing IFITs (1, 2, and 3) were silenced. The role of IFITs in the antimycobacterial response of macrophages and other immune cells has not been previously described. The invention relates to the novel induction of IFITs to kill mycobacteria in host immune cells, which can be used as a standalone anti-tuberculosis therapy or in combination with current first- or second-line drugs. SUMMARY OF THE INVENTION

[0012] The present invention relates to in vitro methods for increasing the cellular concentration of an interferon-induced protein with tetratricopeptide repeats (IFIT) polypeptide in a cell infected with a mycobacterium. The invention also relates to the use of expression vectors encoding an exogenous IFIT protein to stimulate an increase in intercellular IFIT protein concentrations.

[0013] According to a first aspect of the invention, there is provided an in vitro method for increasing the cellular concentration of an interferon-induced protein with tetratricopeptide repeats (IFIT) polypeptide in a cell infected with a mycobacterium, the method comprising introducing into the cell an expression vector comprising a polynucleotide encoding an exogenous IFIT polypeptide, wherein the exogenous IFIT polypeptide is selected from at least one exogenous IFIT1, IFIT2 or IFIT3 polypeptide, and wherein increasing the cellular concentration of the IFIT polypeptide decreases the number of viable mycobacteria in the cell.

[0014] In a first embodiment of the method according to the invention, the exogenous IFIT polypeptides comprise the following amino acid sequences IFIT1 (SEQ ID NO:1), IFIT2 (SEQ ID NO:2) and IFIT3 (SEQ ID NO:3).

[0015] In a second embodiment of the method, the polynucleotides encoding the exogenous IFIT polypeptides comprise the following nucleic acid sequences of IFIT1 (SEQ ID NO:4), IFIT2 (SEQ ID NO:5), and IFIT3 (SEQ ID NO:6). Those skilled in the art will appreciate that, due to the degeneracy of the genetic code, variations of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 will result in the production of the same amino acids listed in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. Furthermore, those skilled in the art can codon-optimize a nucleic acid sequence for expression in a particular environment, e.g., a particular cell type.

[0016] In a third embodiment of the method according to the invention, it is provided that a pharmaceutical compound selected from known mycobacterial therapeutics, namely from the group consisting of arginine, amikacin, bedaquiline, capreomycin, ciprofloxacin, clarithromycin, clavulanic acid, clofazimine, co-amoxiclav, cycloserine, enviomycin, ethambutol, ethionamide, imipenem, interferon-γ, isoniazid, kanamycin, levofloxacin, linezolid, meropenem, metronidazole, moxifloxacin, para-aminosalicylic acid, prochlorperazine, prothionamide, pyrazinamide, rifabutin, rifampicin, streptomycin, thioacetazone, thioridazine, vitamin D and viomycin, is additionally introduced into the cell.

[0017] A fourth embodiment of the method according to the invention provides that the mycobacterium is preferably a mycobacterium selected from the group consisting of Mycobacterium smegmatis, Mycobacterium bovis and Mycobacterium tuberculosis (including clinical strains).

[0018] In a further embodiment of the method according to the invention, the cell is an immune cell, such as a macrophage or other phagocytic cell (professional or non-professional), including macrophages derived from human or animal monocytes.

[0019] According to a second aspect of the invention, there is provided an expression vector comprising a polynucleotide encoding an exogenous IFIT polypeptide for use in a method of treating a mycobacterial infection in a subject, the method comprising administering to the subject a therapeutically effective amount of the expression vector, thereby increasing the cellular concentration of the IFIT polypeptide in a cell infected with a mycobacterium, resulting in a reduction in the number of viable mycobacteria in the cell, thereby treating the mycobacterial infection. It is appreciated that the exogenous IFIT polypeptide is selected from at least one exogenous IFIT1, IFIT2, or IFIT3 polypeptide.

[0020] In a first embodiment of the use of the vector, the exogenous IFIT polypeptides may comprise the amino acid sequence of IFIT1 (SEQ ID NO:1), IFIT2 (SEQ ID NO:2) and IFIT3 (SEQ ID NO:3).

[0021] In a second embodiment of using the vector, the polynucleotide encoding the exogenous polypeptides IFIT1, IFIT2, and IFIT3 may comprise a nucleic acid sequence of IFIT1 (SEQ ID NO:4), IFIT2 (SEQ ID NO:5), and IFIT3 (SEQ ID NO:6). Those skilled in the art will appreciate that, due to the degeneracy of the genetic code, other nucleic acid sequences may also encode the polypeptides of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0022] In a third embodiment of the use of the vector according to the invention, the additional administration of a pharmaceutical compound selected from the group consisting of pharmaceutical compounds known for use in the treatment of an infection with a mycobacterium is provided. The pharmaceutical compounds can be selected from the group consisting of arginine, amikacin, bedaquiline, capreomycin, ciprofloxacin, clarithromycin, clavulanic acid, clofazimine, co-amoxiclav, cycloserine, enviomycin, ethambutol, ethionamide, imipenem, interferon-γ, isoniazid, kanamycin, levofloxacin, linezolid, meropenem, metronidazole, moxifloxacin, para-aminosalicylic acid, prochlorperazine, prothionamide, pyrazinamide, rifabutin, rifampicin, streptomycin, thioacetazone, thioridazine, vitamin D and viomycin and are administered to the subject in combination with the IFIT polypeptide or expression vector.It is understood that the pharmaceutical compound and the expression vector encoding the IFIT polypeptide may be administered to the subject either separately, simultaneously, or sequentially.

[0023] A fourth embodiment of the use of the vector according to the invention provides that the mycobacterium is preferably a mycobacterium selected from the group consisting of Mycobacterium smegmatis, Mycobacterium bovis and Mycobacterium tuberculosis.

[0024] In a fifth embodiment of the use of the vector, the cell may be an immune cell, such as a macrophage, wherein the cell is preferably a macrophage derived from human monocytes.

[0025] In a further embodiment of the use of the vector according to the invention, the subject is selected from the group consisting of a reptile, a bird, or a mammal. Those skilled in the art know that the above-mentioned organisms are all susceptible to mycobacterial infection. Preferably, the subject is a human. BRIEF DESCRIPTION OF THE CHARACTERS

[0026] Non-limiting embodiments of the invention are described below by way of example only and with reference to the following figures: Fig.Figure 1: Illustration of the methodology for vector-based knockup of IFITs. The gene of interest was ligated into the mammalian vector, which was digested at its unique 3' and 5' end sites. This recombinant plasmid was overexpressed in E. coli and then projected into THP-1 cells for transfection. Abbreviations: pc = vector construct; GOI = gene of interest; XhoI = Xanthomonas holcicola; NheI = Neisseria mucosa heidelbergensis; E. coli = Escherichia coli; CFUs = colony-forming units; qRT-PCR = reverse transcription polymerase chain reaction. Fig. Figure 2: Agarose gel electrophoresis (0.8%) to confirm the integrity of plasmids IFIT1, IFIT2, and IFIT3 in duplicate. Abbreviations: IFIT = interferon-induced protein with tetratricopeptide repeats. Fig.Figure 3: Flag-tagged mammalian expression vector (pcDNA3.1) cloned with IFIT1 into NheI and XhoI restriction sites. Abbreviations: pc = vector construct; XhoI = Xanthomonas holcicola; NheI = Neisseria mucosa heidelbergensis; IFIT = interferon-induced protein with tetratricopeptide. Fig. Figure 4: Flag-tagged mammalian expression vector (pcDNA3.1) cloned with IFIT2 into NheI and XhoI restriction sites. Abbreviations: pc = vector construct; XhoI = Xanthomonas holcicola; NheI = Neisseria mucosa heidelbergensis; IFIT = interferon-induced protein with tetratricopeptide. Fig. Figure 5: Flag-tagged mammalian expression vector (pcDNA3.1) cloned with IFIT3 into NheI and XhoI restriction sites. Abbreviations: pc = vector construct; XhoI = Xanthomonas holcicola; NheI = Neisseria mucosa heidelbergensis; IFIT = interferon-induced protein with tetratricopeptide. Fig.Figure 6: Illustration of the knockdown of infected THP-1 cells using an siRNA premix. The siRNA premix was added to the mycobacterially infected cells seeded in 48-well plates. This was further projected to examine the intracellular survival of the mycobacteria using colony forming units (CFU). Knockdown was confirmed by qRT-PCR and Western blot. Abbreviations: siRNA = small interfering ribonucleic acid; CO2 = carbon dioxide; °C = degrees Celsius; CFUs = colony forming units; QRT-PCR = reverse transcription polymerase chain reaction. Fig.Figure 7: CFUs with and without IFIT knockup and knockdown in human monocyte-derived macrophages (hMDMs) infected with Mycobacterium smegmatis; A = 12 hours after IFIT knockup; B = 12 hours after IFIT knockdown; C = 24 hours after IFIT knockup; D = 24 hours after IFIT knockdown. A significant decrease in CFUs was observed with IFIT knockup, while CFUs significantly increased with IFIT knockdown. This was observed both 12 and 24 hours after M. smegmatis infection. KU = knockup; KD = knockdown. Fig.Figure 8: CFUs with and without IFIT knockup and knockdown in hMDMs infected with Mycobacterium bovis BCG; A = 12 hours after IFIT knockup; B = 12 hours after IFIT knockdown; C = 96 hours after IFIT knockup; D = 96 hours after IFIT knockdown. A significant decrease in CFUs was observed in the IFIT knockup, while CFUs significantly increased in the IFIT knockdown. This was observed both 12 and 96 hours after BCG infection. KU = knockup; KD = knockdown. Fig.Figure 9: CFUs with and without IFIT knockup and knockdown in hMDMs infected with Mycobacterium tuberculosis R179; A = 12 hours after IFIT knockup; B = 12 hours after IFIT knockdown; C = 96 hours after IFIT knockup; D = 96 hours after IFIT knockdown. A significant decrease in CFUs was observed with IFIT knockup, while CFUs significantly increased with IFIT knockdown. This was observed both 12 and 96 hours after R179 infection. KU = knockup; KD = knockdown. Fig. Figure 10: [i] A pictorial representation of colony numbers in hMDMs infected with Mycobacterium smegmatis at a multiplication of infection (MOI) of 1 (12 hours post-infection) [ii-iv] and overexpressed with IFIT1, IFIT2 and IFIT3 shows a significant decrease in colony numbers. Fig.Figure 11: Results of the cytotoxicity analysis of hMDMs 12 hours after Mycobacterium smegmatis infection. All cells exhibited a viability of <85%, demonstrating that the cells were not cytotoxically affected by either knock-up or knockdown. UI = uninfected, M. smeg = Mycobacterium smegmatis, KU = knock-up, KD = knock-down. Fig. Figure 12: Results of the cytotoxicity analysis of hMDMs 12 and 96 hours after Mycobacterium bovis BCG infection. All cells exhibited a viability of <85%, demonstrating that the cells were not cytotoxically affected by either knock-up or knock-down. UI = uninfected, KU = knock-up, KD = knock-down. Fig.Figure 13: Results of cytotoxicity analysis of hMDMs 12 and 96 hours after infection with Mycobacterium tuberculosis R179. All cells exhibited a viability of <85%, demonstrating that the cells were not cytotoxic upon either knock-up or knock-down. UI = uninfected, KU = knock-up, KD = knock-down. Fig. Figure 14: Comparison of relative expression after knockdown and knockup of IFIT1, IFIT2, and IFIT3 in hMDMs infected with Mycobacterium smegmatis; UI = uninfected, KU = knockup, KD = knockdown, * means p<0.001. Fig. Figure 15: Comparison of relative expression after knockdown and knockup of IFIT1, IFIT2, and IFIT3 in hMDMs infected with Mycobacterium bovis BCG; UI = uninfected, KU = knockup, KD = knockdown, * means p<0.001. Fig.Figure 16: Comparison of relative expression after knockdown and knockup of IFIT1, IFIT2, and IFIT3 in hMDMs infected with Mycobacterium tuberculosis R179; UI = uninfected, KU = knockup, KD = knockdown, * means p<0.001. Fig. 17: Western blot to confirm IFIT1 knockdown and knockup in THP-1 cells infected with Mycobacterium smegmatis, Mycobacterium bovis BCG, and Mycobacterium tuberculosis R179, 12 hours post-infection (IFIT1 - 55 kDa, GAPDH - 37 kDa); UI = uninfected, KU = knockup, KD = knockdown, GAPDH = glyceraldehyde-3-phosphate dehydrogenase. The housekeeping gene GAPDH is used here as a biological control, as GAPDH is stably and constitutively expressed in many tissues and cells. Fig. 18: Amino acid sequence of the interferon-induced protein with tetratricopeptide repeats - IFIT1 (SEQ ID NO:1). Fig.19: Amino acid sequence of the interferon-induced protein with tetratricopeptide repeats - IFIT2 (SEQ ID NO:2). Fig. 20: Amino acid sequence of the interferon-induced protein with tetratricopeptide repeats - IFIT3 (SEQ ID NO:3). Fig. 21: Nucleic acid sequence of the interferon-induced protein with tetratricopeptide repeats - IFIT1 (SEQ ID NO:4). Fig. 22: Nucleic acid sequence of the interferon-induced protein with tetratricopeptide repeats - IFIT2 (SEQ ID NO:5). Fig. 23: Nucleic acid sequence of the interferon-induced protein with tetratricopeptide repeats - IFIT3 (SEQ ID NO:6). Fig.Figure 24: Heatmap of 19 differentially expressed transcripts with the lowest false discovery rate analyzed with Ampliseq. hMDMs infected with Mycobacterium smegmatis, Mycobacterium bovis BCG, or Mycobacterium tuberculosis R179 were compared with uninfected hMDMs, with Mycobacterium smegmatis showing the highest host response. Expression levels are shown in black as maximum and in white as minimum expression. The dendrogram indicates sample clustering. Fig. Figure 25: Cytokine levels (pg / ml) with and without knock-up (vector-based overexpression) and knock-down of IFITs in hMDMs infected with Mycobacterium smegmatis, Mycobacterium bovis BCG, and Mycobacterium tuberculosis R179. (*) indicates significant (p≤0.05) expression when comparing uninfected with knock-up / down. Fig.Figure 26: Knock-up of IFITs and the OAS family at the individual and synergistic levels to investigate their effect on BCG. A significant decrease (p<0.001) was observed upon knock-up of IFIT1, IFIT2, and IFIT3 individually compared to BCG-infected THP-1 cells 24 hours after knock-up. Fig. Figure 27: Knock-up of IFITs and the OAS family at the individual and synergistic levels to investigate their effect on BCG. A significant decrease (p<0.001) was observed upon knock-up of IFIT1, IFIT2, and IFIT3 individually compared to BCG-infected THP-1 cells 96 hours after knock-up. SEQUENCE LISTING

[0027] The nucleic acid and amino acid sequences listed in the accompanying sequence listing are represented using the standard abbreviations for nucleotide bases and the standard three-letter abbreviations for amino acids. Those skilled in the art will understand that only one strand of each nucleic acid sequence is shown, but that the complementary strand is included by any reference to the strand shown. In the accompanying sequence listing: SEQ ID NO:1 - Amino acid sequence of interferon-induced protein with tetratricopeptide repeats - IFIT isoform 1 (IFIT1). SEQ ID NO:2 - Amino acid sequence of interferon-induced protein with tetratricopeptide repeats - IFIT isoform 2 (IFIT2). SEQ ID NO:3 - Amino acid sequence of interferon-induced protein with tetratricopeptide repeats - IFIT isoform 3 (IFIT3). SEQ ID NO:4 - Nucleic acid sequence of IFIT1. SEQ ID NO:5 - Nucleic acid sequence of IFIT2. SEQ ID NO:6 - Nucleic acid sequence of IFIT3. SEQ ID NO:7 - Nucleic acid target sequence 1 of IFIT1. SEQ ID NO:8 - Nucleic acid target sequence 2 of IFIT1. SEQ ID NO:9 - Nucleic acid target sequence 1 of IFIT2. SEQ ID NO:10 - Nucleic acid target sequence 2 of IFIT2. SEQ ID NO:11 - Nucleic acid target sequence 1 of IFIT3. SEQ ID NO:12 - Nucleic acid target sequence 2 of IFIT3. SEQ ID NO:13 - Nucleic acid sequence of the Hs_GAPDH forward primer. SEQ ID NO:14 - Nucleic acid sequence of the Hs_GAPDH reverse primer. SEQ ID NO:15 - Nucleic acid sequence of the Hs_UBC forward primer. SEQ ID NO:16 - Nucleic acid sequence of the Hs_UBC reverse primer. DETAILED DESCRIPTION OF THE INVENTION

[0028] The present invention will be described in more detail below with reference to the accompanying drawings in which some, but not all, embodiments of the invention are illustrated.

[0029] The described invention is not limited to the specific embodiments disclosed, and modifications and other embodiments are intended to be included within the scope of the invention. Although specific terms are used herein, they are used only in a generic and descriptive sense and not for purposes of limitation.

[0030] As used in this specification and the following claims, the singular forms “a”, “an” and “the” include the plural forms unless the context clearly indicates otherwise.

[0031] The terminology and phraseology used herein is for descriptive purposes and should not be considered limiting. The terms "comprising," "containing," "having," and "including," and variations thereof, are intended to encompass the elements listed below and their equivalents, as well as additional elements.

[0032] “Mycobacteria,” “mycobacterium,” or “mycobacterium” refers to a genus of actinobacteria belonging to the family Mycobacteriaceae.

[0033] Mycobacteria can colonize their hosts without causing any adverse effects. For example, billions of people around the world have asymptomatic infections with Mycobacterium tuberculosis.

[0034] Mycobacterial infections are generally quite difficult to treat. This is because mycobacteria possess a virtually impermeable cell wall that is neither gram-negative nor gram-positive. Furthermore, they are naturally resistant to several antibiotics that disrupt cell wall biosynthesis. Due to their unique cell wall, they can survive prolonged exposure to acids, alkalis, detergents, oxidative shocks, lysis by complement, and many antibiotics. Most mycobacteria are sensitive to the antibiotics clarithromycin and rifamycin, but antibiotic-resistant strains have emerged over the years.

[0035] The terms “protein,” “peptide,” or “polypeptide” refer to any chain of two or more amino acids, including naturally occurring or non-naturally occurring amino acids or amino acid analogues, regardless of any post-translational modification (e.g., glycosylation or phosphorylation).

[0036] Those skilled in the art will appreciate that polypeptides, peptides, or peptide analogues can be synthesized using standard chemical techniques, e.g., automated synthesis using solution or solid-phase synthesis methods. Automated peptide synthesizers are commercially available and use methods known in the art. Polypeptides, peptides, and peptide analogues can also be produced from the corresponding nucleic acid molecules using recombinant DNA technology.

[0037] The terms "nucleic acid," "nucleic acid molecule," or "polynucleotide" encompass both ribonucleotides (RNA) and deoxyribonucleotides (DNA), including cDNA, genomic DNA, and synthetic DNA. A nucleic acid can be double-stranded or single-stranded. If it is single-stranded, it can be the sense strand or the antisense strand. A nucleic acid molecule can be any chain of two or more covalently bonded nucleotides, including naturally occurring or non-naturally occurring nucleotides or nucleotide analogues or derivatives. "RNA" refers to a sequence of two or more covalently bonded, naturally occurring, or modified ribonucleotides. The term "DNA" refers to a sequence of two or more covalently bonded, naturally occurring, or modified deoxyribonucleotides.

[0038] The term "complementary" refers to two nucleic acid molecules, e.g., DNA or RNA, that are capable of forming Watson-Crick base pairs to create a double-stranded region between the two nucleic acid molecules. Those skilled in the art know that not every nucleotide in a nucleic acid molecule needs to form a matching Watson-Crick base pair with a nucleotide in an opposite, complementary strand to form a duplex. Thus, a nucleic acid molecule is "complementary" to a second nucleic acid molecule if it hybridizes to the second nucleic acid molecule under high-stringency conditions. A nucleic acid molecule according to the invention contains both complementary molecules.

[0039] The terms "identical" or percentage "identity", in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a certain percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum agreement over a comparison window or a specified region), as measured by a BLAST or BLAST 2.0 sequence comparison algorithm or by manual alignment and visual inspection. Such sequences are then said to be "essentially identical".

[0040] A "substantially identical" sequence is an amino acid or nucleotide sequence that differs from a reference sequence only by one or more conservative substitutions, or by one or more non-conservative substitutions, deletions, or insertions at positions in the sequence that do not destroy or substantially reduce the antigenicity of one or more of the expressed polypeptides or of the polypeptides encoded by the nucleic acid molecules. Alignment for the purpose of determining percent sequence identity can be performed in a variety of ways known to those skilled in the art. This includes, for example, the use of computer software such as ALIGN, Megalign (DNASTAR), CLUSTALW, or BLAST. Those skilled in the art can readily determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximum alignment across the entire length of the sequences being compared.In one embodiment of the invention, a polypeptide or polynucleotide sequence is provided that has at least about 80% sequence identity, at least about 90% sequence identity, or an even greater sequence identity, such as about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity with the sequences described herein.

[0041] Alternatively, or additionally, two nucleic acid sequences may be "essentially identical" if they hybridize under high-stringency conditions. The "stringency" of a hybridization reaction can be easily determined by one of skill in the art and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below its melting temperature.A typical example of such “stringent” hybridization conditions would be a hybridization performed for 18 hours at 65°C with gentle shaking, with a first wash of 12 minutes at 65°C in wash buffer A (0.5% SDS; 2XSSC) and a second wash of 10 minutes at 65°C in wash buffer B (0.1% SDS; 0.5% SSC).

[0042] The term "gene of interest" refers to a nucleic acid sequence with a nucleotide sequence containing a transcription unit that can be transcribed and translated into a protein. Using the methods and / or assays of the present invention, the expression of a gene of interest can be interrupted or silenced by disrupting a chromosomal contact in the cell.

[0043] The term "vector" refers to a means by which polynucleotides or gene sequences can be introduced into a cell. Various types of vectors are known in the art, including plasmids, viruses, bacteriophages, and cosmids. Generally, polynucleotides or gene sequences are introduced into a vector using a cassette. The term "cassette" refers to a polynucleotide or gene sequence expressed by a vector, e.g., the polynucleotides or gene sequences encoding the polypeptides IFIT1, IFIT2, and IFIT3 described herein. A cassette generally comprises a gene sequence inserted into a vector that, in some embodiments, provides regulatory sequences for expression of the polynucleotide or gene sequences. In other embodiments, the vector provides the regulatory sequences for expression of the polypeptides IFIT1, IFIT2, or IFIT3.In further embodiments, the vector provides some regulatory sequences, and the nucleotide or gene sequence provides other regulatory sequences. "Regulatory sequences" include, but are not limited to, promoters, transcription termination sequences, enhancers, splice acceptors, donor sequences, introns, ribosome binding sequences, poly(A) addition sequences, and / or origins of replication.

[0044] The term "transcription" refers to the process of producing RNA from a DNA template. The term "in vitro transcription" refers to the process of transcribing a DNA sequence into RNA molecules using a laboratory medium containing RNA polymerase and RNA precursors. The term "intracellular transcription" refers to the transcription of a DNA sequence into RNA molecules within a living cell. Furthermore, the term "in vivo transcription" refers to the process of transcribing a DNA sequence into RNA molecules within a living organism, such as a human.

[0045] The IFIT proteins and vectors encoding the IFIT proteins described here can be used to treat a mycobacterial infection or conditions associated with a mycobacterial infection in a cell or in an individual. A "condition associated with a mycobacterial infection" is defined as any condition, disease, or disorder correlated with the presence of an ongoing mycobacterial infection.

[0046] As used herein, the term "subject" includes animals, preferably birds, reptiles, or mammals. Most preferably, the mammal is a human.

[0047] The IFIT proteins or vectors encoding the IFIT proteins described herein may be provided either alone or in combination with other compounds in the presence of an adjuvant or any carrier, such as a pharmaceutically acceptable carrier, and in a form suitable for administration to a subject.

[0048] The term "pharmaceutically acceptable" refers to properties and / or substances that are acceptable for administration to a subject from a pharmacological or toxicological point of view. Furthermore, the term "pharmaceutically acceptable" refers to factors such as formulation, stability, patient acceptance, and bioavailability, which are likely to be known to a manufacturing pharmaceutical chemist from a physical and / or chemical point of view.

[0049] The “suitable forms” of IFIT proteins and vectors encoding the IFIT proteins can be combined with “pharmaceutically acceptable carriers” and other elements known in the art to ensure efficient delivery of the IFIT proteins and vectors encoding the IFIT proteins to a subject or cell.

[0050] “Pharmaceutically acceptable carrier” means a solid or liquid filler, diluent, or encapsulating substance that can be safely used to deliver pharmaceutically acceptable IFIT proteins and pharmaceutically acceptable vectors encoding the IFIT proteins to a subject or cell.

[0051] A "pharmaceutically acceptable carrier" or "excipient" includes all antibacterial and antifungal agents, coatings, dispersion media, solvents, isotonic and absorption-delaying agents, and the like that are physiologically acceptable. A "pharmaceutically acceptable carrier" may include a solid or liquid filler, diluent, or encapsulating substance that can be safely used to administer the composition to a subject or cell. Suitable formulations or compositions for administering the IFIT proteins and vectors encoding the IFIT proteins to individuals to be treated prophylactically against a mycobacterial infection, to individuals suffering from a mycobacterial infection, or to individuals presymptomatic of a condition associated with a mycobacterial infection are within the scope of the invention.Any suitable route of administration may be used, such as parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, intracystemal, intraperitoneal, intranasal, aerosol, topical or oral administration.

[0052] Pharmaceutically acceptable carriers may include sterile aqueous solutions, dispersions, and sterile powders for the preparation of sterile solutions. The use of media and agents for the preparation of pharmaceutically active ingredients is well known in the art. If a conventional medium or agent is incompatible with the active ingredient, its use in the pharmaceutical compositions of the invention is not contemplated.

[0053] Additional active ingredients can also be incorporated into the compositions.

[0054] An "effective amount" of the IFIT proteins and vectors encoding the IFIT proteins of the invention includes a therapeutically effective amount or a prophylactically effective amount. A "therapeutically effective amount" refers to an amount that is effective at the required dosages and for the required periods of time to achieve the desired therapeutic result, e.g., the treatment of a mycobacterial infection or a condition associated with such an infection. The result of treatment may be measured, for example, by a decrease in mycobacterial cell counts, inhibition of bacterial gene expression and replication, a delay in the development of a pathology associated with the mycobacterial infection, stimulation of the immune system, or another method for determining a therapeutic benefit.The therapeutically effective amount of an active ingredient can vary depending on factors such as the disease state, age, sex, and weight of the subject, as well as the ability of a treatment to elicit the desired response in the subject. The dosage can be adjusted to achieve an optimal therapeutic effect. A therapeutically effective amount is also an amount at which any toxic or harmful effects of the treatment are outweighed by the therapeutically beneficial effects.

[0055] In the context of the treatment of a condition, the term “effective amount” refers to the administration of an amount of the active ingredients to a person in need of treatment, whereby either a single dose or multiple doses of the active ingredients can be administered to a person.

[0056] Although some guidance has been given herein regarding suitable dosages of the IFIT proteins and vectors encoding the IFIT proteins of the invention, the precise dosage and frequency of administration of the effective amount will depend on several factors. These factors include the individual components used, the formulation of the extract or pharmaceutical composition containing the extract, the condition to be treated, the severity of the condition, the age, body weight, state of health, and general physical condition of the subject to be treated, the nature and severity of the disorder to be treated or prevented, the route of administration, other medications the subject may be taking, and other factors known to those skilled in the art. The effective amount is expected to fall within a relatively wide range that can be determined by routine experimentation.

[0057] The dosage may vary depending on the severity of the condition to be alleviated. For each individual subject, the specific dosage regimens may be adjusted over time according to individual need and the judgment of the person administering or supervising the administration of the active ingredients described herein. The dosage ranges set forth herein are only exemplary and do not limit the possible dosage ranges. The dosage regimens may be adjusted to achieve an optimal therapeutic response. For example, a single dose may be administered, or multiple doses may be administered over a period of time. It may be advantageous to formulate the compositions in unit dosage form to facilitate administration and ensure consistent dosing.

[0058] The toxicity and therapeutic efficacy of the compositions of the invention can be determined by standard pharmaceutical methods in cell cultures or using experimental animals, for example by determining the LD 50 and the ED 50 The data obtained from cell cultures and / or animal studies can be used to establish a dosage range for use in a subject. The dosage of a composition according to the invention is preferably within a range of circulating concentrations that ensures the ED 50 but exhibits little or no toxicity. The dosage may vary within this range depending on the dosage form and route of administration used. For compositions of the present invention, the therapeutically effective dose can initially be estimated using cell culture assays.

[0059] The following example is for illustrative purposes only and is not a limitation. EXAMPLE 1 Culture of THP-1 cells for knock-up / down experiments

[0060] Human macrophage-like cells, THP-1 (ATCC-88081201), were cultured in RPMI-1640 supplemented with 10% heat-inactivated fetal calf serum (Biochrome, Germany). The cells were incubated at 37°C in a 5% CO incubator. THP-1 cells were treated with a final concentration of 100 nM phorbol 12-myristate 13-acetate (PMA; Sigma Aldrich, USA) for 48 hours. The cells were transferred to a CO incubator in a BSL3 laboratory, and infection continued. For infection experiments, human macrophage cells were seeded into 12-well plates containing 0.7 × 10 6 Cells seeded per well. Preparation of detergent-free mycobacteria for infection

[0061] The three different mycobacterial species (Mycobacterium smegmatis, Mycobacterium bovis BCG, and Mycobacterium tuberculosis R179, clinical isolate) were cultured separately in T25 flasks with a volume of 10 ml in each flask (to maintain adequate headspace). These were incubated for 2–3 weeks at 37°C in an incubator. Subcultures were grown to a maximum optical density of 0.4. Shaking was required for Mycobacterium smegmatis, but not for Mycobacterium bovis BCG and Mycobacterium tuberculosis R179. The cultures were finally stored at -80°C for later use. The mycobacterial stock cultures were stored at -80°C and thawed. Clumps in the thawed vials were broken up by pipetting 10 times with a 1 ml tip. This was then injected 10 times (20 passes) through a G25 needle. The larger clumps were then allowed to settle for their respective settling time.Settling time varied for each strain (Mycobacterium smegmatis = 30 seconds, Mycobacterium bovis BCG = 1 minute, Mycobacterium tuberculosis R179 = 1 minute). The top 750 µl was collected and added to 4.25 ml of RPMI-1640 medium. This 5 ml bacterial suspension was then immediately filtered through a 5.0 µm pore filter (Merck Millipore, Germany) to which 10% human serum was added. The required volume (according to the titration and MOI calculation) was then added to THP-1 cells in complete medium (RPMI-1640 + 10% human serum). Titration of the Mycobacterium tuberculosis strain was also performed using this method (in this case, no human serum was added), with an average CFU determined by processing 3 stock vials. Table 1: Bacterial strains used in the study Strains / Plasmids Description Source / Reference Mycobacterium smegmatis Mycobacterium smegmatis MC155 Collection in the laboratory (Harper, Hayward, Kidd, Wiid, & van Helden, 2010) Mycobacterium bovis BCG Mycobacterium bovis BCG strain Pasteur 1743P2 Collection in the laboratory (Viljoen, Kirsten, Baker, Helden, & Wiid, 2013) Mycobacterium tuberculosis R179 Beijing genotype strain R220 Clinical isolate (Johnson et al., 2006) E. coli DH5a ATCC53868 Collection in the laboratory Infection with mycobacteria

[0062] Pathogenic (Mycobacterium tuberculosis R179), facultatively pathogenic (Mycobacterium bovis BCG), and non-pathogenic (Mycobacterium smegmatis) mycobacteria species were used for infection. The mycobacteria were cultured in 7H9 (with 10% OADC and 0.5% glycerol) without Tween 80. The inventors avoided the use of Tween, as Tween is known to impair macrophage uptake and the immune response to Mycobacterium tuberculosis. THP-1 cells were infected with each mycobacterial strain at an MOI of 1 and allowed to incubate for four hours. The cells were washed three times with phosphate-buffered saline (PBS) to remove all extracellular mycobacteria.

[0063] Two separate in vitro infection experiments were conducted. In the first experiment, cells were infected with the respective mycobacterial species and then washed after 4 hours. The cells were then incubated for a further 8 hours in a 5% CO2 incubator at 37°C. In another series of experiments, the infected cells were washed after 4 hours and then incubated for a further 92 hours in a 5% CO2 incubator at 37°C.

[0064] Uninfected THP-1 cells served as control / uninfected samples. Downstream processing of the cells was then performed by knocking up / down the IFIT1, IFIT2, and IFIT3 genes. The cells were then prepared for CFU analysis (after 12 and 96 hours), RNA extraction after 12 and 96 hours, and Western blot analysis by collecting the cell lysate after treatment with RIPA buffer containing a protease inhibitor at 12 and 96 hours post-infection. Cell supernatant was collected at 12 and 96 hours post-infection for the Luminex assay. Linking of IFITs (IFIT1, IFIT2 and IFIT3) plasmids

[0065] pcDNA3.1 3xFlag IFIT1 (Addgene Plasmid #53554, RRID:Addgene_53554), pcDNA3.1 3xFlag IFIT2 (Addgene Plasmid #53555, RRID:Addgene_53555), and pcDNA3.1 3xFlag IFIT3 (Addgene Plasmid #53553, RRID:Addgene_53553) were a gift from Kathleen Collins and were constructed as described in Katibah et al. (2013). Each of the respective plasmids contained the IFIT1, IFIT2, and IFIT3 genes. Overexpression in E. coli

[0066] The bacterial stock containing the cloned plasmid was spread onto an LB agar plate containing 100 µg / ml ampicillin antibiotic, as the engineered plasmid was resistant to the antibiotic ampicillin. The agar plate was incubated overnight at 37°C in a 5% CO2 incubator. A single colony was picked and inoculated overnight in LB broth at 37°C in a 5% CO2 shaking incubator. The final product, which was engineered with ampicillin resistance, was sequenced to verify the correct plasmid. Fig. Figure 1 shows the detailed procedure of vector-based knock-up of IFITs. Plasmid extraction

[0067] Plasmid extraction for the high-copy plasmid was performed using the QIAGEN Plasmid Mini Kit. The LB broth starter culture was processed by spinning at 6000 xg for 15 minutes at 4°C to harvest the bacterial cells. The bacterial cells were resuspended in 0.3 ml of Buffer P1. 0.3 ml of Buffer P2 was thoroughly mixed by vigorously inverting the sealed tube 4-6 times and incubated for 5 minutes at room temperature. 0.3 ml of ice-cold Buffer P3 was immediately added and mixed thoroughly to completely neutralize the solution. This mixture was incubated on ice for 5 minutes. The mixture was centrifuged at maximum speed in a microcentrifuge for 10 minutes. This separated the supernatant containing the plasmid DNA. This was added to a QIAGEN column to bind the DNA to the column. This column was washed with 2 ml of buffer QC.The plasmid DNA was finally eluted with 0.5 ml of double-distilled water. The purity and integrity of the DNA were analyzed using 0.8% agarose gel electrophoresis. Fig. Figure 2 shows the agarose gel with the plasmids IFIT1, IFIT2 and IFIT3. Transfection

[0068] To optimize transfection into THP-1 cells, various transfection reagents were used, including Lipofectamine 2000 (ThermoFisher Scientific, Cat. No. 11668019), Lipofectamine 3000 (ThermoFisher Scientific, Cat. No. L3000015), and Mission siRNA Transfection Reagent (Sigma-Aldrich, Cat. No. S1452). Successful plasmid transfection into THP-1 cells was achieved using the Mission siRNA Transfection Reagent and confirmed by Western blot. Transfection was performed in a 48-well plate (Greiner Bio One, Cat. No. 677180) with mycobacterially infected 0.05×10 6Cells / well in a volume of 300 µl complete medium (RPMI + 10% FBS).

[0069] For one well of a 48-well plate, 2 µl of transfection reagent was added to 125 ng of plasmid DNA (titrated for transfection) and finally mixed with 100 µl of DMEM. This mixture was vortexed and incubated for 15 minutes at room temperature. 100 µl of the final mixture was added to each well, and the plate was slowly swirled to mix. In this experiment, only the vector (pcDNA3.1) was used as a control. The cells were then incubated at 37°C in a 5% CO2 incubator for the respective time points. A detailed representation of the plasmid for IFIT1, IFIT2, and IFIT3 can be found in Fig. 3, Fig. 4 and Fig. 5. Elimination of IFITs (IFIT1, IFIT2 and IFIT3)

[0070] THP-1 cells were cultured at 5×10 4Cells were seeded per well of a 48-well plate in 0.3 ml of RPMI supplemented with 10% FBS. A final concentration of 100 nM of PMA was added and mixed thoroughly. The cells were incubated for 18–20 hours at 37°C in a 5% CO2 incubator. After incubation, the cells were infected with the respective mycobacterial strains at a predetermined MOI (MOI = 1).

[0071] After 4 hours of bacterial uptake, the cells were thoroughly washed with PBS, and fresh complete medium was added to each well (300 µl per well of a 48-well plate). 6.25 µl of Flexi Tube siRNA Premix was added dropwise to the cells, resulting in a final siRNA concentration of 25 nM in each well (Table 2 contains a detailed list of the siRNA premixes used). As a negative control, a scrambled sequence was used as a negative siRNA premix (Cat. No. S103650325). The culture plates were slowly swirled to mix the premix with the complete medium. The cells were incubated with the transfection complexes under their optimal growth conditions (37°C in a 5% CO2 incubator). Gene silencing was measured 24 hours and 96 hours after transfection using intracellular CFUs. Silencing was performed using Qiagen FlexiTube siRNA Premix.In vitro gene silencing was performed for each gene at two different silencing sites. The latter results, including CFUs and mRNA expression levels, were taken as the average of the values ​​generated by silencing two different target sequences. Table 2: Detailed information on the siRNA premix of IFITs used for knockdown experiments FlexiTube siRNA Premix unq Entrez Gene ID length Target sequence (5' to 3') Catalog number SEQ ID NO: Hs-IFIT1 3434 4396 bp CAGGCTGTCCGCTTAAATCCA S100445879 SEQ ID NO:7 Hs-IFIT1 3434 4396 bp TACATGGGAGTTATCCATTGA S103224284 SEQ ID NO:8 Hs-IFIT2 3433 3505 bp AAAGAAAGTTACTGGAACTAA S104145372 SEQ ID NO:9 Hs-IFIT2 3433 3505 bp CCCATAGAGGTTAGTCCTGCA S104259010 SEQ ID NO:10 Hs-IFIT3 3437 2467 bp ATGCTATGGACTATTCGAATA S103152737 SEQ ID NO:11 Hs-IFIT3 3437 2467 bp AGAGATGATTGAAGCACTAAA S104197788 SEQ ID NO:12 Determination of bacterial uptake after knock-up / down of IFITs

[0072] Intracellular colony-forming units (CFUs) were determined in THP-1 cells infected with mycobacteria knocked down with the IFITs family. These cells were lysed with 0.1% Triton X-100. Bacterial uptake was determined by serial dilution (10 -1 - 10 -4) and plating the mycobacteria on 7H11 agar plates. The agar plates were incubated at 37°C for 5 weeks, and the CFU / ml were determined. Mycobacterial survival in the treated cells was monitored 12 hours and 96 hours after infection (Mycobacterium smegmatis was not measured after 96 hours). Cytotoxicity test after knock-up / down of IFITs

[0073] Cell cytotoxicity was tested using the Roche Water Soluble Tetrazolium (WST-1) Cell Cytotoxicity Reagent (Roche, USA) at a 1:10 dilution of the WST-1 reagent in RPMI complete medium (RPMI + 10% human serum). Cells were assayed for cell cytotoxicity after infection and at the respective incubation time points (12 and 96 hours). 300 µl of a 1:10 dilution of the WST-1 reagent in complete medium was added to the wells of a 12-well plate. The culture plates were properly covered with aluminum foil because the cytotoxicity reagent is light-sensitive. The cells were incubated for 1 hour at 37°C and 5% CO2. The cells were then transferred to a multimode reader in a dark room. Absorbance was measured at 450 and 630 nm (wavelength correction). The difference between the two absorbance values ​​was measured and plotted as a percentage in Microsoft Excel. RNA extraction after knock-up / down of IFITs

[0074] Total RNA from human macrophages was extracted using an RNeasy Plus Mini Kit (Cat. No. 74134, Qiagen, Limburg, Netherlands). The cell culture medium was completely aspirated from the culture plates. The cells were washed three times with ice-cold 1x PBS. 350 µl of RLT Plus buffer (containing 10 µl / ml β-mercaptoethanol) was added to the wells and scraped with a pipette tip to disrupt the cells. The lysate was then pipetted into a microcentrifuge tube and vortexed to ensure no cell clumps were visible. The lysate was then applied directly to a QIAshredder spin column and centrifuged at maximum speed for 2 minutes.

[0075] The homogenized lysate was then transferred to a gDNA Eliminator spin column and centrifuged at 8000 xg for 1 minute. The gDNA Eliminator column ensures the removal of any genomic DNA from all samples. 350 µl of 70% ethanol was added to the flowthrough and mixed thoroughly by pipetting. Up to 700 µl of sample (including the precipitate) was transferred to the RNeasy spin column in a 2-ml collection tube, and the cap was carefully closed. This was then centrifuged at 8000 xg for 15 seconds, and the flowthrough was discarded.

[0076] Subsequently, 700 µl of RW1 buffer was added to the RNeasy spin column, and the lid was carefully closed. The column was then centrifuged at 8000 xg for 15 seconds to wash the spin column membrane, and the flowthrough was discarded. Subsequently, 500 µl of RPE buffer was added to the RNeasy spin column, and the lid was carefully closed. Subsequently, the column was centrifuged at 8000 xg for 15 seconds to wash the spin column membrane, and the flowthrough was discarded. Subsequently, 500 µl of RPE buffer was added to the RNeasy spin column, and the lid was carefully closed. Subsequently, the column was centrifuged at 8000 xg for 2 minutes to wash the column membrane, and the flowthrough was discarded. The RNeasy spin column was then placed in a 2 ml collection tube and centrifuged at full speed for 1 minute. The RNeasy spin column was then placed in a 1.5 ml collection tube.Subsequently, 30 µl of RNase-free water was added directly to the membrane of the spin column and centrifuged at 8000 x g for 1 minute to elute the RNA.

[0077] For each experiment, RNA quantity and quality were measured using the Agilent 2100 Bioanalyzer. RNA with a high RNA integrity number (RIN) (≥ 9) was used for Ampliseq and quantitative real-time qPCR experiments. Quantitative qPCR after knock-up / down of IFITs

[0078] High-quality RNA (RIN>9, 0.8 µg) was used for cDNA preparation using a kit (Quantitect Reverse Transcription Kit). To ensure the removal of genomic DNA, gDNA wipe-out buffer (included in the kit) was added to the RNA before the RNA conversion step. qPCR amplification was performed on a LightCycler 96 system (Roche, Germany). LightCycler 480 SYBR Green I Master was used for various differentially expressed genes using QuantiTect primer assays with a 20 µl reaction volume.

[0079] Hs-GAPDH and Hs-UBC were selected as reference genes, which have been shown to have stable expression levels. The primers used for amplification are listed in Table 3. Table 3: Primer sequences used to confirm stable expression levels. Reference gene orientation sequence SEQ ID NO: Hs_GAPDH Forward TGCACCACCAACTGCTTAGC SEQ ID NO:13 Hs_GAPDH Vice versa GGCATGGACTGTGGTCATGAG SEQ ID NO:14 Hs_UBC Forward CGGTGAACGCCGATGATTAT SEQ ID NO:15 Hs_UBC Vice versa ATCTGCATTGTAAGTGACGA SEQ ID NO:16

[0080] The amplification process comprised 45 cycles of 95°C for 10 seconds, followed by 60°C for 10 seconds, and finally 72°C for 10 seconds. Gene expression changes were determined for pathogen-infected and non-pathogen-infected macrophages using calibrated, normalized relative amounts using the equation N = N0 × 2 Cp calculated. All qPCRs were performed with RNA extracted from three additional experiments. All biological replicates, including a positive control and a control without reverse transcription, were performed in triplicate (along with the calibrator) according to the MIQE guidelines. Western blot

[0081] After infection and subsequent transfection, the protein was extracted with RIPA buffer (0.5% sodium deoxycholate, 150 mM NaCl, 0.1% SDS, 50 mM Tris, and 1.0% Triton X-100). 50 µl of protease inhibitor (Roche, Switzerland) was added to 1 ml of lysis buffer. Complete cell lysis was achieved by scraping the cells with a cell scraper and pipetting them 5 to 10 times with a 1 ml pipette tip. The cells were placed on ice for 10 minutes and then centrifuged at 200 x g for 10 minutes at 4 °C to achieve at least 80% cell lysis. The supernatant was collected and centrifuged at 8000 x g for 30 minutes. The postnuclear supernatant (PNS) was collected, filtered through a 0.22 µm PVDF syringe filter (SIGMA-ALDRICH, USA) into 1.5 ml Eppendorf tubes, and stored at -80°C. Protein quantity and quality were determined using the Bradford assay and SDS-PAGE.

[0082] Bradford Assay: A standard curve was generated using 10% bovine serum albumin, Cat. No. HD14-4 (BSA, QIAGEN, USA). A 1 mg / mL working stock was prepared. Six BSA concentrations were used to generate the standard curve: 2 µg, 4 µg, 8 µg, 12 µg, 16 µg, and 20 µg. 900 µl of 1x Bradford Dye Reagent, Cat. No. 500-0205 (Bio-Rad, USA) was added. Protein samples were stored on ice. 5 µl of the sample, 95 µl of distilled water, and 900 µl of 1x Bradford dye reagent were mixed to 1 ml, and the absorbance was measured at OD 595 on a spectrophotometer (MRCLAB Spectro UV-16, Israel). A control sample contained water and Bradford reagent.

[0083] 10 µg of each protein sample was used. The sample was mixed with 1x XT sample buffer (Bio-Rad, USA) in an Eppendorf and heated on a heat block at 90 °C for 2 minutes. The sample was loaded into a 10% precast SDS gel (Bio-Rad Mini TGX Gels, Bio-Rad, USA, Cat. No. 456-1044) in 1x XT MOPS running buffer (Bio-Rad, USA). The gel was run at 90 volts for 30 minutes to quantify the protein samples. The gel was then transferred to a PVDF membrane (Bio-Rad, Cat. No. 1620174) for 7 minutes using the TURBO blot transfer device (BioRad Trans Blot Turbo Transfer System, serial number 690BR016386). The blotted membranes were blocked with blocking solution (5% BSA in TBST buffer) for 2 hours at room temperature on a shaker at 15 rpm.The membrane was then washed three times with TBST buffer (TBS - 10x - 24 g Tris base, 88 g NaCl, 900 ml double distilled water, pH 7.6, mixed and adjusted to 1 liter with 0.1% Tween in TBST 1x buffer). Each wash was performed for 5 minutes on a shaker at 20 rpm at room temperature. The membrane was then incubated with the respective primary antibody overnight at 4 °C (anti-Flag antibody (Sigma Aldrich, Cat. No. F3165) - 1:5000 dilution in TBST, anti IFIT1 antibody (Sigma Aldrich, Cat. No. SAB4501508) - 1:1000 dilution in TBST, anti IFIT2 antibody (Sigma Aldrich, Cat. No. SAB2101128) - 1:1000 dilution in TBST, anti IFIT3 antibody (Sigma Aldrich, Cat. No. AV46034) - 1:1000 dilution in TBST). The membrane was washed three times with TBST buffer (each wash lasted 5 minutes on a shaker at 20 rpm at room temperature).The membrane was then incubated for one hour at room temperature with the respective secondary antibody (monoclonal anti-mouse antibody (Santa Cruz Biotechnology, Sc516102) - 1:5000 dilution in TBST, used against the primary anti-FLAG antibody, and monoclonal anti-rabbit antibody (Santa Cruz Biotechnology, Sc2030) - 1:5000 dilution in TBST, used against the primary antibodies anti-IFIT1, anti-IFIT2, and anti-IFIT3). The membrane was washed three times with TBST buffer (each wash lasting 5 minutes) on a shaker at 20 rpm at room temperature. The membrane was conjugated with horseradish peroxidase (BioRad). The bound secondary antibody was spotted with the Clarity Max Western ECL substrate enhanced chemiluminescence detection kit (Cat. No. 1705062, BioRad).To ensure even loading of proteins, the membranes were stripped with stripping buffer (100 mM 2-mercaptoethanol, 62.5 mM Tris, pH 6.8, 2% SDS) for 30 min at room temperature and then touched up with beta-actin / GAPDH antibody (Santa Cruz Biotechnology, Sc32233) for 2 h at room temperature. Statistical analysis

[0084] The real-time qPCR data were analyzed using Light Cycler 96 SW 1.1 software and Graph-pad Prism V7. The relative expression of the target transcript in a treated group compared to that of the untreated group was measured using the software in response to the calibrator and the non-transcription control. The data on the relative expression of the cytokines were further analyzed using Graph-pad Prism to determine p-values ​​using a one-way ANOVA. Finally, p-values ​​were determined using multiple-factor testing with Tukey's correction.

[0085] The data (in triplicate) were finally plotted in histograms with the respective means and standard deviations.

[0086] The cytotoxicity curves and CFUs were plotted against the average of the technical triplicates, resulting in the mean of all biological replicates. Statistical analysis was performed using Graph-pad Prism V7 software, determining the percentage of each expressing cell and calculating the p-value using a two-way ANOVA with Tukey's correction. Luminex data were analyzed using a two-way ANOVA with Tukey's correction using Graph-pad Prism V7 for Windows (Graph-pad Software, San Diego, California, USA). CFUs after establishment and dismantling of IFITs

[0087] The inventors determined the CFU of Mycobacterium smegmatis after 12 and 24 hours of infection, while the CFU of Mycobacterium bovis BCG and Mycobacterium tuberculosis R179 were determined after 12 and 96 hours of infection of human monocyte-derived macrophages (hMDMs) with knockdown and knockup of IFIT1, IFIT2, and IFIT3. After 12 hours, the inventors found significantly higher (p<0.0001) CFU after knockdown of all three IFITs, while knockup resulted in a significantly reduced (p<0.0001) number of CFUs for all three mycobacterial strains.

[0088] Subsequently, the CFUs of Mycobacterium smegmatis at 24 hours and of Mycobacterium bovis BCG and Mycobacterium tuberculosis R179 at 96 hours post-infection showed significantly higher CFUs (p<0.001) in the IFIT knockdown, but significantly lower CFUs (p<0.001) in the IFIT knockup. Comparison of the CFUs between the strains revealed that the scrambled sequence for the knockdown and the negative control (vector) for the IFIT knockup were similar ( Fig. 7, Fig. 8 and Fig. 9).

[0089] After 12 hours, the comparison of Mycobacterium smegmatis KFUs between the IFIT family knockdowns showed significantly higher numbers after knockdown with IFIT2 (p=0.007) and IFIT3 (p=0.024) compared to IFIT1.

[0090] After 96 hours (4 days), Mycobacterium bovis BCG CFUs after knockdown of the IFIT family showed significantly higher colony counts after knockdown with IFIT2 (p=0.018) and IFIT3 (p=0.034) compared to IFIT1.

[0091] After 96 hours, the comparison of Mycobacterium tuberculosis R179 CFUs between the IFIT family knockdowns showed higher colony counts after knockdown with IFIT2 (p=0.002) and IFIT3 (p=0.043) compared to IFIT1.

[0092] After 12 hours, the comparison of CFUs between the IFIT family knock-ups showed a significantly higher number after knock-up with IFIT2 (p=0.014) and IFIT3 (p=0.001) compared to IFIT1. Fig. Figure 10 shows the representative image of CFUs after knock-up of IFITs. qPCR after knock-up / down of IFITs

[0093] The inventors determined the relative expression of IFIT1, IFIT2, and IFIT3 during infection with Mycobacterium smegmatis (after 12 hours), Mycobacterium bovis BCG, and Mycobacterium tuberculosis R179 (after 12 and 96 hours) by qPCR after knockdown and knockup of these IFITs. This was performed to standardize the knockdown and knockup of IFITs. The knockdown IFITs of all three species showed a significantly lower relative expression (p<0.001), and the knockup IFITs a statistically higher relative expression (p<0.001) of the respective IFITs.

[0094] In Mycobacterium smegmatis, 12 hours after infection, the mRNA expression level for IFIT1 was very low after knockdown (p<0.001), while the expression level was higher after knockup (p<0.001) compared to the mRNA expression levels of cells infected with Mycobacterium smegmatis alone. The mRNA expression level for IFIT2 was very low after knockdown (p<0.001), while the expression level was higher after knockup (p<0.001) when compared to the mRNA expression levels of cells infected with Mycobacterium smegmatis alone. This was also true for IFIT3, whose mRNA expression level was very low upon knockdown (p<0.001), while the expression level was higher upon knockup (p<0.001) compared to the mRNA expression levels of cells infected only with Mycobacterium smegmatis.

[0095] In Mycobacterium bovis BCG, 12 hours after infection, the mRNA expression level for IFIT1 was very low after knockdown (p<0.001), while it was higher after knockup (p<0.001), compared to the mRNA expression level of cells infected with Mycobacterium bovis BCG alone. The mRNA expression level for IFIT2 was very low after knockdown (p<0.001), while it was higher after knockup (p<0.001), when compared to the mRNA expression levels of cells infected with Mycobacterium bovis BCG alone. This also applied to IFIT3, whose mRNA expression level was very low upon knockdown (p<0.001), while it was higher upon knockup (p<0.001), compared to the mRNA expression level of cells infected only with Mycobacterium bovis BCG. After knockup, mRNA expression for IFIT2 was higher (p<0.036) than for IFIT1 and IFIT3.

[0096] In Mycobacterium bovis BCG, IFIT1 mRNA expression was very low (p<0.001) at 96 hours post-infection, whereas it was higher (p<0.001) in the knock-up mode, compared with the mRNA expression of cells infected with Mycobacterium bovis BCG alone. IFIT2 mRNA expression was very low (p<0.001) in the knock-down mode, whereas it was higher (p<0.001) in the knock-up mode, when compared with the mRNA expression levels of cells infected with Mycobacterium bovis BCG alone. This was also true for IFIT3, whose mRNA expression level was very low (p<0.001) in the knock-down mode, whereas it was higher (p<0.001) in the knock-up mode, compared with the mRNA expression levels of cells infected with Mycobacterium bovis BCG alone.

[0097] In Mycobacterium tuberculosis R179, 12 hours after infection, the mRNA expression level for IFIT1 was very low after knockdown (p<0.001), while it was higher after knockup (p<0.001), compared to the mRNA expression levels of cells infected with Mycobacterium tuberculosis R179 alone. The mRNA expression level for IFIT2 was very low after knockdown (p<0.001), while it was higher after knockup (p<0.001), when compared to the mRNA expression level of cells infected with Mycobacterium tuberculosis R179 alone. This was also true for IFIT3, whose mRNA expression level was very low in knockdown (p<0.001), while it was higher in knockup (p<0.001), compared to the mRNA expression level of cells infected only with Mycobacterium tuberculosis R179.

[0098] In Mycobacterium tuberculosis R179, IFIT1 mRNA expression was very low (p<0.001) 96 hours after infection, while it was higher (p<0.001) in the knockdown compared to the mRNA expression of cells infected with Mycobacterium tuberculosis R179 alone. IFIT2 mRNA expression was very low (p<0.001) in the knockdown compared to the mRNA expression of cells infected with Mycobacterium tuberculosis R179 alone (p<0.001) in the knockup compared to the mRNA expression of cells infected with Mycobacterium tuberculosis R179 alone. This also applies to IFIT3, whose mRNA expression level was very low in the knockdown (p<0.001), while it was higher in the knockup (p<0.001), compared to the mRNA expression level of cells infected only with Mycobacterium tuberculosis R179. Fig. 14, Fig. 15 and Fig.16 show the comparison of mRNA expression after knocking-up and knocking-down of IFITs in hMDMs after infection with Mycobacterium smegmatis, Mycobacterium bovis BCG, and Mycobacterium tuberculosis R179, respectively. Western blot after knock-up / down of IFITs

[0099] The inventors also confirmed the knocking-up and knocking-down of IFITs by examining protein expression using Western blotting ( Fig. 17). GAPDH protein expression was used as an internal quality control. The blots clearly show that after knockdown, band intensity increased in all three species. In contrast, after knockdown, we observed a decrease in intensity in all mycobacterial species. EXAMPLE 2

[0100] The inventors conducted a detailed investigation of the in vitro host response of human monocyte-derived macrophages (hMDMs) to various mycobacterial strains (grown in detergent-free media), i.e., pathogenic (Mycobacterium tuberculosis R179) and non-pathogenic species (Mycobacterium smegmatis and Mycobacterium bovis BCG). The host response was measured post-infection (at the mRNA and protein levels) using amplicon-based RNA sequencing (AmpliSeq), quantitative real-time polymerase chain reaction (RTqPCR), multiplex ELISA (Luminex), intracellular mycobacterial survival, and cytotoxicity assays.

[0101] A biological network analysis (ingenuity pathway analysis (IPA)) was performed to understand the gene regulatory network involved in pathophysiology related to the host immune system. Based on the false discovery rate (FDR) and biological functions, the inventors selected 19 potential differentially expressed genes (DEGs) ( Fig. 24). Of these, a related gene family of interferon-induced proteins with tetratriceptides (IFIT1, IFIT2, and IFIT3) was used to investigate mycobacterial intervention experiments in THP-1 cells.

[0102] The IFIT gene family is known to form a protein complex that targets the antigen during viral infection. The role of IFITs in combating mycobacteria is not yet sufficiently understood. Therefore, the inventors conducted an in vitro vector-based overexpression (knock-up) and small interfering RNA (siRNA) approach (knock-down) of IFITs to investigate their effect on mycobacteria in host macrophages.

[0103] AmpliSeq analysis revealed 19 differentially expressed genes 12 hours after infection for all three mycobacterial species ( Fig.24). Compared with the other two mycobacterial species, a lower number of intracellular mycobacterial growth (CFUs) and a stronger host response were observed in hMDMs infected with Mycobacterium smegmatis. Upon biological network analysis, we found that among the 19 differentially expressed genes, the interferon-interleukin-associated signaling pathways were the most prominent.

[0104] A different host response was observed to all three species, which might be due to their pathogenicity. Comparisons of mRNA and protein levels at different time points revealed a strong role of the interferon- and interleukin-associated gene network. This network was able to successfully combat Mycobacterium smegmatis but was succumbed to Mycobacterium bovis BCG and Mycobacterium tuberculosis R179. The intervention experiments were conducted in THP-1-like macrophages. A visual representation of the in vitro knock-up using vector-based transfection is shown in Fig. 10. To confirm protein expression after knock-up / down of IFITs, a Western blot was performed using GAPDH as an internal control ( Fig. 17).

[0105] Synergy experiments with IFITs and OASs were conducted to investigate their effects on mycobacteria (Leisching et al. 2019). Surprisingly, the combination therapy of IFIT1, IFIT2, and IFIT3 together showed no effect on the knock-up / down as with the individual IFITs ( Fig. 26 and Fig. 27). In a previous study by our group, the effect of OAS on mycobacteria was observed. It is noteworthy that treatment with individual IFITs is more promising than treatment with other genes or their combination.

[0106] The inventors found that the expression of key pro-inflammatory cytokines (i.e., IDO1, IFN-γ, IL-6, and IL-23) was increased during knock-up, resulting in a reduction of mycobacteria ( Fig. 25). It is known that Mycobacterium tuberculosis interferes with IFN-γ-activated host signaling pathways to survive in macrophages.

[0107] Remarkably, IFN-γ levels continued to increase after IFIT knockdown with a vector (vector-based overexpression), even significantly higher than during normal infection. On the other hand, IFIT knockdown completely eliminated IFN-γ expression. Similar to IFN-γ, higher IL-6 levels were also observed after IFIT knockdown (vector-based overexpression). IL-6 has been shown to be differentially expressed as part of a protective immune response in mice infected with Mycobacterium tuberculosis.

[0108] However, similar to IDO-1, IL-6 is not essential for antimycobacterial mechanisms. IL-23 has been found to induce IL-17 levels in T helper cells in healthy tuberculin responders. Increased IL-23 levels in our study indicate a reduction in the intracellular survival of Mycobacterium tuberculosis (reduced CFUs). This may be attributed to the induction of the cytokines IL-17 and IFN-γ by IL-23.

[0109] Our results demonstrate that IFITs play an important role in mycobacterial killing at the individual level. Knocking down individual IFITs in macrophages leads to a significant increase in key pro-inflammatory cytokines (IDO-1, IL-6, IL-23, and IFN-γ), which promotes mycobacterial killing. Knocking down IFITs in macrophages leads to a significant decrease in key pro-inflammatory cytokines (IDO-1, IL-6, IL-23, and IFN-γ), which promotes mycobacterial survival.

[0110] Differentially expressed IFITs demonstrated potent activity against mycobacteria, which may be used as a promising therapeutic target as an adjunct to anti-TB therapy. This knowledge will expand the range of host drug targets for resistance-free bacteriostatic immunotherapy. REFERENCES

[0111] Der SD, Zhou A, Williams BRG, Silverman RH. Identification of genes differentially regulated by interferon α, β, or γ using oligonucleotide arrays. Proc Natl Acad Sci U S A. 1998 Dec 22; 95(26):15623-8.

[0112] Fensterl V, Sen GC. The ISG56 / IFIT1 gene family. J Interferon Cytokine Res Off J Int Soc Interferon Cytokine Res. 2011 Jan;31(1):71-8.

[0113] Harper CJ, Hayward D, Kidd M, Wiid I, van Helden P. Glutamate dehydrogenase and glutamine synthetase are regulated in response to nitrogen availability in Myocbacterium smegmatis. BMC Microbiol. 2010 May 11;10(1):138.

[0114] Johnson R, Warren RM, van der Spuy GD, Gey van Pittius NC, Theron D, Streicher EM, et al. Drug-resistant tuberculosis epidemic in the Western Cape driven by a virulent Beijing genotype strain. Int J Tuberc Lung Dis Off J Int Union Tuberc Lung Dis. 2010 Jan; 14(1):119-21.

[0115] Katibah GE, Lee HJ, Huizar JP, Vogan JM, Alber T, Collins K. tRNA binding, structure, and localization of the human interferon-induced protein IFIT5. Mol. Cell. 2013 Feb 21;49(4):743-50.

[0116] Kumar P, Sweeney TR, Skabkin MA, Skabkina OV, Hellen CUT, Pestova TV. Inhibition of translation by IFIT family members is determined by their ability to interact selectively with the 5'-terminal regions of cap0-, cap1- and 5'ppp- mRNAs. Nucleic Acids Res. 2014 Mar; 42(5):3228-45.

[0117] Kusari J, Sen GC. Regulation of synthesis and turnover of an interferoninducible mRNA. Mol Cell Biol. 1986 Jun; 6(6):2062-7.

[0118] Leisching G, Cole V, Ali AT, Baker B. OAS1, OAS2 and OAS3 restrict intracellular M.tb replication and enhance cytokine secretion. Int J Infect Dis. 2019 Mar;80S:S77-S84. doi: 10.1016 / j.ijid.2019.02.029.

[0119] Viljoen AJ, Kirsten CJ, Baker B, van Helden PD, Wiid IJF. The role of glutamine oxoglutarate aminotransferase and glutamate dehydrogenase in nitrogen metabolism in Mycobacterium bovis BCG. PloS One. 2013;8(12):e84452. This is followed by a sequence listing as an electronic document. This can be accessed both in DEPATISnet and in the DPMA register.

Claims

[1] An in vitro method for increasing the cellular concentration of an interferon-induced protein with tetratricopeptide repeats (IFIT) polypeptide in a cell infected with a mycobacterium, the method comprising introducing into the cell an expression vector comprising a polynucleotide encoding an exogenous IFIT polypeptide, wherein the exogenous IFIT polypeptide is selected from at least one exogenous IFIT1, IFIT2, or IFIT3 polypeptide, and wherein increasing the cellular concentration of the IFIT polypeptide decreases the number of viable mycobacteria in the cell. [2] The in vitro method of claim 1, wherein the exogenous IFIT polypeptide comprises an amino acid sequence of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3. [3] The in vitro method of claim 1, wherein the polynucleotide encoding the exogenous IFIT polypeptide comprises a nucleic acid sequence of SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:

6. [4] The in vitro method according to any one of claims 1 to 3, further comprising introducing into the cell a pharmaceutical compound selected from the group consisting of arginine, amikacin, bedaquiline, capreomycin, ciprofloxacin, clarithromycin, clavulanic acid, clofazimine, co-amoxiclav, cycloserine, enviomycin, ethambutol, ethionamide, imipenem, interferon-γ, isoniazid, kanamycin, levofloxacin, linezolid, meropenem, metronidazole, moxifloxacin, para-aminosalicylic acid, prochlorperazine, prothionamide, pyrazinamide, rifabutin, rifampicin, streptomycin, thioacetazone, thioridazine, vitamin D and viomycin. [5] The in vitro method according to any one of claims 1 to 4, wherein the mycobacterium is selected from the group consisting of Mycobacterium smegmatis, Mycobacterium bovis and Mycobacterium tuberculosis. [6] The in vitro method according to any one of claims 1 to 5, wherein the cell is an immune cell, such as a macrophage. [7] An expression vector comprising a polynucleotide encoding an exogenous IFIT polypeptide for use in a method of treating a mycobacterial infection in a subject, the method comprising administering a therapeutically effective amount of of the expression vector to the subject, thereby increasing the cellular concentration of the IFIT polypeptide in a cell infected with a mycobacterium; wherein the exogenous IFIT polypeptide is selected from at least one exogenous IFIT1, IFIT2 or IFIT3 polypeptide, and whereby increasing the cellular concentration of the IFIT polypeptide decreases the number of viable mycobacteria in the cell, thereby treating the mycobacterial infection. [8] An expression vector for use according to claim 7, wherein the exogenous IFIT polypeptide comprises an amino acid sequence of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:

3. [9] An expression vector for use according to claim 7, wherein the polynucleotide encoding the exogenous IFIT polypeptide comprises a nucleic acid sequence of SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:

6. [10] An expression vector for use according to any one of claims 7 to 9, further comprising administering to the subject a pharmaceutical compound selected from the group consisting of arginine, amikacin, bedaquiline, capreomycin, ciprofloxacin, clarithromycin, clavulanic acid, clofazimine, co-amoxiclav, cycloserine, enviomycin, ethambutol, ethionamide, imipenem, interferon-γ, isoniazid, kanamycin, levofloxacin, linezolid, meropenem, metronidazole, moxifloxacin, para-aminosalicylic acid, prochlorperazine, prothionamide, pyrazinamide, rifabutin, rifampicin, streptomycin, thioacetazone, thioridazine, vitamin D, and viomycin. [11] The expression vector for use according to claim 10, wherein the pharmaceutical compound and the expression vector encoding the IFIT polypeptide are administered to the subject separately, simultaneously, or sequentially. [12] An expression vector for use according to any one of claims 7 to 11, wherein the mycobacterium is selected from the group consisting of Mycobacterium smegmatis, Mycobacterium bovis and Mycobacterium tuberculosis. [13] An expression vector for use according to any one of claims 7 to 12, wherein the cell is an immune cell such as a macrophage. [14] An expression vector for use according to any one of claims 7 to 13, wherein the subject is selected from the group consisting of a mammal. [15] An expression vector for use according to claim 14, wherein the subject is a human.

Images