COMPOSITIONS DERIVED FROM POULTRY FOR USE IN THE TREATMENT OF DIABETES

DE602014092343T2Active Publication Date: 2025-09-03INTERNATIONAL DEHYDRATED FOODS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602014092343
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2013-07-08
Filing Date
2014-07-08
Publication Date
2025-09-03
Estimated Expiration
2034-07-08

AI Technical Summary

Technical Problem

Traditional chicken broths may not maximize the extraction of beneficial compounds due to varying cooking methods and conditions, leading to suboptimal health benefits.

Method used

A method involving cooking chopped chicken parts with bones and cartilage at high temperature and extended time to enhance extraction of beneficial compounds, resulting in a composition with higher concentrations of proteins, amino acids, chondroitin sulfate, and polyphenols.

Benefits of technology

The composition effectively decreases expression of specific microRNAs associated with inflammation and diabetes, providing enhanced nutritional and health benefits, including anti-inflammatory effects and improved joint health.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

BACKGROUND

[0001] Chicken broth is a complex mixture containing extractives obtained from cooking of chicken parts or whole chickens. Different chicken broths may have different compositions which may explain the varying nutritional and health values of different broths. One major constituent of a chicken broth is soluble proteins, which are made up of albumins, along with many other proteins. Numerous other compounds are present in chicken broths. Examples of such compounds include, for example, minerals, organic compounds, nucleotides, metabolites, lipids, phospholipids, vitamins, among others.

[0002] Traditional home-style chicken broth is prepared by cooking one or more poultry parts in water and / or steam for extended time. Broths prepared from different raw materials may have different compositions. Even when the same raw materials are used, slight variations of the cooking processes may result in broths having different constituent profiles.

[0003] Chicken stocks prepared by different methods are disclosed in an article by K. Connaughton, "From the Test Kitchen: Perfect Pressure Cooker Chicken Stock", Saveur, 8 November 2010, pages 1-3, an article by M. Sisson, "Mark's Daily Apple Cooking with Bones", 15 April 2010, pages 1-8, an anonymous article entitled "How to Make Bone Broth and Bone Broth's Health Benefits", 8 November 2021, and an article by K. Daniel, "Why Broth is Beautiful: Essential Roles for Proline, Glycine and Gelatin - The Weston A. Price Foundation", 18 June 2003.

[0004] Patrick du Souich et al. report on immunomodulatory and anti-inflammatory effects of chondroitin sulfate in an article published in the Journal of Cellular and Molecular Medicine, volume 13, number 8a, pages 1451-14632009. D. Ji et al report on the determination of chondroitin sulfate content in raw materials and dietary supplements by high-performance liquid chromatography with ultraviolet detection after enzymatic hydrolysis in the context of a single-laboratory validation in an article in the International Journal of the AOAC, volume 90, number 3, 2007, pages 659-669.

[0005] JP 4695846 B2 discloses an α-glucosidase inhibitor containing, as the effective component, chondroitin sulfate containing molecular units having a structure represented by a certain formula. The α-glucosidase inhibitor contains, as the effective component, chondroitin sulfate derived from cartilage of fish. A further process for obtaining chondroitin sulfate from soft connective tissue, skin, bone, tendon, ligament, cartilage, trachea joint, ear, nasal cartilage from cattle, sheep, pork and shark fin and squid using sodium hydroxide is disclosed in MX 2011012090 A.

[0006] US 5827874 A discloses methods of using proline for the treatment of inflammation and pain and especially for the treatment of inflammatory conditions, rheumatic and non-rheumatic pain and for postoperative or posttraumatic pain. US 6 780 841 B2 discloses hydrolyzed collagen type II powder compositions for inducing cartilage formation in an individual, method of preparing the compositions and use of the compositions in treating connective tissue disorder, replenishing skin viscoelasticity. US5645851A discloses a composition reported to be useful as an edible supplement for alleviating the symptoms of arthritis for oral consumption by mammals, said composition comprising animal tissue containing water-insoluble Type II collagen, which has been separated from non-Type II collagen containing tissue and has been sterilized in subdivided form without changing the original structure of the Type II collagen. US 2002 / 086070 A1 discloses a pharmaceutical composition including a therapeutic quantity of a joint restorative compound selected from amino sugars, chondroitin, collagen 2, or methyl sulfonyl methane; and a therapeutic quantity of a COX-2 inhibitor having an IC50-WHMA COX-2 / COX-1 ratio ranging from about 0.23 to about 3.33. Also disclosed are methods for the treatment, regeneration, and repair of connective tissue in mammals and methods for treating osteoarthritis, rheumatoid arthritis or acute pain utilizing the disclosed

[0007] According to US 2012 / 021063 A1, a collagen / elastin crosslinked material is obtained by crosslinking a fish-derived collagen and a fish-derived elastin, and is fully capable of corresponding to various uses such as medical materials including an artificial dermis and scaffold material for cell culture. EP1607006A1 discloses a food composition comprising elderberry and / or blackcurrant, wherein the food composition has a polyphenol content of 300 mg / kg or more, calculated as gallic acid equivalents, wherein the consumption by a human subject is reported to be effective in reducing the cardiovascular risk of that human subject. US2005148073A1 discloses methods of inducing proliferative and differentiative mammalian hepatocytes, or survival of differentiative mammalian hepatocytes, in vitro comprising contacting the hepatocytes with protein kinase A (PKA) inhibitor. EP2205737B1 relates to very short heavily modified oligonucleotides which target and inhibit microRNAs in vivo, and their use in medicaments and pharmaceutical compositions.SUMMARY

[0008] The present invention is set forth in claim 1 directed to a composition for use in the prevention and / or treatment of diabetes, said composition being prepared by a process including cooking chopped chicken parts containing chicken bones and cartilage in water at a temperature greater than 121 °C for more than 6 hours.

[0009] In one aspect, the composition may have higher concentration of certain beneficial compounds. In another aspect, certain beneficial compounds may be enriched in the disclosed composition to a greater extent as compared to other broth products currently available on the market.

[0010] The composition disclosed herein may be characterized by the methods through which they are prepared. Moreover, the disclosed composition is also unique in the health benefits they may provide to a subject.

[0011] MicroRNAs (miRNAs) are small RNA molecules that can regulate gene expression. miRNAs have been implicated in the development and progression of many inflammatory diseases. In one embodiment, when administered to a subject, the composition may decrease expression of a miRNA in a subject administered an effective amount of said composition as compared to a control subject not administered said composition.

[0012] The composition provided herein is for use in a method to prevent and / or treat diabetes. In one aspect, the composition decreases expression of at least one miRNA in the subject receiving an effective amount of the composition as compared to expression of the same miRNA in a control subject not receiving the effective amount of the composition. Examples of the miRNA associated with these methods include, for example, one or more of SEQ ID Nos. 28-33.BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 shows the protein profile by staining of proteins separated by SDS-PAGE. Figure 2 shows that up-regulation of PKA is significantly repressed in animals fed with AAC1 broth as compared to animals fed with a commercially available product TSN. Figure 3 shows nocifensive responses of AAC1 compared to a commercial product. Figure 4 shows the protein profile by staining of proteins separated by SDS-PAGE and quantification of molecular weight distribution. DETAILED DESCRIPTION

[0014] Chicken soup and chicken broth have been available for human consumption for centuries. Many studies have been performed that show various health benefits of chicken soup or broth. According to conventional home-style method, chicken soup or broth is prepared by boiling whole chicken or large chicken parts in a pot of water for an extended period of time. The soup or broth prepared according to this method may not have maximized the health promoting effects of the soup or broth because some of the compounds may have been lost during cooking or during processing, while other compounds may not have been extracted from the chicken parts.

[0015] The present disclosure provides an improved method by processing chicken parts prior to cooking and by controlling the processing temperature and cooking time to maximize the extraction of beneficial compounds while, concomitantly, minimizing loss of activity due to harsh processing conditions.

[0016] Specially selected raw materials from poultry are processed according to the disclosed methods to obtain a broth having high protein content. Certain amino acids are present in relatively higher concentration as compared to a home-made broth or other commercial products. As shown in various animal studies described herein, the disclosed broth compositions may prove effective in preventing and / or treating joint diseases and the underlying pathology. The compositions may also provide other nutritional and health benefits such as decreasing inflammation.

[0017] The terms "broth" and "soup" refer to a liquid composition containing at least one solute and may also be used to refer to a ready to serve form, a concentrate, a stock in either liquid or solid form.

[0018] The broth of the disclosure may contain a significant amount of different amino acids. Such amino acids may be present in the form of a protein or as free amino acids in the broth. Total amino acids include both amino acids present in the form of proteins and those present as free amino acids. For purpose of this disclosure, the ratio of different amino acids in a broth composition refers to the ratio between total amino acids.

[0019] The term "dry solid" or "solid" as used herein refers to the components of a liquid composition that remain after all free liquid is removed from the liquid composition. In the case of an aqueous broth, the free liquid is water.

[0020] The term "administer" means delivering of a material to an individual, such as by oral ingestion.

[0021] The term "subject" is used to refer to a mammal, including human being.

[0022] The term "substantially" means by at least 10-20%.Examples

[0023] The following examples and comparative examples, which do not form part of the invention, are provided for purposes of illustration only and are not intended to be limiting. The raw materials, reagents, chemicals, and other materials are presented as exemplary components or reagents, and various modifications may be made in view of the foregoing discussion within the scope of this disclosure. Unless otherwise specified in this disclosure, components, reagents, protocol, and other methods used in the system and the assays, as described in the Examples, are for the purpose of illustration only.Example 1 (comparative) Preparation of broth from turkey parts

[0024] In this comparative example not forming part of the invention, turkey parts were used to prepare a broth and the overall quality and potential health benefits of the broth were determined. Briefly, raw turkey was mechanically separated and the parts were finely comminuted to less than 2mm in size to maximize extraction. The small-sized parts from the turkey were gently cooked to 195°F in steam for about 15 minutes or less. The broth was then separated from the insoluble fraction by decanting. Freed fat in the broth was also removed from the broth by a centrifugal separator. The broth was concentrated in a commercial evaporator, chilled, and packaged for sale.Example 2 Preparation of broth from chicken parts

[0025] In this study, chopped chicken parts containing chicken bones and cartilage were cooked in water at a temperature greater than 121 °C (250°F) for more than 6 hours to maximize the extraction of certain broth fraction and / or compounds. The broth obtained from this process was designated "AAC1" for internal reference. More particularly, USDA inspected chopped raw chicken bones remaining after major muscles were removed were cooked in water in a large commercial stainless steel cooking tank. After cooking, the liquid broth portion was separated from the chicken solids by decanting. The broth was concentrated in a commercial evaporator then spray dried and packed in labeled containers.Example 3 Comparing the protein and amino acid profiles of different broths

[0026] Proteins are large molecules composed of one or more chains of amino acids that perform a wide array of functions in biological systems including, for example, functioning as enzymes, facilitating cell communication, and providing structural support to cells. Humans, as well as other animals, obtain essential amino acids from protein consumed as part of their diet since they lack enzymes needed to synthesize them. Ingestion of proteins leads to their break down into amino acids through the digestive process. The amino acids can then be used in protein biosynthesis in muscle production and maintenance, glucose production, serve as a dietary nitrogen source, and serve as a fuel source if necessary. The objective of this study was to determine the concentration and size range of proteins in chicken broth AAC1 as compared to a home-made product.

[0027] One sample prepared according to this disclosure (AAC1) and another sample prepared according to home-style cooking methods (Homemade) were compared. The percent solid (w / v) for AAC1 was 8% solid, while the percentage (w / v) for Homemade was 1.7% solid.

[0028] Prior to determining the amount of protein by the Bradford method, each sample was diluted in distilled water to a final 1% w / v solution. A standard curve was prepared using bovine serum albumin (0-3.5µg / µL). All samples were analyzed in triplicate. The amount of total protein was determined using a plate reader at a wavelength of 595 nm. Results are shown in Table 1. Table 1 Amount of total protein in broth samplesSample Values Results Mean Results Concentration SD CV AAC1 0.4461.5581.6911.6910.1327.80.4611.6930.4741.821Homemade 0.5442.4962.522.520.0341.30.5492.544

[0029] To correct for differences in the percent solids in AAC1 (8%) and Homemade (1.7%) samples, the protein values based on a 1% solution for AAC1 and Homemade were multiplied by their respective starting % solids. The final adjusted amount of total protein for AAC 1 and Homemade are shown in Table 2. Table 2 Adjusted total protein concentration in AAC1 and homemade brothSample Adjusted Final Concentration % of AAC1 AAC1 13.6 µg / ul-Homemade 4.3 µg / ul31.6%

[0030] To determine the protein profile of each sample, equal volumes of the AAC1 and Homemade samples (15.6µl) were each mixed with Laemmli's sample buffer and a reducing agent, heated at 95°C for 5 minutes, and separated on a 4-12% Bis Tris gel. The relative size range of the proteins was determined by comparison to a commercially available protein standard (ranging from 4.5 kDa to 300 kDa). A constant voltage of 150V was applied to the gel for 30 minutes, allowing for separation of proteins in each sample. The proteins were visualized in the gel using SimplyBlue ™< SafeStain.

[0031] The results are shown in Fig. 1. Lane 1 shows the protein profile for homemade broth, lane 2 for the AAC1 broth, and lane 3 is molecular weight standard. Based on the protein profiles, AAC1 is composed of approximately 3 times more protein than a homemade product. Proteins in the homemade product displayed a wider range of molecular weight distribution, containing both large (up to about 300-500 kD) and small proteins (about 5-15kD). By contrast, the majority (i.e., greater than 50%) of proteins in AAC1 has molecular weight of between 70 kDa and 15 kDa.

[0032] Individual amino acid content was also analyzed. Table 3 below shows the individual amino acid content of the broth compositions prepared according to the disclosed methods as compared to those prepared using home-style methods as well as other commercial products. Table 3 Amino acid composition of different brothsTable Two: Content values above calculated to 100% solids basis: 3823Commercial productHome-made-1Home-made-2AAC1-1AAC1-2AAC1-3-W / W%%TAURINE2.50ASPARTIC ACID3.632.443.633.477.045.345.38THREONINE1.440.761.521.421.752.131.79SERINE1.561.341.961.892.081.882.40GLUTAMIC ACID10.256.989.449.2610.529.5010.14PROLINE3.533.055.935.579.5910.6611.07HYDROXYPROLINE2.192.995.314.92na7.009.39GLYCINE5.977.388.799.4718.0215.4117.68Lanthionine0.060.000.000.000.000.000.00ALANINE3.913.374.604.588.067.537.53CYSTINE0.440.290.340.400.000.250.17VALINE1.44 0.73 1.43 1.42 2.44 2.19 2.21 ISOLEUCINE1.13 0.47 1.18 1.02 1.54 1.59 1.59 LEUCINE2.72 1.51 2.48 2.32 3.38 3.47 3.43 METHIONINE0.810.520.930.771.011.061.10TYROSINE0.880.440.810.651.091.000.90PHENYLALANINE1.000.739.537.032.302.161.98HYDROXYLYSINE0.160.000.000.000.000.000.00HISTIDINE2.032.562.701.731.321.161.00ORNITHINE2.250.000.000.000.000.000.00LYSINE3.752.673.073.003.963.663.05ARGININE3.062.794.013.758.246.696.61TRYTOPHAN0.160.060.120.090.220.15Total 54.8441.0867.8062.7982.3582.8887.55 Example 4 Comparing levels of chondroitin sulfate (CS) in different broths

[0033] Chondroitin sulfate (CS) is an important structural compound found in cartilage and is implicated in joint health. CS has been shown to reduce the levels of many inflammatory mediators such as iNOS, PGE2, COX-2 (Gwendolyn, Spine 2011), and NFkB (Vallières, Osteoarthritis Cartilage, 2010). The goal of this study was to determine the amount of CS in various chicken broth samples. Chicken broths were analyzed for total CS using enzymatic digestion and LC-UV detection (Ji, Journal of AOAC International, 2007). Results were calculated as area on the curve compared to standard samples and the limit of quantification as 8 mg chondroitin sulfate / g dry material (Table 4). Among all chicken broths tested, AAC1 had the greatest amount of CS (8.797% w / w). Table 4 Amounts of chondroitin sulfate (CS)SamplesAverage (mg)Dry mg / gDry % w / wPowdered Chicken Broth AAC 117.48087.9718.797Powdered Chicken Broth H81415.44367.5536.755Frozen Concentrate TSN10.88652.0595.206Frozen Concentrate IDF Chicken 8238.62742.1044.210Home Style Broth from Back Bones5.86628.2582.826Frozen Concentrate Turkey 8245.24326.2272.623Powdered Chicken Broth HML 345114.97924.3352.434Powdered Chicken Broth A10043.81718.3051.830Powdered Chicken Broth P13013.07515.0541.505Home Style Broth from Chicken Parts2.18510.991.09Home Style Broth from Chicken Necks1.9379.3610.936 Example 5 Comparison of concentration of polyphenols in different chicken broths

[0034] The concentration of polyphenols in different chicken broths was determined using a modified Folin-Ciocalteau method (Slinkard, American Journal of Enology and Viticulture, 1977). Polyphenols are a class of chemical compounds known to have anti-oxidant and anti-inflammatory properties. While both AAC1 and home-style broths contained polyphenols, AAC1 contained 4828.8 µg / mL GAE of polyphenols, which is approximately 7 times more GAE of polyphenols than a homemade broth (687.7 µg / mL GAE) made from the same kind of chicken parts.Example 6 (comparative) Effect of the broth composition on COX family of enzymes

[0035] The COX family of enzymes is responsible for the synthesis of prostanoids such as prostaglandins. COX-1 is constitutively active while COX-2 is inducible and hence is upregulated during inflammation and pain. Compounds that block COX-2 activation while not effecting COX-1 are of particular interest due to their ability to block inflammation while not causing unwanted side effects mediated by blocking COX-1 activity. The level and specificity of COX inhibition by the chicken broth prepared according to the disclosed methods was investigated.

[0036] Using an in vitro COX enzyme inhibitor assay (Abcam), chicken broth samples were assayed for their ability to block COX-1 and COX-2 activity according to the manufacturer's protocol. The results are shown in Table 5. Table 5 Selective inhibition of COX-1 and COX-2SampleEnzyme% InhibitionRatio of COX2 / COX1InhibitionPowdered IDF AAC1COX-1-2.3COX-242.418.34Frozen IDF 823COX-1-51.5COX-222.10.43Home Style Broth from Back BonesCOX-1-17.9COX-228.11.57Home Style Broth from NecksCOX-1-32.5COX-225.30.78IDF Turkey 824COX-1-21.7COX-232.71.51Chicken Broth KCOX-1-25.5COX-230.81.21Commercial Broth TSNCOX-1-5.1COX-226.35.16Commercial Broth H814COX-1-39.9COX-211.30.28Commercial Broth A1004COX-1-9.2COX-236.74.01Commercial Broth HMLCOX-1-27.0COX-227.31.01Commercial Broth PLNTCOX-1-19.9COX-247.12.36Home Style Broth from same raw partsCOX-1-5.2COX-23.50.67

[0037] Broth labeled "Home Style Broth from same raw parts" was a broth prepared using traditional home-style cooking method with the same raw materials as those used for preparing AAC1. As shown in Table 5 above, chicken broth AAC1 showed the greatest ratio of COX-2 inhibition to COX-1 inhibition (18.34) with greater than 40% inhibition of COX-2 enzyme activity as compared to other commercial products or "Home Style Broth from same raw parts."Example 7 (comparative) Effect of the disclosed broth on joint diseases by regulating protein kinase A

[0038] Temporomandibular Joint Disorder (TMD) is a disease affecting the temporomandibular or jaw joint (TMJ), the muscles of mastication, or both. TMD is believed to be caused by activation of neurons and glia cells located in the trigeminal system (Tjakkes et al., 2010). The prevalence of TMD symptoms have been reported in up to 93% in the general population with varying incidence rates (Zhao et al., 2011). Further development of TMD may also lead to the development of a chronically sensitized state of the disorder.

[0039] Protein kinase A (PKA) is a member of the family of cyclic AMP (cAMP) dependent enzymes that act as pro-inflammatory molecules in peripheral and central nervous systems. Increased levels of PKA expression by sensory nociceptive neurons has been reported during the chronic sensitized state. The objective of this study was to study the effects of commercially available broths, home-style broths, and the broths according to the instant disclosure. These various products may contain certain anti-inflammatory molecules that have some effects on TMD. These molecules may exert their effects through PKA in regulating the development and progress of TMD.

[0040] Three chicken broths (AAC1,TSN, and a homemade broth) were investigated in this study. Broth AAC1 (8% solids) was prepared at a concentration of 0.5% (w / v). First, 5g of powdered broth was placed in a clean, autoclaved bottle. The bottle was then filled to the 1L mark with filtered water and the mixture was stirred to allow the powder to dissolve in water. A homemade style broth (1.7%) was also tested as a control. To achieve a dosage that would allow for the comparison of AAC1 and the homemade-style broth, the homemade broth was diluted 16 fold with filtered water by placing 62.5 mL of stock broth and diluting the broth to 1L. A commercially available broth, TSN, was also tested as another control. To ensure TSN was tested at a concentration similar to that of AAC1, the solution for TSN (33.3% solid) was made in a similar manner. The TSN broth was allowed to warm until a consistency of the stock broth was non-gelatinous. Broths were measured out into 16.7g increments and placed into clean bottles as previously described. The bottle was then filled to the 1L mark with filtered water. All solutions were then placed in a warm, sonication bath for 30 minutes to allow all components of the broths to be evenly solubilized. Broths were stored in the refrigerator until they were administered to the animals via water bottle administration for 2 weeks prior to TMD induction.

[0041] Adult Sprague-Dawley male rats (200g-300g) were used in this study. The rats were divided into three groups, with each group being fed with water, a commercial product (TSN), or AAC1 broth prepared according to this disclosure.

[0042] Mechanical stress was applied to each group and upper spinal cord tissues containing the spinal trigeminal nucleus (STN) samples were obtained and processed for immuno-staining. Prior to immunostaining, slides were placed at room temperature and covered with 1xPBS for 5 minutes. PBS was removed, and liquid was replaced with a 5% normal donkey serum- 0.1% triton solution for 20 minutes. Tissues were then washed with 5 mL 1xPBS. Working dilutions of rabbit anti-rat PKA (BD Biosciences,San Jose,CA;1:500) were made using 5% normal donkey serum. Primary antibodies were allowed to incubate on tissues (100µl / tissue) for 3 hours at room temperature. Samples were then washed with 5mL 0.1% Tween 20- PBS and 2mL 1xPBS. Working dilutions of donkey anti-rabbit IgG Alexa 488 ®< was made by diluting stock antibodies 1:200 in 1xPBS. Secondary antibodies were allowed to incubate on sample slide (100µl / tissue) for 1 hour at room temperature while protected from light. Slides were again washed with 5mL 0.1% Tween 20- PBS and 2mL 1xPBS, and mounted for fluorescent analysis using Vectashield fluorescent mounting media containing the fluorescent dye DAPI. Slides were cover slipped, sealed using clear nail polish, and stored at 4°C until microscopic images were collected.

[0043] A Zeiss Z1 imager with apotome was used to acquire 10x Z-Stacked images of the V3 areas of the trigeminal ganglia and medullary horn of the STN. Zen 2011 software was used to evenly balance the background of each image prior to analysis. Gray scale jpeg images were opened in ImageJ software, where 10 non-overlapping regions of interests (RIOs) with an area of equal size were placed in areas representative of protein expression in each image, and the integrated pixel densities were measured. Background intensities were also acquired through similar procedure, and averaged. The average background intensity acquired from each image was then subtracted from each integrated density values from areas of interest. Subtracted integrated densities were averaged and fold changes were calculated as the average change ± SEM from TMD control levels. Statistical differences were determined using the Mann-Whitney U test in SPSS software, and were considered to be different when p ≤ 0.05.

[0044] The data in Fig. 2 provide evidence that elevated PKA levels caused by prolonged jaw opening are greatly repressed in AAC1 fed animals when compared to levels in animals consuming either water or a commercial product (TSN). In Table 6, the results of several experiments are summarized as the average fold change in the intensity of immunostaining when compared to water whose mean intensity was made equal to one. Table 6 AAC1 repression of elevated PKA levels in response to jaw stress caused by prolonged jaw openingBroth Average Fold Change P Value (vs. TMD) P Value (vs. TSN) Water (TMD) 1.00 ± 0.061.0000.239AAC1 0.75 ± 0.020.0010.000TSN 0.94 ± 0.040.2391.000

[0045] The AAC1 broth disclosed herein showed a greater ability to modulate the levels of PKA in the STN following joint stress when compared to a commercially available product. Based on the difference in composition of AAC1 and a homemade broth, we would predict that AAC1 would be significantly better at repressing stress-induced elevations in PKA levels in the STN.Example 8 (comparative) Nocifensive responses of AAC1 as compared to other broth products

[0046] Temporomandibular Joint Disorder (TMD), is characterized by the continuation of pain behavior and sensation despite a decrease in nociceptive inputs (Herb et al., 2006). The increased sensitivity can be attributed to the development of a chronically sensitized state of the nerves that provide sensory innervation of the joint, muscles, ligaments, and tendons. TMD patients often report that their symptoms negatively affect other aspects of their life (Sessle, 2008). Some TMD patients develop protective behavior modifications that may limit or minimize their everyday activities. This protective behavior is termed "nocifensive" behavior. The objective of this study was to determine if AAC1 chicken broth could reduce TMJ stress-induced nocifensive behaviors in response to mechanical stimulation, and how its performance compares to homemade broth and commercially available products.

[0047] Three chicken broths (AAC1, TSN, and a home-style broth) were investigated in this study. Broth AAC1 (8% solids) was made at a 0.5% (w / v) while a homemade style broth (1.7%) was tested at a dose that would allow for an equal comparison of the ratio of percent solids between AAC1 and a homemade broth. Thus, the homemade broth was diluted 8 fold with filtered water by placing 62.5 mL of stock broth, and diluting the broth to 1L. To test a competing commercially available broth at a similar concentration, a solution for TSN (33.3% solids) was made in a similar manner with the modification that the broth was allowed to warm until a consistency of the stock broth was non-gelatinous.

[0048] Broths were measured out into 16.7g increments and placed into clean bottles as previously described. The bottle was then filled to the 1L mark with filtered water. All solutions were then placed in a warm, sonication bath for 30 minutes to allow all components of the broths to evenly solubilize. Broths were placed in the refrigerator until they were administered to the animals via water bottle administration for 2 weeks prior to TMD induction.

[0049] Adult Sprague-Dawley male rats (200g-300g) were housed separately in clean, standard plastic rat cages (VWR, West Chester, PA) with non-restricted access to both food and water in a room with 12 hour / light dark cycles. Three consecutive days prior to testing, animals were allowed to enter the Ugo Basile Durham animal holding device (Ugo Basile, Collegeville, PA) for 5 min to acclimate to testing conditions. During this acclimation period, stimulation of hair follicles and epidermis located in the masseter and TMJ region of the face occurred by gently rubbing the area with a pipette tip. This stimulation was used to improve the condition of the animal to the testing procedure, thus reducing the number of false reactions to testing filaments. Baseline nocifensive behaviors were assessed by utilizing a modified version of the well-established von Frey method. A series of calibrated von Frey filaments were applied in increasing force to the cutaneous area over the masseter muscle. Prior to application, the muscle was palpated with the tip of the testing filament to insure proper placement. Once placement was established, a scientist blinded to the experimental conditions placed enough force on the location to accomplish a bend in the filament. Reactions observed after initiation of force to the area and prior to the bend of the filament, were verified by one other scientist and recorded. Each filament was applied 5 times, and recorded as the number of reactions obtained from 5 applications of each specific calibrated filament. Measurements were collected over both the right and left masseter muscles of each animal, which were averaged together to obtain a combined average number of reactions out of 5. Baseline readings were prior to 2 week feeding of all chicken broth products and again 24 hours prior to TMD induction.

[0050] The number of nocifensive responses after 2 hr, 3 days, or 7 days in animals experiencing a mechanically induced TMD pathology was measured. The results of this study, which are shown in Fig. 3, demonstrate that AAC1 significantly reduces the number of nocifensive responses after 2 hr, 3 days, or 7 days in animals experiencing a mechanically induced TMD pathology. AAC1 significantly decreases the number of nocifensive responses as compared to TMD animals that consumed only water. The TSN product did not cause a decrease in nocifensive responses at any of the measured time points. Thus, while product AAC1 reduces nocifensive behaviors in animals experiencing chronic inflammation resulting from the prolonged jaw opening TMD model, this ability is not exhibited by a commercially available product. Based on results obtained from previous examples, as well as data presented in this example, we would predict that a homemade broth product would not significantly reduce TMJ stress induced nocifensive responses.Example 9 (partly comparative) Effect of broth on various diseases through epigenetic changes

[0051] The goal of this study was to evaluate the effects of daily administration of chicken broth on miRNAs implicated in the development and resolution of conditions and diseases. miRNAs are small RNA molecules (typically about 22-nucleotide long) that play an important role in regulating the genome of animals including humans. These molecules control the genetic expression of thousands of genes. Importantly, changes in the expression of miRNAs are implicated in the development and progression of many inflammatory and disease states.

[0052] Adult Sprague-Dawley male rats (200g-300g) were housed separately in clean, standard plastic rat cages (VWR, West Chester, PA) with non-restricted access to both food and water in a room with 12 hour / light dark cycles. Chicken broth AAC1 (8% solids) and a homemade-style broth (1.7% solids) were used in this test. Broth AAC1 was made at a 1% (w / v) by placing 10g (1%) of powdered broth in a clean, autoclaved bottle. The bottle was then filled to the 1L mark with filtered water. To maintain comparison ratios of percent solids between AAC1 and a homemade-style broth, the homemade broth was diluted 8 fold with filtered water by placing 125mL of stock broth, and diluting the broth to 1L. Solutions were then placed in a warm, sonication bath for 30 minutes to allow all components of the broths to evenly go into solution. Broths were placed in the refrigerator until they were to be used. Animals received 300mL of broth every two days for a total of 4 weeks. Spinal trigeminal nucleus (STN) and frontal cortex (FC) samples were acquired from the animals, while pancreatic tissue samples were obtained via abdominal dissection. Once extracted, tissues were immediately frozen in liquid nitrogen, and stored at -20°C until RNA could be extracted.

[0053] Tissues were weighed, and placed into a 1.5 mL Eppendorf tube (Eppendorf, Hauppauge, NY) containing 600 µl TRIzol ®< Reagent (Invitrogen, Grand Island, NY). Tissues were homogenized using a plastic pestle in a clean, RNAase free hood. Once tissues were completely homogenized, 600 µl of TRIzol added to each sample, and inverted several times to ensure complete mixing. Once mixed, 120 µl chloroform was placed in each tube, and rapidly inverted. Samples were then placed on ice for 5 minutes. After 5 minutes, samples were centrifuged at 12,000 x g for 15 minutes at 4°C to separate the organic and aqueous layers. Once separated, the RNA containing aqueous layer was removed and placed into a clean, 1.5 mL tube. At this time, an additional 120 µl chloroform was placed in each tube, and rapidly inverted. Samples were again incubated on ice for 5 minutes and centrifuged at 12,000 x g for 15 minutes at 4°C. Once separated, the RNA containing aqueous layer was removed and placed into a clean, 1.5 mL tube. To precipitate the RNA, 1 mL of ice cold isopropanol was placed in each tube. Each sample was then inverted several times to insure complete mixing. Samples were then incubated at -20°C for 30 minutes and centrifuged at 12,000 x g for 15 minutes at 4°C. RNA pellets were first visualized, and isopropanol was removed. RNA pellets were then washed with RNAase free 75% ethanol, and centrifuged 7,500 x g for 10 minutes at 4°C. Ethanol was then removed and the RNA pellets allowed to dry. Pellets were then re-suspended in RNAase free water, and placed at - 20°C.

[0054] cDNA was obtained from total RNA samples (250 ng) using the miScript 2 RT Kit (Qiagen) according to manufacturer's manual. Samples were incubated at 37°C for 1 hour, followed by incubation at 95°C for 5 minutes. This cycle was completed once, at which time the sample was placed on ice. Samples not assayed immediately were placed at -20°C for storage, while samples to be assayed immediately were diluted with 200µl of RNAase free water as described in manufacture's handbook.

[0055] Qiagen Pathway-Focused RT-PCR arrays were used to determine changes in miRNA expression using panels focused on Diabetic, Inflammatory & Autoimmune, and Neurological Development & Diseases pathways. QuantiText SYBR Green PCR Master Mix (2X), miScript Universal Primer (10X), template cDNA, and RNAase free water was allowed to come to room temperature prior to use. In a clean, RNAase-free environment the following components were combined in the following amounts to a clean, RNAase- free reservoir as described in manufacturer's handbook. Once mixed, 25 µl of prepared reaction was pipetted into each well of a 96 well Pathway Focused RT-PCR plate using a multichannel pipette. Once loaded, samples were covered with a provided, clear, plastic adhesive sheet, and each well sealed individually. Each plate was placed in an Applied Biosystems OneStep RT-PCR machine where it was incubated initially at 95°C for 15 minutes, then 40 cycles at the following conditions: 94°C 15 seconds; 55°C for 30 seconds; and 70°C for 30 seconds. Data collection occurred during the second step of each cycle of 40.

[0056] Once each experiment was completed, raw data was imported into OneStep software. Prior to analysis, a baseline was established according to manufacturer's specification listed in the protocol handbook (cycle 2- 2 cycles prior to amplification, not more than cycle 15). The baseline is the noise level in early cycle, where there is no detectable amplification. At this point a threshold was also established according to manufacturer's specifications detailed in the handbook. Thresholds were set using a logarithmic amplification plot to include the log-linear range of the curve. The threshold was placed at 1 for all arrays. This position allowed the threshold to be set above background noise, and at the lower half of the linear portion of the curve for all control samples. Under these conditions, raw CT values were obtained.

[0057] To obtain ΔCT values, raw CT values from one control sample (n=3) and one chicken broth sample (n=3) for each panel was placed in miScrip miRNA PCR Array Web-Based software provided by the manufacture. Data was normalized to a minimum of 2 housekeeping genes, since typically levels of these genes do not change under experimental conditions. Once appropriate housekeeping genes were selected, data was submitted, and normalized ΔCT values were calculated by web-based software. Values obtained from data software were then placed into an excel spreadsheet. To calculate ΔΔCT values for chicken broth samples the following equation was used: ΔΔCT AAC1 = ΔCT control sample1 -ΔCT AAC1 sample1 . To determine fold change from control expression the following equation was used: fold change = 2^ΔΔCT AAC1 sample1 . Fold changes obtained from 3 independent experiments were averaged, and reported as the average fold change ± SDEV. Statistical significance was determined through Mann-Whitney U, and significance determined when p ≤ 0.05. Table 7 Changes in miRNA levels associated with inflammation and autoimmune diseases in response to AAC1 (comparative example)Name Pathology Targets If Known Average Fold Change Control AAC1 P Values Vs. Control Sequence rno-miR-101a-3p Inflammation and AutoimmuneFos, Ptgs2, Rac1, Socs2, Spred11.00 ± 0.07UACAGUACUGUGAUAACUGAA SEQ ID No. 10.69 ± 0.070.05rno-miR-101b-3p Inflammation and AutoimmuneFos, Ptgs2, Rac1, Socs2, Spred11.00 ± 0.06UACAGUACUGUGAUAGCUGAA SEQ ID No. 20.68 ± 0.050.046rno-miR-106b-5p Inflammation and AutoimmuneF3, 1125, Mgll, Osm.1.00 ± 0.06UAAAGUGCUGACAGUGCAGAU SEQ ID No. 30.65 ± 0.080.046rno-miR-125b-5p Inflammation and AutoimmuneIl16, Irf4, Stat3, Tnfsf4.1.00 ± 0.05UCCCUGAGACCCUAACUUGUGA SEQ ID No. 40.78 ± 0.090.046rno-miR-140-5p Inflammation and AutoimmuneBmp2, Fgf9, Hdac7, Spred1, Vegfa.1.00 ± 0.09CAGUGGUUUUACCCUAUGGUAG SEQ ID No. 50.78 ± 0.060.05rno-miR-142-3p Inflammation and AutoimmuneGhr, Prlr, Rac1.1.00 ± 0.05UGUAGUGUUUCCUACUUUAUGGA SEQ ID No. 60.69 ± 0.040.05rno-miR-16-5p Inflammation and AutoimmuneBtla, Cd28, Fgf7, Ghr, 1110ra, Spred1, Vegfa.1.00 ± 0.05UAGCAGCACGUAAAUAUUGGCG SEQ ID No. 70.68 ±0.100.046rno-miR-17-5p Inflammation and AutoimmuneF3, 1125, Mgll, Osm.1.00 ± 0.10CAAAGUGCUUACAGUGCAGGUAG SEQ ID No. 80.54 ± 0.080.05rno-miR-195-5p Inflammation and AutoimmuneBtla, Cd28, Fgf7, Ghr, 1110ra, Spred1, Vegfa1.00 ± 0.06UAGCAGCACAGAAAUAUUGGC SEQ ID No. 90.65 ± 0.120.05rno-miR-19a-3p Inflammation and AutoimmuneBmp3, Cast, Cntfr, F31.00 ± 0.13UGUGCAAAUCUAUGCAAAACUGA SEQ ID No. 100.45 ± 0.060.05rno-miR-19b-3p Inflammation and AutoimmuneBmp3, Cast, Cntfr, F31.00 ± 0.09UGUGCAAAUCCAUGCAAAACUGA SEQ ID No. 110.42 ± 0.040.05rno-miR-20a-5p Inflammation and AutoimmuneF3, 1125, Mgll, Osm.1.00 ± 0.09UAAAGUGCUUAUAGUGCAGGUAG SEQ ID No. 120.62 ± 0.010.046rno-miR-20b-5p Inflammation and AutoimmuneF3, 1125, Mgll, Osm.1.00 ± 0.06CAAAGUGCUCAUAGUGCAGGUAG SEQ ID No. 130.62 ± 0.050.05rno-miR-23a-3p Inflammation and AutoimmuneCcl7, Cxcl12, Fas, Grem1, 1111, 113, Il6ra, Kitlg, Mstn, Prkca, Prok2, Stat5b.1.00 ± 0.15AUCACAUUGCCAGGGAUUUCC SEQ ID No. 140.77 ± 0.120.05rno-miR-23b-3p Inflammation and AutoimmuneCcl7, Cxcl12, Fas, Grem1, 1111, 113, Il6ra, Kitlg, Mstn, Prkca, Prok2, Stat5b.1.00 ± 0.14AUCACAUUGCCAGGGAUUACC SEQ ID No. 150.74 ± 0.120.05rno-miR-27a-3p Inflammation and AutoimmuneBmp3, Cd28, Csf1, Fgf1, Grem1, Irf4, Lifr, Mstn.1.00 ± 0.10UUCACAGUGGCUAAGUUCCGC SEQ ID No. 160.64 ± 0.040.05rno-miR-291a-3p Inflammation and AutoimmuneBcl6, Cyp26b1, Dock2, F3, Lefty1, Lefty2.1.00 ± 0.44AAAGUGCUUCCACUUUGUGUGCC SEQ ID No. 178.13 ± 3.670.05rno-miR-29c-3p Inflammation and AutoimmuneHdac4, Il1rap, Lif, Pdgfa, Pdgfc, Tnfrsf1a, Vegfa1.00 ± 0.04UAGCACCAUUUGAAAUCGGUUA SEQ ID No. 180.88 ± 0.020.05rno-miR-30b-5p Inflammation and AutoimmuneHdac5, Il1a, Irf4, Lifr1.00 ± 0.11UGUAAACAUCCUACACUCAGCU SEQ ID No. 190.64 ± 0.160.05rno-miR-30d-5p Inflammation and AutoimmuneHdac5, Il1a, Irf4, Lifr1.00 ± 0.10UGUAAACAUCCCCGACUGGAAG SEQ ID No. 200.68 ± 0.160.05rno-miR-30e-5p Inflammation and AutoimmuneHdac5, Il1a, Irf4, Lifr1.00 ± 0.14UGUAAACAUCCUUGACUGGAAG SEQ ID No. 210.64 ± 0.060.05rno-miR-322-5pInflammation and AutoimmuneBtla, Cd28, Fgf7, Ghr, 1110ra, Spred1, Vegfa1.00 ± 0.14CAGCAGCAAUUCAUGUUUUGGA SEQ ID No. 220.63 ± 0.140.05rno-miR-34c-5pInflammation and AutoimmuneAreg, Bmp3, Il6ra, Kitlg, Nampt, Nfe211, Serpinf21.00 ± 0.56AGGCAGUGUAGUUAGCUGAUUGC SEQ ID No. 230.54 ± 0.140.05rno-miR-410-3p Inflammation and AutoimmuneCsf2, F3, Fgf7, 114, Nr3c1, Vegfa1.00 ± 0.10AAUAUAACACAGAUGGCCUGU SEQ ID No. 240.67 ± 0.050.05rno-miR-449a-5p Inflammation and AutoimmuneAreg, Bmp3, Il6ra, Kitlg, Nampt, Nfe211, Serpinf21.00 ± 0.06UGGCAGUGUAUUGUUAGCUGGU SEQ ID No. 250.90 ± 0.010.046rno-miR-93-5p Inflammation and AutoimmuneF3, 1125, Mgll, Osm1.00 ± 0.01CAAAGUGCUGUUCGUGCAGGUAG SEQ ID No. 260.66 ± 0.040.05 Table 8 Changes in miRNA levels associated with diabetes in response to AAC1 Name Target Tissue Average Fold Change Control AAC1 P Values Vs. control Sequence rno-miR-184 Adipose, beta cells, modulates insulin signaling, Down in T2DM1.00 ± 0.02UGGACGGAGAACUGAUAAGGGU SEQ ID No. 273.59 ± 2.860.05rno-miR-26b-5p Adipose, Up in T1DM1.00 ± 0.18UUCAAGUAAUUCAGGAUAGGU SEQ ID No. 280.53 ± 0.100.05rno-miR-29b-3p Adipose, Increased then impaired glucose-insulin secreation1.00 ± 0.33UAGCACCAUUUGAAAUCAGUGUU SEQ ID No. 290.30 ± 0.120.05rno-miR-29c-3p Adipose, Above1.00 ± 0.55UAGCACCAUUUGAAAUCGGUUA SEQ ID No. 300.46 ± 0.150.05rno-miR-30a-5p Adipose, initiates glucotoxisity beta cell dysfunction1.00 ± 0.07UGUAAACAUCCUCGACUGGAAG SEQ ID No. 310.82 ± 0.100.05rno-miR-34a-5p Adipose, beta cells1.00 ± 0.13UGGCAGUGUCUUAGCUGGUUGU SEQ ID No. 320.42 ± 0.060.05rno-miR-370-3p Adipose1.00 ± 0.21GCCUGCUGGGGUGGAACCUGGU SEQ ID No. 330.32 ± 0.100.05 Table 9 Changes in miRNA levels associated with AAC1neurological development and in response to AAC1 (comparative example) rno-miR-106b-5p Autistic Disorders, Schizophrenia, Alzheimer's1.00 ± 0.10UAAAGUGCUGACAGUGCAGAU SEQ ID No. 340.77 ± 0.130.05rno-miR-138-5p Development, Schizophrenia1.00 ± 0.18AGCUGGUGUUGUGAAUCAGGCCG SEQ ID No. 350.69 ± 0.200.05rno-miR-148b-3p Autistic Disorders1.00 ± 0.08UCAGUGCAUCACAGAACUUUGU SEQ ID No. 360.74 ± 0.110.05rno-miR-195-5p Schizophrenia1.00 ± 0.05UAGCAGCACAGAAAUAUUGGC SEQ ID No. 370.87 ± 0.040.046rno-miR-19b-3p Alzheimer's, Spinocerebellar Ataxia1.00 ± 0.17UGUGCAAAUCCAUGCAAAACUGA SEQ ID No. 380.65 ± 0.180.05rno-miR-20b-5p Schizophrenia1.00 ± 0.14CAAAGUGCUCAUAGUGCAGGUAG SEQ ID No. 390.78 ± 0.120.05rno-miR-26b-5p Schizophrenia, Alzheimer's1.00 ± 0.06UUCAAGUAAUUCAGGAUAGGU SEQ ID No. 400.76 ± 0.080.05rno-miR-342-3p Prion Disease1.00 ± 0.06UCUCACACAGAAAUCGCACCCGU SEQ ID No. 410.81 ± 0.080.05rno-miR-409a-3p Schizophrenia1.00 ± 0.08AUGUUGCUCGGUGAACCCC SEQ ID No. 420.72 ± 0.070.05rno-miR-598-3p Autistic Disorders1.00 ± 0.12UACGUCAUCGUCGUCAUCGUUA SEQ ID No. 430.77 ± 0.070.05

[0058] Spinal cord samples obtained from animals fed 1% chicken broth AAC1 for 28 days showed significant repression of 26 miRNAs implicated in inflammation as compared to the levels found in animals treated with the control samples. Interestingly, miRNA of the 101 family (See Table 7), which has been shown to inhibit Map Kinase Phosphatase 1, were among those that are inhibited by AAC1 broth. Frontal cortex samples obtained from animals fed 1% AAC1 chicken broth also showed a significant reduction in the expression of 10 miRNAs implicated in the development of multiple neurological diseases. These diseases include Autism, Schizophrenia, Alzheimer's, Spinocerebellar Ataxia, and Prion's diseases.

[0059] Taken together, the results from this study suggest that the chicken broth AAC1 may be beneficial in the epigenetic prophylactic regulation of certain miRNAs. These data suggest that chicken broth AAC1 is more effective in regulating these miRNAs than a homemade product prepared from the same raw materials.Example 10 Protein profiles and quantification of protein molecular weight distribution

[0060] The goal of this study was to differentiate protein profiles in different chicken broth samples through gel electrophoresis. Gel electrophoresis was performed on all the samples to separate protein content by molecular weight. Protein content was visualized using a Simple Blue Safe Stain. Approximate molecular weights of any discernable protein bands were determined.

[0061] Two samples, a control sample containing most major proteins from chickens (lane 2) and AAC1 broth (lane 3) were Diluted in DI water to a final concentration of 1% Solid and analyzed by SDS-PAGE (Figure 4) along with a molecular weight (MW) marker (lane 1). The distribution of major protein bands were quantitated. Different banding patterns may be a result of different processing methods. As shown in Figure 4, AAC1 had a smearing pattern indicating high levels of protein degradation which may be attributed to the production process used to make this product. At least 90% of the proteins in AAC1 were within the range of 10-50 kD. This is in contrast with the control sample, which showed a much broader distribution of MW from 10 kD to 300 kD.

[0062] All animal studies described herein were performed using approved protocols in compliance with government rules and regulations.

Claims

1. A composition for use in the prevention and / or treatment of diabetes, said composition being prepared by a process including cooking chopped chicken parts containing chicken bones and cartilage in water at a temperature greater than 121 °C for more than 6 hours.