ANTI-THYROGLOBULIN T-ZELLREZEPTOREN

DE602015092591T2Active Publication Date: 2025-10-29THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY DEPARTMENT OF HEALTH & HUMAN SERVICES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602015092591
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2014-11-14
Filing Date
2015-11-12
Publication Date
2025-10-29
Estimated Expiration
2035-11-12

AI Technical Summary

Technical Problem

There is an unmet need for additional treatments for thyroid cancer, particularly advanced or metastatic thyroid cancer, as existing treatments like thyroidectomy and radioactive iodine therapy have limited efficacy.

Method used

Development of a recombinant T cell expressing a T cell receptor (TCR) with specific antigenic specificity for human thyroglobulin (TG), which can be allogeneic or autologous to the human, for use in the in vivo detection, treatment, or prevention of cancer, targeting cancer cells while minimizing damage to normal thyroid tissue.

Benefits of technology

The TCR effectively recognizes and targets thyroid cancer cells with high avidity, potentially providing a therapeutic option that reduces toxicity to normal tissues and addresses treatment-resistant thyroid cancers.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 62 / 079,713, filed November 14, 2014.INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0002] Incorporated by reference in its entirety herein is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: One 68,835 Byte ASCII (Text) file named "722275_ST25.txt," dated November 11, 2015.FUNDING

[0003] This invention was made with Government support under project number Z01 BC010937 by the National Institutes of Health, National Cancer Institute. The Government has certain rights in the invention.BACKGROUND OF THE INVENTION

[0004] The incidence of thyroid cancer in the United States has been increasing over the last four decades (Davies et al., JAMA Otolaryngol Head Neck Surg., 140(4): 317-322 (2014)). Despite advances in treatments such as thyroidectomy and adjuvant radioactive iodine (RAI) therapy, the prognosis for thyroid cancer, particularly advanced or metastatic thyroid cancer, may be poor. Accordingly, there exists an unmet need for additional treatments for cancer, particularly thyroid cancer.

[0005] Ehlers et al. (2012, Journal of Clinical Endocrinology and Metabolism 97(4): 1347-1354) report a study to quantify and characterize thyroperoxidase (TPO) and thyroglobulin (Tg)-epitope-specific CD8-positive T-cells of Hashimoto's Thyroiditis (HT) patients and describes choosing specific tetramers and corresponding epitopes.BRIEF SUMMARY OF THE INVENTION

[0006] The invention provides an isolated T cell comprising a recombinant expression vector comprising a nucleic acid encoding: (a) a T cell receptor (TCR) having antigenic specificity for human thyroglobulin (TG) and comprising an α chain complementarity determining region (CDR) 1 comprising the amino acid sequence of SEQ ID NO: 3, an α chain CDR2 comprising the amino acid sequence of SEQ ID NO: 4, an α chain CDR3 comprising the amino acid sequence of SEQ ID NO: 5, a β chain CDR1 comprising the amino acid sequence of SEQ ID NO: 6, a β chain CDR2 comprising the amino acid sequence of SEQ ID NO: 7, and a β chain CDR3 comprising the amino acid sequence of SEQ ID NO: 8, (b) a polypeptide comprising a functional portion of the TCR of (a), wherein the functional portion comprises the amino acid sequences of SEQ ID NOs: 3-8, or (c) a protein comprising a first polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 3-5 and a second polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 6-8, for use in the in vivo detection, treatment or prevention of cancer in a human, wherein the T cell is allogeneic or autologous to the human. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0007] Figure 1A is a graph showing the number of copies of TG (black bars), forkhead box E1 (FOXE1) (horizontally striped bars), iodotyrosine deiodinase (IYD) (slashed bars), thyroid peroxidase (TPO) (boxed bars), and pair box 8 (PAX8) (vertically striped bars) RNA relative to 1 x 10 5< (10^5) copies of β-actin RNA measured in two normal thyroid samples (normal thyroid 1 and 2), one primary thyroid cancer sample, and three lymph node metastasis samples (lymph node metastasis 1, 2, and 3). Figure 1B is a graph showing the number of copies of TG RNA relative to 1 x 10 4< copies of β-actin RNA measured in various normal tissue samples. Figure 2 is a graph showing the amount of mouse interferon (IFN)-γ (pg / ml) secreted by splenocytes from mice vaccinated with adenovirus encoding TG and stimulated twice in vitro with peptide 2 (NLFGGKFLV (SEQ ID NO: 2)) or peptide 5 (ILQRRFLAV (SEQ ID NO: 32)) when co-cultured with (identifying each bar from left to right): target T2 cells pulsed with MART-1 control peptide (T2 / MART) (unshaded bars), T2 cells pulsed with TG cognate peptide (peptide 2 or 5) (grey bars), Cos7-HLA-A*0201 cells that were transfected to express control green fluorescent protein (GFP) (CosA2 / GFP) (backslashed bars), Cos7-HLA-A*0201 cells that were transfected to express TG (CosA2 / TG) (forward slashed bars), carcinoma cell line XTC (vertically striped bars), or XTC cells transduced to express HLA-A0201 (XTC / A2) (horizontally striped bars). Figure 3A is a graph showing the amount of IFN-γ (pg / ml) measured upon co-culture of effector untransduced (UN) PBL with target T2 cells pulsed with various concentrations (nM) of MART-1 peptide (closed circles) or TG peptide NLFGGKFLV (SEQ ID NO: 2) (open triangles), effector anti-MART-1 TCR-transduced PBL with target T2 cells pulsed with various concentrations of MART-1 peptide (open squares) or TG peptide NLFGGKFLV (SEQ ID NO: 2) (diamonds), or effector murine anti-TG TCR (mTG-TCR) (SEQ ID NOs: 11 and 12)-transduced PBL with target T2 cells pulsed with various concentrations of MART-1 peptide (closed triangles) or TG peptide NLFGGKFLV (SEQ ID NO: 2) (open circles). Figure 3B is a graph showing the amount of IFN-γ (pg / ml) measured upon co-culture of effector untransduced (UT) PBL or PBL transduced with an anti-MART-1 TCR (MART) or the murine anti-TG TCR (mTG-TCR) (SEQ ID NOs: 11 and 12) with target cells CosA2 / GFP cells (small checkered bars), CosA2 / MART cells (large checkered bars), CosA2 / TG cells (horizontally striped bars), 624Mel cells (vertically striped bars), 938Mel cells (a melanoma-derived cell line that does not express MART-1) (forward slashed bars)), XTC cells (backslashed bars), or XTC / A2 cells (boxed bars). DETAILED DESCRIPTION OF THE INVENTION

[0008] The invention provides an isolated T cell comprising a recombinant expression vector comprising a nucleic acid encoding: (a) a T cell receptor (TCR) having antigenic specificity for human thyroglobulin (TG) and comprising an α chain complementarity determining region (CDR) 1 comprising the amino acid sequence of SEQ ID NO: 3, an α chain CDR2 comprising the amino acid sequence of SEQ ID NO: 4, an α chain CDR3 comprising the amino acid sequence of SEQ ID NO: 5, a β chain CDR1 comprising the amino acid sequence of SEQ ID NO: 6, a β chain CDR2 comprising the amino acid sequence of SEQ ID NO: 7, and a β chain CDR3 comprising the amino acid sequence of SEQ ID NO: 8, (b) a polypeptide comprising a functional portion of the TCR of (a), wherein the functional portion comprises the amino acid sequences of SEQ ID NOs: 3-8, or (c) a protein comprising a first polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 3-5 and a second polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 6-8, for use in the in vivo detection, treatment or prevention of cancer in a human, wherein the T cell is allogeneic or autologous to the human.

[0009] The technical disclosure set out below may in some respects go beyond the scope of the claims. Elements of the disclosure which do not fall within the scope of the claims are provided for information. In general terms, the disclosure provides an isolated T cell comprising a recombinant expression vector comprising a nucleic acid encoding a TCR having antigenic specificity for human TG. The TCR (including functional portions thereof) may have antigenic specificity for any human TG protein, polypeptide or peptide. Preferably, the TCR (including functional portions thereof) has antigenic specificity for a human TG protein comprising or consisting of the amino acid sequence of SEQ ID NO: 1. It may have antigenic specificity for a human TG 470-478 peptide comprising or consisting of the amino acid sequence of NLFGGKFLV (SEQ ID NO: 2) or a human TG 3-11 peptide comprising or consisting of the amino acid sequence of LVLEIFTLL (SEQ ID NO: 58). Preferably, the TCR (including functional portions thereof) has antigenic specificity for a human TG 470-478 peptide comprising or consisting of the amino acid sequence of NLFGGKFLV (SEQ ID NO: 2).

[0010] The TCRs (including functional portions thereof) are able to recognize human TG in a major histocompatibility complex (MHC) class I-dependent manner. "MHC class I-dependent manner," as used herein, means that the TCR (including functional portions thereof) elicits an immune response upon binding to TG within the context of an MHC class I molecule. The MHC class I molecule can be any MHC class I molecule known in the art, e.g., HLA-A molecules, preferably an HLA-A2 molecule.

[0011] The TCRs (including functional portions thereof) provide many advantages, including when expressed by cells used for adoptive cell transfer. TG has a high level of expression that is limited to differentiated thyroid cancer and normal thyroid, a dispensable tissue that may have already been removed in thyroid cancer patients. TG is also expressed in neuroblastoma. Without being bound to a particular theory or mechanism, it is believed that the TCRs (including functional portions thereof) advantageously target the destruction of cancer cells while minimizing or eliminating the destruction of normal, non-cancerous, non-thyroid cells, thereby reducing, for example, by minimizing or eliminating, toxicity. Moreover, the TCRs (including functional portions thereof) may, advantageously, successfully treat or prevent TG-positive cancers that do not respond to other types of treatment such as, for example, chemotherapy, surgery, or radiation. Additionally, the TCRs (including functional portions thereof) provide highly avid recognition of TG, which may, advantageously, provide the ability to recognize unmanipulated tumor cells (e.g., tumor cells that have not been treated with interferon (IFN)-γ, transfected with a vector encoding one or both of TG and HLA-A2, pulsed with the TG 470-478 peptide, or a combination thereof).

[0012] The phrase "antigenic specificity," as used herein, means that the TCR (including functional portions and functional variants thereof) can specifically bind to and immunologically recognize TG with high avidity. For example, a TCR (including functional portions and functional variants thereof) may be considered to have "antigenic specificity" for TG if T cells expressing the TCR (or functional portion or functional variant thereof) secrete at least about 200 pg / mL or more (e.g., 200 pg / mL or more, 300 pg / mL or more, 400 pg / mL or more, 500 pg / mL or more, 600 pg / mL or more, 700 pg / mL or more, 1000 pg / mL or more, 5,000 pg / mL or more, 7,000 pg / mL or more, 10,000 pg / mL or more, 20,000 pg / mL or more, or a range defined by any two of the foregoing values) of IFN-γ upon co-culture with (a) antigen-negative HLA-A2 +< target cells pulsed with a low concentration of TG peptide (e.g., about 0.05 ng / mL to about 5 ng / mL, 0.05 ng / mL, 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, or a range defined by any two of the foregoing values) or (b) HLA-A2 +< target cells into which a nucleotide sequence encoding TG has been introduced such that the target cell expresses TG. Cells expressing the TCRs (including functional portions and functional variants thereof) may also secrete IFN-γ upon co-culture with antigen-negative HLA-A2 +< target cells pulsed with higher concentrations of TG peptide.

[0013] Alternatively or additionally, a TCR (including functional portions and functional variants thereof) may be considered to have "antigenic specificity" for TG if T cells expressing the TCR (or functional portion or functional variant thereof) secrete at least twice as much IFN-γ upon co-culture with (a) antigen-negative HLA-A2 +< target cells pulsed with a low concentration of TG peptide or (b) HLA-A2 +< target cells into which a nucleotide sequence encoding TG has been introduced such that the target cell expresses TG as compared to the amount of IFN-γ expressed by a negative control. The negative control may be, for example, (i) T cells expressing the TCR (or a functional portion or functional variant thereof), co-cultured with (a) antigen-negative HLA-A2 +< target cells pulsed with the same concentration of an irrelevant peptide (e.g., some other peptide with a different sequence from the TG peptide) or (b) HLA-A2 +< target cells into which a nucleotide sequence encoding an irrelevant peptide has been introduced such that the target cell expresses the irrelevant peptide, or (ii) untransduced T cells (e.g., derived from PBMC, which do not express the TCR, or a functional portion or functional variant thereof) co-cultured with (a) antigen-negative HLA-A2 +< target cells pulsed with the same concentration of TG peptide or (b) HLA-A2 +< target cells into which a nucleotide sequence encoding TG has been introduced such that the target cell expresses TG. IFN-γ secretion may be measured by methods known in the art such as, for example, enzyme-linked immunosorbent assay (ELISA).

[0014] Alternatively or additionally, a TCR (including functional portions and functional variants thereof), may be considered to have "antigenic specificity" for TG if at least twice as many of the numbers of T cells expressing the TCR (or the functional portion or functional variant thereof), secrete IFN-γ upon co-culture with (a) antigen-negative HLA-A2 +< target cells pulsed with a low concentration of TG peptide or (b) HLA-A2 +< target cells into which a nucleotide sequence encoding TG has been introduced such that the target cell expresses TG as compared to the numbers of negative control T cells that secrete IFN-γ. The concentration of peptide and the negative control may be as described herein with respect to other aspects of the invention. The numbers of cells secreting IFN-γ may be measured by methods known in the art such as, for example, ELISPOT.

[0015] The disclosure provides T cell comprising a recombinant expression vector comprising a nucleic acid encoding a TCR comprising two polypeptides (i.e., polypeptide chains), namely an alpha (α) chain of a TCR, and a beta (β) chain of a TCR. The polypeptides of the TCR comprise any amino acid sequence, provided that the TCR has antigenic specificity for TG.

[0016] A TCR comprises two polypeptide chains, each of which comprises a variable region comprising a complementarity determining region (CDR)1, a CDR2, and a CDR3 of a TCR. The TCR of the invention comprises a first polypeptide chain comprising a CDR1 comprising the amino acid sequence of SEQ ID NO: 3 (CDR1 of α chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 4 (CDR2 of α chain), and a CDR3 comprising the amino acid sequence of SEQ ID NO: 5 (CDR3 of α chain), and a second polypeptide chain comprising a CDR1 comprising the amino acid sequence of SEQ ID NO: 6 (CDR1 of β chain), a CDR2 comprising the amino acid sequence of SEQ ID NO: 7 (CDR2 of β chain), and a CDR3 comprising the amino acid sequence of SEQ ID NO: 8 (CDR3 of β chain). The TCR comprises the amino acid sequences of all of SEQ ID NOs: 3-8.

[0017] In an embodiment of the invention, the TCR comprises an amino acid sequence of a variable region of a TCR comprising the CDRs set forth above. In this regard, the TCR can comprise the amino acid sequence of SEQ ID NO: 9 (variable region of α chain); SEQ ID NO: 10 (variable region of β chain); both SEQ ID NOs: 9 and 10. Preferably, the TCR comprises the amino acid sequences of both SEQ ID NOs: 9 and 10.

[0018] In an embodiment of the invention, the TCR further comprises an amino acid sequence of a constant region of a TCR. In this regard, the TCR can comprise the amino acid sequence of SEQ ID NO: 13 (constant region of α chain), SEQ ID NO: 14 (constant region of β chain), or both SEQ ID NOs: 13 and 14. Preferably, the TCR comprises the amino acid sequences of both SEQ ID NOs: 13 and 14.

[0019] In an embodiment of the invention, the TCR may comprise a combination of a variable region and a constant region. In this regard, the TCR can comprise an α chain comprising the amino acid sequences of both SEQ ID NO: 9 (variable region of α chain) and SEQ ID NO: 13 (constant region of α chain); a β chain comprising the amino acid sequences of both SEQ ID NO: 10 (variable region of β chain) and SEQ ID NO: 14 (constant region of β chain); or the amino acid sequences of all of SEQ ID NOs: 9, 10, 13, and 14. Preferably, the TCR comprises the amino acid sequences of all of SEQ ID NOs: 9, 10, 13, and 14.

[0020] In an embodiment of the invention, the TCR may comprise a combination of any of the CDR regions described herein and a constant region. In this regard, the TCR can comprise an α chain comprising the amino acid sequences of all of SEQ ID NOs: 3-5 and 13; a β chain comprising the amino acid sequences of all of SEQ ID NOs: 6-8 and 14; or the amino acid sequences of all of SEQ ID NOs: 3-8 and 13-14.

[0021] In an embodiment of the invention, the TCR can comprise an α chain of a TCR and a β chain of a TCR. Each of the α chain and β chain of the TCR can independently comprise any amino acid sequence. In this regard, the α chain of the TCR can comprise the amino acid sequence of SEQ ID NO: 11. An α chain of this type can be paired with any β chain of a TCR. In this regard, the β chain of the TCR can comprise the amino acid sequence of SEQ ID NO: 12. The TCR, therefore, can comprise the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12, or both SEQ ID NOs: 11 and 12. Preferably, the TCR comprises the amino acid sequences of both SEQ ID NOs: 11 and 12.

[0022] In an embodiment of the invention, the TCR is a murine TCR or a human TCR. As used herein, the term "murine" or "human," when referring to a TCR or any component of a TCR described herein (e.g., complementarity determining region (CDR), variable region, constant region, α chain, and / or β chain), means a TCR (or component thereof) which is derived from a mouse or a human, respectively, i.e., a TCR (or component thereof) that originated from or was, at one time, expressed by a mouse T cell or a human T cell, respectively. In an embodiment of the invention, a TCR comprising (i) all of SEQ ID NOs: 3-8; (ii) SEQ ID NOs: 9 and 10; (iii) SEQ ID NOs: 11 and 12; (iv) all of SEQ ID NOs: 3-8 and 13-14; or (v) all of SEQ ID NOs: 9, 10, 13, and 14 is a murine TCR. Such murine TCR (including functional portions and functional variants thereof) has antigenic specificity for a human TG 470-478 peptide comprising or consisting of the amino acid sequence of NLFGGKFLV (SEQ ID NO: 2).

[0023] The term "functional variant," as used herein, refers to a TCR, polypeptide, or protein having substantial or significant sequence identity or similarity to a parent TCR, polypeptide, or protein, which functional variant retains the biological activity of the TCR, polypeptide, or protein of which it is a variant. Functional variants encompass, for example, those variants of the TCR, polypeptide, or protein described herein (the parent TCR, polypeptide, or protein) that retain the ability to specifically bind to TG for which the parent TCR has antigenic specificity or to which the parent polypeptide or protein specifically binds, to a similar extent, the same extent, or to a higher extent, as the parent TCR, polypeptide, or protein. In reference to the parent TCR, polypeptide, or protein, the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more identical in amino acid sequence to the parent TCR, polypeptide, or protein.

[0024] The functional variant can, for example, comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one conservative amino acid substitution. Conservative amino acid substitutions are known in the art, and include amino acid substitutions in which one amino acid having certain physical and / or chemical properties is exchanged for another amino acid that has the same chemical or physical properties. For instance, the conservative amino acid substitution can be an acidic amino acid substituted for another acidic amino acid (e.g., Asp or Glu), an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain (e.g., Ala, Gly, Val, Ile, Leu, Met, Phe, Pro, Trp, Val, etc.), a basic amino acid substituted for another basic amino acid (Lys, Arg, etc.), an amino acid with a polar side chain substituted for another amino acid with a polar side chain (Asn, Cys, Gln, Ser, Thr, Tyr, etc.), etc.

[0025] Alternatively or additionally, the functional variants can comprise the amino acid sequence of the parent TCR, polypeptide, or protein with at least one non-conservative amino acid substitution. In this case, it is preferable for the non-conservative amino acid substitution to not interfere with or inhibit the biological activity of the functional variant. Preferably, the non-conservative amino acid substitution enhances the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent TCR, polypeptide, or protein.

[0026] The TCR (or functional variant thereof), polypeptide, or protein can consist essentially of the specified amino acid sequence or sequences described herein, such that other components of the TCR (or functional variant thereof), polypeptide, or protein, e.g., other amino acids, do not materially change the biological activity of the TCR (or functional variant thereof), polypeptide, or protein. In this regard, the TCR (or functional variant thereof), polypeptide, or protein can, for example, consist essentially of the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12, or both SEQ ID NOs: 11 and 12. Also, for instance, the TCRs (including functional variants thereof), polypeptides, or proteins can consist essentially of the amino acid sequence(s) of SEQ ID NO: 9, SEQ ID NO: 10, or both SEQ ID NOs: 9 and 10. Furthermore, the TCRs (including functional variants thereof), polypeptides, or proteins can consist essentially of the amino acid sequence of SEQ ID NO: 3 (CDR1 of α chain), SEQ ID NO: 4 (CDR2 of α chain), SEQ ID NO: 5 (CDR3 of α chain), SEQ ID NO: 6 (CDR1 of β chain), SEQ ID NO: 7 (CDR2 of β chain), SEQ ID NO: 8 (CDR3 of β chain), or any combination thereof, e.g., SEQ ID NOs: 3-5; 6-8; or 3-8.

[0027] Also provided is an isolated T cell comprising a recombinant expression vector comprising a nucleic acid encoding a polypeptide comprising a functional portion of any of the TCRs (or functional variants thereof) described herein. The term "polypeptide" as used herein includes oligopeptides and refers to a single chain of amino acids connected by one or more peptide bonds.

[0028] With respect to the polypeptides, the functional portion can be any portion comprising contiguous amino acids of the TCR (or functional variant thereof) of which it is a part, provided that the functional portion specifically binds to TG. The term "functional portion" when used in reference to a TCR (or functional variant thereof) refers to any part or fragment of the TCR (or functional variant thereof), which part or fragment retains the biological activity of the TCR (or functional variant thereof) of which it is a part (the parent TCR or parent functional variant thereof). Functional portions encompass, for example, those parts of a TCR (or functional variant thereof) that retain the ability to specifically bind to TG (e.g., in an HLA-A2-dependent manner), or detect, treat, or prevent cancer, to a similar extent, the same extent, or to a higher extent, as the parent TCR (or functional variant thereof). In reference to the parent TCR (or functional variant thereof), the functional portion can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95%, or more, of the parent TCR (or functional variant thereof).

[0029] The functional portion can comprise additional amino acids at the amino or carboxy terminus of the portion, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent TCR or functional variant thereof. Desirably, the additional amino acids do not interfere with the biological function of the functional portion, e.g., specifically binding to TG; and / or having the ability to detect cancer, treat or prevent cancer, etc. More desirably, the additional amino acids enhance the biological activity, as compared to the biological activity of the parent TCR or functional variant thereof.

[0030] The polypeptide can comprise a functional portion of either or both of the α and β chains of the TCRs or functional variant thereof, such as a functional portion comprising one of more of CDR1, CDR2, and CDR3 of the variable region(s) of the α chain and / or β chain of an TCR or functional variant thereof. Preferably, the polypeptide comprises a functional portion comprising the amino acid sequences of SEQ ID NOs: 3-5; 6-8; or all of SEQ ID NOs: 3-8. The polypeptide of the invention comprises a functional portion comprising the amino acid sequences of all of SEQ ID NOs: 3-8.

[0031] The polypeptide can comprise, for instance, the variable region of the TCR or functional variant thereof comprising a combination of the CDR regions set forth above. In this regard, the polypeptide can comprise the amino acid sequence of SEQ ID NO: 9 (variable region of α chain), SEQ ID NO: 10 (variable region of β chain), or both SEQ ID NOs: 9 and 10. Preferably, the polypeptide comprises the amino acid sequences of both SEQ ID NOs: 9 and 10.

[0032] The polypeptide can further comprise the constant region of the TCR or functional variant thereof set forth above. In this regard, the polypeptide can comprise the amino acid sequence of SEQ ID NO: 13 (constant region of α chain), SEQ ID NO: 14 (constant region of β chain), or both SEQ ID NOs: 13 and 14. Preferably, the polypeptide comprises the amino acid sequences of both SEQ ID NOs: 13 and 14.

[0033] The polypeptide may comprise a combination of a variable region and a constant region of the TCR or functional variant thereof. In this regard, the polypeptide can comprise the amino acid sequences of both SEQ ID NO: 9 (variable region of α chain) and SEQ ID NO: 13 (constant region of α chain), both SEQ ID NO: 10 (variable region of β chain) and SEQ ID NO: 14 (constant region of β chain), or all of SEQ ID NOs: 9, 10, 13, and 14. Preferably, the polypeptide comprises the amino acid sequences of all of SEQ ID NOs: 9, 10, 13, and 14.

[0034] The polypeptide may comprise a combination of any of the CDR regions described herein and a constant region of the TCR or functional variant thereof. In this regard, the polypeptide can comprise the amino acid sequences of all of SEQ ID NOs: 3-5 and 13, all of SEQ ID NOs: 6-8 and 14, or all of SEQ ID NOs: 3-8 and 13-14. Preferably, the polypeptide comprises the amino acid sequences of all of SEQ ID NOs: 3-8 and 13-14.

[0035] The polypeptide can comprise the entire length of an α or β chain of the TCR or functional variant thereof described herein. In this regard, the polypeptide can comprise the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12, or both SEQ ID NOs: 11 and 12. Preferably, the polypeptide comprises the amino acid sequences of both SEQ ID NOs: 11 and 12.

[0036] The disclosure further provides an isolated T cell comprising a recombinant expression vector comprising a nucleic acid encoding a protein comprising at least one of the polypeptides described herein. By "protein" is meant a molecule comprising one or more polypeptide chains.

[0037] The protein can comprise a first polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 3-5 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NOs: 6-8. Alternatively or additionally, the protein can comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 9 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 10. The protein can, for example, comprise a first polypeptide chain comprising the amino acid sequences of both SEQ ID NOs: 9 and 13 or all of SEQ ID NOs: 3-5 and 13 and a second polypeptide chain comprising the amino acid sequences of both SEQ ID NOs: 10 and 14 or all of SEQ ID NOs: 6-8 and 14. Alternatively or additionally, the protein can comprise a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 11 and a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 12. In this instance, the protein can be a TCR. Alternatively, if, for example, the protein comprises a single polypeptide chain comprising the amino acid sequences of both SEQ ID NOs: 11 and 12 or if the first and / or second polypeptide chain(s) of the protein further comprise(s) other amino acid sequences, e.g., an amino acid sequence encoding an immunoglobulin or a portion thereof, then the protein can be a fusion protein. In this regard, the disclosure also provides a fusion protein comprising at least one of the polypeptides described herein along with at least one other polypeptide. The other polypeptide can exist as a separate polypeptide of the fusion protein, or can exist as a polypeptide, which is expressed in frame (in tandem) with one of the polypeptides described herein. The other polypeptide can encode any peptidic or proteinaceous molecule, or a portion thereof, including, but not limited to an immunoglobulin, CD3, CD4, CD8, an MHC molecule, a CD1 molecule, e.g., CD1a, CD1b, CD1c, CD1d, etc.

[0038] The fusion protein can comprise one or more copies of the polypeptide and / or one or more copies of the other polypeptide. For instance, the fusion protein can comprise 1, 2, 3, 4, 5, or more, copies of the polypeptide and / or of the other polypeptide. Suitable methods of making fusion proteins are known in the art, and include, for example, recombinant methods.

[0039] The TCRs (and functional portions and functional variants thereof), polypeptides, and proteins may be expressed as a single protein comprising a linker peptide linking the α chain and the β chain. In this regard, the TCRs (and functional variants and functional portions thereof), polypeptides, and proteins comprising both SEQ ID NOs: 11 and 12, both SEQ ID NO: 9 and 10, all of SEQ ID NOs: 3-8, all of SEQ ID NOs: 9, 10, 13, and 14, or all of SEQ ID NOs: 3-8 and 13-14 may further comprise a linker peptide. The linker peptide may advantageously facilitate the expression of a recombinant TCR (including functional portions and functional variants thereof), polypeptide, and / or protein in a host cell. The linker peptide may comprise any suitable amino acid sequence. The TCR (or functional portion or variant thereof), polypeptide, or protein may comprise a self-cleaving, viral linker peptide. For example, the linker peptide may comprise SEQ ID NO: 28. Upon expression of the construct including the linker peptide by a host cell, the linker peptide may be cleaved, resulting in separated α and β chains.

[0040] The protein can be a recombinant antibody comprising at least one of the polypeptides described herein. As used herein, "recombinant antibody" refers to a recombinant (e.g., genetically engineered) protein comprising at least one of the polypeptides described herein and a polypeptide chain of an antibody, or a portion thereof. The polypeptide of an antibody, or portion thereof, can be a heavy chain, a light chain, a variable or constant region of a heavy or light chain, a single chain variable fragment (scFv), or an Fc, Fab, or F(ab) 2 ' fragment of an antibody, etc. The polypeptide chain of an antibody, or portion thereof, can exist as a separate polypeptide of the recombinant antibody. Alternatively, the polypeptide chain of an antibody, or portion thereof, can exist as a polypeptide, which is expressed in frame (in tandem) with the polypeptide of the disclosure. The polypeptide of an antibody, or portion thereof, can be a polypeptide of any antibody or any antibody fragment, including any of the antibodies and antibody fragments described herein.

[0041] The TCRs, polypeptides, and proteins (including functional variants thereof) can be of any length, i.e., can comprise any number of amino acids, provided that the TCRs, polypeptides, or proteins (or functional variants thereof) retain their biological activity, e.g., the ability to specifically bind to TG; detect cancer in a mammal; or treat or prevent cancer in a mammal, etc. For example, the polypeptide can be in the range of from about 50 to about 5000 amino acids long, such as 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids in length. In this regard, the polypeptides of the disclosure also include oligopeptides.

[0042] The TCRs, polypeptides, and proteins (including functional variants thereof) can comprise synthetic amino acids in place of one or more naturally-occurring amino acids. Such synthetic amino acids are known in the art, and include, for example, aminocyclohexane carboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4- nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, β-phenylserine β-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentane carboxylic acid, α-aminocyclohexane carboxylic acid, α-aminocycloheptane carboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,β-diaminopropionic acid, homophenylalanine, and α-tert-butylglycine.

[0043] The TCRs, polypeptides, and proteins (including functional variants thereof) can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and / or optionally dimerized or polymerized, or conjugated.

[0044] The TCR, polypeptide, and / or protein (including functional variants thereof) can be obtained by methods known in the art such as, for example, de novo synthesis. Also, polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Green and Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). Alternatively, the TCRs, polypeptides, and / or proteins described herein (including functional variants thereof) can be commercially synthesized by companies, such as Synpep (Dublin, CA), Peptide Technologies Corp. (Gaithersburg, MD), and Multiple Peptide Systems (San Diego, CA). In this respect, the TCRs (including functional variants thereof), polypeptides, and proteins can be synthetic, recombinant, isolated, and / or purified.

[0045] Also contemplated are conjugates, e.g., bioconjugates, comprising any of the disclosed T cells. Conjugates, as well as methods of synthesizing conjugates in general, are known in the art.

[0046] Disclosed herein is a nucleic acid comprising a nucleotide sequence encoding any of the TCRs (including functional portions and functional variants thereof), polypeptides, or proteins described herein. "Nucleic acid," as used herein, includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and / or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. The nucleic acid may comprise complementary DNA (cDNA). It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and / or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and / or substitutions.

[0047] Preferably, the encoding nucleic acids are recombinant. As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication.

[0048] The nucleic acids can be constructed based on chemical synthesis and / or enzymatic ligation reactions using procedures known in the art. See, for example, Green and Sambrook et al., supra. For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides). Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N 6< -isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N 6< -substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N 6< -isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the disclosure can be purchased from companies, such as Macromolecular Resources (Fort Collins, CO) and Synthegen (Houston, TX).

[0049] The nucleic acid can comprise any nucleotide sequence which encodes any of the TCRs (including functional portions and functional variants thereof), polypeptides, or proteins described herein. As disclosed herein, the nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 22 (CDR1 of α chain); the nucleotide sequence of SEQ ID NO: 23 (CDR2 of α chain); the nucleotide sequence of SEQ ID NO: 24 (CDR3 of α chain); the nucleotide sequence of SEQ ID NO: 25 (CDR1 of β chain); the nucleotide sequence of SEQ ID NO: 26 (CDR2 of β chain); or the nucleotide sequence of SEQ ID NO: 27 (CDR3 of β chain). Preferably, the nucleic acid comprises the nucleotide sequences of all of SEQ ID NOs: 22-24; all of SEQ ID NOs: 25-27; or all of SEQ ID NOs: 22-27. In respect of the invention the nucleic acid comprises the nucleotide sequences of all of SEQ ID NOs: 22-27. In an embodiment of the invention, the nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 15 (variable region α chain); SEQ ID NO: 16 (variable region β chain); or both SEQ ID NOs: 15 and 16. Preferably, the nucleic acid comprises the nucleotide sequences of both SEQ ID NOs: 15 and 16. In another embodiment of the invention, the nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 17 (full-length α chain); SEQ ID NO: 18 (full length β chain); or both of SEQ ID NOs: 17 and 18. Preferably, the nucleic acid comprises the nucleotide sequences of both of SEQ ID NOs: 17 and 18.

[0050] In an embodiment of the invention, the nucleic acid further comprises a nucleotide sequence that encodes the constant region of a TCR α or β chain. In this regard, any of the nucleic acids described herein may further comprise the nucleotide sequence of SEQ ID NO: 19 (constant region of α chain); SEQ ID NO: 20 (constant region of β chain); or both SEQ ID NOs: 19 and 20. Preferably, the nucleic acid comprises the nucleotide sequence of both SEQ ID NOs: 15 and 19; both SEQ ID NOs: 16 and 20; all of SEQ ID NOs: 15-16 and 19-20; all of SEQ ID NOs: 22-24 and 19; all of SEQ ID NOs: 25-27 and 20; or all of SEQ ID NOs: 22-27 and 19-20. In an especially preferred embodiment, the nucleic acid comprises the nucleotide sequences of all of SEQ ID NOs: 15-16 and 19-20 or all of SEQ ID NOs: 22-27 and 19-20.

[0051] In an embodiment of the invention, a nucleic acid comprising the nucleotide sequence of all of SEQ ID NOs: 22-24; all of SEQ ID NOs: 25-27; all of SEQ ID NOs: 22-27; both SEQ ID NOs: 15 and 16; both SEQ ID NOs: 17 and 18; both SEQ ID NOs: 15 and 19; both SEQ ID NOs: 16 and 20; all of SEQ ID NOs: 15-16 and 19-20; all of SEQ ID NOs: 22-24 and 19; all of SEQ ID NOs: 25-27 and 20; or all of SEQ ID NOs: 22-27 and 19-20 encodes a murine TCR.

[0052] The disclosure also provides a nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein.

[0053] The nucleotide sequence which hybridizes under stringent conditions preferably hybridizes under high stringency conditions. By "high stringency conditions" is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization. High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable. Relatively high stringency conditions would include, for example, low salt and / or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 °C. Such high stringency conditions tolerate little, if any, mismatch between the nucleotide sequence and the template or target strand, and are particularly suitable for detecting expression of any of the TCRs (including functional portions and functional variants thereof). It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

[0054] The disclosure also provides a nucleic acid comprising a nucleotide sequence that is at least about 70% or more, e.g., about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to any of the nucleic acids described herein. In this regard, the nucleic acid may consist essentially of any of the nucleotide sequences described herein.

[0055] The nucleic acids of the disclosure can be incorporated into a recombinant expression vector. In this regard, the disclosure provides a recombinant expression vector comprising any of the nucleic acids of the disclosure. In an embodiment of the invention, the recombinant expression vector comprised in an isolated T cell of the invention comprises a nucleotide sequence encoding the α chain, the β chain, and linker peptide. For example, in an embodiment, the recombinant expression vector comprises the nucleotide sequence of SEQ ID NO: 21 (encoding α and β chains SEQ ID NOs: 11 and 12 with a linker positioned between them).

[0056] For purposes herein, the term "recombinant expression vector" means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The vectors comprised in an isolated T cell of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring. The recombinant expression vectors comprised in an isolated T cell of the invention can comprise any type of nucleotide, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The recombinant expression vectors can comprise naturally-occurring, non-naturally-occurring internucleotide linkages, or both types of linkages. Preferably, the non-naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector.

[0057] The recombinant expression vector comprised in an isolated T cell of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host cell. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA). Bacteriophage vectors, such as λGT10, λGT11, λZapII (Stratagene), λEMBL4, and λNM1149, also can be used. Examples of plant expression vectors include pBI01, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech). Preferably, the recombinant expression vector is a viral vector, e.g., a retroviral vector. In an especially preferred embodiment, the recombinant expression vector is an MSGV1 vector.

[0058] The recombinant expression vectors comprised in an isolated T cell of the invention can be prepared using standard recombinant DNA techniques described in, for example, Green and Sambrook et al., supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from ColEl, 2 µ plasmid, λ, SV40, bovine papillomavirus, and the like.

[0059] Desirably, the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host cell (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA-based.

[0060] The recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected host cells. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host cell to provide prototrophy, and the like. Suitable marker genes for the expression vectors include, for instance, neomycin / G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.

[0061] The recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional variants thereof). The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.

[0062] The recombinant expression vectors comprised in an isolated T cell of the invention can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression. Further, the recombinant expression vectors can be made to include a suicide gene.

[0063] As used herein, the term "suicide gene" refers to a gene that causes the cell expressing the suicide gene to die. The suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent. Suicide genes are known in the art and include, for example, the Herpes Simplex Virus (HSV) thymidine kinase (TK) gene, cytosine daminase, purine nucleoside phosphorylase, and nitroreductase.

[0064] Also provided herein is a host cell comprising any of the recombinant expression vectors described herein. As used herein, the term "host cell" refers to any type of cell that can contain the recombinant expression vector. The host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa. The host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human. The host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for instance, DH5α E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like. For purposes of amplifying or replicating the recombinant expression vector, the host cell is preferably a prokaryotic cell, e.g., a DH5α cell. For purposes of producing a recombinant TCR, polypeptide, or protein, the host cell is preferably a mammalian cell. Most preferably, the host cell is a human cell. While the host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage, the host cell preferably is a peripheral blood lymphocyte (PBL) or a peripheral blood mononuclear cell (PBMC). According to the invention, the host cell is a T cell.

[0065] For purposes herein, the T cell can be any T cell, such as a cultured T cell, e.g., a primary T cell, or a T cell from a cultured T cell line, e.g., Jurkat, SupT1, etc., or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from numerous sources, including but not limited to blood, bone marrow, lymph node, the thymus, or other tissues or fluids. T cells can also be enriched for or purified. Preferably, the T cell is a human T cell. The T cell can be any type of T cell and can be of any developmental stage, including but not limited to, CD4 +< / CD8 +< double positive T cells, CD4 +< helper T cells, e.g., Th 1 and Th 2 cells, CD4 +< T cells, CD8 +< T cells (e.g., cytotoxic T cells), tumor infiltrating lymphocytes (TILs), memory T cells (e.g., central memory T cells and effector memory T cells), naive T cells, and the like.

[0066] Also provided herein is a population of cells comprising at least one host cell described herein. The population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors, or a cell other than a T cell, e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cells, a muscle cell, a brain cell, etc. Alternatively, the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector. The population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector. The population of cells may be a clonal population comprising host cells comprising a recombinant expression vector as described herein.

[0067] The numbers of cells in the population may be rapidly expanded. Expansion of the numbers of T cells can be accomplished by any of a number of methods as are known in the art as described in, for example, U.S. Patent 8,034,334; U.S. Patent 8,383,099; U.S. Patent Application Publication No. 2012 / 0244133; Dudley et al., J. Immunother., 26:332-42 (2003); and Riddell et al., J. Immunol. Methods, 128:189-201 (1990). The expansion of the numbers of T cells can be carried out by culturing the T cells with OKT3 antibody, IL-2, and feeder PBMC (e.g., irradiated allogeneic PBMC).

[0068] Also disclosed, but not claimed, is an antibody, or antigen binding portion thereof, which specifically binds to a functional portion of any of the TCRs (or functional variant thereof) described herein. Preferably, the functional portion specifically binds to the cancer antigen, e.g., the functional portion comprising the amino acid sequence SEQ ID NO: 3 or 44 (CDR1 of α chain), 4 or 45 (CDR2 of α chain), 5 or 46 (CDR3 of α chain), 6 or 47 (CDR1 of β chain), 7 or 48 (CDR2 of β chain), 8 or 49 (CDR3 of β chain), SEQ ID NO: 9 or 50 (variable region of α chain), SEQ ID NO: 10 or 51 (variable region of β chain), or a combination thereof, e.g., 3-5; 44-46; 6-8; 47-49; 3-8; 44-49; 9; 10; 50; 51; 9-10 or 50-51. More preferably, the functional portion comprises the amino acid sequences of SEQ ID NOs: 3-8, SEQ ID NOs: 44-49, SEQ ID NOs: 9 and 10, or SEQ ID NOs: 50 and 51. In a preferred embodiment of the disclosure, the antibody, or antigen binding portion thereof, binds to an epitope which is formed by all 6 CDRs (CDR1-3 of the α chain and CDR1-3 of the β chain). The antibody can be any type of immunoglobulin that is known in the art. For instance, the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc. The antibody can be monoclonal or polyclonal. The antibody can be a naturally-occurring antibody, e.g., an antibody isolated and / or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc. Alternatively, the antibody can be a genetically-engineered antibody, e.g., a humanized antibody or a chimeric antibody. The antibody can be in monomeric or polymeric form. Also, the antibody can have any level of affinity or avidity for the functional portion of the TCR (or functional variant thereof). Desirably, the antibody is specific for the functional portion of the TCR (or functional variants thereof), such that there is minimal cross-reaction with other peptides or proteins.

[0069] Methods of testing antibodies for the ability to bind to any functional portion or functional variant of the TCR are known in the art and include any antibody-antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays.

[0070] Suitable methods of making antibodies are known in the art. For instance, standard hybridoma methods are described in, e.g., C.A. Janeway et al. (eds.), Immunobiology, 8th Ed., Garland Publishing, New York, NY (2011)). Alternatively, other methods, such as EBV-hybridoma methods, methods of producing antibodies in non-human animals, and bacteriophage vector expression systems are known in the art.

[0071] Phage display can also be used to generate the antibody of the disclosure. In this regard, phage libraries encoding antigen-binding variable (V) domains of antibodies can be generated using standard molecular biology and recombinant DNA techniques (see, e.g., Green and Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, New York (2012)). Phage encoding a variable region with the desired specificity are selected for specific binding to the desired antigen, and a complete or partial antibody is reconstituted comprising the selected variable domain. Nucleic acid sequences encoding the reconstituted antibody are introduced into a suitable cell line, such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra).

[0072] Methods for generating humanized antibodies are well known in the art. Antibodies can also be produced by transgenic mice that are transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described in, for example, Janeway et al., supra.

[0073] The disclosure also provides antigen binding portions of any of the antibodies described herein. The antigen binding portion can be any portion that has at least one antigen binding site, such as Fab, F(ab') 2 , dsFv, sFv, diabodies, and triabodies.

[0074] A single-chain variable region fragment (sFv) antibody fragment, which consists of a truncated Fab fragment comprising the variable (V) domain of an antibody heavy chain linked to a V domain of a light antibody chain via a synthetic peptide, can be generated using routine recombinant DNA technology techniques (see, e.g., Janeway et al., supra). Similarly, disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology. Antibody fragments of the disclosure, however, are not limited to these exemplary types of antibody fragments.

[0075] Also, the antibody, or antigen binding portion thereof, can be modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).

[0076] The TCRs, polypeptides, proteins, (including functional variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof) described herein can be isolated and / or purified. The term "isolated" as used herein means having been removed from its natural environment. The term "purified" as used herein means having been increased in purity, wherein "purity" is a relative term, and not to be necessarily construed as absolute purity. For example, the purity can be at least about 50%, can be greater than 60%, 70%, 80%, 90%, 95%, or can be 100%.

[0077] The TCRs, polypeptides, proteins (including functional variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof) including isolated T cells according to the invention, and antibodies (including antigen binding portions thereof) described herein, all of which are collectively referred to as "disclosed TCR materials" hereinafter, can be formulated into a composition, such as a pharmaceutical composition. In this regard, the disclosure provides a pharmaceutical composition comprising any of the TCRs, polypeptides, proteins, functional portions, functional variants, nucleic acids, expression vectors, host cells (including populations thereof), and antibodies (including antigen binding portions thereof) described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing any of the disclosed TCR materials can comprise more than one disclosed TCR material, e.g., a polypeptide and a nucleic acid, or two or more different TCRs (including functional portions and functional variants thereof). Alternatively, the pharmaceutical composition can comprise a disclosed TCR material in combination with another pharmaceutically active agent(s) or drug(s), such as a chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.

[0078] Preferably, the carrier is a pharmaceutically acceptable carrier. With respect to pharmaceutical compositions, the carrier can be any of those conventionally used for the particular disclosed TCR material under consideration. Such pharmaceutically acceptable carriers are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which has no detrimental side effects or toxicity under the conditions of use.

[0079] The choice of carrier will be determined in part by the particular disclosed TCR material, as well as by the particular method used to administer the disclosed TCR material. Accordingly, there are a variety of suitable formulations of the disclosed pharmaceutical composition. Suitable formulations may include any of those for oral, parenteral, subcutaneous, intravenous, intramuscular, intraarterial, intrathecal, or interperitoneal administration. More than one route can be used to administer the disclosed TCR materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route.

[0080] Preferably, the disclosed TCR material is administered by injection, e.g., intravenously. When the disclosed TCR material is a host cell expressing the TCR (or functional variant thereof), the pharmaceutically acceptable carrier for the cells for injection may include any isotonic carrier such as, for example, normal saline (about 0.90% w / v of NaCl in water, about 300 mOsm / L NaCl in water, or about 9.0 g NaCl per liter of water), NORMOSOL R electrolyte solution (Abbott, Chicago, IL), PLASMA-LYTE A (Baxter, Deerfield, IL), about 5% dextrose in water, or Ringer's lactate. The pharmaceutically acceptable carrier may be supplemented with human serum albumen.

[0081] For the isolated T cell of the invention for use the in vivo detection, treatment or prevention of cancer in a human, the amount or dose (e.g., numbers of cells when the disclosed TCR material is one or more cells) of the disclosed TCR material administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject or animal over a reasonable time frame. For example, the dose of the disclosed TCR material should be sufficient to bind to a cancer antigen (e.g., human TG), or detect, treat or prevent cancer in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration. In certain cases the time period could be even longer. The dose will be determined by the efficacy of the particular disclosed TCR material and the condition of the animal (e.g., human), as well as the body weight of the animal (e.g., human) to be treated.

[0082] Many assays for determining an administered dose are known in the art. For purposes of the disclosure, an assay, which comprises comparing the extent to which target cells are lysed or IFN-γ is secreted by T cells expressing the TCR (or functional variant or functional portion thereof), polypeptide, or protein upon administration of a given dose of such T cells to a mammal among a set of mammals of which is each given a different dose of the T cells, could be used to determine a starting dose to be administered to a mammal. The extent to which target cells are lysed or IFN-γ is secreted upon administration of a certain dose can be assayed by methods known in the art.

[0083] The dose of the disclosed TCR material also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular disclosed TCR material. Typically, the attending physician will decide the dosage of the disclosed TCR material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, disclosed TCR material to be administered, route of administration, and the severity of the cancer being treated. Where the disclosed TCR material is a population of cells, the number of cells administered per infusion may vary, e.g., from about 1 x 10 6< to about 1 x 10 12< cells or more. In certain cases fewer than 1 x 10 6< cells may be administered.

[0084] One of ordinary skill in the art will readily appreciate that the disclosed TCR materials can be modified in any number of ways, such that the therapeutic or prophylactic efficacy of the disclosed TCR materials is increased through the modification. For instance, the disclosed TCR materials can be conjugated either directly or indirectly through a bridge to a targeting moiety. The practice of conjugating compounds, e.g., disclosed TCR materials, to targeting moieties is known in the art. The term "targeting moiety" as used herein, refers to any molecule or agent that specifically recognizes and binds to a cell-surface receptor, such that the targeting moiety directs the delivery of the disclosed TCR materials to a population of cells on which surface the receptor is expressed. Targeting moieties include, but are not limited to, antibodies, or fragments thereof, peptides, hormones, growth factors, cytokines, and any other natural or non-natural ligands, which bind to cell surface receptors (e.g., Epithelial Growth Factor Receptor (EGFR), T cell receptor (TCR), B-cell receptor (BCR), CD28, Platelet-derived Growth Factor Receptor (PDGF), nicotinic acetylcholine receptor (nAChR), etc.). The term "bridge" as used herein, refers to any agent or molecule that links the disclosed TCR materials to the targeting moiety. One of ordinary skill in the art recognizes that sites on the disclosed TCR materials, which are not necessary for the function of the disclosed TCR materials, are ideal sites for attaching a bridge and / or a targeting moiety, provided that the bridge and / or targeting moiety, once attached to the disclosed TCR materials, do(es) not interfere with the function of the disclosed TCR materials, i.e., the ability to bind to TG or to detect, treat, or prevent cancer.

[0085] It is contemplated that the disclosed pharmaceutical compositions, TCRs (including functional variants thereof), polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, or populations of cells can be used in methods of treating or preventing cancer. Without being bound to a particular theory, the disclosed TCRs (and functional variants thereof) are believed to bind specifically to TG, such that the TCR (or related polypeptide or protein and functional variants thereof), when expressed by a cell, is able to mediate an immune response against a target cell expressing TG. In this regard, the invention provides an isolated T cell for use in a method of treating or preventing cancer in a human, comprising administering it to the human in an amount effective to treat or prevent cancer in the mammal.

[0086] The terms "treat," and "prevent" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive T cells for use can provide any amount of any level of treatment or prevention of cancer in a mammal. Furthermore, the treatment or prevention provided by the inventive T cells for use can include treatment or prevention of one or more conditions or symptoms of the cancer being treated or prevented. For example, treatment or prevention can include promoting the regression of a tumor. Also, for purposes herein, "prevention" can encompass delaying the onset of the cancer, or a symptom or condition thereof.

[0087] Also provided is an isolated T cell according to the invention for use in a method of detecting the presence of cancer in a human. The method comprises (i) contacting a sample comprising one or more cells from the human with any of the inventive T cells for use, thereby forming a complex, and detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the .

[0088] With respect to the inventive T cell for use in a method of detecting cancer in a human, the sample of cells can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction.

[0089] For purposes of the inventive T cell for use in a detecting method, the contacting takes place in vivo with respect to the human.

[0090] Also, detection of the complex can occur through any number of ways known in the art. For instance, the inventive T cell for use described herein, can be labeled with a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).

[0091] For purposes of the inventive T cells for use, wherein host cells or populations of cells are administered, the cells can be cells that are allogeneic or autologous to the human. Preferably, the cells are autologous to the human.

[0092] With respect to the inventive T cells for use, the cancer can be any cancer, including any of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, cancer of the anus, anal canal, or anorectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vagina, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, uterine cervical cancer, gastrointestinal carcinoid tumor, glioma, Hodgkin lymphoma, hypopharynx cancer, kidney cancer, larynx cancer, liver cancer, lung cancer, malignant mesothelioma, melanoma, multiple myeloma, nasopharynx cancer, non-Hodgkin lymphoma, neuroblastoma, cancer of the oropharynx, ovarian cancer, cancer of the penis, pancreatic cancer, peritoneum, omentum, and mesentery cancer, pharynx cancer, prostate cancer, rectal cancer, renal cancer, skin cancer, small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thyroid cancer, cancer of the uterus, ureter cancer, and urinary bladder cancer. A preferred cancer is thyroid cancer or neuroblastoma.

[0093] The mammal referred to in the disclosed methods can be any mammal. As used herein, the term "mammal" refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is more preferred that the mammals are from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). It is most preferred that the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). An especially preferred mammal is the human.

[0094] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting the scope of the claims.EXAMPLES

[0095] The following materials and methods were employed in Examples 1-7.Cell Lines, Tissues, Peptides, & Antibodies

[0096] The Hurthle Carcinoma Cell line XTC (Endocrine Surgery Branch, NCI) was maintained in Dulbecco's Modified Eagle's Medium (DMEM) (Life Technologies, Carlsbad, CA) including 10% fetal bovine serum (FBS; Sigma, St. Louis, MO), 10 IU / L thyroid stimulating hormone (TSH; Sigma-Aldrich), Insulin-Transferrin-Selenium (Life Technologies). HLA-A2-expressing XTC (XTC / A2) was established by transducing XTC with retrovirus containing HLA-A*0201 (Surgery Branch, NCI). The cell lines used included: melanoma lines 624 and 938, which were generated in the Surgery Branch from resected tumors as described in Topalian et al., J. Immunol., 142(10): 3714-25 (1989). Cos7, T2, and 293GP cell lines were obtained from Surgery Branch, NCI. Normal human primary cultures including fibroblasts (Surgery Branch, NCI) and small airway epithelial cells (Lonza, Walkersville, MD) were used as controls in experiments and maintained in RPMI 1640 medium (Life Technologies) with 10% FBS. Control tumor lines used included: MDA231 (breast adenocarcinoma; HLA-A2 +< ), MDA468 (breast adenocarcinoma; HLA-A2 -< ), H2087 (lung carcinoma; HLA-A2 +< ), BE-3 (Barrett's esophagus-associated adenocarcinoma of the distal esophagus; HLA-A2 +< ), SK-BR3 (breast adenocarcinoma; HLA-A2 -< ), SK-OV3 (ovarian adenocarcinoma; HLA-A2 -< ) BIC (human esophageal adenocarcinoma; HLA-A2 +< ), and four renal cell carcinoma lines (HLA-A2 +< ; Surgery Branch, NCI).

[0097] All peptides (Pi Prometrics, Huntsville, AL) were synthesized based on an HLA-A*0201 binding algorithm. The twenty best HLA-A2 binding 9-mers and ten best 10-mers were chosen for in vitro stimulation. Peptides 1-8 represent the following epitopes of TG: 1-TLLASICWV (SEQ ID NO: 29), 2-NLFGGKFLV (SEQ ID NO: 2), 3-ELPEFLLFL (SEQ ID NO: 30), 4-ALVLEIFTL (SEQ ID NO: 31), 5-ILQRRFLAV (SEQ ID NO: 32), 6-ALLRSGPYM (SEQ ID NO: 33), 7-LVEIFTLL (SEQ ID NO: 34), 8-VQQVQCWCV (SEQ ID NO: 35).TAQMAN Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

[0098] RNA was collected from surgically resected tissues or purchased commercially (Clonetech, Mountain View, CA). Complementary DNA (cDNA) was synthesized by the high-capacity cDNA Reverse Transcription Kit or SUPERSCRIPT III First-Strand cDNA synthesis system (Life Technologies). The following RT-PCR Taqman probes for comparison of antigens were used: 3' TG (00968047_m1), TPO (Hs00374163_A1), IYD (Hs00416923_A1), FOXE1 (Hs00915085_S1), and PAX8 (Hs00247586_m1), ACTB (Hs03023880_g1) (Life Technologies). For TG, a custom-designed Taqman primer / probe was also used to evaluate low expression of TG in a normal tissue panel. Absolute copy number was calculated based on standard curves generated by using a plasmid encoding each cDNA as a reference on the 7500 FAST Real-time PCR system (Life Technologies).Preparation of adenovirus

[0099] Normal thyroid total RNA was purified from a surgical specimen using RNeasy mini kit (Qiagen, Valencia, CA) and random hexamer-primed cDNA was synthesized by the SUPERSCRIPT III First-Strand cDNA synthesis system (Life Technologies). Two short cDNA fragments (TG 42-2186 and TG 2172-4292 ) from the 5' half of TG 42-8348 were PCR-amplified and cloned into the pShuttle2 vector by using an In-Fusion cloning kit (Clontech). After sequence confirmation, production of TG protein was examined by transfecting the pShuttle2 / TG 42-4292 plasmid into HEK 293 cells and by conducting Western blotting (antibody: sc-7836, Santa Cruz Biotechnology). From the pShuttle2 / TG 42-4292 plasmid, cytomegalovirus (CMV) promoter-TG 42-4292 fragment was obtained by restriction enzyme digestion and was cloned into the pAdeno-X plasmid. This plasmid was used for amplifying recombinant adenovirus according to the manufacturer's instructions (ADENO-X expression System 1, Clontech). Amplified virus was purified by ADENO-X maxi purification kit (Clontech, Mountain View, CA) and the buffer was exchanged with PBS using the PD10 gel-filtration column (GE Healthcare Life Sciences, Pittsburgh, PA). Titer of the infectious virus was measured by ADENO-X rapid titer kit (Clontech).Immunization of Yeti / A2 Mice

[0100] Yeti mice (Stetson et al., J. Exp. Med., 198(7): 1069-76 (2003)) were crossed to HLA-A*0201 transgenic mice to generate Yeti / HLA-A*0201 (Yeti / A2). The mice were also transgenic for an IFN-γ reporter gene, yellow fluorescent protein (YFP). In the Yeti system, the expression of YFP is driven by the IFN-γ promoter. When cells in these mice produce IFN-y, they also express YFP which can be visualized with a fluorescent microscope or detected by fluorescence-activated cell scan (FACS). One hundred million colony forming units (CFU) of recombinant adenovirus / TG 42-4292 were used to immunize Yeti / A2 (half intravenously and the other half subcutaneously at the tail base) in two-week intervals. Two weeks after the second adenoviral immunization, splenocytes were harvested, plated onto 24-well plates at a cell concentration of one million cells / well maintained in RPMI (Life Technologies) including 10% fetal bovine serum (FBS; Life Technologies), 55 µM 2-mercaptoethanol (Life Technologies), 1 mM sodium pyruvate (Life Technologies), 1X MEMnon-essential amino acids (Life Technologies), 10 µg / mL gentamicin (Life Technologies), 10U / mL penicillin, 100µg / mL streptomycin (Life Technologies), and 250 ng / mL amphotericin B (Life Technologies) with recombinant human interleukin (IL)-2 (30 IU / ml). Individual peptides were added at a final concentration of 1 µM. Re-stimulation at one week was carried out as detailed below. HLA-A*0201 positive, Epstein-Barr Virus transformed B lymphoblastoid T2 cells were irradiated at 100 Gy and were pulsed with each peptide at a concentration of 1 µM for two hours at room temperature. After washing three times with the culture medium, T2 cells were added to Yeti splenocytes at the approximate cell number ratio of 1 to 1. Two days after the second in vitro stimulation, yellow fluorescent protein (YFP) expression was analyzed by fluorescent microscopy (AX10, Zeiss) and flow cytometry (FACS; FACSCanto II, BD Biosciences). Cultures with YFP expression were selected for co-culture with TG-expressing targets (XTC / A2 and CosA2 transfected to express TG) and reactivity was examined by IFN-γ secretion. RNA was purified from cultures with TG-reactivity using an RNeasy kit for the purpose of cloning T-cell receptor genes.Generation of Retroviral Supernatant

[0101] Retroviral supernatants were generated in 293GP cells by co-transfection with the retroviral vector encoding the anti-TG-TCR and an envelope protein (RD114) using lipofectamine 2000 (Life Technologies) as described in Robbins et al., J. Clin. Oncol., 29(7): 917-24 (2011). On the next day of lipofection, medium was replaced with fresh medium. The supernatant was harvested after 48 hours (h) and used to transduce anti-CD3-stimulated peripheral blood lymphocytes (PBL).Retroviral Transduction of Anti-CD3 Stimulated PBL

[0102] All PBL were collected via leukapheresis from patients enrolled in Institutional Review Board-approved studies. Lymphocytes were cultured as described in Cohen et al., Cancer Res., 66(17): 8878-86 (2006) using AIM-V media (Life Technologies) containing 5% human serum (Valley Biomedical Inc., Winchester, VA) and IL-2 (Prometheus, San Diego CA) at a concentration of 300 IU / ml for PBL. PBL from allogeneic donors were stimulated with soluble anti-CD3 (OKT3, 50 ng / mL) and IL-2 (300 IU / mL) for two days before transduction was performed. After stimulation, cells were added to 24-well plates initially coated with retronectin (10 µg / mL in 400 uL of PBS; Takara Shuzo, Japan) and subsequently loaded with virus by adding the virus-containing culture supernatant and centrifugating (2000 x g 32 °C, 2 h). After loading the virus, stimulated PBL were added at a concentration of 5 x 10 5< cells per well and the plates were centrifuged at 1000 x g for 10 minutes (min). Plates were incubated overnight at 37 °C in 5% CO 2 incubator. On the following day, cells were transferred to new retronectin-coated and virus-loaded 24-well plates, and the second transduction was performed. Cells were maintained at a cell density between 0.5-1x10 6< cells / mL. Transduction efficiency was confirmed by FACS analysis of mouse TCR-β expression in transduced PBL.Cytokine release assay

[0103] Interferon (IFN)-γ release by transduced PBL was determined as previously described in Wang et al., J. Immunol. Methods, 366(1-2): 43-51 (2011). Briefly, retrovirally-transduced cells (1x10 5< ) were co-cultured with 5x10 4< target cells (XTC, XTC / A2, CosA2, or CosA2 transfected with TG) or control tumor cell lines for 18-22 hrs in RPMI with 10% FBS at 37 °C, 5% CO 2 . On the subsequent day, IFN-γ secretion was determined by enzyme-linked immunosorbent assay (ELISA).EXAMPLE 1

[0104] This example demonstrates that TG is expressed in normal tissues, primary thyroid cancer, and lymph node metastases.

[0105] Expression of thyroid-specific antigens, including thyroid peroxidase (TPO), paired box 8 (PAX8), forkhead box E1 (FOXE1), iodotyrosine deiodinase (IYD) and thyroglobulin (TG) (van Staveren et al., Cancer Res., 67(17): 8113-20 (2007)), was investigated by TAQMAN quantitative RT-PCR. Of all of these thyroid-specific antigens, TG maintained the highest expression in normal thyroid, primary thyroid cancer, and lymph node metastases of thyroid cancer (Fig. 1A). Low expression of TG was observed in non-thyroid, normal human tissue. TG expression in thyroid tissue was higher than expression in other normal tissues (Fig. 1B). Based on these data, TG was identified as a candidate thyroid-specific target antigen for adoptive cellular therapy.EXAMPLE 2

[0106] This example demonstrates the stimulation of Yeti / A2 splenocytes with TG 470-478 .

[0107] HLA-A0201-restricted murine T cells were generated by vaccinating Yeti mice that were transgenic for HLA-A0201 and an IFN-γ reporter gene (yellow fluorescent protein (YFP)) with an adenovirus encoding the 5' half of the TG gene (TG 42-4292 ). The mice were vaccinated with TG-containing adenovirus on day 0, followed by a second vaccination with the same adenovirus on day 14. On day 28, splenocytes were collected and stimulated in vitro with TG peptide immediately at the time of harvest, followed by a second in vitro TG peptide stimulation on day 35.

[0108] The expression of the IFN-γ reporter gene YFP by the Yeti / A2 splenocytes was measured by flow cytometry two days after the second in vitro stimulation. YFP expression in stimulated splenocytes was also evaluated by ultraviolet (UV)-microscopy after-co-culture with T2 cells pulsed with TG cognate peptide.

[0109] Cells that were stimulated by the peptide 2, representing the TG 470-478 epitope (NLFGGKFLV; SEQ ID NO: 2), produced a YFP signal as determined by flow cytometry and microscopy. This bulk culture was tested for reactivity against T2 cells pulsed with irrelevant (T2 / MART) or the TG 470-478 peptide (T2 / TG), COSA2 cells transfected with GFP or TG cDNA (CosA2 / GFP and CosA2 / TG) and XTC, TG +< thyroid carcinoma cell line with or without transfection of HLA-A2. (Fig 2). Peptide 2-stimulated splenocytes showed strong reactivity to XTC / A2 cells, CosA2 / TG cells, and T2 cells pulsed with cognate peptide.EXAMPLE 3

[0110] This example demonstrates the isolation of the murine anti-TG TCR from the TG 470-478 -stimulated splenocytes of Example 2.

[0111] Total RNA was isolated from the bulk culture by an RNA isolation kit (RNeasy, Qiagen). Amplification of the 5' cDNA ends of the TCR α and β chains was done by SMARTer 5' RACE kit (Clontech) using the following primers: Universal Primer A Mix (Clonetech), α-specific primer 5' -GGCTACTTTCAGCAGGAGGA - 3' (SEQ ID NO: 36), β-specific primer 5' AGGCCTCTGCACTGATGTTC - 3' (SEQ ID NO: 37). TCR α and β cDNA molecules were then inserted into a TOPO vector by TA cloning. Plasmids from 48 individual colonies for α- and β-chains were purified and sequenced. This sequence analysis revealed oligo-clonality, with 27 / 48 colonies of α representing TRAV3D-3*02 / J22*01, 21 / 48 colonies of α representing TRAV15N-1*01, and 45 / 47 colonies of β representing TRBV26*01 / D2*01 / J2-5*01. Since TRAV15N-1*01 was a nonproductive recombination, it was disregarded. Based on the sequencing data, the following primers were synthesized (Life Technologies): TCR α forward (SEQ ID NO: 38) and TCR α reverse (SEQ ID NO: 39) for the α chain and TCR β forward (SEQ ID NO: 43) and TCR β reverse (SEQ ID NO: 40) for the β chain. By RT-PCR, full length cDNA of the α chain and β chain were isolated. The α chain and β chain cDNA encoded SEQ ID NOs: 11 and 12, respectively.EXAMPLE 4

[0112] This example demonstrates the generation of a retroviral recombinant expression vector encoding the murine anti-TG TCR of Example 3.

[0113] After the isolation of the full length α chain and β chain as described in Example 3, a self-cleaving 2A peptide sequence was introduced into the 5' of β chain using a 7:2:1 molar ratio mix of SEQ ID NOs: 41, 42 and 43 as the forward primer and SEQ ID NO: 40 as the reverse primer.

[0114] After the amplification, the α-chain and 2A-β-chain were cloned into the retroviral vector, MSGV1 (SEQ ID NO: 21), which is a derivative of the murine stem cell virus-based retroviral vector pMSGV (Zhao et al., J. Immunol., 174(7): 4415-23 (2005)) by the InFusion reaction (Clontech). The plasmid encoding the mouse anti-TG TCR was a 7394 base pair (bp) sequence encoding the α and β-chains (SEQ ID NOs: 11 and 12, respectively) separated by a self-cleaving p2A region (SEQ ID:NO 28). The sequence of the plasmid was confirmed by Sanger sequencing.EXAMPLE 5

[0115] This example demonstrates the transduction of donor PBL with a retroviral vector encoding the murine anti-TG TCR.

[0116] Anti-CD3 stimulated, human donor PBL were retrovirally transduced with the vector of Example 4. Three days after transduction, FACS analysis was performed by labeling the T-cells with antibodies against CD3, CD8, and the mouse TCR-β chain or MART-1 / HLA-A2 tetramer. The efficiency of transduction of PBL from three donor patients was high (80-90%) without significant differences between CD4 +< and CD8 +< T-cells. The experiments were performed more than five times, each of which gave similar results.EXAMPLE 6

[0117] This example demonstrates the reactivity of the murine anti-TG TCR against HLA-A*0201 +< / TG +< targets.

[0118] Anti-CD3 stimulated PBL were transduced with the retroviral vector encoding the murine anti-TG TCR of Example 4 or an anti-MART-1 TCR. Untransduced cells were used as a control. Three days after transduction, 1 x 10 5< transduced cells or control cells were co-cultured with 5 x 10 4< T2 cells that had been pulsed with either TG (NLFGGKFLV (SEQ ID NO: 2)) (T2 / TG) or MART-1 (T2 / MART-1) peptides. PBL expressing the murine anti-TG TCR (SEQ ID NOs: 11 and 12) recognized the peptide at very low concentrations (< 0.1 nM), out-performing the anti-MART-1 TCR control. (Fig. 3A).

[0119] PBL transduced with a vector encoding the murine anti-TG TCR (SEQ ID NOs: 11 and 12) were analyzed for reactivity, as determined by human (h) IFN-γ release, after co-culture with tumor cell lines or cell lines transfected to express TG. High levels of IFN-γ were released by the PBL transduced with a vector encoding the murine anti-TG TCR (SEQ ID NOs: 11 and 12) in response to HLA-A2 +< TG +< lines, including XTC / A2 and CosA2 / TG. (Fig. 3B).EXAMPLE 7

[0120] This example demonstrates the specificity of the murine anti-TG TCR for HLA-A*0201 +< / TG +< targets.

[0121] The specificity of the murine anti-TG TCR (SEQ ID NOs: 11 and 12) was tested by analyzing its reactivity against XTC, XTC / A2, and a panel of cell lines and normal tissues not expressing one or both of TG and HLA-A*0201, including H2087, BIC, BE-3, SK-OV3, SK-BR3, MDA231, MDA468, four renal cell carcinoma lines, normal human fibroblasts, and small airway epithelial epithelium cells (Table 1). As shown in Table 1, all cell lines were one or both of HLA-A*0201 -< and TG -< , except XTC / A2. The PBL transduced with a vector encoding the murine anti-TG TCR (SEQ ID NOs: 11 and 12) showed reactivity only to the HLA-A2+ / TG+ XTC / A2 cell line, and showed no reactivity to any TG-negative or HLA-A*0201-negative cell lines. Further testing of the murine anti-TG TCR against TG-expressing, freshly resected, normal, primary thyroid tissues from an HLA-A*0201 -< patient and a HLA-A*0201 +< patient demonstrated that the murine anti-TG TCR transduced PBL were reactive against HLA-A*0201 +< / TG +< , but not HLA-A*0201 -< / TG +< tissue by IFN-γ secretion. TABLE 1Cell Line HLA-A2+ Tg+ XTC-+XTC / A2++mel624+-mel938+-Fibroblasts+-Small Airway Epithelial Cells--MDA231+-MDA468--SK-OV3--SK-BR3--H2087+-BE-3+-BIC+-RCC #1+-RCC #2+-RCC #3+-RCC #4+- EXAMPLE 8

[0122] This example demonstrates the isolation of a human anti-TG TCR and the transduction efficiency of the human anti-TG TCR into PBL.

[0123] Human PBL were individually stimulated four times with 30 computer algorithmically-predicted HLA-A2 high binding peptides derived from TG 42-4292 . After four in vitro stimulations, TG 3-11 peptide (LVLEIFTLL, SEQ ID NO: 58)-stimulated culture showed reactivity against XTC / A2. Limiting dilution cloning was carried out for this culture and one of 28 clones analyzed, clone 14, was found to have TG-specific reactivity. After the expansion of the cells, TCR α and β genes were cloned by 5'RACE followed by RT-PCR (encoding SEQ ID NOs: 54 and 55, respectively). PBL were transduced with the retroviral expression vector encoding the human anti-TG TCR.

[0124] Transduction efficiency of human anti-TG TCR expression in transduced PBL was confirmed by FACS analysis. The efficiency of transduction of PBL from two donor patients was high (75-80%) without significant differences between CD4 +< and CD8 +< T-cells.EXAMPLE 9

[0125] This example demonstrates the reactivity of the human anti-TG TCR of Example 8.

[0126] PBL transduced with the human anti-TG TCR of Example 8 were co-cultured with T2 cells pulsed with various concentrations of MART-1 or TG 3-11 and IFN-γ was measured (pg / ml). The results are shown in Table 2A. TABLE 2AConcentration of peptide pulsed IFN-γ (pg / ml) T2 / MART-1 TG 3-11 1000 nM73.429734.3100 nM73.628600.910 nM64.716848.21 nM68.22522.10.1 nM54.5325.50.01 nM89.293.20.001 nM81.872.90 nM70.375.7

[0127] PBL transduced with the murine anti-TG TCR of Example 3 were co-cultured with T2 cells pulsed with various concentrations of MART-1 or TG 470-478 . The results are shown in Table 2B. TABLE 2BConcentration of peptide pulsed IFN-γ (pg / ml) T2 / MART-1 T2 / TG 470-478 1000 nM373.747261.6100 nM125.833459.210 nM50.227326.81 nM41.513124.80.1 nM36.586800.01 nM411236.80.001 nM38.2136.10 nM37.755.8

[0128] As shown in Tables 2A and 2B, although the reactivity of the murine anti-TG TCR was superior to that of the human anti-TG TCR, PBL transduced with the human anti-TG TCR were reactive against cells pulsed with TG 3-11 .

[0129] PBL transduced with the human anti-TG TCR of Example 8 or the murine anti-TG TCR of Example 3 were co-cultured with COSA2 / GFP cells, COSA2 / TG cells, 624Mel cells, XTC cells, or XTC / A2 cells, and IFN-γ was measured (pg / ml). The results are shown in Table 3. TABLE 3IFN-γ (pg / ml) COSA2 / GFP COSA2 / TG 624Mel XTC XTC / A2 human anti-TG TCR 15.58794.71.85.7735.3murine anti-TG TCR 19.225298.47.22.321371.9

[0130] As shown in Table 3, although the reactivity of the murine anti-TG TCR was superior to that of the human anti-TG TCR, PBL transduced with the human anti-TG TCR were reactive against HLA-A2+ / TG+ cell lines.

[0131] In a separate experiment, PBL from two patients that were untransduced (UT) or transduced with the human anti-TG TCR of Example 8, the murine anti-TG TCR of Example 3, or an anti-MART-1 TCR were co-cultured with COSA2 / GFP cells, COSA2 / MART-1 cells, Cos7-HLA-A*01 cells that were transfected to express TG (COSA1 / TG cells), COSA2 / TG cells, 624Mel cells (MART-1+), 938Mel cells, XTC cells, or XTC / A2 cells, and IFN-γ was measured (pg / ml). The results are shown in Table 4A (Patient 1) and Table 4B (Patient 2). TABLE 4AIFN-γ (pg / ml) UT Anti-MART-1 TCR human anti-TG TCR murine anti-TG TCR COSA2 / GFP0000COSA2 / MART-102000000COSA1 / TG0000COSA2 / TG001550020000624Mel0700000938Mel0000XTC0000XTC / A20050020000 TABLE 4B IFN-γ (pg / ml) UT Anti-MART-1 TCR human anti-TG TCR murine anti-TG TCR COSA2 / GFP0000COSA2 / MART-102000000COSA1 / TG0000COSA2 / TG001480020000624Mel0380000938Mel0000XTC0000XTC / A20030017900

[0132] Further testing of the human anti-TG-TCR against TG-expressing, freshly resected, normal, primary thyroid tissues from an HLA-A*0201 -< patient and a HLA-A*0201 +< patient demonstrated that the human anti-TG-TCR transduced PBL were reactive against HLA-A*0201 +< / TG +< , but not HLA-A*0201 -< / TG +< tissue, as measured by IFN-γ secretion.

[0133] The use of the terms "a" and "an" and "the" and "at least one" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The use of the term "at least one" followed by a list of one or more items (for example, "at least one of A and B") is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

Claims

1. An isolated T cell comprising a recombinant expression vector comprising a nucleic acid encoding: (a) a T cell receptor (TCR) having antigenic specificity for human thyroglobulin (TG) and comprising an α chain complementarity determining region (CDR) 1 comprising the amino acid sequence of SEQ ID NO: 3, an α chain CDR2 comprising the amino acid sequence of SEQ ID NO: 4, an α chain CDR3 comprising the amino acid sequence of SEQ ID NO: 5, a β chain CDR1 comprising the amino acid sequence of SEQ ID NO: 6, a β chain CDR2 comprising the amino acid sequence of SEQ ID NO: 7, and a β chain CDR3 comprising the amino acid sequence of SEQ ID NO: 8, (b) a polypeptide comprising a functional portion of the TCR of (a), wherein the functional portion comprises the amino acid sequences of SEQ ID NOs: 3-8, or (c) a protein comprising a first polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 3-5 and a second polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 6-8, for use in the in vivo detection, treatment or prevention of cancer in a human, wherein the T cell is allogeneic to the human.

2. An isolated T cell comprising a recombinant expression vector comprising a nucleic acid encoding: (a) a T cell receptor (TCR) having antigenic specificity for human thyroglobulin (TG) and comprising an α chain complementarity determining region (CDR) 1 comprising the amino acid sequence of SEQ ID NO: 3, an α chain CDR2 comprising the amino acid sequence of SEQ ID NO: 4, an α chain CDR3 comprising the amino acid sequence of SEQ ID NO: 5, a β chain CDR1 comprising the amino acid sequence of SEQ ID NO: 6, a β chain CDR2 comprising the amino acid sequence of SEQ ID NO: 7, and a β chain CDR3 comprising the amino acid sequence of SEQ ID NO: 8, (b) a polypeptide comprising a functional portion of the TCR of (a), wherein the functional portion comprises the amino acid sequences of SEQ ID NOs: 3-8, or (c) a protein comprising a first polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 3-5 and a second polypeptide chain comprising the amino acid sequences of SEQ ID NOs: 6-8, for use in the in vivo detection, treatment or prevention of cancer in a human, wherein the T cell is autologous to the human.

3. The T cell for the use according to claim 1 or 2, wherein the TCR has antigenic specificity for the TG470-478 amino acid sequence of SEQ ID NO: 2.

4. The T cell for the use according to any one of claims 1-3, wherein the TCR comprises an α chain variable region comprising the amino acid sequence of SEQ ID NO: 9 and a β chain variable region comprising the amino acid sequence of SEQ ID NO: 10.

5. The T cell for the use according to any one of claims 1-4, wherein the TCR further comprises rising an α chain constant region comprising the amino acid sequence of SEQ ID NO: 13 and a β chain constant region comprising the amino acid sequence of SEQ ID NO: 14.

6. The T cell for the use according to any one of claims 1-5, wherein the TCR comprises an α chain comprising the amino acid sequence of SEQ ID NO: 11 and a β chain comprising the amino acid sequence of SEQ ID NO: 12.

7. The T cell for the use according to any one of claims 1-4, wherein the functional portion of the polypeptide comprises the amino acid sequence of both SEQ ID NOs: 9 and 10.

8. The T cell for the use according to any one of claims 1-7, wherein the functional portion of the polypeptide comprises the amino acid sequence of both SEQ ID NOs: 11 and 12.

9. The T cell for the use according to any one of claims 1-8, wherein the TCR and / or polypeptide comprises a self-cleaving, viral linker peptide.

10. The T cell for the use according to claim 1 or 2, wherein the nucleic acid encodes a protein as defined in claim 1(c) or 2(c), wherein: (a) the first polypeptide chain comprises the amino acid sequence of SEQ ID NO: 9 and the second polypeptide chain comprises the amino acid sequence of SEQ ID NO: 10; or (b) the first polypeptide chain comprises the amino acid sequence of SEQ ID NO: 11 and the second polypeptide chain comprises the amino acid sequence of SEQ ID NO: 12.

11. The T cell for the use according to claim 1, 2, or 10, wherein the protein referred to in claims 1(c), 2(c), and 10 is a fusion protein.

12. The T cell for the use according to any one of claims 1-11, wherein the nucleic acid: (a) comprises the nucleotide sequences of SEQ ID NOs: 22-27; (b) comprises the nucleotide sequences of SEQ ID NOs: 15 and 16; (c) further comprises the nucleotide sequences of SEQ ID NOs: 19 and 20; and / or (d) comprises the nucleotide sequences of SEQ ID NOs: 17 and 18.

13. The T cell for the use according to any one of claims 1-12, wherein the recombinant expression vector comprises the nucleotide sequence of SEQ ID NO: 21.

14. The T cell for the use according to any one of claims 1-13, wherein the cancer is thyroid cancer or neuroblastoma.