PORPHOBILINOGENDEAMINASE-CODING POLYPEPTIDES FOR THE TREATMENT OF SEVERE INTERMITTENT PORPHYRIA

DE602017095560T2Active Publication Date: 2026-06-10FUNDACION PARA LA INVESTIGACION MEDICA APLICADA +1

Patent Information

Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
FUNDACION PARA LA INVESTIGACION MEDICA APLICADA
Filing Date
2017-05-18
Publication Date
2026-06-10

AI Technical Summary

Technical Problem

Current treatments for acute intermittent porphyria (AIP) are inadequate, with existing therapies like Panhematin therapy having short-acting efficacy, potential long-term complications, and limited effectiveness in chronic cases, while other approaches such as enzyme replacement therapy and gene therapy have shown insufficient reduction in surrogate markers of PBGD activity.

Method used

Development of mRNA therapeutics using modified nucleotides and lipid nanoparticle delivery systems to deliver mRNA encoding porphobilinogen deaminase (PBGD) for intracellular protein synthesis, minimizing immune activation and optimizing translation efficiency.

Benefits of technology

The mRNA therapeutics significantly reduce urinary excretion of aminolevulinate acid, porphobilinogen, and porphyrin, and serum levels of alanine transaminase, aspartate transaminase, and bilirubin, maintaining hepatic PBGD activity for extended periods post-administration.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

BACKGROUND

[0001] Acute intermittent porphyria (AIP) is an autosomal dominant metabolic disorder associated with impaired production of heme, the oxygen-binding prosthetic group of hemoglobin. The causative gene for AIP is porphobilinogen deaminase (PBGD) (NM_000190; NP_000181; also referred to as hydroxymethylbilane synthase (HMBS or HM-synthase) and uroporphyrinogen I synthase). Song G et al., FASEB J. 23: 396-404 (2009). PBGD (E.C. 2.5.1.61) is one of the eight enzymes involved in the porphyrin-heme biosynthetic pathway. PBGD's biological function is to catalyze the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. There are two primary isoforms of PBGD: the 44-kDa housekeeping enzyme (isoform 1), which is expressed in all tissues, and the 42-kDa erythrocyte-specific enzyme (isoform 2). The ubiquitous PBGD isoform 1 is 361 amino acid residues, while the erythrocyte-specific variant (PBGD isoform 2) is 344 amino acids. Id.

[0002] Mutations within the PBGD gene can result in the complete or partial loss of PBGD function, resulting in impaired heme production and the abnormal accumulation of aminolevulinic acid (ALA) and porphobilinogen (PBG) in cytoplasm of cells, plasma and urine. Id.

[0003] While signs and symptoms can be variable, patients suffering from AIP often exhibit neurological (e.g., agitation, delirium, seizures, loss of motor function, respiratory paralysis) and gastrointestinal (e.g., extreme abdominal pain, vomiting, painful urination) issues. These signs and symptoms can be triggered by various factors (e.g., drugs, hormones, and alcohol) and usually occur as episodes or attacks that develop over course of several hours or few days. Hrdinka M et al., Physiol Res. 2: S119-36 (2006). In between these episodes or attacks, AIP patients can otherwise appear healthy. However, if left untreated, AIP can potentially cause life-threatening complications, including death. AIP has an estimate prevalence of about 5.9 per million people worldwide (Elder G et al., J. Inherit. Metab. Dis. 36:849-57 (2012)). While AIP patients from all ethnic groups have been reported, the disorder is much more prevalent in both the Dutch and Swedish populations (1 in 10,000 to 8 in 10,000). Tjensvoll K et al., Dis Markers. 19: 41-6 (2003-2004).

[0004] Historic treatment for AIP was primarily via lifestyle modification (e.g., avoiding alcohol, smoking and known porphyrogenic drugs and diet) and management of individual sign and symptoms. Badminton MN et al., Int J Clin Pract. 56: 272-8 (2002). In extreme cases, regular hematin infusions and / or liver transplantation had been recommended. Seth AK et al., Liver Transpl. 13: 1219-27 (2007).

[0005] Today, the current Standard of Care (SOC) for AIP is Panhematin therapy, also known as "hemin" therapy. The SOC therapy is based on a down-regulation of hepatic heme synthesis using heme administration. Notably however, heme therapy is indicated only if an acute attack of porphyria is proven by a marked increase in urine PBG. Moreover, there remain several unmet medical needs including ineffectiveness in chronic AlP, and short-acting efficacy (lasts only 1-2 days). Moreover, recurrent hyper-activation of the hepatic heme synthesis pathway can be associated with neurological and metabolic manifestations and long-term complications including chronic kidney disease and increased risk of hepatocellular carcinoma in certain AIP patients. Prophylactic heme infusion can be an effective strategy in some of these patients, but it induces tolerance and its frequent application may be associated with thromboembolic disease and hepatic siderosis.

[0006] Emerging therapies including enzyme replacement therapy (ERT) or gene therapy (e.g., HMBS-gene transfer), as well as a potential therapy based on ALAS1-gene expression inhibition, are being developed. Zymenex (also known as "Porphozym"), a recombinant human PBGD, failed in Phase 3 clinical trials in 2009. While the therapy had an excellent safety profile, the treatment failed to sufficiently reduce the levels of the surrogate markers of PBGD activity (i.e., PBG and ALA). In the trial, PBG declined, but ALA did not. Moreover, the PBG enzyme wasn't targeted to hepatocytes. In a Phase I open label liver-directed gene therapy clinical trial for acute intermittent porphyria, D'Avola and colleagues reported the results of the first gene therapy trial for AIP and the first-in-human use of AAV5 in which they showed evidence of safety, although there was no clear efficacy signal. It is possible that the biology of the disease and the lack of reliable read-outs might account for the lack of efficacy. To date, orthotopic liver transplantation is the only curative treatment in patients with recurrent acute attacks.

[0007] Thus, with the exception of liver transplants, most treatments often fail to completely and reliably treat the disorder. Therefore, there is an ongoing need for improved therapeutics to treat AIP.

[0008] WO2010 / 036118 discloses nucleotide sequences coding for human porphobilinogen deaminase that are optimised for higher expression in mammalian cells, and DNA constructs comprising such optimised synthetic coding sequences for use in gene therapy of conditions caused by a deficiency in porphobilinogen deaminase, such as acute intermittent porphyria.SUMMARY

[0009] Based on the disclosure that is contained herein, the present invention provides a composition comprising (a) an mRNA comprising an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide and (b) a delivery agent, wherein the delivery agent comprises: (i) a compound having the Formula (IId): or a salt or stereoisomer thereof, wherein n is selected from 2, 3, and 4; m is selected from 5, 7, and 9; R 2 is C 8 alkyl; R 3 is C 5-9 alkyl; R 5 and R 6 are H; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, -R*YR", -YR", and H; each R" is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each Y is independently a C 3-6 carbocycle; or (ii) a compound of Formula (IIa), (IIb), (IIc), or (IIe): or or a salt or isomer thereof, wherein: R 4 is unsubstituted C 1-3 alkyl, or -(CH 2 ) n Q, in which n is 1, 2, 3, 4, or 5 and Q is OH, -NHC(S)N(R) 2 , or -NHC(O)N(R) 2 ; each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H. DETAILED DESCRIPTION

[0010] The present invention is defined in the independent claims and certain optional features thereof are defined in the dependent claims. In so far as the terms "invention", "example", "aspect", and "embodiment" are used herein, these terms will be interpreted in such a way that protection does not extend beyond the scope of the claims. The technical information set out below may in some respects go beyond the scope of the invention, which is defined exclusively by the appended claims. The additional technical information is provided to place the actual invention in a broader technical context, and to illustrate possible related technical developments.

[0011] Any references to methods for treatment of the human or animal body by surgery or therapy and diagnostic methods practices on the human or animal body are not to be construed as claiming protection for such methods as such but are instead to be construed a referring to products, in particular substances or compositions for use in any of these methods.

[0012] The present invention provides mRNA therapeutics for the treatment of acute intermittent porphyria (AIP), as defined in the claims. The mRNA therapeutics of the invention are particularly well-suited for the treatment of AIP as the technology provides for the intracellular delivery of mRNA encoding PBGD followed by de novo synthesis of functional PBGD protein within target cells. The instant invention features the incorporation of modified nucleotides within therapeutic mRNAs to (1) minimize unwanted immune activation (e.g., the innate immune response associated with the in vivo introduction of foreign nucleic acids) and (2) optimize the translation efficiency of mRNA to protein. Exemplary aspects of the invention feature a combination of nucleotide modifications to reduce the innate immune response and sequence optimization, in particular, within the open reading frame (ORF) of therapeutic mRNAs encoding PBGD to enhance protein expression.

[0013] In further embodiments, the mRNA therapeutic technology of the instant invention also features delivery of mRNA encoding PBGD via a lipid nanoparticle (LNP) delivery system. The instant invention features novel ionizable lipid-based LNPs which have improved properties when combined with mRNA encoding PBGD and administered in vivo, for example, cellular uptake, intracellular transport and / or endosomal release or endosomal escape. The LNP formulations of the invention also demonstrate reduced immunogenicity associated with the in vivo administration of LNPs.

[0014] In one aspect, the invention provides compositions comprising a polynucleotide, i.e., a messenger RNA (mRNA), encoding porphobilinogen deaminase, as defined in the claims. In a further aspect, the invention provides the compositions of the invention for use in a method of treating acute intermittent porphyria (AIP) in a subject in need thereof by administering the same.

[0015] The present disclosure provides a pharmaceutical composition comprising a lipid nanoparticle encapsulated mRNA that comprises an open reading frame (ORF) encoding an porphobilinogen deaminase (PBGD) polypeptide, wherein the composition is suitable for administration to a human subject in need of treatment for acute intermittent porphyria (AIP).

[0016] The present disclosure further provides a pharmaceutical composition comprising: (a) a mRNA that comprises (i) an open reading frame (ORF) encoding an porphobilinogen deaminase (PBGD) polypeptide, wherein the ORF comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof, (ii) an untranslated region (UTR) comprising a microRNA (miRNA) binding site; and (b) a delivery agent, wherein the pharmaceutical composition is suitable for administration to a human subject in need of treatment for acute intermittent porphyria (AIP).

[0017] The present disclosure further provides a pharmaceutical composition comprising an mRNA comprising an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the composition when administered to a subject in need thereof as a single intravenous dose is sufficient to reduce urinary excretion of: (i) aminolevulinate acid (ALA) at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold or at least 50-fold as compared to a reference ALA excretion level (e.g., during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) porphobilinogen (PBG) at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold or at least 50-fold as compared to a reference PBG excretion level (e.g., during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) porphyrin at least at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold or at least 50-fold as compared to a reference porphyrin excretion level (e.g., during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0018] The present disclosure further provides a pharmaceutical composition comprising an mRNA comprising an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the composition when administered to a subject in need thereof as a single intravenous dose is sufficient to reduce urinary excretion of: (i) aminolevulinate acid (ALA) by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 98%, at least 99%, or 100% as compared to the subject's baseline level or a reference ALA excretion level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) porphobilinogen (PBG) by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 98%, at least 99%, or 100% as compared to the subject's baseline level or a reference PBG excretion level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) porphyrin by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 98%, at least 99%, or 100% as compared to the subject's baseline level or a reference porphyrin excretion level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0019] The present disclosure further provides a pharmaceutical composition comprising an mRNA comprising an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the composition when administered to a subject in need thereof as a single intravenous dose is sufficient to reduce serum levels of: (i) alanine transaminase (ALT) to at least within 10-fold, at least within 5-fold, at least within 2-fold, or at least within 1.5-fold or to within at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% of a reference ALT serum level within at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) aspartate transaminase (AST) to at least within 10-fold, at least within 5-fold, at least within 2-fold, or at least within 1.5-fold or within at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% of a reference AST serum level, for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) bilirubin to at least within 10-fold, at least within 5-fold, at least within 2-fold, or at least within 1.5 fold or within at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% of a reference bilirubin serum level, for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0020] The present disclosure further provides a pharmaceutical composition comprising an mRNA comprising an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the composition when administered to a subject in need thereof as a single intravenous dose is sufficient to reduce serum levels of: (i) alanine transaminase (ALT) by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, or at least 30% as compared to the subject's baseline level or a reference ALT serum level (e.g., in a subject with AIP or during an acute porphyria attack), within at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) aspartate transaminase (AST) by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, or at least 30% as compared to the subject's baseline level or a reference AST serum level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) bilirubin by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, or at least 30% as compared to the subject's baseline level or a reference bilirubin serum level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0021] The present disclosure further provides a pharmaceutical composition comprising an mRNA comprising an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the composition when administered to a subject in need thereof as a single intravenous dose is sufficient to: (i) maintain hepatic PBGD activity levels at or above a reference physiological level or at a supraphysiological level for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (ii) maintain hepatic PBGD activity levels at 50% or more of a reference hepatic PBGD activity level for at least 24 hours, at least 48 hours, at least 72 hours, or at least 96 hours post-administration.

[0022] In some embodiments, the pharmaceutical compositions disclosed herein further comprise a delivery agent.

[0023] The present disclosure provides a polynucleotide comprising an open reading frame (ORF) encoding a porphobilinogen deaminase (PBGD) polypeptide, wherein the uracil or thymine content of the ORF relative to the theoretical minimum uracil or thymine content of a nucleotide sequence encoding the PBGD polypeptide (%U TM or %T TM ), is between about 100% and about 150%. In some embodiments of the invention, the %U TM or %T TM is between about 105% and about 145%, between about 105% and about 140%, between about 110% and about 140%, between about 110% and about 145%, between about 115% and about 135%, between about 105% and about 135%, between about 110% and about 135%, between about 115% and about 145%, or between about 115% and about 140%. In some embodiments, the uracil or thymine content of the ORF relative to the uracil or thymine content of the corresponding wild-type ORF (%U WT or %T WT ) is less than 100%. In some embodiments, the %U WT or %T WT is less than about 95%, less than about 90%, less than about 85%, less than 80%, less than 79%, less than 78%, less than 77%, less than 76%, less than 75%, less than 74%, or less than 73%. In some embodiments, the %U WT or %T WT is between 65% and 73%. In some embodiments, the uracil or thymine content in the ORF relative to the total nucleotide content in the ORF (%U TL or %T TL ) is less than about 50%, less than about 40%, less than about 30%, or less than about 19%. In some embodiments, the %U TL or %T TL is less than about 19%. In some embodiments, the %U TL or %T TL is between about 13% and about 15%. In some embodiments, the guanine content of the ORF with respect to the theoretical maximum guanine content of a nucleotide sequence encoding the PBGD polypeptide (%G TMX ) is at least 69%, at least 70%, at least 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%. In some embodiments, the %G TMX is between about 70% and about 80%, between about 71% and about 79%, between about 71% and about 78%, or between about 71% and about 77%.

[0024] In some embodiments, the cytosine content of the ORF relative to the theoretical maximum cytosine content of a nucleotide sequence encoding the PBGD polypeptide (%C TMX ) is at least 59%, at least 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%. In some embodiments, the %C TMX is between about 60% and about 80%, between about 62% and about 80%, between about 63% and about 79%, or between about 68% and about 76%. In some embodiments, the guanine and cytosine content (G / C) of the ORF relative to the theoretical maximum G / C content in a nucleotide sequence encoding the PBGD polypeptide (%G / C TMX ) is at least about 81%, at least about 85%, at least about 90%, at least about 95%, or about 100%. In some embodiments, the %G / C TMX is between about 80% and about 100%, between about 85% and about 99%, between about 90% and about 97%, or between about 91% and about 96%. In some embodiments, the G / C content in the ORF relative to the G / C content in the corresponding wild-type ORF (%G / C WT ) is at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 110%, at least 115%, or at least 120%. In some embodiments, the average G / C content in the 3 rd< codon position in the ORF is at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, or at least 30% higher than the average G / C content in the 3 rd< codon position in the corresponding wild-type ORF.

[0025] In some embodiments, the ORF has at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 33, and 89 to 117. In some embodiments, the ORF has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 to 33, and 89 to 117. In some embodiments, the ORF has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO: 104, 112, or 114. In some embodiments, the ORF has at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NO: 104, 112, or 114. In some embodiments, the ORF comprises the nucleic acid sequence of SEQ ID NO: 104, 112, or 114.

[0026] In some embodiments, the PBGD polypeptide comprises an amino acid sequence at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to (i) the polypeptide sequence of wild type PBGD, isoform 1 (SEQ ID NO: 1), (ii) the polypeptide sequence of wild type PBGD, isoform 2 (SEQ ID NO: 3), the polypeptide sequence of wild type PBGD, isoform 3 (SEQ ID NO: 5), or the polypeptide sequence of wild type PBGD, isoform 4 (SEQ ID NO: 7), and wherein the PBGD polypeptide has porphobilinogen deaminase activity. In some embodiments, the PBGD polypeptide is a variant, derivative, or mutant having a porphobilinogen deaminase activity (e.g., the SM gain of function variant, SEQ ID NO: 152). In some embodiments, the gain-of-function mutant PBGD comprises an I291M mutation, an N340S mutation, or a combination thereof. In some embodiments, the gain-of-function mutant PBGD comprises the polypeptide sequence of SEQ ID NO:152. In some embodiments, the PBGD polypeptide is a PBGD fusion protein. In some embodiments, the PBGD fusion protein comprises heterologous protein moiety. In some embodiments, the heterologous protein moiety is an apolipoprotein. In some embodiments, the apolipoprotein is human apolipoprotein A1. In some embodiments, the human apolipoprotein A1 is mature human apolipoprotein A1. In some embodiments, a fusion protein comprising PBGD and mature human apolipoprotein A1 comprises the polypeptide sequence of SEQ ID NO: 154.

[0027] In some embodiments, the polynucleotide sequence further comprises a nucleotide sequence encoding a transit peptide.

[0028] In the composition of the invention, the polynucleotide is mRNA. In some embodiments, the polynucleotide comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof. In some embodiments, the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (ψ), N1-methylpseudouracil (m1ψ), 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, and any combination thereof. In some embodiments, the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (ψ), N1-methylpseudouracil (m1ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof. In some embodiments, the at least one chemically modified nucleobase is 5-methoxyuracil. In some embodiments, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracils are 5-methoxyuracils. In some embodiments, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracils or thymines are chemically modified. In some embodiments, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the guanines are chemically modified. In some embodiments, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the cytosines are chemically modified. In some embodiments, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the adenines are chemically modified.

[0029] In some embodiments, the polynucleotide further comprises a miRNA binding site.

[0030] In some embodiments, the polynucleotide comprises at least two different microRNA (miR) binding sites.

[0031] In some embodiments, the microRNA is expressed in an immune cell of hematopoietic lineage or a cell that expresses TLR7 and / or TLR8 and secretes pro-inflammatory cytokines and / or chemokines, and wherein the polynucleotide (i.e., mRNA) comprises one or more modified nucleobases.

[0032] In some embodiments, the mRNA comprises at least one first microRNA binding site of a microRNA abundant in an immune cell of hematopoietic lineage and at least one second microRNA binding site is of a microRNA abundant in endothelial cells.

[0033] In some embodiments, the mRNA comprises multiple copies of a first microRNA binding site and at least one copy of a second microRNA binding site.

[0034] In some embodiments, the mRNA comprises first and second microRNA binding sites of the same microRNA.

[0035] In some embodiments, the microRNA binding sites are of the 3p and 5p arms of the same microRNA.

[0036] In some embodiments, the microRNA binding site comprises one or more nucleotide sequences selected from Table 3 or Table 4.

[0037] In some embodiments, the microRNA binding site binds to miR-126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR-24, miR-27 or miR-26a, or any combination thereof.

[0038] In some embodiments, the microRNA binding site binds to miR126-3p, miR-142-3p, miR-142-5p, or miR-155, or any combination thereof.

[0039] In some embodiments, the microRNA binding site is a miR-126 binding site. In some embodiments, at least one microRNA binding site is a miR-142 binding site. In some embodiments, one microRNA binding site is a miR-126 binding site and the second microRNA binding site is for a microRNA selected from the group consisting of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27.

[0040] In some embodiments, the mRNA comprises at least one miR-126-3p binding site and at least one miR-142-3p binding site. In some embodiments, the mRNA comprises at least one miR-142-3p binding site and at least one 142-5p binding site.

[0041] In some embodiments, the microRNA binding sites are located in the 5' UTR, 3' UTR, or both the 5' UTR and 3' UTR of the mRNA. In some embodiments, the microRNA binding sites are located in the 3' UTR of the mRNA. In some embodiments, the microRNA binding sites are located in the 5' UTR of the mRNA. In some embodiments, the microRNA binding sites are located in both the 5' UTR and 3' UTR of the mRNA. In some embodiments, at least one microRNA binding site is located in the 3' UTR immediately adjacent to the stop codon of the coding region of the mRNA. In some embodiments, at least one microRNA binding site is located in the 3' UTR 70-80 bases downstream of the stop codon of the coding region of the mRNA. In some embodiments, at least one microRNA binding site is located in the 5' UTR immediately preceding the start codon of the coding region of the mRNA. In some embodiments, at least one microRNA binding site is located in the 5' UTR 15-20 nucleotides preceding the start codon of the coding region of the mRNA. In some embodiments, at least one microRNA binding site is located in the 5' UTR 70-80 nucleotides preceding the start codon of the coding region of the mRNA.

[0042] In some embodiments, the mRNA comprises multiple copies of the same microRNA binding site positioned immediately adjacent to each other or with a spacer of less than 5, 5-10, 10-15, or 15-20 nucleotides.

[0043] In some embodiments, the mRNA comprises multiple copies of the same microRNA binding site located in the 3' UTR, wherein the first microRNA binding site is positioned immediately adjacent to the stop codon and the second and third microRNA binding sites are positioned 30-40 bases downstream of the 3' most residue of the first microRNA binding site.

[0044] In some embodiments, the microRNA binding site comprises one or more nucleotide sequences selected from SEQ ID NO:36 and SEQ ID NO:38. In some embodiments, the miRNA binding site binds to miR-142. In some embodiments, the miRNA binding site binds to miR-142-3p or miR-142-5p. In some embodiments, the miR-142 comprises SEQ ID NO: 34.

[0045] In some embodiments, the microRNA binding site comprises one or more nucleotide sequences selected from SEQ ID NO: 158 and SEQ ID NO: 160. In some embodiments, the miRNA binding site binds to miR-126. In some embodiments, the miRNA binding site binds to miR-126-3p or miR-126-5p. In some embodiments, the miR-126 comprises SEQ ID NO: 156.

[0046] In some embodiments, the mRNA comprises a 3' UTR comprising a microRNA binding site that binds to miR-142, miR-126, or a combination thereof.

[0047] In some embodiments, the polynucleotide,i.e., mRNA, further comprises a 3' UTR. In some embodiments, the 3' UTR comprises a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a 3'UTR sequence selected from the group consisting of SEQ ID NOs: 57 to 81, 84, 149 to 151, 161 to 172, 192 to 199, or any combination thereof. In some embodiments, the miRNA binding site is located within the 3' UTR.

[0048] In some embodiments, the 3' UTR comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 57 to 81, 84, 149 to 151, 161 to 172, 192 to 199, and any combination thereof. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 149 to 151, or any combination thereof. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 150. In some embodiments, the mRNA comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 151.

[0049] In some embodiments, the i.e., mRNA, further comprises a 5' UTR. In some embodiments, the 5' UTR comprises a nucleic acid sequence at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a 5'UTR sequence selected from the group consisting of SEQ ID NO: 39 to 56, 83, 189 to 191, or any combination thereof. In some embodiments, the 5' UTR comprises a sequence selected from the group consisting of SEQ ID NO: 39 to 56, 83, 189 to 191, and any combination thereof. In some embodiments, the mRNA comprises a 5' UTR comprising the nucleic acid sequence of SEQ ID NO: 39.

[0050] In some embodiments, the polynucleotide, i.e., mRNA, further comprises a 5' terminal cap. In some embodiments, the 5' terminal cap comprises a Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5' methylG cap, or an analog thereof. In some embodiments, the 5' terminal cap comprises a Cap1.

[0051] In some embodiments, the polynucleotide, i.e., mRNA, further comprises a poly-A region. In some embodiments, the poly-A region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, or at least about 90 nucleotides in length. In some embodiments, the poly-A region has about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, about 80 to about 120 nucleotides in length.

[0052] In some embodiments, the polynucleotide, i.e., mRNA, encodes a PBGD polypeptide that is fused to one or more heterologous polypeptides. In some embodiments, the one or more heterologous polypeptides increase a pharmacokinetic property of the PBGD polypeptide. In some embodiments, upon administration to a subject, the polynucleotide has (i) a longer plasma half-life; (ii) increased expression of a PBGD polypeptide encoded by the ORF; (iii) a lower frequency of arrested translation resulting in an expression fragment; (iv) greater structural stability; or (v) any combination thereof, relative to a corresponding polynucleotide comprising SEQ ID NO: 2, 4, 6, 8, or 153. In some embodiments, the polynucleotide encodes a PBGD polypeptide that is fused to human apolipoprotein A1 (e.g., SEQ ID NO: 155).

[0053] In some embodiments, the polynucleotide, i.e., mRNA, comprises (i) a 5'-terminal cap; (ii) a 5'-UTR; (iii) an ORF encoding a PBGD polypeptide; (iv) a 3'-UTR; and (v) a poly-A region. In some embodiments, the 3'-UTR comprises a miRNA binding site. In some embodiments, the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 118-148, for example, SEQ ID NO: 133, 141, 144, or 145. In some embodiments the polynucleotide further comprises a 5'-terminal cap (e.g., Cap1) and a poly-A-tail region (e.g., about 100 nucleotides in length).

[0054] The present disclosure also provides a method of producing a polynucleotide, i.e., mRNA, the method comprising modifying an ORF encoding a PBGD polypeptide by substituting at least one uracil nucleobase with an adenine, guanine, or cytosine nucleobase, or by substituting at least one adenine, guanine, or cytosine nucleobase with a uracil nucleobase, wherein all the substitutions are synonymous substitutions. In some embodiments, the method further comprises replacing at least about 90%, at least about 95%, at least about 99%, or about 100% of uracils with 5-methoxyuracils.

[0055] The composition of the invention comprises (a) a polynucleotide, i.e., mRNA; and (b) a delivery agent as defined in the claims. In some embodiments, the delivery agent comprises a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, or a conjugate. In some embodiments, the delivery agent comprises a lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises a lipid selected from the group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), (13Z,165Z)-N,N-dimethyl-3-nonydocosa-13-16-dien-1-amine (L608), 2-({8-[(3(3)-cholest-5-en-3-yloxy]ocyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-di en-1-yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9, 12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9, 12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2S)), and any combinations thereof. In some embodiments, the lipid nanoparticle comprises DLin-MC3-DMA.

[0056] In the composition of the invention, the delivery agent may comprise a compound of the Formula (IIa), or a salt or stereoisomer thereof, wherein: R 4 is unsubstituted C 1-3 alkyl, or -(CH 2 ) n Q, in which n is 1, 2, 3, 4, or 5 and Q is OH, -NHC(S)N(R) 2 , or -NHC(O)N(R) 2 ; each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H.

[0057] In the composition of the invention, the delivery agent may comprise a compound of the Formula (IIb), or a salt or stereoisomer thereof, wherein: R 4 is unsubstituted C 1-3 alkyl, or -(CH 2 ) n Q, in which n is 1, 2, 3, 4, or 5 and Q is OH, -NHC(S)N(R) 2 , or -NHC(O)N(R) 2 ; each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H.

[0058] In the composition of the invention, the delivery agent may comprise a compound of the Formula (IIc) or (IIe), or a salt or stereoisomer thereof, wherein: R 4 is unsubstituted C 1-3 alkyl, or -(CH 2 ) n Q, in which n is 1, 2, 3, 4, or 5 and Q is OH, -NHC(S)N(R) 2 , or -NHC(O)N(R) 2 ; each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H

[0059] In the composition of the invention, the delivery agent may comprise a compound is of the Formula (IId), or a salt or stereoisomer thereof, wherein R 2 is C 8 alkyl; R 3 is C 5 alkyl, C 6 alkyl, C 7 alkyl, C 8 alkyl, or C 9 alkyl; m is 5, 7, or 9; R 5 is H; R 6 is H; n is selected from 2, 3, and 4; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, -R*YR", -YR", and H; each R" is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; and each Y is independently a C 3-6 carbocycle.

[0060] In some embodiments, the composition of the invention is a nanoparticle composition. In some embodiments, the delivery agent further comprises a phospholipid. In some embodiments, the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSpC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16:0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and any mixtures thereof.

[0061] In some embodiments, the delivery agent further comprises a structural lipid. In some embodiments, the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and any mixtures thereof.

[0062] In some embodiments, the delivery agent further comprises a PEG lipid. In some embodiments, the PEG lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and any mixtures thereof. In some embodiments, the PEG lipid has the Formula: wherein r is an integer between 1 and 100. In some embodiments, the PEG lipid is Compound 428.

[0063] In some embodiments, the delivery agent further comprises an ionizable lipid selected from the group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-di en-1-yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9, 12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)), and (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9, 12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2S)).

[0064] In some embodiments, the delivery agent further comprises a phospholipid, a structural lipid, a PEG lipid, or any combination thereof. In some embodiments, the delivery agent comprises Compound 18, DSPC, Cholesterol, and Compound 428, e.g., with a mole ratio of about 50:10:38.5:1.5.

[0065] In some embodiments, the composition is formulated for in vivo delivery. In some embodiments, the composition is formulated for intramuscular, subcutaneous, or intradermal delivery.

[0066] The present disclosure further provides a polynucleotide comprising an mRNA comprising: (i) a 5' UTR, (ii) an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the ORF comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 9 to 33 and 89 to 117, and (iii) a 3' UTR comprising a microRNA binding site selected from miR-142, miR-126, or a combination thereof, wherein the mRNA comprises at least one chemically modified nucleobase.

[0067] The present disclosure further provides a polynucleotide comprising an mRNA comprising: (i) a 5'-terminal cap; (ii) a 5' UTR comprising a sequence selected from the group consisting of SEQ ID NO: 39 to 56, 83, 189 to 191, and any combination thereof; (iii) an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the ORF comprises a sequence selected from the group consisting of SEQ ID NOs: 9 to 33 and 89 to 117, wherein the mRNA comprises at least one chemically modified nucleobase selected from the group consisting of pseudouracil (ψ), N1-methylpseudouracil (m1ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof; and (iv) a 3' UTR comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 57 to 81, 84, 149 to 151, 161 to 172, 192 to 199, and any combination thereof; and (v) a poly-A-region.

[0068] In some embodiments, the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 133, 141, 144, and 145.

[0069] The present disclosure further provides a pharmaceutical composition comprising the polynucleotide, e.g., an mRNA, and a delivery agent. In the composition of the invention, the delivery agent may be a lipid nanoparticle comprising Compound 18. In the composition of the invention, the polynucleotide comprises a nucleotide sequence encoding a PBGD polypeptide is formulated with a delivery agent comprising, a compound having the Formula IId, IIa, IIb, IIc, or IIe, e.g., Compound 18. In some embodiments, the delivery agent comprises Compound 18, DSPC, Cholesterol, and Compound 428, e.g., with a mole ratio of about 50:10:38.5:1.5.

[0070] In one aspect of the embodiments disclosed herein, the subject is a human subject in need of treatment or prophylaxis for acute intermittent porphyria (AIP) and / or an acute porphyria attack.

[0071] In one aspect of the embodiments disclosed herein, upon administration to the subject, the mRNA has: (i) a longer plasma half-life; (ii) increased expression of a PBGD polypeptide encoded by the ORF; (iii) a lower frequency of arrested translation resulting in an expression fragment; (iv) greater structural stability; or (v) any combination thereof, relative to a corresponding mRNA having the nucleic acid sequence of SEQ ID NO: 2, 4, 6, or 8 and / or administered as naked mRNA.

[0072] In some embodiments, a pharmaceutical composition or polynucleotide disclosed herein is suitable for administration as a single unit dose or a plurality of single unit doses.

[0073] In some embodiments, a pharmaceutical composition or polynucleotide disclosed herein is suitable for reducing the level of one or more biomarkers of AIP in the subject.

[0074] In some embodiments, a pharmaceutical composition or polynucleotide disclosed herein is for use in treating, preventing or delaying the onset of AIP signs or symptoms in the subject. In some embodiments, the signs or symptoms include pain, seizures, paralysis, neuropathy, death, or a combination thereof.

[0075] The present disclosure also provides a host cell comprising a polynucleotide. In some embodiments, the host cell is a eukaryotic cell. The present disclosure also provides a vector comprising a polynucleotide. Also provided is a method of making a polynucleotide comprising synthesizing the polynucleotide enzymatically or chemically. The present disclosure also provides a polypeptide encoded by a polynucleotide, a composition comprising a polynucleotide, a host cell comprising a polynucleotide, a vector comprising a polynucleotide, or produced by the method of making disclosed herein.

[0076] The present disclosure also provides a method of expressing in vivo an active PBGD polypeptide in a subject in need thereof comprising administering to the subject an effective amount of the polynucleotide, a composition comprising a polynucleotide, a host cell comprising a polynucleotide, a vector comprising a polynucleotide. Also provided is a method of treating acute intermittent porphyria (AIP) in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the polynucleotide, a composition comprising a polynucleotide, a host cell comprising a polynucleotide, a vector comprising a polynucleotide, wherein the administration alleviates the signs or symptoms of AIP in the subject.

[0077] The present disclosure also provides a method to prevent or delay the onset of AIP signs or symptoms in a subject in need thereof comprising administering to the subject a prophylactically effective amount of the polynucleotide, a composition comprising a polynucleotide, a host cell comprising a polynucleotide, a vector comprising a polynucleotide before AIP signs or symptoms manifest, wherein the administration prevents or delays the onset of AIP signs or symptoms in the subject. Also provided is a method to ameliorate the signs or symptoms of AIP in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the polynucleotide, a composition comprising a polynucleotide, a host cell comprising a polynucleotide, a vector comprising a polynucleotide before AIP signs or symptoms manifest, wherein the administration ameliorates AIP signs or symptoms in the subject.

[0078] The present disclosure further provides a method of expressing a porphobilinogen deaminase (PBGD) polypeptide in a human subject in need thereof comprising administering to the subject an effective amount of a pharmaceutical composition or a polynucleotide, e.g., an mRNA, described herein, wherein the pharmaceutical composition or polynucleotide is suitable for administrating as a single dose or as a plurality of single unit doses to the subject.

[0079] The present disclosure further provides a method of treating, preventing or delaying the onset of acute intermittent porphyria (AIP) signs or symptoms in a human subject in need thereof comprising administering to the subject an effective amount of a pharmaceutical composition or a polynucleotide, e.g., an mRNA, described herein, wherein the administration treats, prevents or delays the onset of one or more of the signs or symptoms of AIP in the subject.

[0080] The present disclosure further provides a method for the treatment of acute intermittent porphyria (AIP), comprising administering to a human subject suffering from AIP a single intravenous dose of a pharmaceutical composition or a polynucleotide, e.g., an mRNA, described herein.

[0081] The present disclosure further provides a method of reducing an aminolevulinate acid (ALA), a porphobilinogen (PBG) and / or a porphyrin urinary excretion level in a human subject comprising administering to the subject an effective amount of a pharmaceutical composition or a polynucleotide, e.g., an mRNA, described herein, wherein the administration reduces the ALA, PBG and / or porphyrin urinary excretion level in the subject. In some embodiments, (i) ALA urinary excretion level is reduced at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold or at least 50-fold as compared to a reference ALA excretion level during an acute porphyria attack, for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) PBG urinary excretion level is reduced at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold or at least 50-fold as compared to a reference PBG excretion level during an acute porphyria attack, for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) porphyrin urinary excretion level is reduced at least at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold or at least 50-fold as compared to a reference porphyrin excretion level during an acute porphyria attack, for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0082] The present disclosure further provides a method of reducing an aminolevulinate acid (ALA), a porphobilinogen (PBG) and / or a porphyrin urinary excretion level in a human subject comprising administering to the subject an effective amount of a pharmaceutical composition or a polynucleotide described herein, wherein the administration reduces the ALA, PBG and / or porphyrin urinary excretion level in the subject. In some embodiments, (i) ALA urinary excretion level is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% as compared to the subject's baseline level or a reference ALA excretion level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) PBG urinary excretion level is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% as compared to the subject's baseline level or a reference PBG excretion level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) porphyrin urinary excretion level is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% as compared to the subject's baseline level or a reference porphyrin excretion level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0083] The present disclosure further provides a method of reducing an alanine transaminase (ALT), a aspartate transaminase (AST) and / or a bilirubin serum level in a human subject comprising administering to the subject an effective amount of a pharmaceutical composition or a polynucleotide, e.g., an mRNA, described herein, wherein the administration reduces the ALT, AST and / or bilirubin serum level in the subject. In some embodiments, (i) ALT serum level is reduced to at least within 10-fold, at least within 5-fold, at least within 2-fold, or at least within 1.5-fold as compared to a reference ALT serum level within at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) AST serum level is reduced to at least within 10-fold, at least within 5-fold, at least within 2-fold, or at least within 1.5-fold, as compared to a reference AST serum level, for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) bilirubin serum level is reduced to at least within 10-fold, at least within 5-fold, at least within 2-fold, or at least within 1.5 fold as compared to a reference bilirubin serum level, for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0084] The present disclosure further provides a method of reducing an alanine transaminase (ALT), a aspartate transaminase (AST) and / or a bilirubin serum level in a human subject comprising administering to the subject an effective amount of a pharmaceutical composition or a polynucleotide described herein, wherein the administration reduces the ALT, AST and / or bilirubin serum level in the subject. In some embodiments, (i) ALT serum level is reduced by at least 90%, at least 80%, at least 70%, at least 60% at least 50%, at least 40%, or at least 30% as compared to the subject's baseline level or a reference ALT serum level (e.g., in a subject with AIP or during an acute porphyria attack) within at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, (ii) AST serum level is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, or at least 30% as compared to the subject's baseline level or a reference AST serum level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration, and / or (iii) bilirubin serum level is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, or at least 30% as compared to the subject's baseline level or a reference bilirubin serum level (e.g., in a subject with AIP or during an acute porphyria attack), for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours post-administration.

[0085] In some embodiments, 12 hours after the pharmaceutical composition or polynucleotide is administered to the subject, the PBGD activity in the subject is increased at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 600% compared to the subject's baseline PBGD activity.

[0086] In some embodiments, the PBGD activity is increased in the liver of the subject.

[0087] In some embodiments, the increased PBGD activity persists for greater than 24, 36, 48, 60, 72, or 96 hours.

[0088] In some embodiments, the pharmaceutical composition or polynucleotide is administered to the subject during an acute porphyria attack.

[0089] In some embodiments, after administration of the pharmaceutical composition or polynucleotide to the subject, e.g., within 24 hours, the level of ALA in the subject is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% compared to the subject's baseline ALA.

[0090] In some embodiments, the level of ALA is reduced in one or more of the urine, plasma, serum, and / or liver of the subject.

[0091] In some embodiments, after administration to the subject the level of ALA in the subject is reduced compared to the baseline level in the subject for at least one day, at least two days, at least three days, at least four days, at least five days, at least one week, at least two weeks, at least three weeks, or at least one month.

[0092] In some embodiments, after administration of the pharmaceutical composition or polynucleotide to the subject, e.g., within 24 hours, the level of PBG in the subject is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% compared to the subject's baseline ALA.

[0093] In some embodiments, the level of PBG is reduced in one or more of the urine, plasma, serum, and / or liver of the subject.

[0094] In some embodiments, after administration to the subject the level of PBG in the subject is reduced compared to the baseline level in the subject for at least one day, at least two days, at least three days, at least four days, at least five days, at least one week, at least two weeks, at least three weeks, or at least one month.

[0095] In some embodiments, after administration of the pharmaceutical composition or polynucleotide to the subject, e.g., within 24 hours, the level of porphyrin in the subject is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% compared to the subject's baseline ALA.

[0096] In some embodiments, the level of porphyrin is reduced in one or more of the urine, plasma, serum, and / or liver of the subject.

[0097] In some embodiments, after administration to the subject the level of porphyrin in the subject is reduced compared to the baseline level in the subject for at least one day, at least two days, at least three days, at least four days, at least five days, at least one week, at least two weeks, at least three weeks, or at least one month.

[0098] In some embodiments, after administration of the pharmaceutical composition or polynucleotide to the subject, e.g., within 24 hours, the level of ALT in the subject is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% compared to the subject's baseline ALT.

[0099] In some embodiments, the level of ALT is reduced in one or more of the urine, plasma, serum, and / or liver of the subject.

[0100] In some embodiments, after administration to the subject the level of ALT in the subject is reduced compared to the baseline level in the subject for at least one day, at least two days, at least three days, at least four days, at least five days, at least one week, at least two weeks, at least three weeks, or at least one month.

[0101] In some embodiments, after administration of the pharmaceutical composition or polynucleotide to the subject, e.g., within 24 hours, the level of AST in the subject is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% compared to the subject's baseline AST.

[0102] In some embodiments, the level of AST is reduced in one or more of the urine, plasma, serum, and / or liver of the subject.

[0103] In some embodiments, after administration to the subject the level of AST in the subject is reduced compared to the baseline level in the subject for at least one day, at least two days, at least three days, at least four days, at least five days, at least one week, at least two weeks, at least three weeks, or at least one month.

[0104] In some embodiments, after administration of the pharmaceutical composition or polynucleotide to the subject, e.g., within 24 hours, the level of bilirubin in the subject is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% compared to the subject's baseline bilirubin.

[0105] In some embodiments, the level of bilirubin is reduced in one or more of the urine, plasma, serum, and / or liver of the subject.

[0106] In some embodiments, after administration to the subject the level of bilirubin in the subject is reduced compared to the baseline level in the subject for at least one day, at least two days, at least three days, at least four days, at least five days, at least one week, at least two weeks, at least three weeks, or at least one month.

[0107] In some embodiments, the AIP is clinically manifest (overt) AIP.

[0108] In some embodiments, the AIP is clinically presymptomatic (latent) AIP.

[0109] In some embodiments, the level the PBGD polypeptide activity level is sufficient to reduce the risk of or prevent the onset of an acute attack and / or sufficient to treat an acute attack.

[0110] In some embodiments, the pharmaceutical composition or polynucleotide is administered as a single dose of less than 1.5 mg / kg, less than 1.25 mg / kg, less than 1 mg / kg, or less than 0.75 mg / kg.

[0111] In some embodiments, the administration to the subject is about once a week, about once every two weeks, or about once a month.

[0112] In some embodiments, the pharmaceutical composition or polynucleotide is administered intravenously.BRIEF DESCRIPTION OF THE DRAWINGS / FIGURES

[0113] FIG. 1A-Dshows the protein sequence ( FIG. 1A), table with domain features ( FIG. 1B), graphic representation of domain structure ( FIG. 1C), and nucleic acid sequence ( FIG. 1D) of isoform 1 of PBGD. FIG. 2A-Dshows the protein sequence ( FIG. 2A), table with domain features ( FIG. 2B), graphic representation of domain structure ( FIG. 2C), and nucleic acid sequence ( FIG. 2D) of isoform 2 of PBGD. FIG. 3A-Dshows the protein sequence ( FIG. 3A), table with domain features ( FIG. 3B), graphic representation of domain structure ( FIG. 3C), and nucleic acid sequence ( FIG. 3D) of isoform 3 of PBGD. FIG. 4A-Dshows the protein sequence ( FIG. 4A), table with domain features ( FIG. 4B), graphic representation of domain structure ( FIG. 4C), and nucleic acid sequence ( FIG. 4D) of isoform 4 of PBGD. FIG. 5 shows uracil (U) metrics corresponding to wild type isoform 1 of PBGD and 25 sequence optimized PBGD polynucleotides. The column labeled "U content (%)" corresponds to the %U TL parameter. The column labeled "U Content v. WT (%)" corresponds to %U WT . The column labeled "U Content v. Theoretical Minimum (%)" corresponds to %U TM . The column labeled "UU pairs v. WT (%)" corresponds to %UU WT . FIG. 6 shows guanine (G) metrics corresponding to wild type isoform 1 of PBGD and 25 sequence optimized PBGD polynucleotides. The column labeled "G Content (%)" corresponds to %G TL . The column labeled "G Content v. WT (%)" corresponds to %G WT . The column labeled "G Content v. Theoretical Maximum (%)" corresponds to %G TMX . FIG. 7 shows cytosine (C) metrics corresponding to wild type isoform 1 of PBGD and 25 sequence optimized PBGD polynucleotides. The column labeled "C Content (%)" corresponds to %C TL . The column labeled "C Content v. WT (%)" corresponds to %C WT . The column labeled "C Content v. Theoretical Maximum (%)" corresponds to %C TMX . FIG. 8 shows guanine plus cytosine (G / C) metrics corresponding to wild type isoform 1 of PBGD and 25 sequence optimized PBGD polynucleotides. The column labeled "G / C Content (%)" corresponds to %G / C TL . The column labeled "G / C Content v. WT (%)" corresponds to %G / C WT . The column labeled "G / C Content v. Theoretical Maximum (%)" corresponds to %G / C TMX . FIG. 9 shows a comparison between the G / C compositional bias for codon positions 1, 2, 3 corresponding to the wild type isoform 1 of PBGD and 25 sequence optimized PBGD polynucleotides. FIG. 10A-Cshows the protein sequence ( FIG. 10A), table with domain features ( FIG. 10B), graphic representation of domain structure ( FIG. 10C) of the I291M / N340S gain of function mutant of isoform 1 of PBGD. FIG. 11 shows the nucleic acid sequence of the I291M / N340S gain of function mutant of isoform 1 of PBGD. FIG. 12A-Dshows the protein sequence ( FIG. 12A), table with domain features ( FIG. 12B), graphic representation of domain structure ( FIG. 12C), and nucleic acid sequence ( FIG. 12D) of a fusion construct comprising the mature form of apolipoprotein A1 (sequence without signal peptide and propeptide) and isoform 1 of PBGD. FIG. 13 shows the levels of hepatic PBGD activity after IV administration of chemically modified mRNAs encoding wild type PBGD (COV1 and COV2), PBGD-SM protein variant, and ApoAI-PBGD-SM conjugate to AIP mice. A single IV dose of mRNA construct at 1 nmol / kg was administered. PBGD activity in liver was quantitated as pmol of uroporphyrin produced per mg of protein per hour. Levels of hepatic PBGD activity observed in wild type mice and AIP mice are also shown for comparison. Data are expressed as mean ± SD. FIG. 14 shows the design of a pharmacodynamics study to evaluate the effects of the administration of a single IV dose of modified mRNA encoding wild type or SM variant of PBGD to AIP mice subjected to three acute porphyria attacks triggered by phenobarbital challenges. Intraperitoneal injections of phenobarbital and intravenous administration of PBGD mRNA are indicated by arrows above the time line of the study. FIG. 15 shows urinary ALA excretion levels (micrograms of ALA per mg of creatinine) in AIP mice subjected to porphyria attacks caused by intraperitoneal phenobarbital challenges. In accordance with the study design shown in FIG. 14, AIP mice were administered a single intravenous injection of a chemically modified mRNA encoding PBGD, SM variant of PBGD, or luciferase, all formulated in MC3 and at 0.5 mg / kg. Data are expressed as mean ± SD. FIG. 16 shows urinary PBG excretion levels (micrograms of PBG per mg of creatinine) in AIP mice subjected to porphyria attacks caused by intraperitoneal phenobarbital challenges. In accordance with the study design shown in FIG. 14, AIP mice were administered a single intravenous injection of a chemically modified mRNA encoding PBGD, SM variant of PBGD, or luciferase, all formulated in MC3 and at 0.5 mg / kg. Data are expressed as mean ± SD. FIG. 17 shows pain measurements in AIP mice subjected to porphyria attacks caused by intraperitoneal phenobarbital challenges. In accordance with the study design shown in FIG. 14, AIP mice were administered a single intravenous injection of a chemically modified mRNA encoding PBGD, SM variant of PBGD, or luciferase, all formulated in MC3 and at 0.5 mg / kg. Pain levels were measured after the first, second, and third phenobarbital challenge (pain scale was measured using the method reported in Langford et al., Nat. Methods. 7(6): 447-9 (2010); Matsumiya et al., J. Am. Assoc. Lab. Anim. Sci. 51(1): 42-9 (2012)). Data are expressed as mean ± SD. FIGS. 18A and 18B present assessments of peripheral neuropathy as determined by rotarod ( FIG. 18A) and footprint measurements (gait patterns) ( FIG. 18B) following a single IV administration of PBGD, SM variant of PBGD, or luciferase mRNA (0.5 mg / kg) according to the study design shown in FIG. 14. Baseline measurements and measurements after each phenobarbital challenge are shown. Data are expressed as mean ± SD. FIGS. 19A, 19B, 19C, 19D and 19E show correction of sciatic nerve dysfunction following a single IV administration of PBGD or SM variant of PBGD mRNA (0.5 mg / kg) compared to luciferase mRNA (0.5 mg / kg) in AIP mice induced by three consecutive phenobarbital challenges according to the study design shown in FIG. 14. FIG. 19A shows sciatic nerve conduction data corresponding to AIP mice administered mRNA encoding luciferase. FIG. 19B and FIG. 19C shows sciatic nerve conduction data corresponding to AIP mice administered modified mRNA encoding wild type PBGD ( FIG. 19B) and modified mRNA encoding PBGD-SM protein variant ( FIG. 19C). FIG. 19D and FIG. 19E, respectively, show latency and amplitude values from sciatic nerve conduction data corresponding to AIP mice administered mRNA encoding luciferase or modified mRNA encoding wild type PBGD or modified mRNA encoding PBGD-SM variant. FIG. 20A, 20B, 20C, 20D, and 20E show hepatic expression of PBGD protein observed after IV administration of modified mRNA encoding wild type PBGD, or an AAV-PBGD vector. FIG. 20A shows hepatic PBGD protein expression after administration of AAV-PBGD. FIG. 20B shows basal PBGD protein expression levels. FIG. 20C, FIG. 20D and FIG. 20E shows hepatic PBGD protein levels on day 1, day 2 and day 4, respectively, after administration of modified mRNA encoding wild type PBGD. FIGS. 21A and FIG. 21B show urinary ALA excretion levels (micrograms of ALA per mg of creatinine) (FIG. 21A) and urinary PBG excretion levels (micrograms of PBG per mg of creatinine) (FIG. 21B) in AIP mice subjected to porphyria attacks caused by intraperitoneal phenobarbital challenges. AIP mice were administered a single intravenous injection of a chemically modified mRNA encoding PBGD or mRNA encoding luciferase. mRNAs were formulated in MC3 or Compound 18 lipid nanoparticles. The mRNA encoding luciferase was administered at 0.5 mg / kg. The mRNA encoding PBGD was administered at 0.5 mg / kg and 0.1 mg / kg. Data are expressed as mean ± SD. FIG. 22A shows pain measurements in AIP mice subjected to porphyria attacks caused by intraperitoneal phenobarbital challenges. Pain levels were measured using a method reported in Langford et al., Nature Methods. 7(6): 447-9 (2010) after the first, second and third phenobarbital challenges. AIP mice were administered a single intravenous injection of a chemically modified mRNA encoding PBGD or mRNA encoding luciferase. mRNAs were formulated in MC3 or Compound 18 lipid nanoparticles. The mRNA encoding luciferase was administered at 0.5 mg / kg. The mRNA encoding PBGD was administered at 0.5 mg / kg and 0.1 mg / kg. Data are expressed as mean ± SD. FIG. 22B shows rotarod measurements in AIP mice subjected to porphyria attacks caused by intraperitoneal phenobarbital challenges. Time spent on rotarod was measured before the phenobarbital challenge as baseline, and after the first, second and third phenobarbital challenges. AIP mice were administered a single intravenous injection of a chemically modified mRNA encoding PBGD or an mRNA encoding luciferase at the beginning of the study (day 1). mRNAs were formulated in MC3 or Compound 18 lipid nanoparticles. The mRNA encoding luciferase was administered at 0.5 mg / kg. The mRNA encoding PBGD was administered at 0.5 mg / kg and 0.1 mg / kg. Data are expressed as mean ± SD. FIGS. 23A-Bshows in vivo hepatic PBGD activity (expressed as nM uroporphyrin 1 concentration) ( FIG. 23A) and in vivo hepatic PBGD protein expression ( FIG. 23B) in wild type CD-1 mice administered modified mRNA constructs encoding wild type PBGD or luciferase as a control. FIG. 24 shows the design of a multi-dose pharmacodynamics / dose-response study to evaluate the effects of the administration of a multiple doses of modified mRNA encoding human wild type PBGD to AIP mice subjected to three acute porphyria attacks triggered by phenobarbital challenges. Intraperitoneal injections of phenobarbital and intravenous administration of PBGD mRNA are indicated by arrows above the time line of the study. During each induced porphyria attack, the AIP mice were administered intravenous injections of a chemically modified mRNA encoding PBGD (Construct #14) formulated in Compound 18 lipid nanoparticles, which was administered at a dose of 0.5 mg / kg, 0.2 mg / kg, or 0.05 mg / kg every other week during each attack. PBS and an mRNA encoding luciferase were used as controls. FIG. 25 shows urinary ALA excretion levels (micrograms of ALA per mg of creatinine) in AIP mice subjected to multiple porphyria attacks induced by intraperitoneal phenobarbital challenges according to the study design shown in FIG. 24. Data are expressed as mean ± SD. FIG. 26 shows urinary PBG excretion levels (micrograms of PBG per mg of creatinine) in AIP mice subjected to multiple porphyria attacks induced by intraperitoneal phenobarbital challenges according to the study design shown in FIG. 24. Data are expressed as mean ± SD. FIG. 27 shows urinary porphyrin excretion levels (micrograms of porphyrin per mg of creatinine) in AIP mice subjected to multiple porphyria attacks induced by intraperitoneal phenobarbital challenges according to the study design shown in FIG. 24. Data are expressed as mean ± SD. FIG. 28 shows pain measurements in AIP mice subjected to multiple porphyria attacks induced by intraperitoneal phenobarbital challenges according to the study design shown in FIG. 24. Pain levels were measured using a method reported in Langford et al., Nature Methods, 7(6): 447-9 (2010) after the first, second and third phenobarbital challenges. Data are expressed as mean ± SD. P-values obtained from repeated measures ANOVA. **p<0.01, ***p<0.001 FIG. 29 present assessments of peripheral neuropathy as determined by rotarod. Measurement at baseline and measurements after each phenobarbital challenge are shown. AIP mice were subjected to three porphyria attacks induced by intraperitoneal phenobarbital challenges according to the study design shown in FIG. 24. The figure also shows data corresponding to untreated wild type animals (WT). Data are expressed as mean with SD. In case of the statistical analysis (see asterisks), data were log transformed prior to repeated measures ANOVA analysis to equalize variances and comparisons between baseline and marks obtained after each induction were made using Bonferroni's multiple comparisons. *p<0.05, **p<0.01, ***p<0.001 FIG. 30 present assessments of peripheral neuropathy as determined by gait pattern analysis. Measurements at baseline and measurements after each phenobarbital challenge are shown. AIP mice were subjected to three porphyria attacks induced by intraperitoneal phenobarbital challenges according to the study design shown in FIG. 24. The figure also shows data corresponding to untreated wild type animals (WT). The stride length was measured in the two hind legs of each of the animals. The bars represent mean with S.D. Data were log transformed prior to repeated measures ANOVA analysis to equalize variances and comparisons between baseline and footprint marks obtained after each induction were made using Bonferroni's multiple comparisons. *p<0.05, **p<0.01, ***p<0.001 FIG. 31 present assessments of sciatic nerve dysfunction due to recurrent acute porphyria attacks in AIP mice induced by phenobarbital challenge according to the study design shown in FIG. 24. Amplitude values from sciatic nerve conduction data correspond to mice under control conditions or after administration of a modified mRNA encoding wild type human PBGD (at doses, e.g., 0.05 mg / kg, 0.2 mg / kg, and 0.5 mg / kg). Control measurements correspond to: AIP mice treated with buffer, AIP mice administered mRNA encoding luciferase, untreated wild type mice, and wild type mice treated with phenobarbital. The bars represent mean with S.D. P-values were obtained from a one-way ANOVA. *p<0.05, ***p<0.001 FIGs. 32A, 32B, and 32C present assessments of serum transaminases and bilirubin levels in AIP mice according to the study design shown in FIG. 24. Each drawing presents measurements from mice under control conditions or after 3 IV administrations of modified mRNA encoding human wild type PBGD (at doses of 0.05 mg / kg, 0.2 mg / kg, and 0.5 mg / kg). Control measurements correspond to: AIP mice treated with buffer, AIP mice treated with mRNA encoding luciferase, untreated wild type mice, and wild type mice treated with phenobarbital. The bars represent mean with S.D. FIG. 32A shows levels of serum ALT transaminase (I.U. / L) at sacrifice. FIG. 32B shows levels of serum AST transaminase (I.U. / L) at sacrifice. FIG. 32C shows serum bilirubin levels (mg / dL). FIGs. 33A, 33B, and 33C show the effect of the administration of a modified mRNA encoding wild type PBGD on AIP urine biomarker levels (ALA, PBG, and porphyrin, respectively) during a porphyria attack triggered by phenobarbital challenges. Each drawing shows results corresponding to AIP mice treated with PBS without phenobarbital, mice treated with mRNA encoding luciferase, and a modified mRNA encoding wild type human PBGD. FIG. 33A shows the effect on urine ALA levels, FIG. 33B shows the effect on urine PBG levels, and FIG. 33C shows the effect on urine porphyrin levels. FIG. 34 shows the pharmacokinetic profile of hepatic PBGD activity in WT CD-1 mice after IV administration of either a control mRNA encoding luciferase, or a modified mRNA encoding human wild type PBGD (0.5 mg / kg). The error bars represent S.D. Hepatic PBGD activity was quantitated based on uroporphyrin levels (nM). Splenic PBGD activity did not differ between mice administered luciferase (vehicle control) mRNA and hPBGD mRNA (data not shown). FIG. 35A shows the decay in hepatic PBGD activity in WT CD-1 mice after IV administration of a modified mRNA encoding human wild type PBGD (0.5 mg / kg). FIG. 35B shows the decay in hepatic PBGD activity in AIP mice after IV administration of a modified mRNA encoding human wild type PBGD. In both cases, the terminal t 1 / 2 of the PBGD activity, determined by noncompartmental analysis, was 8 days. FIG. 36 shows the pharmacokinetic of hepatic human PBGD protein concentration in WT CD-1 mice after IV administration of either a control mRNA encoding luciferase, or a modified mRNA encoding human wild type PBGD (0.5 mg / kg). The error bars represent S.D. Human PBGD protein levels in liver were quantified by LC-MS / MS using a human specific peptide (ASYPGLQFEIIAMSTTGDK; SEQ ID NO: 85). FIG. 37 shows hepatic PBGD activity (measured as uroporphyrin production, nM; left axis) and hPBGD mRNA levels in liver (pg / uL; right axis) in WT CD1 mice administered a single IV bolus of human PBGD mRNA (0.5 mg / kg). FIGs. 38A, 38B, 38C, 38D, 38E, and 38F show hepatic expression of PBGD protein observed in WT CD1 mice after IV administration of modified mRNA encoding human wild type PBGD (0.5 mg / kg). FIG. 38A, 38B, 38C, 38D, and 38E show hepatic PBGD protein levels at 2 hours, 6 hours, 10 hours, 16 hours, and 24 hours, respectively, after administration of modified mRNA encoding human wild type PBGD. FIG. 38F shows basal PBGD protein expression levels detected by Novus anti-PBGD antibody which doesn't cross-react with endogenous mouse PBGD protein. FIG. 39 shows hepatic PBGD activity levels after a single IV administration of 5-methoxyuracil comprising chemically modified mRNAs encoding wild type PBGD to AIP mice. A single IV dose of mRNA construct at 0.2 mg / kg or 0.5 mg / kg was administered. Levels of hepatic PBGD activity observed in wild type mice and AIP mice are also shown for comparison. Data are expressed as mean ± SD. FIGs. 40A and 40B shows a decrease in systolic (FIG. 40A) and diastolic (FIG. 40B) blood pressure in AIP mice administered a single IV injection of human PBGD mRNA (0.5 mg / kg). A porphyric attack was induced in AIP mice by daily intraperitoneal phenobarbital injections. Blood pressure in WT and AIP mice that were not administered phenobarbital are shown as control groups. FIG. 41 shows the hepatic PBGD activity 1 and 2 days after a single IV administration of human PBGD mRNA or luciferase vehicle control mRNA (0.5 mg / kg) to Sprague Dawley rats. Data are presented as mean ± SD. In contrast, PBGD activity levels in spleen did not differ between treatment arms 1-2 days post-injection in these rats. FIG. 42A shows hepatic expression of PBGD protein observed in Sprague Dawley rats at 24 hours after IV administration of modified mRNA encoding human wild type PBGD (1 mg / kg). FIG. 42B shows basal PBGD protein expression levels detected by Novus anti-PBGD antibody which doesn't cross-react with endogenous rat PBGD protein significantly. FIGS. 43A-Bshows in vivo hepatic PBGD activity (expressed as expressed as pmol uroporphyrinogen / mg protein / hour) ( FIG. 43A) and in vivo hepatic PBGD protein expression ( FIG. 43B) in Cynomolgus macaque liver following administration of modified mRNA constructs encoding wild type PBGD. FURTHER DETAILED DESCRIPTION

[0114] The present invention provides mRNA therapeutics for the treatment of acute intermittent porphyria (AIP). Acute intermittent porphyria (AIP) is a genetic metabolic disorder affecting the production of heme, the oxygen-binding prosthetic group of hemoglobin. AIP is caused by mutations in the HMBS gene, which codes for the enzyme porphobilinogen deaminase (PBGD). Without porphobilinogen deaminase (PBGD), a necessary cytoplasmic enzyme, heme synthesis cannot finish, and the metabolite porphobilinogen accumulates in the cytoplasm. mRNA therapeutics are particularly well-suited for the treatment of AIP as the technology provides for the intracellular delivery of mRNA encoding PBGD followed by de novo synthesis of functional PBGD protein within target cells. After delivery of mRNA to the target cells, the desired PBGD protein is expressed by the cells' own translational machinery, and hence, fully functional PBGD protein replaces the defective or missing protein.

[0115] One challenge associated with delivering nucleic acid-based therapeutics (e.g., mRNA therapeutics) in vivo stems from the innate immune response which can occur when the body's immune system encounters foreign nucleic acids. Foreign mRNAs can activate the immune system via recognition through toll-like receptors (TLRs), in particular TLR7 / 8, which is activated by single-stranded RNA (ssRNA). In nonimmune cells, the recognition of foreign mRNA can occur through the retinoic acid-inducible gene I (RIG-I). Immune recognition of foreign mRNAs can result in unwanted cytokine effects including interleukin- 10 (IL-1β) production, tumor necrosis factor-α (TNF-α) distribution and a strong type I interferon (type I IFN) response. The instant disclosure features the incorporation of different modified nucleotides within therapeutic mRNAs to minimize the immune activation and optimize the translation efficiency of mRNA to protein. Particular aspects of the disclosure feature a combination of nucleotide modification to reduce the innate immune response and sequence optimization, in particular, within the open reading frame (ORF) of therapeutic mRNAs encoding PBGD to enhance protein expression.

[0116] Certain embodiments of the mRNA therapeutic technology of the instant invention also feature delivery of mRNA encoding PBGD via a lipid nanoparticle (LNP) delivery system. Lipid nanoparticles (LNPs) are an ideal platform for the safe and effective delivery of mRNAs to target cells. LNPs have the unique ability to deliver nucleic acids by a mechanism involving cellular uptake, intracellular transport and endosomal release or endosomal escape. The instant invention features novel ionizable lipid-based LNPs combined with mRNA encoding PBGD which have improved properties when administered in vivo. Without being bound in theory, it is believed that the novel ionizable lipid-based LNP formulations of the invention have improved properties, for example, cellular uptake, intracellular transport and / or endosomal release or endosomal escape. LNPs administered by systemic route (e.g., intravenous (IV) administration), for example, in a first administration, can accelerate the clearance of subsequently injected LNPs, for example, in further administrations. This phenomenon is known as accelerated blood clearance (ABC) and is a key challenge, in particular, when replacing deficient enzymes (e.g., PBGD) in a therapeutic context. This is because repeat administration of mRNA therapeutics is in most instances essential to maintain necessary levels of enzyme in target tissues in subjects (e.g., subjects suffering from AIP.) Repeat dosing challenges can be addressed on multiple levels. mRNA engineering and / or efficient delivery by LNPs can result in increased levels and or enhanced duration of protein (e.g., PBGD) being expressed following a first dose of administration, which in turn, can lengthen the time between first dose and subsequent dosing. It is known that the ABC phenomenon is, at least in part, transient in nature, with the immune responses underlying ABC resolving after sufficient time following systemic administration. As such, increasing the duration of protein expression and / or activity following systemic delivery of an mRNA therapeutic in one aspect, combats the ABC phenomenon. Moreover, LNPs can be engineered to avoid immune sensing and / or recognition and can thus further avoid ABC upon subsequent or repeat dosing. Exemplary aspect of the disclosure feature novel LNPs which have been engineered to have reduced ABC.1. Porphobilinogen deaminase (PBGD)

[0117] Porphobilinogen deaminase (PBGD; EC 4.3.1.8) is the third enzyme of the biosynthetic pathway leading to the production of heme. It catalyzes the synthesis of hydroxymethylbilane by stepwise condensation of 4 porphobilinogen units. Hydroxymethylbilane is then converted to uroporphyrinogen III by uroporphyrinogen III synthetase. The structure of 40-42 kDa porphobilinogen deaminase, which is highly conserved amongst organisms, consists of three domains. Domains 1 and 2 are structurally very similar: each consisting of five beta-sheets and three alpha helices in humans. Domain 3 is positioned between the other two and has a flattened beta-sheet geometry. A dipyrrole, a cofactor of this enzyme consisting of two condensed porphobilinogen molecules, is covalently attached to domain 3 and extends into the active site, the cleft between domains 1 and 2. Several positively charged arginine residues, positioned to face the active site from domains 1 and 2, have been shown to stabilize the carboxylate functionalities on the incoming porphobilinogen as well as the growing pyrrole chain. These structural features presumably favor the formation of the final hydroxymethylbilane product. Porphobilinogen deaminase usually exists in dimer units in the cytoplasm of the cell.

[0118] The most well-known health issue involving porphobilinogen deaminase is acute intermittent porphyria (AIP), an autosomal dominant genetic disorder where insufficient hydroxymethylbilane is produced, leading to a build-up of porphobilinogen in the cytoplasm as well as elevation in ALA and PBG levels in plasma and urine. This is caused by a gene mutation that, in 90% of cases, causes decreased amounts of enzyme. However, mutations where less-active enzymes and / or different isoforms have been described. See Grandchamp et al. (1989) Nucleic Acids Res. 17:6637-49; and Astrin et al. (1994) Hum. Mut. 4:243-52.

[0119] The coding sequence (CDS) for wild type PBGD canonical mRNA sequence, corresponding to isoform 1, is described at the NCBI Reference Sequence database (RefSeq) under accession number NM_000109.3 ("Homo sapiens hydroxymethylbilane synthase (HBMS), transcript variant 1, mRNA"). The wild type PBGD canonical protein sequence, corresponding to isoform 1, is described at the RefSeq database under accession number NP_000181.2 ("Porphobilinogen deaminase isoform 1 [Homo sapiens]"). The PBGD isoform 1 protein is 361 amino acids long. It is noted that the specific nucleic acid sequences encoding the reference protein sequence in the Ref Seq sequences are the coding sequence (CDS) as indicated in the respective RefSeq database entry.

[0120] Isoforms 2, 3, and 4 are produced by alternative splicing.

[0121] The RefSeq protein and mRNA sequences for isoform 2 of PBGD are NP_001019553.1 and NM_001024382.1, respectively. The RefSeq protein and mRNA sequences for isoform 3 of PBGD are NP_001245137.1 and NM_001258208.1, respectively. The RefSeq protein and mRNA sequences for isoform 4 of PBGD are NP _001245138.1 and NM_001258209.1, respectively. Isoforms 2, 3, and 4 PBGD are encoded by the CDS disclosed in each one of the above mentioned mRNA RefSeq entries.

[0122] The isoform 2 polynucleotide contains an alternate, in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. It encodes a PBGD isoform 2 polypeptide, which has a shorter N-terminus compared to isoform 1. The PBGD isoform 2 protein is 344 amino acids long and lacks the amino acids corresponding to positions 1-17 in isoform 1.

[0123] The isoform 3 polynucleotide lacks an alternate in-frame exon compared to variant 1. The resulting PBGD isoform 3 polypeptide has the same N- and C-termini but is shorter compared to isoform 1. The PBGD isoform 3 protein is 321 amino acids long and lacks the amino acids corresponding to positions 218-257 in isoform 1.

[0124] The isoform 4 polynucleotide uses an alternate splice junction at the 3' end of the first exon and lacks an alternate in-frame exon compared to variant 1. The resulting PBGD isoform 4 polypeptide is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1. The PBGD isoform 4 protein is 304 amino acids long and lacks the amino acids corresponding to positions 1-17 and positions 218-257 in isoform 1.

[0125] The compoaition of the invention provides a polynucleotide ( i.e., a messenger RNA (mRNA)) comprising a nucleotide sequence (i.e., an open reading frame (ORF)) encoding a PBGD polypeptide. In some embodiments of the invention, the PBGD polypeptide is a wild type PBGD isoform 1, 2, 3, or 4 protein. In some embodiments, the PBGD polypeptide is a variant, a peptide or a polypeptide containing a substitution, and insertion and / or an addition, a deletion and / or a covalent modification with respect to a wild-type PBGD isoform 1, 2, 3, or 4 sequence. In some embodiments, sequence tags or amino acids, can be added to the sequences encoded by the polynucleotides (e.g., at the N-terminal or C-terminal ends), e.g., for localization. In some embodiments, amino acid residues located at the carboxy, amino terminal, or internal regions of a polypeptide can optionally be deleted providing for fragments.

[0126] In some embodiments of the invention, the polynucleotide (i.e., an mRNA) comprising a nucleotide sequence (i.e., an ORF) encodes a substitutional variant of a PBGD isoform 1, 2, 3, or 4 sequence, which can comprise one, two, three or more than three substitutions. In some embodiments, the substitutional variant can comprise one or more conservative amino acids substitutions. In other embodiments, the variant is an insertional variant. In other embodiments, the variant is a deletional variant.

[0127] As recognized by those skilled in the art, PBGD isoform 1, 2, 3, or 4 protein fragments, functional protein domains, variants, and homologous proteins (orthologs) are also considered to be within the scope of the PBGD polypeptides. Nonlimiting examples of polypeptides are shown in FIGs. 1 to 4. For example, FIG. 1 shows the amino acid sequence of human PBGD wild type isoform 1.

[0128] Certain compositions and methods presented in this disclosure refer to the protein or polynucleotide sequences of PBGD isoform 1. A person skilled in the art will understand that such disclosures are equally applicable to any other isoforms of PBGD known in the art.2. Polynucleotides and Open Reading Frames (ORFs)

[0129] The composition of the invention features mRNAs for use in treating (i.e., prophylactically and / or therapeutically treating) AIP, as defined in the claims. The mRNAs featured for use in the invention are administered to subjects and encode human porphobilinogen deaminase (PBGD) proteins(s) in vivo. Accordingly, the invention relates to compositions comprising polynucleotides, i.e., mRNA, comprising an open reading frame of linked nucleosides encoding human porphobilinogen deaminase (PBGD), isoforms thereof, functional fragments thereof, and fusion proteins comprising PBGD. In some embodiments, the open reading frame is sequence-optimized. In particular embodiments, the composition of the invention features sequence-optimized polynucleotides comprising nucleotides encoding the polypeptide sequence of isoforms 1, 2, 3 or 4 of human PBGD, or sequence having high sequence identity with those sequence optimized polynucleotides.

[0130] In certain aspects, the composition of the invention provides polynucleotides (i.e., an mRNA) that comprise a nucleotide sequence (i.e., an ORF) encoding one or more PBGD polypeptides. In some embodiments of the invention, the encoded PBGD polypeptide can be selected from: (i) a full length PBGD polypeptide (e.g., having the same or essentially the same length as wild-type PBGD isoform 1, 2, 3 or 4); (ii) a functional fragment of any of the PBGD isoforms described herein (e.g., a truncated (e.g., deletion of carboxy, amino terminal, or internal regions) sequence shorter than one of wild-type isoforms 1, 2, 3 or 4; but still retaining PBGD enzymatic activity); (iii) a variant thereof, e.g., full length or truncated isoform 1, 2, 3, or 4 protein in which one or more amino acids have been replaced, e.g., variants that retain all or most of the PBGD activity of the polypeptide with respect to a reference isoform (such as, e.g., T59I, D178N, or any other natural or artificial variants known in the art, or a variant comprising the I291M and N340S mutations); or (iv) a fusion protein comprising (i) a full length PBGD isoform 1, 2, 3, or 4 protein, a functional fragment or a variant thereof, and (ii) at least one heterologous protein (e.g., Apolipoprotein A1).

[0131] In certain embodiments, the encoded PBGD polypeptide is a mammalian PBGD polypeptide, such as a human PBGD polypeptide, a functional fragment or a variant thereof.

[0132] In some embodiments, the polynucleotide (i.e., an mRNA) increases PBGD protein expression levels and / or detectable PBGD enzymatic activity levels in cells when introduced in those cells, e.g., by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%, compared to PBGD protein expression levels and / or detectable PBGD enzymatic activity levels in the cells prior to the administration of the polynucleotide. PBGD protein expression levels and / or PBGD enzymatic activity can be measured according to methods know in the art. In some embodiments, the polynucleotide is introduced to the cells in vitro. In some embodiments, the polynucleotide is introduced to the cells in vivo.

[0133] In some embodiments, the polynucleotides (i.e., an mRNA) comprise a nucleotide sequence (i.e., an ORF) that encodes a wild-type human PBGD, e.g., wild-type isoform 1 of human PBGD (SEQ ID NO: 1, see FIG. 1), wild-type isoform 2 of human PBGD (SEQ ID NO: 3, see FIG. 2), wild-type isoform 3 of human PBGD (SEQ ID NO: 5, see FIG. 3), or wild-type isoform 4 of human PBGD (SEQ ID NO: 7, see FIG. 4).

[0134] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a sequence optimized nucleic acid sequence, wherein the open reading frame (ORF) of the sequence optimized nucleic acid sequence is derived from a wild-type PBGD sequence (e.g., wild-type isoforms 1, 2, 3 or 4). For example, for polynucleotides comprising a sequence optimized ORF encoding PBGD isoform 2, the corresponding wild type sequence is the native PBGD isoform 2. Similarly, for a sequence optimized mRNA encoding a functional fragment of isoform 1, the corresponding wild type sequence is the corresponding fragment from PBGD isoform 1.

[0135] In some embodiments, the polynucleotides (ei.e., an mRNA) comprise a nucleotide sequence encoding PBGD isoform 1 having the full length sequence of human PBGD isoform 1 (i.e., including the initiator methionine). In mature human PBGD isoform 1, the initiator methionine can be removed to yield a "mature PBGD" comprising amino acid residues of 2-361 of the translated product. The teachings of the present disclosure directed to the full sequence of human PBGD (amino acids 1-361) are also applicable to the mature form of human PBGD lacking the initiator methionine (amino acids 2-361). Thus, in some embodiments, the polynucleotides (i.e., an mRNA) comprise a nucleotide sequence encoding PBGD isoform 1 having the mature sequence of human PBGD isoform 1 (i.e., lacking the initiator methionine). In some embodiments, the polynucleotide (e.i.e., an mRNA) comprising a nucleotide sequence encoding PBGD isoform 1 having the full length or mature sequence of human PBGD isoform 1 is sequence optimized.

[0136] In some embodiments, the polynucleotides (i.e., an mRNA) comprise a nucleotide sequence (e.g., an ORF) encoding a mutant PBGD polypeptide, e.g., a double mutant I291M / N340S PBGD. The protein (SEQ ID NO: 152) and polynucleotide (SEQ ID NO: 153) of double mutant I291M / N340S human PBGD isoform 1 ("SM PBGD") are shown in FIG. 10A and FIG. 11. In some embodiments, the polynucleotides comprise an ORF encoding a PBGD polypeptide that comprises at least one point mutation in the PBGD sequence and retains PBGD enzymatic activity. In some embodiments, the mutant PBGD polypeptide has a PBGD activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the PBGD activity of the corresponding wild-type PBGD (i.e., the same PBGD isoform but without the mutation(s)). In some embodiments, the polynucleotide (i.e., an mRNA) comprising an ORF encoding a mutant PBGD polypeptide is sequence optimized.

[0137] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) that encodes a PBGD polypeptide with mutations that do not alter PBGD enzymatic activity. Such mutant PBGD polypeptides can be referred to as function-neutral. In some embodiments, the polynucleotide comprises an ORF that encodes a mutant PBGD polypeptide comprising one or more function-neutral point mutations.

[0138] In some embodiments, the mutant PBGD polypeptide has higher PBGD enzymatic activity than the corresponding wild-type PBGD. In some embodiments, the mutant PBGD polypeptide has a PBGD activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than the activity of the corresponding wild-type PBGD (i.e., the same PBGD isoform but without the mutation(s)).

[0139] In some embodiments, the polynucleotides (i.e., an mRNA) comprise a nucleotide sequence (i.e., an ORF) encoding a functional PBGD fragment, e.g., where one or more fragments correspond to a polypeptide subsequence of a wild type PBGD polypeptide and retain PBGD enzymatic activity. In some embodiments, the PBGD fragment has a PBGD activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the PBGD activity of the corresponding full length PBGD. In some embodiments, the polynucleotide (i.e., an mRNA) of the invention comprising an ORF encoding a functional PBGD fragment is sequence optimized.

[0140] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD fragment that has higher PBGD enzymatic activity than the corresponding full length PBGD. Thus, in some embodiments the PBGD fragment has a PBGD activity which is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than the PBGD activity of the corresponding full length PBGD.

[0141] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD fragment that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25% shorter than wild-type isoform 1, 2, 3, or 4 of PBGD.

[0142] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the nucleotide sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence of SEQ ID NO:2, 4, 6 or 8 (see, e.g., panel D in FIGs. 1, 2, 3 and 4, respectively).

[0143] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 33, and 89 to 117. See TABLE 2.

[0144] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the nucleotide sequence has 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 70% to 95%, 80% to 95%, 70% to 85%, 75% to 90%, 80% to 95%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 33, and 89 to 117. See TABLE 2.

[0145] In some embodiments, the polynucleotide (i.e., an mRNA) comprises an ORF encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the polynucleotide comprises a nucleic acid sequence having 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 70% to 95%, 80% to 95%, 70% to 85%, 75% to 90%, 80% to 95%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 118-148. See TABLE 5.

[0146] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the nucleotide sequence is at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence of SEQ ID NO:2, 4, 6 or 8 (see, e.g., panel D FIGs. 1, 2, 3 and 4, respectively).

[0147] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the nucleotide sequence is between 70% and 90% identical; between 75% and 85% identical; between 76% and 84% identical; between 77% and 83% identical, between 77% and 82% identical, or between 78% and 81% identical to the sequence of SEQ ID NO:2, 4, 6 or 8 (see, e.g., panel D in FIGs. 1, 2, 3, and 4, respectively).

[0148] In some embodiments, the polynucleotide (i.e., an mRNA) comprises from about 900 to about 100,000 nucleotides (e.g., from 900 to 1,000, from 900 to 1,100, from 900 to 1,200, from 900 to 1,300, from 900 to 1,400, from 900 to 1,500, from 1,000 to 1,100, from 1,000 to 1,100, from 1,000 to 1,200, from 1,000 to 1,300, from 1,000 to 1,400, from 1,000 to 1,500, from 1,083 to 1,200, from 1,083 to 1,400, from 1,083 to 1,600, from 1,083 to 1,800, from 1,083 to 2,000, from 1,083 to 3,000, from 1,083 to 5,000, from 1,083 to 7,000, from 1,083 to 10,000, from 1,083 to 25,000, from 1,083 to 50,000, from 1,083 to 70,000, or from 1,083 to 100,000).

[0149] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the length of the nucleotide sequence (e.g., an ORF) is at least 500 nucleotides in length (e.g., at least or greater than about 500, 600, 700, 80, 900, 1,000, 1,050, 1,083, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700, 2,800, 2,900, 3,000, 3,100, 3,200, 3,300, 3,400, 3,500, 3,600, 3,700, 3,800, 3,900, 4,000, 4,100, 4,200, 4,300, 4,400, 4,500, 4,600, 4,700, 4,800, 4,900, 5,000, 5,100, 5,200, 5,300, 5,400, 5,500, 5,600, 5,700, 5,800, 5,900, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides).

[0150] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), and further comprises at least one nucleic acid sequence that is noncoding, e.g., a miRNA binding site. In some embodiments, the polynucleotide (i.e., an mRNA) of the invention further comprises a 5'-UTR (e.g., selected from the sequences of SEQ ID NOs: 39 to 56, 83, 189 to 191) and a 3'UTR (e.g., selected from the sequences of SEQ ID NOs: 57 to 81, 84, 149 to 151, 161 to 172, 192 to 199). In some embodiments, the polynucleotide (i.e., an mRNA) of the invention comprises a sequence selected from the group consisting of SEQ ID NO: 118-148, e.g., SEQ ID NO: 133, 141, 144 or 145. In a further embodiment, the polynucleotide (i.e., an mRNA) comprises a 5' terminal cap (e.g., Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5' methylG cap, or an analog thereof) and a poly-A-tail region (e.g., about 100 nucleotides in length). In a further embodiment, the polynucleotide (i.e., an mRNA) comprises a 3' UTR comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 149 to 151, or any combination thereof. In a further embodiment, the polynucleotide (i.e., an mRNA) comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 150. In a further embodiment, the polynucleotide (i.e., an mRNA) comprises a 3' UTR comprising a nucleic acid sequence of SEQ ID NO: 151.

[0151] In some embodiments, the polynucleotide (i.e., an mRNA) comprising a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide is single stranded or double stranded.

[0152] The polynucleotide comprising a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof) is messenger RNA (mRNA). In some embodiments, the mRNA comprises a nucleotide sequence (i.e., an ORF) that encodes at least one PBGD polypeptide, and is capable of being translated to produce the encoded PBGD polypeptide in vitro, in vivo, in situ, or ex vivo.

[0153] In some embodiments, the polynucleotide of the invention (i.e., an mRNA) comprises a sequence-optimized nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof), wherein the polynucleotide comprises at least one chemically modified nucleobase, e.g., 5-methoxyuracil. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-142 and / or a miRNA binding site that binds to miR-126. In the composition of the invention, the polynucleotide (i.e., an mRNA) defined in the claims is formulated with a delivery agent comprisinga compound having the Formula IId, IIa, IIb, IIc, or IIe as defined in the claims, e.g., Compound 18. In some embodiments, the delivery agent comprises Compound 18, DSPC, Cholesterol, and Compound 428, e.g., with a mole ratio of about 50:10:38.5:1.5.3. Signal Sequences

[0154] The polynucleotides (i.e., an mRNA) can also comprise nucleotide sequences that encode additional features that facilitate trafficking of the encoded polypeptides to therapeutically relevant sites. One such feature that aids in protein trafficking is the signal sequence, or targeting sequence. The peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides. In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes a PBGD polypeptide described herein.

[0155] In some embodiments, the "signal sequence" or "signal peptide" is a polynucleotide or polypeptide, respectively, which is from about 9 to 200 nucleotides (3-70 amino acids) in length that, optionally, is incorporated at the 5' (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site.

[0156] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a PBGD polypeptide, wherein the nucleotide sequence further comprises a 5' nucleic acid sequence encoding a heterologous signal peptide.4. Fusion Proteins

[0157] In some embodiments, the polynucleotide (i.e., an mRNA) can comprise more than one nucleic acid sequence i.e., an ORF) encoding a polypeptide of interest. In some embodiments, polynucleotides comprise a single ORF encoding a PBGD polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide can comprise more than one ORF, for example, a first ORF encoding a PBGD polypeptide (a first polypeptide of interest), a functional fragment, or a variant thereof, and a second ORF expressing a second polypeptide of interest. In some embodiments, two or more polypeptides of interest can be genetically fused, i.e., two or more polypeptides can be encoded by the same ORF. In some embodiments, the polynucleotide can comprise a nucleic acid sequence encoding a linker (e.g., a G 4 S peptide linker or another linker known in the art) between two or more polypeptides of interest.

[0158] In some embodiments, a polynucleotide (i.e., an mRNA) can comprise two, three, four, or more ORFs, each expressing a polypeptide of interest.

[0159] In some embodiments, the polynucleotide (i.e., an mRNA) can comprise a first nucleic acid sequence (e.g., a first ORF) encoding a PBGD polypeptide and a second nucleic acid sequence (e.g., a second ORF) encoding a second polypeptide of interest.

[0160] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a nucleic acid encoding a PBGD fusion protein, wherein said fusion protein comprises an apolipoprotein A1 fused to PBGD. In a particular embodiment, the apolipoprotein A1 (ApoA1) fusion component is a mature form of human apolipoprotein A1 without the native signal peptide and propeptide sequence. See FIGs. 12A-D. In a particular embodiment, the ApoA1-PBGD fusion protein comprises, consists, or consists essentially of the sequence of SEQ ID NO: 154 (see FIG. 12A). In a particular embodiment, the polypeptide is encoded by a nucleic acid sequence encoding an ApoA1-PBGD fusion protein, wherein said nucleic acid comprises, consists, or consists essentially of the sequence of SEQ ID NO: 155 (see FIG. 12D).

[0161] In some embodiments, a polynucleotide can comprise a portion encoding PBGD (e.g., a wild type PBGD or a variant such as the SM gain of function variant), and, in some embodiments, an ApoA1 component. For example, the polynucleotides (i.e., mRNA) can comprise, for example, polynucleotides encoding (i) human PBGD isoform 1 (human housekeeping PBGD), (ii) human PBGD isoform 2 (human erythroid-specific PBGD), (iii) SM variant (I291M and N340S double mutant) of PBGD1, (iv) SM variant of PBGD2, (v) human apolipoprotein A1 fused to human PBGD1, (vi) human apolipoprotein A1 fused to PBGD2, (vii) human apolipoprotein A1 fused to SM variant of PBGD1, (viii) human apolipoprotein A1 fused to SM variant of PBGD2, or (ix) combinations thereof. In some embodiments, the polynucleotides have been sequence optimized (e.g., see TABLE 2 and the sequences disclosed in International Publication WO2010 / 036118).5. Sequence Optimization of Nucleotide Sequence Encoding a PBGD Polypeptide

[0162] In some embodiments, the polynucleotide (i.e., an mRNA) of the invention is sequence optimized. In some embodiments, the polynucleotide (i.e., an mRNA) of the invention comprises a nucleotide sequence i.e., an ORF) encoding a PBGD polypeptide, a nucleotide sequence (i.e., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, a miRNA, a nucleotide sequence encoding a linker, or any combination thereof, that is sequence optimized.

[0163] A sequence optimized nucleotide sequence, e.g., a codon optimized mRNA sequence encoding a PBGD polypeptide, is a sequence comprising at least one synonymous nucleobase substitution with respect to a reference sequence (e.g., a wild type nucleotide sequence encoding a PBGD polypeptide).

[0164] A sequence optimized nucleotide sequence can be partially or completely different in sequence from the reference sequence. For example, a reference sequence encoding polyserine uniformly encoded by TCT codons can be sequence optimized by having 100% of its nucleobases substituted (for each codon, T in position 1 replaced by A, C in position 2 replaced by G, and T in position 3 replaced by C) to yield a sequence encoding polyserine which would be uniformly encoded by AGC codons. The percentage of sequence identity obtained from a global pairwise alignment between the reference polyserine nucleic acid sequence and the sequence optimized polyserine nucleic acid sequence would be 0%. However, the protein products from both sequences would be 100% identical.

[0165] Some sequence optimization (also sometimes referred to codon optimization) methods are known in the art (and discussed in more detail below) and can be useful to achieve one or more desired results. These results can include, e.g., matching codon frequencies in certain tissue targets and / or host organisms to ensure proper folding; biasing G / C content to increase mRNA stability or reduce secondary structures; minimizing tandem repeat codons or base runs that can impair gene construction or expression; customizing transcriptional and translational control regions; inserting or removing protein trafficking sequences; removing / adding post translation modification sites in an encoded protein (e.g., glycosylation sites); adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translational rates to allow the various domains of the protein to fold properly; and / or reducing or eliminating problem secondary structures within the polynucleotide. Sequence optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods.

[0166] Codon options for each amino acid are given in TABLE 1. TABLE 1. Codon OptionsAmino AcidSingle Letter CodeCodon OptionsIsoleucineIATT, ATC, ATALeucineLCTT, CTC, CTA, CTG, TTA, TTGValineVGTT, GTC, GTA, GTGPhenylalanineFTTT, TTCMethionineMATGCysteineCTGT, TGCAlanineAGCT, GCC, GCA, GCGGlycineGGGT, GGC, GGA, GGGProlinePCCT, CCC, CCA, CCGThreonineTACT, ACC, ACA, ACGSerineSTCT, TCC, TCA, TCG, AGT, AGCTyrosineYTAT, TACTryptophanWTGGGlutamineQCAA, CAGAsparagineNAAT, AACHistidineHCAT, CACGlutamic acidEGAA, GAGAspartic acidDGAT, GACLysineKAAA, AAGArginineRCGT, CGC, CGA, CGG, AGA, AGGSelenocysteineSeeUGA in mRNA in presence of Selenocysteine insertion element (SECIS)Stop codonsStopTAA, TAG, TGA

[0167] In some embodiments, a polynucleotide (i.e., an mRNA) comprises a sequence-optimized nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide, a functional fragment, or a variant thereof, wherein the PBGD polypeptide, functional fragment, or a variant thereof encoded by the sequence-optimized nucleotide sequence has improved properties (e.g., compared to a PBGD polypeptide, functional fragment, or a variant thereof encoded by a reference nucleotide sequence that is not sequence optimized), e.g., improved properties related to expression efficacy after administration in vivo. Such properties include, but are not limited to, improving nucleic acid stability (e.g., mRNA stability), increasing translation efficacy in the target tissue, reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and / or decreasing protein aggregation.

[0168] In some embodiments, the sequence optimized nucleotide sequence is codon optimized for expression in human subjects, having structural and / or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and / or protein concentrations; optimizing protein localization; and avoiding deleterious bio-responses such as the immune response and / or degradation pathways.

[0169] In some embodiments, the polynucleotides comprise a nucleotide sequence (i.e., an ORF) encoding a PBGD polypeptide, a nucleotide sequence (i.e., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, a microRNA binding site, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence-optimized according to a method comprising: (i) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a PBGD polypeptide) with an alternative codon to increase or decrease uridine content to generate a uridine-modified sequence; (ii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a PBGD polypeptide) with an alternative codon having a higher codon frequency in the synonymous codon set; (iii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a PBGD polypeptide) with an alternative codon to increase G / C content; or (iv) a combination thereof.

[0170] In some embodiments, the sequence optimized nucleotide sequence (i.e., an ORF encoding a PBGD polypeptide) has at least one improved property with respect to the reference nucleotide sequence.

[0171] In some embodiments, the sequence optimization method is multiparametric and comprises one, two, three, four, or more methods disclosed herein and / or other optimization methods known in the art.

[0172] Features, which can be considered beneficial in some embodiments of the invention, can be encoded by or within regions of the polynucleotide and such regions can be upstream (5') to, downstream (3') to, or within the region that encodes the PBGD polypeptide. These regions can be incorporated into the polynucleotide before and / or after sequence-optimization of the protein encoding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, poly-A tail, and detectable tags and can include multiple cloning sites that can have XbaI recognition.

[0173] In some embodiments, the polynucleotide comprises a 5' UTR, a 3' UTR and / or a miRNA binding site. In some embodiments, the polynucleotide comprises two or more 5' UTRs and / or 3' UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more miRNA, which can be the same or different sequences. Any portion of the 5' UTR, 3' UTR, and / or miRNA binding site, including none, can be sequence-optimized and can independently contain one or more different structural or chemical modifications, before and / or after sequence optimization.

[0174] In some embodiments, after optimization, the polynucleotide is reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes. For example, the optimized polynucleotide can be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.6. Sequence-Optimized Nucleotide Sequences Encoding PBGD Polypeptides

[0175] In some embodiments, the polynucleotide comprises a sequence optimized nucleotide sequence encoding a PBGD polypeptide disclosed herein. In some embodiments, the polynucleotide comprises an open reading frame (ORF) encoding a PBGD polypeptide, wherein the ORF has been sequence optimized.

[0176] Exemplary sequence optimized nucleotide sequences encoding human PBGD isoform 1 are set forth as SEQ ID Nos: 9-33 (PBGD-CO01, PBGD-CO02, PBGD-CO03, PBGD-CO04, PBGD-CO05, PBGD-CO06, PBGD-CO07, PBGD-CO08, PBGD-CO09, PBGD-CO10, PBGD-CO11, PBGD-CO12, PBGD-CO13, PBGD-CO14, PBGD-CO15, PBGD-CO16, PBGD-CO17, PBGD-CO18, PBGD-CO19, PBGD-CO20, PBGD-CO21, PBGD-CO22, PBGD-CO23, PBGD-CO24, and PBGD-CO25, respectively. Further exemplary sequence optimized nucleotide sequences encoding human PBGD isoform 1 are shown in TABLE 2. In some embodiments, the sequence optimized PBGD sequences set forth as SEQ ID Nos: 9-33 or shown in TABLE 2, fragments, and variants thereof are used to practice the methods disclosed herein. In some embodiments, the sequence optimized PBGD sequences set forth as SEQ ID Nos: 9-33 or shown in TABLE 2, fragments and variants thereof are combined with or alternatives to the wild-type sequences disclosed in FIGs. 1-4

[0177] Exemplary sequence optimized nucleotide sequences encoding human PBGD isoform 1 are set forth as SEQ ID Nos: 89 to 117 (PBGD-CO30, PBGD-CO31, PBGD-CO32, PBGD-CO33, PBGD-CO34, PBGD-CO35, PBGD-CO36, PBGD-CO37, PBGD-CO38, PBGD-CO39, PBGD-CO40A, PBGD-CO41A, PBGD-CO42A, PBGD-CO43A, PBGD-CO44A, PBGD-CO45A, PBGD-CO46A, PBGD-CO47A, PBGD-CO40B, PBGD-CO41B, PBGD-CO42B, PBGD-CO43B, PBGD-CO44B, PBGD-CO45B, PBGD-CO46B, PBGD-CO47B, PBGD-CO48, PBGD-CO49, PBGD-CO50, respectively). Further exemplary sequence optimized nucleotide sequences encoding human PBGD isoform 1 are shown in TABLE 2. In some embodiments, the sequence optimized PBGD sequences set forth as SEQ ID Nos: 89 to 117, or shown in TABLE 2, fragments, and variants thereof are used to practice the methods disclosed herein. In some embodiments, the sequence optimized PBGD sequences set forth as SEQ ID Nos: 89 to 117, or shown in TABLE 2, fragments and variants thereof are combined with or alternatives to the wild-type sequences disclosed in FIGs. 1-4.

[0178] In some embodiments, an mRNA nucleotide sequence encoding a PBGD polypeptide, comprises from 5' to 3' end: (i) a 5' cap provided herein, for example, CAP1; (ii) a 5' UTR, such as the sequences provided herein, for example, SEQ ID NO: 39; (iii) an open reading frame encoding a PBGD polypeptide, e.g., a sequence optimized nucleic acid sequence encoding PBGD set forth as SEQ ID Nos: 9 to 33 and 89 to 117, or shown in TABLE 2; (iv) at least one stop codon; (v) a 3' UTR, such as the sequences provided herein, for example, SEQ ID NOs 149 to 151; and (vi) a poly-A tail provided above. TABLE 2: Sequence optimized sequences for human PBGD, isoform 1 SEQ ID NONameSequence9PBGD-CO01See Sequence Listing10PBGD-CO02See Sequence Listing11PBGD-CO03See Sequence Listing12PBGD-CO04See Sequence Listing13PBGD-CO05See Sequence Listing14PBGD-CO06See Sequence Listing15PBGD-CO07See Sequence Listing16PBGD-CO08See Sequence Listing17PBGD-CO09See Sequence Listing18PBGD-CO10See Sequence Listing19PBGD-CO11See Sequence Listing20PBGD-CO12See Sequence Listing21PBGD-CO13See Sequence Listing22PBGD-CO14See Sequence Listing23PBGD-CO15See Sequence Listing24PBGD-CO16See Sequence Listing25PBGD-CO17See Sequence Listing26PBGD-CO18See Sequence Listing27PBGD-CO19See Sequence Listing28PBGD-CO20See Sequence Listing29PBGD-CO21See Sequence Listing30PBGD-CO22See Sequence Listing31PBGD-CO23See Sequence Listing32PBGD-CO24See Sequence Listing33PBGD-CO25See Sequence Listing89PBGD-CO3090PBGD-CO3191PBGD-CO3292PBGD-CO3393PBGD-CO3494PBGD-CO3595PBGD-CO3696PBGD-CO3797PBGD-CO3898PBGD-CO30999PBGD-CO40A100PBGD-CO41A101PBGD-CO42A102PBGD-CO43A103PBGD-CO44A104PBGD-CO45A105PBGD-CO46A106PBGD-CO47A107PBGD-CO40B108PBGD-CO41B109PBGD-CO42B110PBGD-CO43B111PBGD-CO44B112PBGD-CO45B113PBGD-CO46B114PBGD-CO47B115PBGD-CO48116PBGD-CO49117PBGD-CO50

[0179] The sequence optimized nucleotide sequences disclosed herein are distinct from the corresponding wild type nucleotide acid sequences and from other known sequence optimized nucleotide sequences, e.g., these sequence optimized nucleic acids have unique compositional characteristics.

[0180] In some embodiments, the percentage of uracil or thymine nucleobases in a sequence optimized nucleotide sequence (e.g., encoding a PBGD polypeptide, a functional fragment, or a variant thereof) is modified (e.g., reduced) with respect to the percentage of uracil or thymine nucleobases in the reference wild-type nucleotide sequence. Such a sequence is referred to as a uracil-modified or thymine-modified sequence. The percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in a sequence by the total number of nucleotides and multiplying by 100. In some embodiments, the sequence optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence. In some embodiments, the uracil or thymine content in a sequence-optimized nucleotide sequence is greater than the uracil or thymine content in the reference wild-type sequence and still maintain beneficial effects, e.g., increased expression and / or reduced Toll-Like Receptor (TLR) response when compared to the reference wild-type sequence.

[0181] The uracil or thymine content of wild-type PBGD isoform 1 is about 20%. In some embodiments, the uracil or thymine content of a uracil- or thymine- modified sequence encoding a PBGD polypeptide is less than 20%. In some embodiments, the uracil or thymine content of a uracil- or thymine-modified sequence encoding a PBGD polypeptide is less than 19%, less that 18%, less than 17%, less than 16%, less than 15%, less than 14%, less than 13%, less than 12%, less than 11%, or less than 10%. In some embodiments, the uracil or thymine content is not less than 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10%. The uracil or thymine content of a sequence disclosed herein, i.e., its total uracil or thymine content is abbreviated herein as %U TL or %T TL .

[0182] A uracil- or thymine-modified sequence encoding a PBGD polypeptide can also be described according to its uracil or thymine content relative to the uracil or thymine content in the corresponding wild-type nucleic acid sequence (%U WT or %T WT ), or according to its uracil or thymine content relative to the theoretical minimum uracil or thymine content of a nucleic acid encoding the wild-type protein sequence (%U TM or (%T TM ).

[0183] The phrases "uracil or thymine content relative to the uracil or thymine content in the wild type nucleic acid sequence," refers to a parameter determined by dividing the number of uracils or thymines in a sequence-optimized nucleic acid by the total number of uracils or thymines in the corresponding wild-type nucleic acid sequence and multiplying by 100. This parameter is abbreviated herein as %U WT or %Twr.

[0184] In some embodiments, the %U WT or %T WT of a uracil- or thymine-modified sequence encoding a PBGD polypeptide is above 50%, above 55%, above 60%, above 65%, above 70%, above 75%, above 80%, above 85%, above 90%, or above 95%.

[0185] Uracil- or thymine- content relative to the uracil or thymine theoretical minimum, refers to a parameter determined by dividing the number of uracils or thymines in a sequence-optimized nucleotide sequence by the total number of uracils or thymines in a hypothetical nucleotide sequence in which all the codons in the hypothetical sequence are replaced with synonymous codons having the lowest possible uracil or thymine content and multiplying by 100. This parameter is abbreviated herein as %U TM or %T TM .

[0186] For DNA it is recognized that thymine is present instead of uracil, and one would substitute T where U appears. Thus, all the disclosures related to, e.g., %U TM , %U WT , or %U TL , with respect to RNA are equally applicable to %T TM , %T WT , or %T TL with respect to DNA.

[0187] In some embodiments, the %U TM of a uracil-modified sequence encoding a PBGD polypeptide is between about 118% and about 132%.

[0188] In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide has a reduced number of consecutive uracils with respect to the corresponding wild-type nucleic acid sequence. For example, two consecutive leucines can be encoded by the sequence CUUUUG, which includes a four uracil cluster. Such a subsequence can be substituted, e.g., with CUGCUC, which removes the uracil cluster.

[0189] Phenylalanine can be encoded by UUC or UUU. Thus, even if phenylalanines encoded by UUU are replaced by UUC, the synonymous codon still contains a uracil pair (UU). Accordingly, the number of phenylalanines in a sequence establishes a minimum number of uracil pairs (UU) that cannot be eliminated without altering the number of phenylalanines in the encoded polypeptide. For example, if the polypeptide (e.g., wild type PBGD isoform 1) has, e.g., 7, 8, or 9 phenylalanines, the absolute minimum number of uracil pairs (UU) in that a uracil-modified sequence encoding the polypeptide (e.g., wild type PBGD isoform 1) can contain is 7, 8, or 9, respectively.

[0190] Wild type PBGD isoform 1 contains 32 uracil pairs (UU), and four uracil triplets (UUU). In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide has a reduced number of uracil triplets (UUU) with respect to the wild-type nucleic acid sequence. In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide contains 4, 3, 2, 1 or no uracil triplets (UUU).

[0191] In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide has a reduced number of uracil pairs (UU) with respect to the number of uracil pairs (UU) in the wild-type nucleic acid sequence. In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide has a number of uracil pairs (UU) corresponding to the minimum possible number of uracil pairs (UU) in the wild-type nucleic acid sequence, e.g., 9 uracil pairs in the case of wild type PBGD isoform 1.

[0192] In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 24 uracil pairs (UU) less than the number of uracil pairs (UU) in the wild-type nucleic acid sequence. In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide of the invention has between 8 and 16 uracil pairs (UU).

[0193] The phrase "uracil pairs (UU) relative to the uracil pairs (UU) in the wild type nucleic acid sequence," refers to a parameter determined by dividing the number of uracil pairs (UU) in a sequence-optimized nucleotide sequence by the total number of uracil pairs (UU) in the corresponding wild-type nucleotide sequence and multiplying by 100. This parameter is abbreviated herein as %UU wt .

[0194] In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide has a %UU wt less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 65%, less than 60%, less than 55%, less than 50%, less than 40%, less than 30%, or less than 20%.

[0195] In some embodiments, a uracil-modified sequence encoding a PBGD polypeptide has a %UU wt between 20% and 55%. In a particular embodiment, a uracil-modified sequence encoding a PBGD polypeptide has a %UU wt between 25% and 55%.

[0196] In some embodiments, the polynucleotide comprises a uracil-modified sequence encoding a PBGD polypeptide disclosed herein. In some embodiments, the uracil-modified sequence encoding a PBGD polypeptide comprises at least one chemically modified nucleobase, e.g., 5-methoxyuracil. In some embodiments, at least 95% of a nucleobase (e.g., uracil) in a uracil-modified sequence encoding a PBGD polypeptide are modified nucleobases. In some embodiments, at least 95% of uracil in a uracil-modified sequence encoding a PBGD polypeptide is 5-methoxyuracil. In some embodiments, the polynucleotide comprising a uracil-modified sequence further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-142 and / or a miRNA binding site that binds to miR-126. In the composition of the invention, the polynucleotide (i.e., an mRNA) can comprise a uracil-modified sequence disclosed herein, formulated with a delivery agent comprising a compound having the Formula IId, IIa, IIb, IIc or IIe as defined in the claims, e.g., Compound 18. In some embodiments, the delivery agent comprises Compound 18, DSPC, Cholesterol, and Compound 428, e.g., with a mole ratio of about 50:10:38.5:1.5.

[0197] In some embodiments, the "guanine content of the sequence optimized ORF encoding PBGD with respect to the theoretical maximum guanine content of a nucleotide sequence encoding the PBGD polypeptide," abbreviated as %G TMX is at least 69%, at least 70%, at least 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%. In some embodiments, the %G TMX is between about 70% and about 80%, between about 71% and about 79%, between about 71% and about 78%, or between about 71% and about 77%.

[0198] In some embodiments, the "cytosine content of the ORF relative to the theoretical maximum cytosine content of a nucleotide sequence encoding the PBGD polypeptide," abbreviated as %C TMX , is at least 59%, at least 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%. In some embodiments, the %C TMX is between about 60% and about 80%, between about 62% and about 80%, between about 63% and about 79%, or between about 68% and about 76%.

[0199] In some embodiments, the "guanine and cytosine content (G / C) of the ORF relative to the theoretical maximum G / C content in a nucleotide sequence encoding the PBGD polypeptide," abbreviated as %G / C TMX is at least about 81%, at least about 85%, at least about 90%, at least about 95%, or about 100%. The %G / C TMX is between about 80% and about 100%, between about 85% and about 99%, between about 90% and about 97%, or between about 91% and about 96%.

[0200] In some embodiments, the "G / C content in the ORF relative to the G / C content in the corresponding wild-type ORF," abbreviated as %G / C WT is at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 110%, at least 115%, or at least 120%.

[0201] In some embodiments, the average G / C content in the 3rd codon position in the ORF is at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, or at least 30% higher than the average G / C content in the 3rd codon position in the corresponding wild-type ORF.

[0202] In some embodiments, the polynucleotide comprises an open reading frame (ORF) encoding a PBGD polypeptide, wherein the ORF has been sequence optimized, and wherein each of %U TL , %U WT , %U TM , %G TL , %G WT , %G TMX , %C TL , %C WT , %C TMX , %G / C TL , %G / C WT , or %G / C TMX , alone or in a combination thereof is in a range between (i) a maximum corresponding to the parameter's maximum value (MAX) plus about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 standard deviations (STD DEV), and (ii) a minimum corresponding to the parameter's minimum value (MIN) less 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 standard deviations (STD DEV).7. Methods for Sequence Optimization

[0203] In some embodiments, a polynucleotide, i.e., mRNA, (comprising a nucleotide sequence encoding a PBGD polypeptide, e.g., the wild-type sequence, functional fragment, or variant thereof) is sequence optimized. A sequence optimized nucleotide sequence (nucleotide sequence is also referred to as "nucleic acid" herein) comprises at least one codon modification with respect to a reference sequence (e.g., a wild-type sequence encoding a PBGD polypeptide). Thus, in a sequence optimized nucleic acid, at least one codon is different from a corresponding codon in a reference sequence (e.g., a wild-type sequence).

[0204] In general, sequence optimized nucleic acids are generated by at least a step comprising substituting codons in a reference sequence with synonymous codons (i.e., codons that encode the same amino acid). Such substitutions can be effected, for example, by applying a codon substitution map (i.e., a table providing the codons that will encode each amino acid in the codon optimized sequence), or by applying a set of rules (e.g., if glycine is next to neutral amino acid, glycine would be encoded by a certain codon, but if it is next to a polar amino acid, it would be encoded by another codon). In addition to codon substitutions (i.e., "codon optimization") the sequence optimization methods disclosed herein comprise additional optimization steps which are not strictly directed to codon optimization such as the removal of deleterious motifs (destabilizing motif substitution). Compositions and formulations comprising these sequence optimized nucleic acids (e.g., a RNA, e.g., an mRNA) can be administered to a subject in need thereof to facilitate in vivo expression of functionally active PBGD.

[0205] The recombinant expression of large molecules in cell cultures can be a challenging task with numerous limitations (e.g., poor protein expression levels, stalled translation resulting in truncated expression products, protein misfolding, etc.). These limitations can be reduced or avoided by administering the polynucleotides (e.g., a RNA, e.g., an mRNA), which encode a functionally active PBGD or compositions or formulations comprising the same to a patient suffering from AIP, so the synthesis and delivery of the PBGD polypeptide to treat AIP takes place endogenously.

[0206] Changing from an in vitro expression system (e.g., cell culture) to in vivo expression requires the redesign of the nucleic acid sequence encoding the therapeutic agent. Redesigning a naturally occurring gene sequence by choosing different codons without necessarily altering the encoded amino acid sequence can often lead to dramatic increases in protein expression levels (Gustafsson et al., 2004, Trends Biotechnol 22:346-53). Variables such as codon adaptation index (CAI), mRNA secondary structures, cis-regulatory sequences, GC content and many other similar variables have been shown to somewhat correlate with protein expression levels (Villalobos et al., 2006, BMC Bioinformatics 7:285). However, due to the degeneracy of the genetic code, there are numerous different nucleic acid sequences that can all encode the same therapeutic agent. Each amino acid is encoded by up to six synonymous codons; and the choice between these codons influences gene expression. In addition, codon usage (i.e., the frequency with which different organisms use codons for expressing a polypeptide sequence) differs among organisms (for example, recombinant production of human or humanized therapeutic antibodies frequently takes place in hamster cell cultures).

[0207] In some embodiments, a reference nucleic acid sequence can be sequence optimized by applying a codon map. The skilled artisan will appreciate that T bases are present in DNA, whereas the T bases would be replaced by U bases in corresponding RNAs. For example, a sequence optimized nucleic acid disclosed herein in DNA form, e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA. In this respect, both sequence optimized DNA sequences (comprising T) and their corresponding RNA sequences (comprising U) are considered sequence optimized nucleic acid. A skilled artisan would also understand that equivalent codon-maps can be generated by replaced one or more bases with non-natural bases. Thus, e.g., a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn can correspond to a ΨΨC codon (RNA map in which U has been replaced with pseudouridine).

[0208] In one embodiment, a reference sequence encoding PBGD can be optimized by replacing all the codons encoding a certain amino acid with only one of the alternative codons provided in a codon map. For example, all the valines in the optimized sequence would be encoded by GTG or GTC or GTT.

[0209] Sequence optimized polynucleotides can be generated using one or more optimization methods, or a combination thereof. Sequence optimization methods which can be used to sequence optimize nucleic acid sequences are described in detail herein. This list of methods is not comprehensive or limiting.

[0210] It will be appreciated that the design principles and rules described for each one of the sequence optimization methods discussed below can be combined in many different ways, for example high G / C content sequence optimization for some regions or uridine content sequence optimization for other regions of the reference nucleic acid sequence, as well as targeted nucleotide mutations to minimize secondary structure throughout the sequence or to eliminate deleterious motifs.

[0211] The choice of potential combinations of sequence optimization methods can be, for example, dependent on the specific chemistry used to produce a synthetic polynucleotide. Such a choice can also depend on characteristics of the protein encoded by the sequence optimized nucleic acid, e.g., a full sequence, a functional fragment, or a fusion protein comprising PBGD, etc. In some embodiments, such a choice can depend on the specific tissue or cell targeted by the sequence optimized nucleic acid (e.g., a therapeutic synthetic mRNA).

[0212] The mechanisms of combining the sequence optimization methods or design rules derived from the application and analysis of the optimization methods can be either simple or complex. For example, the combination can be: (i) Sequential: Each sequence optimization method or set of design rules applies to a different subsequence of the overall sequence, for example reducing uridine at codon positions 1 to 30 and then selecting high frequency codons for the remainder of the sequence. (ii) Hierarchical: Several sequence optimization methods or sets of design rules are combined in a hierarchical, deterministic fashion. For example, use the most GC-rich codons, breaking ties (which are common) by choosing the most frequent of those codons. (iii) Multifactorial / Multiparametric: Machine learning or other modeling techniques are used to design a single sequence that best satisfies multiple overlapping and possibly contradictory requirements. This approach would require the use of a computer applying a number of mathematical techniques, for example, genetic algorithms.

[0213] Ultimately, each one of these approaches can result in a specific set of rules which in many cases can be summarized in a single codon table, i.e., a sorted list of codons for each amino acid in the target protein (i.e., PBGD), with a specific rule or set of rules indicating how to select a specific codon for each amino acid position.a. Uridine Content Optimization

[0214] The presence of local high concentrations of uridine in a nucleic acid sequence can have detrimental effects on translation, e.g., slow or prematurely terminated translation, especially when modified uridine analogs are used in the production of synthetic mRNAs. Furthermore, high uridine content can also reduce the in vivo half-life of synthetic mRNAs due to TLR activation.

[0215] Accordingly, a nucleic acid sequence can be sequence optimized using a method comprising at least one uridine content optimization step. Such a step comprises, e.g., substituting at least one codon in the reference nucleic acid with an alternative codon to generate a uridine-modified sequence, wherein the uridine-modified sequence has at least one of the following properties: (i) increase or decrease in global uridine content; (ii) increase or decrease in local uridine content (i.e., changes in uridine content are limited to specific subsequences); (iii) changes in uridine distribution without altering the global uridine content; (iv) changes in uridine clustering (e.g., number of clusters, location of clusters, or distance between clusters); or (v) combinations thereof.

[0216] In some embodiments, the sequence optimization process comprises optimizing the global uridine content, i.e., optimizing the percentage of uridine nucleobases in the sequence optimized nucleic acid with respect to the percentage of uridine nucleobases in the reference nucleic acid sequence. For example, 30% of nucleobases can be uridines in the reference sequence and 10% of nucleobases can be uridines in the sequence optimized nucleic acid.

[0217] In other embodiments, the sequence optimization process comprises reducing the local uridine content in specific regions of a reference nucleic acid sequence, i.e., reducing the percentage of uridine nucleobases in a subsequence of the sequence optimized nucleic acid with respect to the percentage of uridine nucleobases in the corresponding subsequence of the reference nucleic acid sequence. For example, the reference nucleic acid sequence can have a 5'-end region (e.g., 30 codons) with a local uridine content of 30%, and the uridine content in that same region could be reduced to 10% in the sequence optimized nucleic acid.

[0218] In specific embodiments, codons can be replaced in the reference nucleic acid sequence to reduce or modify, for example, the number, size, location, or distribution of uridine clusters that could have deleterious effects on protein translation. Although as a general rule it is desirable to reduce the uridine content of the reference nucleic acid sequence, in certain embodiments the uridine content, and in particular the local uridine content, of some subsequences of the reference nucleic acid sequence can be increased.

[0219] The reduction of uridine content to avoid adverse effects on translation can be done in combination with other optimization methods disclosed here to achieve other design goals. For example, uridine content optimization can be combined with ramp design, since using the rarest codons for most amino acids will, with a few exceptions, reduce the U content.

[0220] In some embodiments, the uridine-modified sequence is designed to induce a lower Toll-Like Receptor (TLR) response when compared to the reference nucleic acid sequence. Several TLRs recognize and respond to nucleic acids. Double-stranded (ds)RNA, a frequent viral constituent has been shown to activate TLR3. See Alexopoulou et al. (2001) Nature, 413:732-738 and Wang et al. (2004) Nat. Med., 10:1366-1373. Single-stranded (ss)RNA activates TLR7. See Diebold et al. (2004) Science 303 :1529-1531. RNA oligonucleotides, for example RNA with phosphorothioate internucleotide linkages, are ligands of human TLR8. See Heil et al. (2004) Science 303:1526-1529. DNA containing unmethylated CpG motifs, characteristic of bacterial and viral DNA, activate TLR9. See Hemmi et al. (2000) Nature, 408: 740-745.

[0221] As used herein, the term "TLR response" is defined as the recognition of single-stranded RNA by a TLR7 receptor, and in some embodiments encompasses the degradation of the RNA and / or physiological responses caused by the recognition of the single-stranded RNA by the receptor. Methods to determine and quantitate the binding of an RNA to a TLR7 are known in the art. Similarly, methods to determine whether an RNA has triggered a TLR7-mediated physiological response (e.g., cytokine secretion) are well known in the art. In some embodiments, a TLR response can be mediated by TLR3, TLR8, or TLR9 instead of TLR7.

[0222] Suppression of TLR7-mediated response can be accomplished via nucleoside modification. RNA undergoes over hundred different nucleoside modifications in nature (see the RNA Modification Database, available at mods.rna.albany.edu). Human rRNA, for example, has ten times more pseudouridine (Ψ) and 25 times more 2'-O-methylated nucleosides than bacterial rRNA. Bacterial mRNA contains no nucleoside modifications, whereas mammalian mRNAs have modified nucleosides such as 5-methylcytidine (m5C), N6-methyladenosine (m6A), inosine and many 2'-O-methylated nucleosides in addition to N7-methylguanosine (m7G).

[0223] Uracil and ribose, the two defining features of RNA, are both necessary and sufficient for TLR7 stimulation, and short single-stranded RNA (ssRNA) act as TLR7 agonists in a sequence-independent manner as long as they contain several uridines in close proximity. See Diebold et al. (2006) Eur. J. Immunol. 36:3256-3267. Accordingly, one or more of the optimization methods disclosed herein comprises reducing the uridine content (locally and / or globally) and / or reducing or modifying uridine clustering to reduce or to suppress a TLR7-mediated response.

[0224] In some embodiments, the TLR response (e.g., a response mediated by TLR7) caused by the uridine-modified sequence is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% lower than the TLR response caused by the reference nucleic acid sequence.

[0225] In some embodiments, the TLR response caused by the reference nucleic acid sequence is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold higher than the TLR response caused by the uridine-modified sequence.

[0226] In some embodiments, the uridine content (average global uridine content) (absolute or relative) of the uridine-modified sequence is higher than the uridine content (absolute or relative) of the reference nucleic acid sequence. Accordingly, in some embodiments, the uridine-modified sequence contains at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% more uridine that the reference nucleic acid sequence.

[0227] In other embodiments, the uridine content (average global uridine content) (absolute or relative) of the uridine-modified sequence is lower than the uridine content (absolute or relative) of the reference nucleic acid sequence. Accordingly, in some embodiments, the uridine-modified sequence contains at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% less uridine that the reference nucleic acid sequence.

[0228] In some embodiments, the uridine content (average global uridine content) (absolute or relative) of the uridine-modified sequence is less than 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the total nucleobases in the uridine-modified sequence. In some embodiments, the uridine content of the uridine-modified sequence is between about 10% and about 20%. In some particular embodiments, the uridine content of the uridine-modified sequence is between about 12% and about 16%.

[0229] In some embodiments, the uridine content of the reference nucleic acid sequence can be measured using a sliding window. In some embodiments, the length of the sliding window is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleobases. In some embodiments, the sliding window is over 40 nucleobases in length. In some embodiments, the sliding window is 20 nucleobases in length. Based on the uridine content measured with a sliding window, it is possible to generate a histogram representing the uridine content throughout the length of the reference nucleic acid sequence and sequence optimized nucleic acids.

[0230] In some embodiments, a reference nucleic acid sequence can be modified to reduce or eliminate peaks in the histogram that are above or below a certain percentage value. In some embodiments, the reference nucleic acid sequence can be modified to eliminate peaks in the sliding-window representation which are above 65%, 60%, 55%, 50%, 45%, 40%, 35%, or 30% uridine. In another embodiment, the reference nucleic acid sequence can be modified so no peaks are over 30% uridine in the sequence optimized nucleic acid, as measured using a 20 nucleobase sliding window. In some embodiments, the reference nucleic acid sequence can be modified so no more or no less than a predetermined number of peaks in the sequence optimized nucleic sequence, as measured using a 20 nucleobase sliding window, are above or below a certain threshold value. For example, in some embodiments, the reference nucleic acid sequence can be modified so no peaks or no more than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 peaks in the sequence optimized nucleic acid are above 10%, 15%, 20%, 25% or 30% uridine. In another embodiment, the sequence optimized nucleic acid contains between 0 peaks and 2 peaks with uridine contents 30% of higher.

[0231] In some embodiments, a reference nucleic acid sequence can be sequence optimized to reduce the incidence of consecutive uridines. For example, two consecutive leucines could be encoded by the sequence CUUUUG, which would include a four uridine cluster. Such subsequence could be substituted with CUGCUC, which would effectively remove the uridine cluster. Accordingly, a reference nucleic sequence can be sequence optimized by reducing or eliminating uridine pairs (UU), uridine triplets (UUU) or uridine quadruplets (UUUU). Higher order combinations of U are not considered combinations of lower order combinations. Thus, for example, UUUU is strictly considered a quadruplet, not two consecutive U pairs; or UUUUUU is considered a sextuplet, not three consecutive U pairs, or two consecutive U triplets, etc.

[0232] In some embodiments, all uridine pairs (UU) and / or uridine triplets (UUU) and / or uridine quadruplets (UUUU) can be removed from the reference nucleic acid sequence. In other embodiments, uridine pairs (UU) and / or uridine triplets (UUU) and / or uridine quadruplets (UUUU) can be reduced below a certain threshold, e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the sequence optimized nucleic acid. In a particular embodiment, the sequence optimized nucleic acid contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 uridine pairs. In another particular embodiment, the sequence optimized nucleic acid contains no uridine pairs and / or triplets.

[0233] Phenylalanine codons, i.e., UUC or UUU, comprise a uridine pair or triplet and therefore sequence optimization to reduce uridine content can at most reduce the phenylalanine U triplet to a phenylalanine U pair. In some embodiments, the occurrence of uridine pairs (UU) and / or uridine triplets (UUU) refers only to non-phenylalanine U pairs or triplets. Accordingly, in some embodiments, non-phenylalanine uridine pairs (UU) and / or uridine triplets (UUU) can be reduced below a certain threshold, e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the sequence optimized nucleic acid. In a particular embodiment, the sequence optimized nucleic acid contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 non-phenylalanine uridine pairs and / or triplets. In another particular embodiment, the sequence optimized nucleic acid contains no non-phenylalanine uridine pairs and / or triplets.

[0234] In some embodiments, the reduction in uridine combinations (e.g., pairs, triplets, quadruplets) in the sequence optimized nucleic acid can be expressed as a percentage reduction with respect to the uridine combinations present in the reference nucleic acid sequence.

[0235] In some embodiments, a sequence optimized nucleic acid can contain about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65% of the total number of uridine pairs present in the reference nucleic acid sequence. In some embodiments, a sequence optimized nucleic acid can contain about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65% of the total number of uridine triplets present in the reference nucleic acid sequence. In some embodiments, a sequence optimized nucleic acid can contain about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65% of the total number of uridine quadruplets present in the reference nucleic acid sequence.

[0236] In some embodiments, a sequence optimized nucleic acid can contain about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65% of the total number of non-phenylalanine uridine pairs present in the reference nucleic acid sequence. In some embodiments, a sequence optimized nucleic acid can contain about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65% of the total number of non-phenylalanine uridine triplets present in the reference nucleic acid sequence.

[0237] In some embodiments, the uridine content in the sequence optimized sequence can be expressed with respect to the theoretical minimum uridine content in the sequence. The term "theoretical minimum uridine content" is defined as the uridine content of a nucleic acid sequence as a percentage of the sequence's length after all the codons in the sequence have been replaced with synonymous codon with the lowest uridine content. In some embodiments, the uridine content of the sequence optimized nucleic acid is identical to the theoretical minimum uridine content of the reference sequence (e.g., a wild type sequence). In some aspects, the uridine content of the sequence optimized nucleic acid is about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200%, about 210%, about 220%, about 230%, about 240% or about 250% of the theoretical minimum uridine content of the reference sequence (e.g., a wild type sequence).

[0238] In some embodiments, the uridine content of the sequence optimized nucleic acid is identical to the theoretical minimum uridine content of the reference sequence (e.g., a wild type sequence).

[0239] The reference nucleic acid sequence (e.g., a wild type sequence) can comprise uridine clusters which due to their number, size, location, distribution or combinations thereof have negative effects on translation. As used herein, the term "uridine cluster" refers to a subsequence in a reference nucleic acid sequence or sequence optimized nucleic sequence with contains a uridine content (usually described as a percentage) which is above a certain threshold. Thus, in certain embodiments, if a subsequence comprises more than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or 65% uridine content, such subsequence would be considered a uridine cluster.

[0240] The negative effects of uridine clusters can be, for example, eliciting a TLR7 response. Thus, in some implementations of the nucleic acid sequence optimization methods disclosed herein it is desirable to reduce the number of clusters, size of clusters, location of clusters (e.g., close to the 5' and / or 3' end of a nucleic acid sequence), distance between clusters, or distribution of uridine clusters (e.g., a certain pattern of cluster along a nucleic acid sequence, distribution of clusters with respect to secondary structure elements in the expressed product, or distribution of clusters with respect to the secondary structure of an mRNA).

[0241] In some embodiments, the reference nucleic acid sequence comprises at least one uridine cluster, wherein said uridine cluster is a subsequence of the reference nucleic acid sequence wherein the percentage of total uridine nucleobases in said subsequence is above a predetermined threshold. In some embodiments, the length of the subsequence is at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 nucleobases. In some embodiments, the subsequence is longer than 100 nucleobases. In some embodiments, the threshold is 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25% uridine content. In some embodiments, the threshold is above 25%.

[0242] For example, an amino acid sequence comprising A, D, G, S and R could be encoded by the nucleic acid sequence GCU, GAU, GGU, AGU, CGU. Although such sequence does not contain any uridine pairs, triplets, or quadruplets, one third of the nucleobases would be uridines. Such a uridine cluster could be removed by using alternative codons, for example, by using GCC, GAC, GGC, AGC, and CGC, which would contain no uridines.

[0243] In other embodiments, the reference nucleic acid sequence comprises at least one uridine cluster, wherein said uridine cluster is a subsequence of the reference nucleic acid sequence wherein the percentage of uridine nucleobases of said subsequence as measured using a sliding window that is above a predetermined threshold. In some embodiments, the length of the sliding window is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleobases. In some embodiments, the sliding window is over 40 nucleobases in length. In some embodiments, the threshold is 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25% uridine content. In some embodiments, the threshold is above 25%.

[0244] In some embodiments, the reference nucleic acid sequence comprises at least two uridine clusters. In some embodiments, the uridine-modified sequence contains fewer uridine-rich clusters than the reference nucleic acid sequence. In some embodiments, the uridine-modified sequence contains more uridine-rich clusters than the reference nucleic acid sequence. In some embodiments, the uridine-modified sequence contains uridine-rich clusters with are shorter in length than corresponding uridine-rich clusters in the reference nucleic acid sequence. In other embodiments, the uridine-modified sequence contains uridine-rich clusters which are longer in length than the corresponding uridine-rich cluster in the reference nucleic acid sequence.

[0245] See, Kariko et al. (2005) Immunity 23:165-175; Kormann et al. (2010) Nature Biotechnology 29:154-157; or Sahin et al. (2014) Nature Reviews Drug Discovery | AOP, published online 19 September 2014m doi:10.1038 / nrd4278.b. Guanine / Cytosine (G / C) Content

[0246] A reference nucleic acid sequence can be sequence optimized using methods comprising altering the Guanine / Cytosine (G / C) content (absolute or relative) of the reference nucleic acid sequence. Such optimization can comprise altering (e.g., increasing or decreasing) the global G / C content (absolute or relative) of the reference nucleic acid sequence; introducing local changes in G / C content in the reference nucleic acid sequence (e.g., increase or decrease G / C in selected regions or subsequences in the reference nucleic acid sequence); altering the frequency, size, and distribution of G / C clusters in the reference nucleic acid sequence, or combinations thereof.

[0247] In some embodiments, the sequence optimized nucleic acid encoding PBGD comprises an overall increase in G / C content (absolute or relative) relative to the G / C content (absolute or relative) of the reference nucleic acid sequence. In some embodiments, the overall increase in G / C content (absolute or relative) is at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% relative to the G / C content (absolute or relative) of the reference nucleic acid sequence.

[0248] In some embodiments, the sequence optimized nucleic acid encoding PBGD comprises an overall decrease in G / C content (absolute or relative) relative to the G / C content of the reference nucleic acid sequence. In some embodiments, the overall decrease in G / C content (absolute or relative) is at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% relative to the G / C content (absolute or relative) of the reference nucleic acid sequence.

[0249] In some embodiments, the sequence optimized nucleic acid encoding PBGD comprises a local increase in Guanine / Cytosine (G / C) content (absolute or relative) in a subsequence (i.e., a G / C modified subsequence) relative to the G / C content (absolute or relative) of the corresponding subsequence in the reference nucleic acid sequence. In some embodiments, the local increase in G / C content (absolute or relative) is by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% relative to the G / C content (absolute or relative) of the corresponding subsequence in the reference nucleic acid sequence.

[0250] In some embodiments, the sequence optimized nucleic acid encoding PBGD comprises a local decrease in Guanine / Cytosine (G / C) content (absolute or relative) in a subsequence (i.e., a G / C modified subsequence) relative to the G / C content (absolute or relative) of the corresponding subsequence in the reference nucleic acid sequence. In some embodiments, the local decrease in G / C content (absolute or relative) is by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% relative to the G / C content (absolute or relative) of the corresponding subsequence in the reference nucleic acid sequence.

[0251] In some embodiments, the G / C content (absolute or relative) is increased or decreased in a subsequence which is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleobases in length.

[0252] In some embodiments, the G / C content (absolute or relative) is increased or decreased in a subsequence which is at least about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleobases in length.

[0253] In some embodiments, the G / C content (absolute or relative) is increased or decreased in a subsequence which is at least about 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, or 10000 nucleobases in length.

[0254] The increases or decreases in G and C content (absolute or relative) described herein can be conducted by replacing synonymous codons with low G / C content with synonymous codons having higher G / C content, or vice versa. For example, L has 6 synonymous codons: two of them have 2 G / C (CUC, CUG), 3 have a single G / C (UUG, CUU, CUA), and one has no G / C (UUA). So if the reference nucleic acid had a CUC codon in a certain position, G / C content at that position could be reduced by replacing CUC with any of the codons having a single G / C or the codon with no G / C.

[0255] See, U.S. Publ. Nos. US20140228558, US20050032730 A1; Gustafsson et al. (2012) Protein Expression and Purification 83: 37-46.c. Codon Frequency - Codon Usage Bias

[0256] Numerous codon optimization methods known in the art are based on the substitution of codons in a reference nucleic acid sequence with codons having higher frequencies. Thus, in some embodiments, a nucleic acid sequence encoding PBGD disclosed herein can be sequence optimized using methods comprising the use of modifications in the frequency of use of one or more codons relative to other synonymous codons in the sequence optimized nucleic acid with respect to the frequency of use in the non-codon optimized sequence.

[0257] As used herein, the term "codon frequency" refers to codon usage bias, i.e., the differences in the frequency of occurrence of synonymous codons in coding DNA / RNA. It is generally acknowledged that codon preferences reflect a balance between mutational biases and natural selection for translational optimization. Optimal codons help to achieve faster translation rates and high accuracy. As a result of these factors, translational selection is expected to be stronger in highly expressed genes. In the field of bioinformatics and computational biology, many statistical methods have been proposed and used to analyze codon usage bias. See, e.g., Comeron & Aguadé (1998) J. Mol. Evol. 47: 268-74. Methods such as the "frequency of optimal codons" (Fop) (Ikemura (1981) J. Mol. Biol. 151 (3): 389-409), the "Relative Codon Adaptation" (RCA) (Fox & Eril (2010) DNA Res. 17 (3): 185-96) or the "Codon Adaptation Index" (CAI) (Sharp & Li (1987) Nucleic Acids Res. 15 (3): 1281-95) are used to predict gene expression levels, while methods such as the "effective number of codons" (Nc) and Shannon entropy from information theory are used to measure codon usage evenness. Multivariate statistical methods, such as correspondence analysis and principal component analysis, are widely used to analyze variations in codon usage among genes (Suzuki et al. (2008) DNA Res. 15 (6): 357-65; Sandhu et al., In Silico Biol. 2008;8(2):187-92).

[0258] The nucleic acid sequence encoding a PBGD polypeptide disclosed herein (e.g., a wild type nucleic acid sequence, a mutant nucleic acid sequence, a chimeric nucleic sequence, etc. which is an mRNA), can be codon optimized using methods comprising substituting at least one codon in the reference nucleic acid sequence with an alternative codon having a higher or lower codon frequency in the synonymous codon set; wherein the resulting sequence optimized nucleic acid has at least one optimized property with respect to the reference nucleic acid sequence.

[0259] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in the reference nucleic acid sequence encoding PBGD are substituted with alternative codons, each alternative codon having a codon frequency higher than the codon frequency of the substituted codon in the synonymous codon set.

[0260] In some embodiments, at least one codon in the reference nucleic acid sequence encoding PBGD is substituted with an alternative codon having a codon frequency higher than the codon frequency of the substituted codon in the synonymous codon set, and at least one codon in the reference nucleic acid sequence is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.

[0261] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% of the codons in the reference nucleic acid sequence encoding PBGD are substituted with alternative codons, each alternative codon having a codon frequency higher than the codon frequency of the substituted codon in the synonymous codon set.

[0262] In some embodiments, at least one alternative codon having a higher codon frequency has the highest codon frequency in the synonymous codon set. In other embodiments, all alternative codons having a higher codon frequency have the highest codon frequency in the synonymous codon set.

[0263] In some embodiments, at least one alternative codon having a lower codon frequency has the lowest codon frequency in the synonymous codon set. In some embodiments, all alternative codons having a higher codon frequency have the highest codon frequency in the synonymous codon set.

[0264] In some specific embodiments, at least one alternative codon has the second highest, the third highest, the fourth highest, the fifth highest or the sixth highest frequency in the synonymous codon set. In some specific embodiments, at least one alternative codon has the second lowest, the third lowest, the fourth lowest, the fifth lowest, or the sixth lowest frequency in the synonymous codon set.

[0265] Optimization based on codon frequency can be applied globally, as described above, or locally to the reference nucleic acid sequence encoding a PBGD polypeptide. In some embodiments, when applied locally, regions of the reference nucleic acid sequence can modified based on codon frequency, substituting all or a certain percentage of codons in a certain subsequence with codons that have higher or lower frequencies in their respective synonymous codon sets. Thus, in some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in a subsequence of the reference nucleic acid sequence are substituted with alternative codons, each alternative codon having a codon frequency higher than the codon frequency of the substituted codon in the synonymous codon set.

[0266] In some embodiments, at least one codon in a subsequence of the reference nucleic acid sequence encoding a PBGD polypeptide is substituted with an alternative codon having a codon frequency higher than the codon frequency of the substituted codon in the synonymous codon set, and at least one codon in a subsequence of the reference nucleic acid sequence is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.

[0267] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% of the codons in a subsequence of the reference nucleic acid sequence encoding a PBGD polypeptide are substituted with alternative codons, each alternative codon having a codon frequency higher than the codon frequency of the substituted codon in the synonymous codon set.

[0268] In some embodiments, at least one alternative codon substituted in a subsequence of the reference nucleic acid sequence encoding a PBGD polypeptide and having a higher codon frequency has the highest codon frequency in the synonymous codon set. In other embodiments, all alternative codons substituted in a subsequence of the reference nucleic acid sequence and having a lower codon frequency have the lowest codon frequency in the synonymous codon set.

[0269] In some embodiments, at least one alternative codon substituted in a subsequence of the reference nucleic acid sequence encoding a PBGD polypeptide and having a lower codon frequency has the lowest codon frequency in the synonymous codon set. In some embodiments, all alternative codons substituted in a subsequence of the reference nucleic acid sequence and having a higher codon frequency have the highest codon frequency in the synonymous codon set.

[0270] In specific embodiments, a sequence optimized nucleic acid encoding a PBGD polypeptide can comprise a subsequence having an overall codon frequency higher or lower than the overall codon frequency in the corresponding subsequence of the reference nucleic acid sequence at a specific location, for example, at the 5' end or 3' end of the sequence optimized nucleic acid, or within a predetermined distance from those region (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 codons from the 5' end or 3' end of the sequence optimized nucleic acid).

[0271] In some embodiments, a sequence optimized nucleic acid encoding a PBGD polypeptide can comprise more than one subsequence having an overall codon frequency higher or lower than the overall codon frequency in the corresponding subsequence of the reference nucleic acid sequence. A skilled artisan would understand that subsequences with overall higher or lower overall codon frequencies can be organized in innumerable patterns, depending on whether the overall codon frequency is higher or lower, the length of the subsequence, the distance between subsequences, the location of the subsequences, etc.

[0272] See, U.S. Pat. Nos. US5082767, US8126653, US7561973, US8401798; U.S. Publ. No. US 20080046192, US 20080076161; Int'l. Publ. No. WO2000018778; Welch et al. (2009) PLoS ONE 4(9): e7002; Gustafsson et al. (2012) Protein Expression and Purification 83: 37-46; Chung et al. (2012) BMC Systems Biology 6:134.d. Destabilizing Motif Substitution

[0273] There is a variety of motifs that can affect sequence optimization, which fall into various non-exclusive categories, for example: (i) Primary sequence based motifs: Motifs defined by a simple arrangement of nucleotides. (ii) Structural motifs: Motifs encoded by an arrangement of nucleotides that tends to form a certain secondary structure. (iii) Local motifs: Motifs encoded in one contiguous subsequence. (iv) Distributed motifs: Motifs encoded in two or more disjoint subsequences. (v) Advantageous motifs: Motifs which improve nucleotide structure or function. (vi) Disadvantageous motifs: Motifs with detrimental effects on nucleotide structure or function.

[0274] There are many motifs that fit into the category of disadvantageous motifs. Some examples include, for example, restriction enzyme motifs, which tend to be relatively short, exact sequences such as the restriction site motifs for Xba1 (TCTAGA), EcoRI (GAATTC), EcoRII (CCWGG, wherein W means A or T, per the IUPAC ambiguity codes), or HindIII (AAGCTT); enzyme sites, which tend to be longer and based on consensus not exact sequence, such in the T7 RNA polymerase (GnnnnWnCRnCTCnCnnWnD, wherein n means any nucleotide, R means A or G, W means A or T, D means A or G or T but not C); structural motifs, such as GGGG repeats (Kim et al. (1991) Nature 351(6324):331-2); or other motifs such as CUG-triplet repeats (Querido et al. (2014) J. Cell Sci. 124:1703-1714).

[0275] Accordingly, the nucleic acid sequence encoding a PBGD polypeptide disclosed herein can be sequence optimized using methods comprising substituting at least one destabilizing motif in a reference nucleic acid sequence, and removing such disadvantageous motif or replacing it with an advantageous motif.

[0276] In some embodiments, the optimization process comprises identifying advantageous and / or disadvantageous motifs in the reference nucleic sequence, wherein such motifs are, e.g., specific subsequences that can cause a loss of stability in the reference nucleic acid sequence prior or during the optimization process. For example, substitution of specific bases during optimization can generate a subsequence (motif) recognized by a restriction enzyme. Accordingly, during the optimization process the appearance of disadvantageous motifs can be monitored by comparing the sequence optimized sequence with a library of motifs known to be disadvantageous. Then, the identification of disadvantageous motifs could be used as a post-hoc filter, i.e., to determine whether a certain modification which potentially could be introduced in the reference nucleic acid sequence should be actually implemented or not.

[0277] In some embodiments, the identification of disadvantageous motifs can be used prior to the application of the sequence optimization methods disclosed herein, i.e., the identification of motifs in the reference nucleic acid sequence encoding a PBGD polypeptide and their replacement with alternative nucleic acid sequences can be used as a preprocessing step, for example, before uridine reduction.

[0278] In other embodiments, the identification of disadvantageous motifs and their removal is used as an additional sequence optimization technique integrated in a multiparametric nucleic acid optimization method comprising two or more of the sequence optimization methods disclosed herein. When used in this fashion, a disadvantageous motif identified during the optimization process would be removed, for example, by substituting the lowest possible number of nucleobases in order to preserve as closely as possible the original design principle(s) (e.g., low U, high frequency, etc.).

[0279] See, e.g., U.S. Publ. Nos. US20140228558, US20050032730, or US20140228558.e. Limited Codon Set Optimization

[0280] In some particular embodiments, sequence optimization of a reference nucleic acid sequence encoding a PBGD polypeptide can be conducted using a limited codon set, e.g., a codon set wherein less than the native number of codons is used to encode the 20 natural amino acids, a subset of the 20 natural amino acids, or an expanded set of amino acids including, for example, non-natural amino acids.

[0281] The genetic code is highly similar among all organisms and can be expressed in a simple table with 64 entries which would encode the 20 standard amino acids involved in protein translation plus start and stop codons. The genetic code is degenerate, i.e., in general, more than one codon specifies each amino acid. For example, the amino acid leucine is specified by the UUA, UUG, CUU, CUC, CUA, or CUG codons, while the amino acid serine is specified by UCA, UCG, UCC, UCU, AGU, or AGC codons (difference in the first, second, or third position). Native genetic codes comprise 62 codons encoding naturally occurring amino acids. Thus, in some embodiments of the methods disclosed herein optimized codon sets (genetic codes) comprising less than 62 codons to encode 20 amino acids can comprise 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 codons.

[0282] In some embodiments, the limited codon set comprises less than 20 codons. For example, if a protein contains less than 20 types of amino acids, such protein could be encoded by a codon set with less than 20 codons. Accordingly, in some embodiments, an optimized codon set comprises as many codons as different types of amino acids are present in the protein encoded by the reference nucleic acid sequence. In some embodiments, the optimized codon set comprises 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or even 1 codon.

[0283] In some embodiments, at least one amino acid selected from the group consisting of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Phe, Pro, Ser, Thr, Tyr, and Val, i.e., amino acids which are naturally encoded by more than one codon, is encoded with less codons than the naturally occurring number of synonymous codons. For example, in some embodiments, Ala can be encoded in the sequence optimized nucleic acid by 3, 2 or 1 codons; Cys can be encoded in the sequence optimized nucleic acid by 1 codon; Asp can be encoded in the sequence optimized nucleic acid by 1 codon; Glu can be encoded in the sequence optimized nucleic acid by 1 codon; Phe can be encoded in the sequence optimized nucleic acid by 1 codon; Gly can be encoded in the sequence optimized nucleic acid by 3 codons, 2 codons or 1 codon; His can be encoded in the sequence optimized nucleic acid by 1 codon; Ile can be encoded in the sequence optimized nucleic acid by 2 codons or 1 codon; Lys can be encoded in the sequence optimized nucleic acid by 1 codon; Leu can be encoded in the sequence optimized nucleic acid by 5 codons, 4 codons, 3 codons, 2 codons or 1 codon; Asn can be encoded in the sequence optimized nucleic acid by 1 codon; Pro can be encoded in the sequence optimized nucleic acid by 3 codons, 2 codons, or 1 codon; Gln can be encoded in the sequence optimized nucleic acid by 1 codon; Arg can be encoded in the sequence optimized nucleic acid by 5 codons, 4 codons, 3 codons, 2 codons, or 1 codon; Ser can be encoded in the sequence optimized nucleic acid by 5 codons, 4 codons, 3 codons, 2 codons, or 1 codon; Thr can be encoded in the sequence optimized nucleic acid by 3 codons, 2 codons, or 1 codon; Val can be encoded in the sequence optimized nucleic acid by 3 codons, 2 codons, or 1 codon; and, Tyr can be encoded in the sequence optimized nucleic acid by 1 codon.

[0284] In some embodiments, at least one amino acid selected from the group consisting of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Phe, Pro, Ser, Thr, Tyr, and Val, i.e., amino acids which are naturally encoded by more than one codon, is encoded by a single codon in the limited codon set.

[0285] In some specific embodiments not falling under the scope of the invention, the sequence optimized nucleic acid is a DNA and the limited codon set consists of 20 codons, wherein each codon encodes one of 20 amino acids. In some embodiments not falling under the scope of the invention, the sequence optimized nucleic acid is a DNA and the limited codon set comprises at least one codon selected from the group consisting of GCT, GCC, GCA, and GCG; at least a codon selected from the group consisting of CGT, CGC, CGA, CGG, AGA, and AGG; at least a codon selected from AAT or ACC; at least a codon selected from GAT or GAC; at least a codon selected from TGT or TGC; at least a codon selected from CAA or CAG; at least a codon selected from GAA or GAG; at least a codon selected from the group consisting of GGT, GGC, GGA, and GGG; at least a codon selected from CAT or CAC; at least a codon selected from the group consisting of ATT, ATC, and ATA; at least a codon selected from the group consisting of TTA, TTG, CTT, CTC, CTA, and CTG; at least a codon selected from AAA or AAG; an ATG codon; at least a codon selected from TTT or TTC; at least a codon selected from the group consisting of CCT, CCC, CCA, and CCG; at least a codon selected from the group consisting of TCT, TCC, TCA, TCG, AGT, and AGC; at least a codon selected from the group consisting of ACT, ACC, ACA, and ACG; a TGG codon; at least a codon selected from TAT or TAC; and, at least a codon selected from the group consisting of GTT, GTC, GTA, and GTG.

[0286] In other embodiments, the sequence optimized nucleic acid is an mRNA and the limited codon set consists of 20 codons, wherein each codon encodes one of 20 amino acids. In some embodiments, the sequence optimized nucleic acid is an RNA and the limited codon set comprises at least one codon selected from the group consisting of GCU, GCC, GCA, and GCG; at least a codon selected from the group consisting of CGU, CGC, CGA, CGG, AGA, and AGG; at least a codon selected from AAU or ACC; at least a codon selected from GAU or GAC; at least a codon selected from UGU or UGC; at least a codon selected from CAA or CAG; at least a codon selected from GAA or GAG; at least a codon selected from the group consisting of GGU, GGC, GGA, and GGG; at least a codon selected from CAU or CAC; at least a codon selected from the group consisting of AUU, AUC, and AUA; at least a codon selected from the group consisting of UUA, UUG, CUU, CUC, CUA, and CUG; at least a codon selected from AAA or AAG; an AUG codon; at least a codon selected from UUU or UUC; at least a codon selected from the group consisting of CCU, CCC, CCA, and CCG; at least a codon selected from the group consisting of UCU, UCC, UCA, UCG, AGU, and AGC; at least a codon selected from the group consisting of ACU, ACC, ACA, and ACG; a UGG codon; at least a codon selected from UAU or UAC; and, at least a codon selected from the group consisting of GUU, GUC, GUA, and GUG.

[0287] In some specific embodiments, the limited codon set has been optimized for in vivo expression of a sequence optimized nucleic acid (i.e., a synthetic mRNA) following administration to a certain tissue or cell.

[0288] In some embodiments, the optimized codon set (e.g., a 20 codon set encoding 20 amino acids) complies at least with one of the following properties: (i) the optimized codon set has a higher average G / C content than the original or native codon set; or, (ii) the optimized codon set has a lower average U content than the original or native codon set; or, (iii) the optimized codon set is composed of codons with the highest frequency; or, (iv) the optimized codon set is composed of codons with the lowest frequency; or, (v) a combination thereof.

[0289] In some specific embodiments, at least one codon in the optimized codon set has the second highest, the third highest, the fourth highest, the fifth highest or the sixth highest frequency in the synonymous codon set. In some specific embodiments, at least one codon in the optimized codon has the second lowest, the third lowest, the fourth lowest, the fifth lowest, or the sixth lowest frequency in the synonymous codon set.

[0290] As used herein, the term "native codon set" refers to the codon set used natively by the source organism to encode the reference nucleic acid sequence. As used herein, the term "original codon set" refers to the codon set used to encode the reference nucleic acid sequence before the beginning of sequence optimization, or to a codon set used to encode an optimized variant of the reference nucleic acid sequence at the beginning of a new optimization iteration when sequence optimization is applied iteratively or recursively.

[0291] In some embodiments, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of codons in the codon set are those with the highest frequency. In other embodiments, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of codons in the codon set are those with the lowest frequency.

[0292] In some embodiments, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of codons in the codon set are those with the highest uridine content. In some embodiments, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of codons in the codon set are those with the lowest uridine content.

[0293] In some embodiments, the average G / C content (absolute or relative) of the codon set is 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% higher than the average G / C content (absolute or relative) of the original codon set. In some embodiments, the average G / C content (absolute or relative) of the codon set is 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% lower than the average G / C content (absolute or relative) of the original codon set.

[0294] In some embodiments, the uracil content (absolute or relative) of the codon set is 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% higher than the average uracil content (absolute or relative) of the original codon set. In some embodiments, the uracil content (absolute or relative) of the codon set is 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% lower than the average uracil content (absolute or relative) of the original codon set.

[0295] See also U.S. Appl. Publ. No. 2011 / 0082055, and Int'l. Publ. No. WO2000018778.8. Characterization of Sequence Optimized Nucleic Acids

[0296] The polynucleotide (i.e., an mRNA) comprising a sequence optimized nucleic acid disclosed herein encoding a PBGD polypeptide can be tested to determine whether at least one nucleic acid sequence property (e.g., stability when exposed to nucleases) or expression property has been improved with respect to the non-sequence optimized nucleic acid.

[0297] As used herein, "expression property" refers to a property of a nucleic acid sequence either in vivo (e.g., translation efficacy of a synthetic mRNA after administration to a subject in need thereof) or in vitro (e.g., translation efficacy of a synthetic mRNA tested in an in vitro model system). Expression properties include but are not limited to the amount of protein produced by an mRNA encoding a PBGD polypeptide after administration, and the amount of soluble or otherwise functional protein produced. In some embodiments, sequence optimized nucleic acids disclosed herein can be evaluated according to the viability of the cells expressing a protein encoded by a sequence optimized nucleic acid sequence (e.g., a RNA, e.g., an mRNA) encoding a PBGD polypeptide disclosed herein.

[0298] In a particular embodiment, a plurality of sequence optimized nucleic acids disclosed herein i.e., an mRNA) containing codon substitutions with respect to the non-optimized reference nucleic acid sequence can be characterized functionally to measure a property of interest, for example an expression property in an in vitro model system, or in vivo in a target tissue or cell.a. Optimization of Nucleic Acid Sequence Intrinsic Properties

[0299] In some embodiments of the invention, the desired property of the polynucleotide is an intrinsic property of the nucleic acid sequence. For example, the nucleotide sequence (i.e., an mRNA) can be sequence optimized for in vivo or in vitro stability. In some embodiments, the nucleotide sequence can be sequence optimized for expression in a particular target tissue or cell. In some embodiments, the nucleic acid sequence is sequence optimized to increase its plasma half-life by preventing its degradation by endo and exonucleases.

[0300] In other embodiments, the nucleic acid sequence is sequence optimized to increase its resistance to hydrolysis in solution, for example, to lengthen the time that the sequence optimized nucleic acid or a pharmaceutical composition comprising the sequence optimized nucleic acid can be stored under aqueous conditions with minimal degradation.

[0301] In other embodiments, the sequence optimized nucleic acid can be optimized to increase its resistance to hydrolysis in dry storage conditions, for example, to lengthen the time that the sequence optimized nucleic acid can be stored after lyophilization with minimal degradation.b. Nucleic Acids Sequence Optimized for Protein Expression

[0302] In some embodiments of the invention, the desired property of the polynucleotide is the level of expression of a PBGD polypeptide encoded by a sequence optimized sequence disclosed herein. Protein expression levels can be measured using one or more expression systems. In some embodiments, expression can be measured in cell culture systems, e.g., CHO cells or HEK293 cells. In some embodiments, expression can be measured using in vitro expression systems prepared from extracts of living cells, e.g., rabbit reticulocyte lysates, or in vitro expression systems prepared by assembly of purified individual components. In other embodiments, the protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc.

[0303] In some embodiments, protein expression in solution form can be desirable. Accordingly, in some embodiments, a reference sequence can be sequence optimized to yield a sequence optimized nucleic acid sequence having optimized levels of expressed proteins in soluble form. Levels of protein expression and other properties such as solubility, levels of aggregation, and the presence of truncation products (i.e., fragments due to proteolysis, hydrolysis, or defective translation) can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.).c. Optimization of Target Tissue or Target Cell Viability

[0304] In some embodiments not falling under the scope of the invention, the expression of heterologous therapeutic proteins encoded by a nucleic acid sequence can have deleterious effects in the target tissue or cell, reducing protein yield, or reducing the quality of the expressed product (e.g., due to the presence of protein fragments or precipitation of the expressed protein in inclusion bodies), or causing toxicity.

[0305] Accordingly, in some embodiments of the invention, the sequence optimization of a nucleic acid sequence disclosed herein, e.g., a nucleic acid sequence encoding a PBGD polypeptide, can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid.

[0306] Heterologous protein expression can also be deleterious to cells transfected with a nucleic acid sequence for autologous or heterologous transplantation. Accordingly, in some embodiments of the present disclosure the sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid sequence. Changes in cell or tissue viability, toxicity, and other physiological reaction can be measured according to methods known in the art.d. Reduction of Immune and / or Inflammatory Response

[0307] In some cases, the administration of a sequence optimized nucleic acid encoding PBGD polypeptide or a functional fragment thereof can trigger an immune response, which could be caused by (i) the therapeutic agent (e.g., an mRNA encoding a PBGD polypeptide), or (ii) the expression product of such therapeutic agent (e.g., the PBGD polypeptide encoded by the mRNA), or (iv) a combination thereof. Accordingly, in some embodiments of the present disclosure the sequence optimization of nucleic acid sequence (e.g., an mRNA) disclosed herein can be used to decrease an immune or inflammatory response triggered by the administration of a nucleic acid encoding a PBGD polypeptide or by the expression product of PBGD encoded by such nucleic acid.

[0308] In some aspects, an inflammatory response can be measured by detecting increased levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA. The term "inflammatory cytokine" refers to cytokines that are elevated in an inflammatory response. Examples of inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1; also known as GROα, interferon-γ (IFNγ), tumor necrosis factor (α (TNFα), interferon γ-induced protein 10 (IP-10), or granulocyte-colony stimulating factor (G-CSF). The term inflammatory cytokines includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1), interleukin-8 (IL-8), interleukin-12 (IL-12), interleukin-13 (Il-13), interferon α (IFN-α), etc.9. Modified Nucleotide Sequences Encoding PBGD Polypeptides

[0309] In some embodiments, the polynucleotide (i.e., an mRNA) comprises a chemically modified nucleobase, e.g., 5-methoxyuracil. In some embodiments, the mRNA is a uracil-modified sequence comprising an ORF encoding a PBGD polypeptide, wherein the mRNA comprises a chemically modified nucleobase, e.g., 5-methoxyuracil.

[0310] In certain aspects of the invention, when the 5-methoxyuracil base is connected to a ribose sugar, as it is in polynucleotides, the resulting modified nucleoside or nucleotide is referred to as 5-methoxyuridine. In some embodiments, uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% 5-methoxyuracil. In one embodiment, uracil in the polynucleotide is at least 95% 5-methoxyuracil. In another embodiment, uracil in the polynucleotide is 100% 5-methoxyuracil.

[0311] In embodiments where uracil in the polynucleotide is at least 95% 5-methoxyuracil, overall uracil content can be adjusted such that the polynucleotide (i.e., an mRNA) provides suitable protein expression levels while inducing little to no immune response. In some embodiments, the uracil content of the ORF is between about 105% and about 145%, about 105% and about 140%, about 110% and about 140%, about 110% and about 145%, about 115% and about 135%, about 105% and about 135%, about 110% and about 135%, about 115% and about 145%, or about 115% and about 140% of the theoretical minimum uracil content in the corresponding wild-type ORF (%U TM ). In other embodiments, the uracil content of the ORF is between about 117% and about 134% or between 118% and 132% of the %U TM . In some embodiments, the uracil content of the ORF encoding a PBGD polypeptide is about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of the %U TM . In this context, the term "uracil" can refer to 5-methoxyuracil and / or naturally occurring uracil.

[0312] In some embodiments, the uracil content in the ORF of the mRNA encoding a PBGD polypeptide is less than about 50%, about 40%, about 30%, or about 20% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF is between about 15 % and about 25% of the total nucleobase content in the ORF. In other embodiments, the uracil content in the ORF is between about 20% and about 30% of the total nucleobase content in the ORF. In one embodiment, the uracil content in the ORF of the mRNA encoding a PBGD polypeptide is less than about 20% of the total nucleobase content in the open reading frame. In this context, the term "uracil" can refer to 5-methoxyuracil and / or naturally occurring uracil.

[0313] In further embodiments, the ORF of the mRNA encoding a PBGD polypeptide having 5-methoxyuracil and adjusted uracil content has increased Cytosine (C), Guanine (G), or Guanine / Cytosine (G / C) content (absolute or relative). In some embodiments, the overall increase in C, G, or G / C content (absolute or relative) of the ORF is at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% relative to the G / C content (absolute or relative) of the wild-type ORF. In some embodiments, the G, the C, or the G / C content in the ORF is less than about 100%, less than about 90%, less than about 85%, or less than about 80% of the theoretical maximum G, C, or G / C content of the corresponding wild type nucleotide sequence encoding the PBGD polypeptide (%G TMX ; %C TMX , or %G / C TMX ). In other embodiments, the G, the C, or the G / C content in the ORF is between about 70% and about 80%, between about 71% and about 79%, between about 71% and about 78%, or between about 71% and about 77% of the %G TMX , %C TMX , or %G / C TMX . In some embodiments, the increases in G and / or C content (absolute or relative) described herein can be conducted by replacing synonymous codons with low G, C, or G / C content with synonymous codons having higher G, C, or G / C content. In other embodiments, the increase in G and / or C content (absolute or relative) is conducted by replacing a codon ending with U with a synonymous codon ending with G or C.

[0314] In further embodiments, the ORF of the mRNA encoding a PBGD polypeptide comprises 5-methoxyuracil and has an adjusted uracil content containing less uracil pairs (UU) and / or uracil triplets (UUU) and / or uracil quadruplets (UUUU) than the corresponding wild-type nucleotide sequence encoding the PBGD polypeptide. In some embodiments, the ORF of the mRNA encoding a PBGD polypeptide contains no uracil pairs and / or uracil triplets and / or uracil quadruplets. In some embodiments, uracil pairs and / or uracil triplets and / or uracil quadruplets are reduced below a certain threshold, e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the ORF of the mRNA encoding the PBGD polypeptide. In a particular embodiment, the ORF of the mRNA encoding the PBGD polypeptide contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 non-phenylalanine uracil pairs and / or triplets. In another embodiment, the ORF of the mRNA encoding the PBGD polypeptide contains no non-phenylalanine uracil pairs and / or triplets.

[0315] In further embodiments, the ORF of the mRNA encoding a PBGD polypeptide comprises 5-methoxyuracil and has an adjusted uracil content containing less uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding the PBGD polypeptide. In some embodiments, the ORF of the mRNA encoding the PBGD polypeptide contains uracil-rich clusters that are shorter in length than corresponding uracil-rich clusters in the corresponding wild-type nucleotide sequence encoding the PBGD polypeptide.

[0316] In further embodiments, alternative lower frequency codons are employed. At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in the PBGD polypeptide-encoding ORF of the 5-methoxyuracil-comprising mRNA are substituted with alternative codons, each alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set. The ORF also has adjusted uracil content, as described above. In some embodiments, at least one codon in the ORF of the mRNA encoding the PBGD polypeptide is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.

[0317] In some embodiments, the adjusted uracil content, PBGD polypeptide-encoding ORF of the 5-methoxyuracil-comprising mRNA exhibits expression levels of PBGD when administered to a mammalian cell that are higher than expression levels of PBGD from the corresponding wild-type mRNA. In other embodiments, the expression levels of PBGD when administered to a mammalian cell are increased relative to a corresponding mRNA containing at least 95% 5-methoxyuracil and having a uracil content of about 160%, about 170%, about 180%, about 190%, or about 200% of the theoretical minimum. In yet other embodiments, the expression levels of PBGD when administered to a mammalian cell are increased relative to a corresponding mRNA, wherein at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of uracils are 1-methylpseudouracil or pseudouracils. In some embodiments, the mammalian cell is a mouse cell, a rat cell, or a rabbit cell. In other embodiments, the mammalian cell is a monkey cell or a human cell. In some embodiments, the human cell is a HeLa cell, a BJ fibroblast cell, or a peripheral blood mononuclear cell (PBMC). In some embodiments, PBGD is expressed when the mRNA is administered to a mammalian cell in vivo. In some embodiments, the mRNA is administered to mice, rabbits, rats, monkeys, or humans. In one embodiment, mice are null mice. In some embodiments, the mRNA is administered to mice in an amount of about 0.01 mg / kg, about 0.05 mg / kg, about 0.1 mg / kg, or about 0.15 mg / kg. In some embodiments, the mRNA is administered intravenously or intramuscularly. In other embodiments, the PBGD polypeptide is expressed when the mRNA is administered to a mammalian cell in vitro. In some embodiments, the expression is increased by at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or at least about 3000-fold. In other embodiments, the expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.

[0318] In some embodiments, adjusted uracil content, PBGD polypeptide-encoding ORF of the 5-methoxyuracil-comprising mRNA exhibits increased stability. In some embodiments, the mRNA exhibits increased stability in a cell relative to the stability of a corresponding wild-type mRNA under the same conditions. In some embodiments, the mRNA exhibits increased stability including resistance to nucleases, thermal stability, and / or increased stabilization of secondary structure. In some embodiments, increased stability exhibited by the mRNA is measured by determining the half-life of the mRNA (e.g., in a plasma, serum, cell, or tissue sample) and / or determining the area under the curve (AUC) of the protein expression by the mRNA over time (e.g., in vitro or in vivo). An mRNA is identified as having increased stability if the half-life and / or the AUC is greater than the half-life and / or the AUC of a corresponding wild-type mRNA under the same conditions.

[0319] In some embodiments, the mRNA induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by a corresponding wild-type mRNA under the same conditions. In other embodiments, the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by an mRNA that encodes for a PBGD polypeptide but does not comprise 5-methoxyuracil under the same conditions, or relative to the immune response induced by an mRNA that encodes for a PBGD polypeptide and that comprises 5-methoxyuracil but that does not have adjusted uracil content under the same conditions. The innate immune response can be manifested by increased expression of pro-inflammatory cytokines, activation of intracellular PRRs (RIG-I, MDA5, etc.), cell death, and / or termination or reduction in protein translation. In some embodiments, a reduction in the innate immune response can be measured by expression or activity level of Type 1 interferons (e.g., IFN-α, IFN-β, IFN-κ, IFN-δ, IFN-ε, IFN-τ, IFN-ω, and IFN-ζ) or the expression of interferon-regulated genes such as the toll-like receptors (e.g., TLR7 and TLR8), and / or by decreased cell death following one or more administrations of the mRNA into a cell.

[0320] In some embodiments, the expression of Type-1 interferons by a mammalian cell in response to the mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or greater than 99.9% relative to a corresponding wild-type mRNA, to an mRNA that encodes a PBGD polypeptide but does not comprise 5-methoxyuracil, or to an mRNA that encodes a PBGD polypeptide and that comprises 5-methoxyuracil but that does not have adjusted uracil content. In some embodiments, the interferon is IFN-β. In some embodiments, cell death frequency caused by administration of mRNA of the present disclosure to a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or over 95% less than the cell death frequency observed with a corresponding wild-type mRNA, an mRNA that encodes for a PBGD polypeptide but does not comprise 5-methoxyuracil, or an mRNA that encodes for a PBGD polypeptide and that comprises 5-methoxyuracil but that does not have adjusted uracil content. In some embodiments, the mammalian cell is a BJ fibroblast cell. In other embodiments, the mammalian cell is a splenocyte. In some embodiments, the mammalian cell is that of a mouse or a rat. In other embodiments, the mammalian cell is that of a human. In one embodiment, the mRNA of the present disclosure does not substantially induce an innate immune response of a mammalian cell into which the mRNA is introduced.

[0321] In some embodiments, the polynucleotide is an mRNA that comprises an ORF that encodes a PBGD polypeptide, wherein uracil in the mRNA is at least about 95% 5-methoxyuracil, wherein the uracil content of the ORF is between about 115% and about 135% of the theoretical minimum uracil content in the corresponding wild-type ORF, and wherein the uracil content in the ORF encoding the PBGD polypeptide is less than about 30% of the total nucleobase content in the ORF. In some embodiments, the ORF that encodes the PBGD polypeptide is further modified to increase G / C content of the ORF (absolute or relative) by at least about 40%, as compared to the corresponding wild-type ORF. In yet other embodiment, the ORF encoding the PBGD polypeptide contains less than 20 non-phenylalanine uracil pairs and / or triplets. In some embodiments, at least one codon in the ORF of the mRNA encoding the PBGD polypeptide is further substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set. In some embodiments, the expression of the PBGD polypeptide encoded by an mRNA comprising an ORF wherein uracil in the mRNA is at least about 95% 5-methoxyuracil, and wherein the uracil content of the ORF is between about 115% and about 135% of the theoretical minimum uracil content in the corresponding wild-type ORF, is increased by at least about 10-fold when compared to expression of the PBGD polypeptide from the corresponding wild-type mRNA. In some embodiments, the mRNA comprises an open ORF wherein uracil in the mRNA is at least about 95% 5-methoxyuracil, and wherein the uracil content of the ORF is between about 115% and about 135% of the theoretical minimum uracil content in the corresponding wild-type ORF, and wherein the mRNA does not substantially induce an innate immune response of a mammalian cell into which the mRNA is introduced.10. Methods for Modifying Polynucleotides

[0322] The invention includes modified polynucleotides comprising a polynucleotide described herein (i.e., an mRNA, comprising a nucleotide sequence encoding a PBGD polypeptide). The modified polynucleotides can be chemically modified and / or structurally modified. When the polynucleotides are chemically and / or structurally modified the polynucleotides can be referred to as "modified polynucleotides."

[0323] The present disclosure provides for modified nucleosides and nucleotides of a polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding a PBGD polypeptide. A "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A "nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.

[0324] The modified polynucleotides disclosed herein can comprise various distinct modifications. In some embodiments, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified polynucleotide, introduced to a cell can exhibit one or more desirable properties, e.g., improved protein expression, reduced immunogenicity, or reduced degradation in the cell, as compared to an unmodified polynucleotide.a. Structural Modifications

[0325] In some embodiments, a polynucleotide (i.e., a mRNA polynucleotide comprising a nucleotide sequence encoding a PBGD polypeptide) is structurally modified. As used herein, a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". Here, the dinucleotide "CC" has been inserted, resulting in a structural modification to the polynucleotide.b. Chemical Modifications

[0326] In some embodiments, the polynucleotides (i.e., a mRNA polynucleotide comprising a nucleotide sequence encoding a PBGD polypeptide) are chemically modified. As used herein in reference to a polynucleotide, the terms "chemical modification" or, as appropriate, "chemically modified" refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof. Generally, herein, these terms are not intended to refer to the ribonucleotide modifications in naturally occurring 5'-terminal mRNA cap moieties.

[0327] In some embodiments, the polynucleotides (i.e., a mRNA polynucleotide comprising a nucleotide sequence encoding a PBGD polypeptide) can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation, such as where all uridines are replaced by a uridine analog, e.g., 5-methoxyuridine. In another embodiment, the polynucleotides can have a uniform chemical modification of two, three, or four of the same nucleoside type throughout the entire polynucleotide (such as all uridines and / or all cytidines, etc. are modified in the same way).

[0328] Modified nucleotide base pairing encompasses not only the standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine or uracil. Any combination of base / sugar or linker can be incorporated into polynucleotides of the present disclosure.

[0329] The skilled artisan will appreciate that, except where otherwise noted, polynucleotide sequences set forth in the instant application will recite "T"s in a representative DNA sequence but where the sequence represents RNA, the "T"s would be substituted for "U"s.

[0330] Modifications of polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) that are useful in the compositions, methods and synthetic processes of the present disclosure include, but are not limited to the following nucleotides, nucleosides, and nucleobases: 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine; 2-methylthio-N6-methyladenosine; 2-methylthio-N6-threonyl carbamoyladenosine; N6-glycinylcarbamoyladenosine; N6-isopentenyladenosine; N6-methyladenosine; N6-threonylcarbamoyladenosine; 1,2'-O-dimethyladenosine; 1-methyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); 2-methyladenosine; 2-methylthio-N6 isopentenyladenosine; 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); Isopentenyladenosine; N6-(cis-hydroxyisopentenyl)adenosine; N6,2'-O-dimethyladenosine; N6,2'-O-dimethyladenosine; N6,N6,2'-O-trimethyladenosine; N6,N6-dimethyladenosine; N6-acetyladenosine; N6-hydroxynorvalylcarbamoyladenosine: N6-methyl-N6-threonylcarbamoyladenosine; 2-methyladenosine; 2-methylthio-N6-isopentenyladenosine; 7-deaza-adenosine; N1-methyl-adenosine; N6, N6 (dimethyl)adenine; N6-cis-hydroxy-isopentenyl-adenosine; α-thio-adenosine; 2 (amino)adenine; 2 (aminopropyl)adenine; 2 (methylthio) N6 (isopentenyl)adenine; 2-(alkyl)adenine; 2-(aminoalkyl)adenine; 2-(aminopropyl)adenine; 2-(halo)adenine; 2-(halo)adenine; 2-(propyl)adenine; 2'-Amino-2'-deoxy-ATP; 2'-Azido-2'-deoxy-ATP; 2'-Deoxy-2'-a-aminoadenosine TP; 2'-Deoxy-2'-a-azidoadenosine TP; 6 (alkyl)adenine; 6 (methyl)adenine; 6-(alkyl)adenine; 6-(methyl)adenine; 7 (deaza)adenine; 8 (alkenyl)adenine; 8 (alkynyl)adenine; 8 (amino)adenine; 8 (thioalkyl)adenine; 8-(alkenyl)adenine; 8-(alkyl)adenine; 8-(alkynyl)adenine; 8-(amino)adenine; 8-(halo)adenine; 8-(hydroxyl)adenine; 8-(thioalkyl)adenine; 8-(thiol)adenine; 8-azido-adenosine; aza adenine; deaza adenine; N6 (methyl)adenine; N6-(isopentyl)adenine; 7-deaza-8-aza-adenosine; 7-methyladenine; 1-Deazaadenosine TP; 2'Fluoro-N6-Bz-deoxyadenosine TP; 2'-OMe-2-Amino-ATP; 2'O-methyl-N6-Bz-deoxyadenosine TP; 2'-a-Ethynyladenosine TP; 2-aminoadenine; 2-Aminoadenosine TP; 2-Amino-ATP; 2'-a-Trifluoromethyladenosine TP; 2-Azidoadenosine TP; 2'-b-Ethynyladenosine TP; 2-Bromoadenosine TP; 2'-b-Trifluoromethyladenosine TP; 2-Chloroadenosine TP; 2'-Deoxy-2',2'-difluoroadenosine TP; 2'-Deoxy-2'-a-mercaptoadenosine TP; 2'-Deoxy-2'-a-thiomethoxyadenosine TP; 2'-Deoxy-2'-b-aminoadenosine TP; 2'-Deoxy-2'-b-azidoadenosine TP; 2'-Deoxy-2'-b-bromoadenosine TP; 2'-Deoxy-2'-b-chloroadenosine TP; 2'-Deoxy-2'-b-fluoroadenosine TP; 2'-Deoxy-2'-b-iodoadenosine TP; 2'-Deoxy-2'-b-mercaptoadenosine TP; 2'-Deoxy-2'-b-thiomethoxyadenosine TP; 2-Fluoroadenosine TP; 2-Iodoadenosine TP; 2-Mercaptoadenosine TP; 2-methoxy-adenine; 2-methylthio-adenine; 2-Trifluoromethyladenosine TP; 3-Deaza-3-bromoadenosine TP; 3-Deaza-3-chloroadenosine TP; 3-Deaza-3-fluoroadenosine TP; 3-Deaza-3-iodoadenosine TP; 3-Deazaadenosine TP; 4'-Azidoadenosine TP; 4'-Carbocyclic adenosine TP; 4'-Ethynyladenosine TP; 5'-Homo-adenosine TP; 8-Aza-ATP; 8-bromo-adenosine TP; 8-Trifluoromethyladenosine TP; 9-Deazaadenosine TP; 2-aminopurine; 7-deaza-2,6-diaminopurine; 7-deaza-8-aza-2,6-diaminopurine; 7-deaza-8-aza-2-aminopurine; 2,6-diaminopurine; 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine; 2-thiocytidine; 3-methylcytidine; 5-formylcytidine; 5-hydroxymethylcytidine; 5-methylcytidine; N4-acetylcytidine; 2'-O-methylcytidine; 2'-O-methylcytidine; 5,2'-O-dimethylcytidine; 5-formyl-2'-O-methylcytidine; Lysidine; N4,2'-O-dimethylcytidine; N4-acetyl-2'-O-methylcytidine; N4-methylcytidine; N4,N4-Dimethyl-2'-OMe-Cytidine TP; 4-methylcytidine; 5-aza-cytidine; Pseudo-iso-cytidine; pyrrolo-cytidine; α-thio-cytidine; 2-(thio)cytosine; 2'-Amino-2'-deoxy-CTP; 2'-Azido-2'-deoxy-CTP; 2'-Deoxy-2'-α-aminocytidine TP; 2'-Deoxy-2'-a-azidocytidine TP; 3 (deaza) 5 (aza)cytosine; 3 (methyl)cytosine; 3-(alkyl)cytosine; 3-(deaza) 5 (aza)cytosine; 3-(methyl)cytidine; 4,2'-O-dimethylcytidine; 5 (halo)cytosine: 5 (methyl)cytosine; 5 (propynyl)cytosine; 5 (trifluoromethyl)cytosine; 5-(alkyl)cytosine; 5-(alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine; 5-bromo-cytidine; 5-iodo-cytidine; 5-propynyl cytosine; 6-(azo)cytosine; 6-aza-cytidine; aza cytosine; deaza cytosine; N4 (acetyl)cytosine; 1-methyl-1-deaza-pseudoisocytidine; 1-methyl-pseudoisocytidine; 2-methoxy-5-methyl-cytidine; 2-methoxy-cytidine; 2-thio-5-methyl-cytidine; 4-methoxy-1-methyl-pseudoisocytidine; 4-methoxy-pseudoisocytidine; 4-thio-1-methyl-1-deaza-pseudoisocytidine; 4-thio-1-methyl-pseudoisocytidine; 4-thio-pseudoisocytidine; 5-aza-zebularine; 5-methyl-zebularine; pyrrolo-pseudoisocytidine; Zebularine; (E)-5-(2-Bromo-vinyl)cytidine TP; 2,2'-anhydro-cytidine TP hydrochloride; 2'Fluor-N4-Bz-cytidine TP; 2'Fluoro-N4-Acetyl-cytidine TP; 2'-O-Methyl-N4-Acetyl-cytidine TP; 2'O-methyl-N4-Bz-cytidine TP; 2'-a-Ethynylcytidine TP; 2'-a-Trifluoromethylcytidine TP; 2'-b-Ethynylcytidine TP; 2'-b-Trifluoromethylcytidine TP; 2'-Deoxy-2',2'-difluorocytidine TP; 2'-Deoxy-2'-a-mercaptocytidine TP; 2'-Deoxy-2'-a-thiomethoxycytidine TP; 2'-Deoxy-2'-b-aminocytidine TP; 2'-Deoxy-2'-b-azidocytidine TP; 2'-Deoxy-2'-b-bromocytidine TP; 2'-Deoxy-2'-b-chlorocytidine TP; 2'-Deoxy-2'-b-fluorocytidine TP; 2'-Deoxy-2'-b-iodocytidine TP; 2'-Deoxy-2'-b-mercaptocytidine TP; 2'-Deoxy-2'-b-thiomethoxycytidine TP; 2'-O-Methyl-5-(1-propynyl)cytidine TP; 3'-Ethynylcytidine TP; 4'-Azidocytidine TP; 4'-Carbocyclic cytidine TP; 4'-Ethynylcytidine TP; 5-(1-Propynyl)ara-cytidine TP; 5-(2-Chloro-phenyl)-2-thiocytidine TP; 5-(4-Amino-phenyl)-2-thiocytidine TP; 5-Aminoallyl-CTP; 5-Cyanocytidine TP; 5-Ethynylara-cytidine TP; 5-Ethynylcytidine TP; 5'-Homo-cytidine TP; 5-Methoxycytidine TP; 5-Trifluoromethyl-Cytidine TP; N4-Amino-cytidine TP; N4-Benzoyl-cytidine TP; Pseudoisocytidine; 7-methylguanosine; N2,2'-O-dimethylguanosine; N2-methylguanosine; Wyosine; 1,2'-O-dimethylguanosine; 1-methylguanosine; 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 7-aminomethyl-7-deazaguanosine; 7-cyano-7-deazaguanosine; Archaeosine; Methylwyosine; N2,7-dimethylguanosine; N2,N2,2'-O-trimethylguanosine; N2,N2,7-trimethylguanosine; N2,N2-dimethylguanosine; N2,7,2'-O-trimethylguanosine; 6-thio-guanosine; 7-deaza-guanosine; 8-oxo-guanosine; N1-methyl-guanosine; α-thio-guanosine; 2 (propyl)guanine; 2-(alkyl)guanine; 2'-Amino-2'-deoxy-GTP; 2'-Azido-2'-deoxy-GTP; 2'-Deoxy-2'-a-aminoguanosine TP; 2'-Deoxy-2'-a-azidoguanosine TP; 6 (methyl)guanine; 6-(alkyl)guanine; 6-(methyl)guanine; 6-methyl-guanosine; 7 (alkyl)guanine; 7 (deaza)guanine; 7 (methyl)guanine; 7-(alkyl)guanine; 7-(deaza)guanine; 7-(methyl)guanine; 8 (alkyl)guanine; 8 (alkynyl)guanine; 8 (halo)guanine; 8 (thioalkyl)guanine; 8-(alkenyl)guanine; 8-(alkyl)guanine; 8-(alkynyl)guanine; 8-(amino)guanine; 8-(halo)guanine; 8-(hydroxyl)guanine; 8-(thioalkyl)guanine; 8-(thiol)guanine; aza guanine; deaza guanine; N (methyl)guanine; N-(methyl)guanine; 1-methyl-6-thio-guanosine; 6-methoxy-guanosine; 6-thio-7-deaza-8-aza-guanosine; 6-thio-7-deaza-guanosine; 6-thio-7-methyl-guanosine; 7-deaza-8-aza-guanosine; 7-methyl-8-oxo-guanosine; N2,N2-dimethyl-6-thio-guanosine; N2-methyl-6-thio-guanosine; 1-Me-GTP; 2'Fluoro-N2-isobutyl-guanosine TP; 2'O-methyl-N2-isobutyl-guanosine TP; 2'-a-Ethynylguanosine TP; 2'-a-Trifluoromethylguanosine TP; 2'-b-Ethynylguanosine TP; 2'-b-Trifluoromethylguanosine TP; 2'-Deoxy-2',2'-difluoroguanosine TP; 2'-Deoxy-2'-a-mercaptoguanosine TP; 2'-Deoxy-2'-a-thiomethoxyguanosine TP; 2'-Deoxy-2'-b-aminoguanosine TP; 2'-Deoxy-2'-b-azidoguanosine TP; 2'-Deoxy-2'-b-bromoguanosine TP; 2'-Deoxy-2'-b-chloroguanosine TP; 2'-Deoxy-2'-b-fluoroguanosine TP; 2'-Deoxy-2'-b-iodoguanosine TP; 2'-Deoxy-2'-b-mercaptoguanosine TP; 2'-Deoxy-2'-b-thiomethoxyguanosine TP; 4'-Azidoguanosine TP; 4'-Carbocyclic guanosine TP; 4'-Ethynylguanosine TP; 5'-Homo-guanosine TP; 8-bromo-guanosine TP; 9-Deazaguanosine TP; N2-isobutyl-guanosine TP; 1-methylinosine; Inosine; 1,2'-O-dimethylinosine; 2'-O-methylinosine; 7-methylinosine; 2'-O-methylinosine; Epoxyqueuosine; galactosyl-queuosine; Mannosylqueuosine; Queuosine; allyamino-thymidine; aza thymidine; deaza thymidine; deoxy-thymidine; 2'-O-methyluridine; 2-thiouridine; 3-methyluridine; 5-carboxymethyluridine; 5-hydroxyuridine; 5-methyluridine; 5-taurinomethyl-2-thiouridine; 5-taurinomethyluridine; Dihydrouridine; Pseudouridine; (3-(3-amino-3-carboxypropyl)uridine; 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1-methylpseudouridine; 1-ethyl-pseudouridine; 2'-O-methyluridine; 2'-O-methylpseudouridine; 2'-O-methyluridine; 2-thio-2'-O-methyluridine; 3-(3-amino-3-carboxypropyl)uridine; 3,2'-O-dimethyluridine; 3-Methyl-pseudo-Uridine TP; 4-thiouridine; 5-(carboxyhydroxymethyl)uridine; 5-(carboxyhydroxymethyl)uridine methyl ester; 5,2'-O-dimethyluridine; 5,6-dihydro-uridine; 5-aminomethyl-2-thiouridine; 5-carbamoylmethyl-2'-O-methyluridine; 5-carbamoylmethyluridine; 5-carboxyhydroxymethyluridine; 5-carboxyhydroxymethyluridine methyl ester; 5-carboxymethylaminomethyl-2'-O-methyluridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; 5-carboxymethylaminomethyluridine; 5-Carbamoylmethyluridine TP; 5-methoxycarbonylmethyl-2'-O-methyluridine; 5-methoxycarbonylmethyl-2-thiouridine; 5-methoxycarbonylmethyluridine; 5-methyluridine,), 5-methoxyuridine; 5-methyl-2-thiouridine; 5-methylaminomethyl-2-selenouridine; 5-methylaminomethyl-2-thiouridine; 5-methylaminomethyluridine; 5-Methyldihydrouridine; 5-Oxyacetic acid- Uridine TP; 5-Oxyacetic acid-methyl ester-Uridine TP; N1-methyl-pseudo-uracil; N1-ethyl-pseudo-uracil; uridine 5-oxyacetic acid; uridine 5-oxyacetic acid methyl ester; 3-(3-Amino-3-carboxypropyl)-Uridine TP; 5-(iso-Pentenylaminomethyl)- 2-thiouridine TP; 5-(iso-Pentenylaminomethyl)-2'-O-methyluridine TP; 5-(iso-Pentenylaminomethyl)uridine TP; 5-propynyl uracil; α-thiouridine; 1 (aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouracil; 1 (aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudouracil; 1 (aminoalkylaminocarbonylethylenyl)-4 (thio)pseudouracil; 1 (aminoalkylaminocarbonylethylenyl)-pseudouracil; 1 (aminocarbonylethylenyl)-2(thio)-pseudouracil; 1 (aminocarbonylethylenyl)-2,4-(dithio)pseudouracil; 1 (aminocarbonylethylenyl)-4 (thio)pseudouracil; 1 (aminocarbonylethylenyl)-pseudouracil; 1 substituted 2(thio)-pseudouracil; 1 substituted 2,4-(dithio)pseudouracil; 1 substituted 4 (thio)pseudouracil; 1 substituted pseudouracil; 1-(aminoalkylamino-carbonylethylenyl)-2-(thio)-pseudouracil; 1-Methyl-3-(3-amino-3-carboxypropyl) pseudouridine TP; 1-Methyl-3-(3-amino-3-carboxypropyl)pseudo-UTP; 1-Methyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 2 (thio)pseudouracil; 2' deoxy uridine; 2' fluorouridine; 2-(thio)uracil; 2,4-(dithio)pseudouracil; 2' methyl, 2'amino, 2'azido, 2'fluro-guanosine; 2'-Amino-2'-deoxy-UTP; 2'-Azido-2'-deoxy-UTP; 2'-Azido-deoxyuridine TP; 2'-O-methylpseudouridine; 2' deoxy uridine; 2' fluorouridine; 2'-Deoxy-2'-a-aminouridine TP; 2'-Deoxy-2'-a-azidouridine TP; 2-methylpseudouridine; 3 (3 amino-3 carboxypropyl)uracil; 4 (thio)pseudouracil; 4-(thio )pseudouracil; 4-(thio)uracil; 4-thiouracil; 5 (1,3-diazole-1-alkyl)uracil; 5 (2-aminopropyl)uracil; 5 (aminoalkyl)uracil; 5 (dimethylaminoalkyl)uracil; 5 (guanidiniumalkyl)uracil; 5 (methoxycarbonylmethyl)-2-(thio)uracil; 5 (methoxycarbonyl-methyl)uracil; 5 (methyl) 2 (thio)uracil; 5 (methyl) 2,4 (dithio)uracil; 5 (methyl) 4 (thio)uracil; 5 (methylaminomethyl)-2 (thio)uracil; 5 (methylaminomethyl)-2,4 (dithio)uracil; 5 (methylaminomethyl)-4 (thio)uracil; 5 (propynyl)uracil; 5 (trifluoromethyl)uracil; 5-(2-aminopropyl)uracil; 5-(alkyl)-2-(thio)pseudouracil; 5-(alkyl)-2,4 (dithio)pseudouracil; 5-(alkyl)-4 (thio)pseudouracil; 5-(alkyl)pseudouracil; 5-(alkyl)uracil; 5-(alkynyl)uracil; 5-(allylamino)uracil; 5-(cyanoalkyl)uracil; 5-(dialkylaminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidiniumalkyl)uracil; 5-(halo)uracil; 5-(1,3-diazole-1-alkyl)uracil; 5-(methoxy)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5-(methoxycarbonyl-methyl)uracil; 5-(methyl) 2(thio)uracil; 5-(methyl) 2,4 (dithio )uracil; 5-(methyl) 4 (thio)uracil; 5-(methyl)-2-(thio)pseudouracil; 5-(methyl)-2,4 (dithio)pseudouracil; 5-(methyl)-4 (thio)pseudouracil; 5-(methyl)pseudouracil; 5-(methylaminomethyl)-2 (thio)uracil; 5-(methylaminomethyl)-2,4(dithio )uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5-(trifluoromethyl)uracil; 5-aminoallyl-uridine; 5-bromo-uridine; 5-iodo-uridine; 5-uracil; 6 (azo)uracil; 6-(azo)uracil; 6-aza-uridine; ally amino-uracil; aza uracil; deaza uracil; N3 (methyl)uracil; P seudo-UTP-1-2-ethanoic acid; Pseudouracil; 4-Thio-pseudo-UTP; 1-carboxymethyl-pseudouridine; 1-methyl-1-deaza-pseudouridine; 1-propynyl-uridine; 1-taurinomethyl-1-methyl-uridine; 1-taurinomethyl-4-thio-uridine; 1-taurinomethyl-pseudouridine; 2-methoxy-4-thio-pseudouridine; 2-thio-1-methyl-1-deaza-pseudouridine; 2-thio-1-methyl-pseudouridine; 2-thio-5-aza-uridine; 2-thio-dihydropseudouridine; 2-thio-dihydrouridine; 2-thio-pseudouridine; 4-methoxy-2-thio-pseudouridine; 4-methoxy-pseudouridine; 4-thio-1-methyl-pseudouridine; 4-thio-pseudouridine; 5-aza-uridine; Dihydropseudouridine; (±)1-(2-Hydroxypropyl)pseudouridine TP; (2R)-1-(2-Hydroxypropyl)pseudouridine TP; (2S)-1-(2-Hydroxypropyl)pseudouridine TP; (E)-5-(2-Bromo-vinyl)ara-uridine TP; (E)-5-(2-Bromo-vinyl)uridine TP; (Z)-5-(2-Bromo-vinyl)ara-uridine TP; (Z)-5-(2-Bromo-vinyl)uridine TP; 1-(2,2,2-Trifluoroethyl)-pseudo-UTP; 1-(2,2,3,3,3-Pentafluoropropyl)pseudouridine TP; 1-(2,2-Diethoxyethyl)pseudouridine TP; 1-(2,4,6-Trimethylbenzyl)pseudouridine TP; 1-(2,4,6-Trimethyl-benzyl)pseudo-UTP; 1-(2,4,6-Trimethyl-phenyl)pseudo-UTP; 1-(2-Amino-2-carboxyethyl)pseudo-UTP; 1-(2-Amino-ethyl)pseudo-UTP; 1-(2-Hydroxyethyl)pseudouridine TP; 1-(2-Methoxyethyl)pseudouridine TP; 1-(3,4-Bis-trifluoromethoxybenzyl)pseudouridine TP; 1-(3,4-Dimethoxybenzyl)pseudouridine TP; 1-(3-Amino-3-carboxypropyl)pseudo-UTP; 1-(3-Amino-propyl)pseudo-UTP; 1-(3-Cyclopropyl-prop-2-ynyl)pseudouridine TP; 1-(4-Amino-4-carboxybutyl)pseudo-UTP; 1-(4-Amino-benzyl)pseudo-UTP; 1-(4-Aminobutyl)pseudo-UTP; 1-(4-Amino-phenyl)pseudo-UTP; 1-(4-Azidobenzyl)pseudouridine TP; 1-(4-Bromobenzyl)pseudouridine TP; 1-(4-Chlorobenzyl)pseudouridine TP; 1-(4-Fluorobenzyl)pseudouridine TP; 1-(4-Iodobenzyl)pseudouridine TP; 1-(4-Methanesulfonylbenzyl)pseudouridine TP; 1-(4-Methoxybenzyl)pseudouridine TP; 1-(4-Methoxy-benzyl)pseudo-UTP; 1-(4-Methoxy-phenyl)pseudo-UTP; 1-(4-Methylbenzyl)pseudouridine TP; 1-(4-Methyl-benzyl)pseudo-UTP; 1-(4-Nitrobenzyl)pseudouridine TP; 1-(4-Nitro-benzyl)pseudo-UTP; 1(4-Nitro-phenyl)pseudo-UTP; 1-(4-Thiomethoxybenzyl)pseudouridine TP; 1-(4-Trifluoromethoxybenzyl)pseudouridine TP; 1-(4-Trifluoromethylbenzyl)pseudouridine TP; 1-(5-Amino-pentyl)pseudo-UTP; 1-(6-Amino-hexyl)pseudo-UTP; 1,6-Dimethyl-pseudo-UTP; 1-[3-(2-{2-[2-(2-Aminoethoxy)-ethoxy]-ethoxy}-ethoxy)-propionyl]pseudouridine TP; 1-{3-[2-(2-Aminoethoxy)-ethoxy]-propionyl } pseudouridine TP; 1-Acetylpseudouridine TP; 1-Alkyl-6-(1-propynyl)-pseudo-UTP; 1-Alkyl-6-(2-propynyl)-pseudo-UTP; 1-Alkyl-6-allyl-pseudo-UTP; 1-Alkyl-6-ethynyl-pseudo-UTP; 1-Alkyl-6-homoallyl-pseudo-UTP; 1-Alkyl-6-vinyl-pseudo-UTP; 1-Allylpseudouridine TP; 1-Aminomethyl-pseudo-UTP; 1-Benzoylpseudouridine TP; 1-Benzyloxymethylpseudouridine TP; 1-Benzyl-pseudo-UTP; 1-Biotinyl-PEG2-pseudouridine TP; 1-Biotinylpseudouridine TP; 1-Butyl-pseudo-UTP; 1-Cyanomethylpseudouridine TP; 1-Cyclobutylmethyl-pseudo-UTP; 1-Cyclobutyl-pseudo-UTP; 1-Cycloheptylmethyl-pseudo-UTP; 1-Cycloheptyl-pseudo-UTP; 1-Cyclohexylmethyl-pseudo-UTP; 1-Cyclohexyl-pseudo-UTP; 1-Cyclooctylmethyl-pseudo-UTP; 1-Cyclooctyl-pseudo-UTP; 1-Cyclopentylmethyl-pseudo-UTP; 1-Cyclopentyl-pseudo-UTP; 1-Cyclopropylmethyl-pseudo-UTP; 1-Cyclopropyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 1-Hexyl-pseudo-UTP; 1-Homoallylpseudouridine TP; 1-Hydroxymethylpseudouridine TP; 1-iso-propyl-pseudo-UTP; 1-Me-2-thio-pseudo-UTP; 1-Me-4-thio-pseudo-UTP; 1-Me-alpha-thio-pseudo-UTP; 1-Methanesulfonylmethylpseudouridine TP; 1-Methoxymethylpseudouridine TP; 1-Methyl-6-(2,2,2-Trifluoroethyl)pseudo-UTP; 1-Methyl-6-(4-morpholino)-pseudo-UTP; 1-Methyl-6-(4-thiomorpholino)-pseudo-UTP; 1-Methyl-6-(substituted phenyl)pseudo-UTP; 1-Methyl-6-amino-pseudo-UTP; 1-Methyl-6-azido-pseudo-UTP; 1-Methyl-6-bromo-pseudo-UTP; 1-Methyl-6-butyl-pseudo-UTP; 1-Methyl-6-chloro-pseudo-UTP; 1-Methyl-6-cyano-pseudo-UTP; 1-Methyl-6-dimethylamino-pseudo-UTP; 1-Methyl-6-ethoxy-pseudo-UTP; 1-Methyl-6-ethylcarboxylate-pseudo-UTP; 1-Methyl-6-ethyl-pseudo-UTP; 1-Methyl-6-fluoro-pseudo-UTP; 1-Methyl-6-formyl-pseudo-UTP; 1-Methyl-6-hydroxyamino-pseudo-UTP; 1-Methyl-6-hydroxy-pseudo-UTP; 1-Methyl-6-iodo-pseudo-UTP; 1-Methyl-6-iso-propyl-pseudo-UTP; 1-Methyl-6-methoxy-pseudo-UTP; 1-Methyl-6-methylamino-pseudo-UTP; 1-Methyl-6-phenyl-pseudo-UTP; 1-Methyl-6-propyl-pseudo-UTP; 1-Methyl-6-tert-butyl-pseudo-UTP; 1-Methyl-6-trifluoromethoxy-pseudo-UTP; 1-Methyl-6-trifluoromethyl-pseudo-UTP; 1-Morpholinomethylpseudouridine TP; 1-Pentyl-pseudo-UTP; 1-Phenyl-pseudo-UTP; 1-Pivaloylpseudouridine TP; 1-Propargylpseudouridine TP; 1-Propyl-pseudo-UTP; 1-propynyl-pseudouridine; 1-p-tolyl-pseudo-UTP; 1-tert-Butyl-pseudo-UTP; 1-Thiomethoxymethylpseudouridine TP; 1-Thiomorpholinomethylpseudouridine TP; 1-Trifluoroacetylpseudouridine TP; 1-Trifluoromethyl-pseudo-UTP; 1-Vinylpseudouridine TP; 2,2'-anhydro-uridine TP; 2'-bromo-deoxyuridine TP; 2'-F-5-Methyl-2'-deoxy-UTP; 2'-OMe-5-Me-UTP; 2'-OMe-pseudo-UTP; 2'-a-Ethynyluridine TP; 2'-a-Trifluoromethyluridine TP; 2'-b-Ethynyluridine TP; 2'-b-Trifluoromethyluridine TP; 2'-Deoxy-2',2'-difluorouridine TP; 2'-Deoxy-2'-a-mercaptouridine TP; 2'-Deoxy-2'-a-thiomethoxyuridine TP; 2'-Deoxy-2'-b-aminouridine TP; 2'-Deoxy-2'-b-azidouridine TP; 2'-Deoxy-2'-b-bromouridine TP; 2'-Deoxy-2'-b-chlorouridine TP; 2'-Deoxy-2'-b-fluorouridine TP; 2'-Deoxy-2'-b-iodouridine TP; 2'-Deoxy-2'-b-mercaptouridine TP; 2'-Deoxy-2'-b-thiomethoxyuridine TP; 2-methoxy-4-thio-uridine; 2-methoxyuridine; 2'-O-Methyl-5-(1-propynyl)uridine TP; 3-Alkyl-pseudo-UTP; 4'-Azidouridine TP; 4'-Carbocyclic uridine TP; 4'-Ethynyluridine TP; 5-(1-Propynyl)ara-uridine TP; 5-(2-Furanyl)uridine TP; 5-Cyanouridine TP; 5-Dimethylaminouridine TP; 5'-Homo-uridine TP; 5-iodo-2'-fluoro-deoxyuridine TP; 5-Phenylethynyluridine TP; 5-Trideuteromethyl-6-deuterouridine TP; 5-TrifluoromethylUridine TP; 5-Vinylarauridine TP; 6-(2,2,2-Trifluoroethyl)-pseudo-UTP; 6-(4-Morpholino)-pseudo-UTP; 6-(4-Thiomorpholino)-pseudo-UTP; 6-(Substituted-Phenyl)-pseudo-UTP; 6-Amino-pseudo-UTP; 6-Azido-pseudo-UTP; 6-Bromo-pseudo-UTP; 6-Butyl-pseudo-UTP; 6-Chloro-pseudo-UTP; 6-Cyano-pseudo-UTP; 6-Dimethylamino-pseudo-UTP; 6-Ethoxy-pseudo-UTP; 6-Ethylcarboxylate-pseudo-UTP; 6-Ethyl-pseudo-UTP; 6-Fluoro-pseudo-UTP; 6-Formyl-pseudo-UTP; 6-Hydroxyamino-pseudo-UTP; 6-Hydroxy-pseudo-UTP; 6-Iodo-pseudo-UTP; 6-iso-Propyl-pseudo-UTP; 6-Methoxy-pseudo-UTP; 6-Methylamino-pseudo-UTP; 6-Methyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Propyl-pseudo-UTP; 6-tert-Butyl-pseudo-UTP; 6-Trifluoromethoxy-pseudo-UTP; 6-Trifluoromethyl-pseudo-UTP; Alpha-thio-pseudo-UTP; Pseudouridine 1-(4-methylbenzenesulfonic acid) TP; Pseudouridine 1-(4-methylbenzoic acid) TP; Pseudouridine TP 1-[3-(2-ethoxy)]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-(2-ethoxy )-ethoxy]-ethoxy )-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-{2(2-ethoxy )-ethoxy}-ethoxy]-ethoxy )-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-ethoxy ]-ethoxy)-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}] propionic acid; Pseudouridine TP 1-methylphosphonic acid; Pseudouridine TP 1-methylphosphonic acid diethyl ester; Pseudo-UTP-N1-3-propionic acid; Pseudo-UTP-N1-4-butanoic acid; Pseudo-UTP-N1-5-pentanoic acid; Pseudo-UTP-N1-6-hexanoic acid; Pseudo-UTP-N1-7-heptanoic acid; Pseudo-UTP-N1-methyl-p-benzoic acid; Pseudo-UTP-N1-p-benzoic acid; Wybutosine; Hydroxywybutosine; Isowyosine; Peroxywybutosine; undermodified hydroxywybutosine; 4-demethylwyosine; 2,6-(diamino)purine;1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl: 1,3-( diaza)-2-( oxo )-phenthiazin-1-yl;1,3-(diaza)-2-(oxo)-phenoxazin-1-yl;1,3,5-(triaza)-2,6-(dioxa)-naphthalene;2 (amino)purine;2,4,5-(trimethyl)phenyl;2' methyl, 2'amino, 2'azido, 2'fluro-cytidine;2' methyl, 2'amino, 2'azido, 2'fluro-adenine;2'methyl, 2'amino, 2'azido, 2'fluro-uridine;2'-amino-2'-deoxyribose; 2-amino-6-Chloro-purine; 2-aza-inosinyl; 2'-azido-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified bases; 2'-O-methyl-ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxo-pyridopyrimidine-3-yl; 2-pyridinone; 3 nitropyrrole; 3-(methyl)-7-(propynyl)isocarbostyrilyl; 3-(methyl)isocarbostyrilyl; 4-(fluoro)-6-(methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(methyl)indolyl; 4,6-(dimethyl)indolyl; 5 nitroindole; 5 substituted pyrimidines; 5-(methyl)isocarbostyrilyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloropurine; 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio )-3-(aza)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-( diaza)-2-( oxo )-phenthiazin-l-yl; 7-(aminoalkylhydroxy)-l,3-( diaza)-2-(oxo)-phenoxazin-l-yl; 7-(aza)indolyl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio )-3-(aza)-phenoxazinl-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio )-3-(aza)-phenthiazin-l-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidiniumalkyl-hydroxy)-l,3-( diaza)-2-( oxo )-phenthiazin-l-yl; 7-(guanidiniumalkylhydroxy)-l,3-(diaza)-2-( oxo )-phenoxazin-l-yl; 7-(propynyl)isocarbostyrilyl; 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidizopyridinyl; Aminoindolyl; Anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Difluorotolyl; Hypoxanthine; Imidizopyridinyl; Inosinyl; Isocarbostyrilyl; Isoguanisine; N2-substituted purines; N6-methyl-2-aminopurine; N6-substituted purines; N-alkylated derivative; Napthalenyl; Nitrobenzimidazolyl; Nitroimidazolyl; Nitroindazolyl; Nitropyrazolyl; Nubularine; O6-substituted purines; O-alkylated derivative; ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Oxoformycin TP; para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Pentacenyl; Phenanthracenyl; Phenyl; propynyl-7-(aza)indolyl; Pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl; pyrrolo-pyrimidin-2-on-3-yl; Pyrrolopyrimidinyl; Pyrrolopyrizinyl; Stilbenzyl; substituted 1,2,4-triazoles; Tetracenyl; Tubercidine; Xanthine; Xanthosine-5'-TP; 2-thio-zebularine; 5-aza-2-thio-zebularine; 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-Amino-riboside-TP; Formycin A TP; Formycin B TP; Pyrrolosine TP; 2'-OH-ara-adenosine TP; 2'-OH-ara-cytidine TP; 2'-OH-ara-uridine TP; 2'-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP; and N6-(19-Amino-pentaoxanonadecyl)adenosine TP.

[0331] In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) includes a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0332] In some embodiments, the mRNA comprises at least one chemically modified nucleoside. In some embodiments, the at least one chemically modified nucleoside is selected from the group consisting of pseudouridine (ψ), 2-thiouridine (s2U), 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyl uridine, 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), α-thio-guanosine, α-thio-adenosine, 5-cyano uridine, 4'-thio uridine 7-deaza-adenine, 1-methyladenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), and 2,6-Diaminopurine, (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lysidine, 2-selenouridine, 3-(3-amino-3-carboxypropyl)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 3-methylpseudouridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-selenouridine, 5-cyanomethyluridine, 5-hydroxycytidine, 5-methylaminomethyl-2-geranylthiouridine, 7-aminocarboxypropyl-demethylwyosine, 7-aminocarboxypropylwyosine, 7-aminocarboxypropylwyosine methyl ester, 8-methyladenosine, N4,N4-dimethylcytidine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, cyclic N6-threonylcarbamoyladenosine, glutamyl-queuosine, methylated undermodified hydroxywybutosine, N4,N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethyl-2-thiouridine, geranylated 5-carboxymethylaminomethyl-2-thiouridine, Qbase, preQ0base, preQ1base, and two or more combinations thereof. In some embodiments, the at least one chemically modified nucleoside is selected from the group consisting of pseudouridine, 1-methylpseudouridine, 1-ethyl-pseudouridine, 5-methylcytosine, 5-methoxyuridine, and a combination thereof. In some embodiments, the polynucleotide (i.e. mRNA polynucleotide) includes a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.(i) Base Modifications

[0333] In certain embodiments, the chemical modification is at nucleobases in the polynucleotides (i.e. mRNA polynucleotide). In some embodiments, modified nucleobases in the polynucleotide (i.e. mRNA polynucleotide) are selected from the group consisting of 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (ψ), α-thio-guanosine and α-thio-adenosine. In some embodiments, the polynucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0334] In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises pseudouridine (ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 1-methyl-pseudouridine (m1ψ). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 1-ethyl-pseudouridine (e1ψ). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 1-methyl-pseudouridine (m1ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polynucleotide ( i.e., mRNA polynucleotide) comprises 1-ethyl-pseudouridine (e1ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 2-thiouridine (s2U). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 2-thiouridine and 5-methyl-cytidine (m5C). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises methoxy-uridine (mo5U). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 2'-O-methyl uridine. In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 2'-O-methyl uridine and 5-methyl-cytidine (m5C). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises N6-methyl-adenosine (m6A). In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

[0335] In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 5-methyl-cytidine (m5C), meaning that all cytosine residues in the mRNA sequence are replaced with 5-methyl-cytidine (m5C). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as any of those set forth above.

[0336] In some embodiments, the chemically modified nucleosides in the open reading frame are selected from the group consisting of uridine, adenine, cytosine, guanine, and any combination thereof.

[0337] In some embodiments, the modified nucleobase is a modified cytosine. Examples of nucleobases and nucleosides having a modified cytosine include N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine.

[0338] In some embodiments, a modified nucleobase is a modified uridine. Example nucleobases and nucleosides having a modified uridine include 5-cyano uridine or 4'-thio uridine.

[0339] In some embodiments, a modified nucleobase is a modified adenine. Example nucleobases and nucleosides having a modified adenine include 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), and 2,6-Diaminopurine.

[0340] In some embodiments, a modified nucleobase is a modified guanine. Example nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine.

[0341] In some embodiments, the nucleobase modified nucleotides in the polynucleotide (i.e., mRNA polynucleotide) are 5-methoxyuridine.

[0342] In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) includes a combination of at least two (e.g., 2, 3, 4 or more) of modified nucleobases.

[0343] In some embodiments, at least 95% of a type of nucleobases (e.g., uracil) in a polynucleotide ( i.e., an mRNA polynucleotide encoding PBGD) are modified nucleobases. In some embodiments, at least 95% of uracil in a polynucleotide of the present invention (i.e., an mRNA polynucleotide encoding PBGD) is 5-methoxyuracil.

[0344] In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) comprises 5-methoxyuridine (5mo5U) and 5-methyl-cytidine (m5C).

[0345] In some embodiments, the polynucleotide (i.e., mRNA polynucleotide) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 5-methoxyuridine, meaning that substantially all uridine residues in the mRNA sequence are replaced with 5-methoxyuridine. Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as any of those set forth above.

[0346] In some embodiments, the modified nucleobase is a modified cytosine.

[0347] In some embodiments, a modified nucleobase is a modified uracil. Example nucleobases and nucleosides having a modified uracil include 5-methoxyuracil.

[0348] In some embodiments, a modified nucleobase is a modified adenine.

[0349] In some embodiments, a modified nucleobase is a modified guanine.

[0350] In some embodiments, the nucleobases, sugar, backbone, or any combination thereof in the open reading frame encoding a PBGD polypeptide are chemically modified by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%.

[0351] In some embodiments, the uridine nucleosides in the open reading frame encoding a PBGD polypeptide are chemically modified by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%.

[0352] In some embodiments, the adenosine nucleosides in the open reading frame encoding a PBGD polypeptide are chemically modified by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%.

[0353] In some embodiments, the cytidine nucleosides in the open reading frame encoding a PBGD polypeptide are chemically modified by at least at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%.

[0354] In some embodiments, the guanosine nucleosides in the open reading frame encoding a PBGD polypeptide are chemically modified by at least at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100%.

[0355] In some embodiments, the polynucleotides can include any useful linker between the nucleosides. Such linkers, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH 3 )-CH 2 -CH 2 -, oligonucleosides with heteroatom internucleoside linkage, phosphinates, phosphoramidates, phosphorodithioates, phosphorothioate internucleoside linkages, phosphorothioates, phosphotriesters, PNA, siloxane backbones, sulfamate backbones, sulfide sulfoxide and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkylphosphonates, thionoalkylphosphotriesters, and thionophosphoramidates.(ii) Sugar Modifications

[0356] The modified nucleosides and nucleotides (e.g., building block molecules), which can be incorporated into a polynucleotide (i.e., mRNA, as described herein), can be modified on the sugar of the ribonucleic acid. For example, the 2' hydroxyl group (OH) can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-10 aryl-C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); "locked" nucleic acids (LNA) in which the 2'-hydroxyl is connected by a C 1-6 alkylene or C 1-6 heteroalkylene bridge to the 4'-carbon of the same ribose sugar, where exemplary bridges included methylene, propylene, ether, or amino bridges; aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino as defined herein; and amino acid, as defined herein

[0357] Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting modified nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with α-L-threofuranosyl-(3'→2')), and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone). The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar. Such sugar modifications are taught International Patent Publication Nos. WO2013052523 and WO2014093924.(iii) Combinations of Modifications

[0358] The polynucleotides in the composition of the invention (i.e., a mRNA polynucleotide comprising a nucleotide sequence encoding a PBGD polypeptide or a functional fragment or variant thereof) can include a combination of modifications to the sugar, the nucleobase, and / or the internucleoside linkage. These combinations can include any one or more modifications described herein.

[0359] Combinations of modified nucleotides can be used to form the polynucleotides. Unless otherwise noted, the modified nucleotides can be completely substituted for the natural nucleotides of the polynucleotides. As a non-limiting example, the natural nucleotide uridine can be substituted with a modified nucleoside described herein. In another non-limiting example, the natural nucleotide uridine can be partially substituted or replaced (e.g., about 0.1%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99.9%) with at least one of the modified nucleoside disclosed herein. Any combination of base / sugar or linker can be incorporated into the and such modifications are taught in International Patent Publications WO2013052523 and WO2014093924, and U.S. Publ. Nos. US 20130115272 and US20150307542.11. Untranslated Regions (UTRs)

[0360] Untranslated regions (UTRs) are nucleic acid sections of a polynucleotide before a start codon (5'UTR) and after a stop codon (3'UTR) that are not translated. In some embodiments, a polynucleotide ( i.e., a messenger RNA (mRNA)) comprising an open reading frame (ORF) encoding a PBGD polypeptide further comprises UTR (e.g., a 5'UTR or functional fragment thereof, a 3'UTR or functional fragment thereof, or a combination thereof).

[0361] A UTR can be homologous or heterologous to the coding region in a polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding the PBGD polypeptide. In some embodiments, the UTR is heterologous to the ORF encoding the PBGD polypeptide. In some embodiments, the polynucleotide comprises two or more 5'UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3'UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences.

[0362] In some embodiments, the 5'UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof is sequence optimized.

[0363] In some embodiments, the 5'UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., 1-methylpseudouridine or 5-methoxyuracil.

[0364] UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization and / or translation efficiency. A polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5'UTR or 3'UTR comprises one or more regulatory features of a full length 5' or 3' UTR, respectively.

[0365] Natural 5'UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another 'G'. 5'UTRs also have been known to form secondary structures that are involved in elongation factor binding.

[0366] By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a polynucleotide. For example, introduction of 5'UTR of liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of polynucleotides in hepatic cell lines or liver. Likewise, use of 5'UTR from other tissue-specific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1, CD36), for myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS), for leukocytes (e.g., CD45, CD18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (e.g., SP-A / B / C / D).

[0367] In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature or property. For example, an encoded polypeptide can belong to a family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide.

[0368] In some embodiments, the 5'UTR and the 3'UTR can be heterologous. In some embodiments, the 5'UTR can be derived from a different species than the 3'UTR. In some embodiments, the 3'UTR can be derived from a different species than the 5'UTR.

[0369] Co-owned International Patent Application No. PCT / US2014 / 021522 (Publ. No. WO / 2014 / 164253) provides a listing of exemplary UTRs that can be utilized in the polynucleotide as flanking regions to an ORF.

[0370] Exemplary UTRs of the application include, but are not limited to, one or more 5'UTR and / or 3'UTR derived from the nucleic acid sequence of: a globin, such as an α- or β-globin (e.g., a Xenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 α polypeptide); an albumin (e.g., human albumin7); a HSD17B4 (hydroxysteroid (17-β) dehydrogenase); a virus (e.g., a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus, or a PAV barley yellow dwarf virus); a heat shock protein (e.g., hsp70); a translation initiation factor (e.g., elF4G); a glucose transporter (e.g., hGLUT1 (human glucose transporter 1)); an actin (e.g., human α or β actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g., a 5'UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g., human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g., ATPSA1 or the β subunit of mitochondrial H +< -ATP synthase); a growth hormone e (e.g., bovine (bGH) or human (hGH)); an elongation factor (e.g., elongation factor 1 α1 (EEF1A1)); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a β-F1-ATPase, a creatine kinase, a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g., collagen type I, alpha 2 (Col1A2), collagen type I, alpha 1 (Col1A1), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (Col6A1)); a ribophorin (e.g., ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g., LRP1); a cardiotrophin-like cytokine factor (e.g., Nnt1); calreticulin (Calr); a procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plod1); and a nucleobindin (e.g., Nucb1).

[0371] In some embodiments, the 5'UTR is selected from the group consisting of a β-globin 5'UTR; a 5'UTR containing a strong Kozak translational initiation signal; a cytochrome b-245 α polypeptide (CYBA) 5'UTR; a hydroxysteroid (17-β) dehydrogenase (HSD17B4) 5'UTR; a Tobacco etch virus (TEV) 5'UTR; a Venezuelen equine encephalitis virus (TEEV) 5'UTR; a 5' proximal open reading frame of rubella virus (RV) RNA encoding nonstructural proteins; a Dengue virus (DEN) 5'UTR; a heat shock protein 70 (Hsp70) 5'UTR; a eIF4G 5'UTR; a GLUT1 5'UTR; functional fragments thereof and any combination thereof.

[0372] In some embodiments, the 3'UTR is selected from the group consisting of a β-globin 3'UTR; a CYBA 3'UTR; an albumin 3'UTR; a growth hormone (GH) 3'UTR; a VEEV 3'UTR; a hepatitis B virus (HBV) 3'UTR; α-globin 3'UTR; a DEN 3'UTR; a PAV barley yellow dwarf virus (BYDV-PAV) 3'UTR; an elongation factor 1 α1 (EEF1A1) 3'UTR; a manganese superoxide dismutase (MnSOD) 3'UTR; a β subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3'UTR; a GLUT1 3'UTR; a MEF2A 3'UTR; a β-F1-ATPase 3'UTR; functional fragments thereof and combinations thereof.

[0373] Wild-type UTRs derived from any gene or mRNA can be incorporated into the polynucleotides. In some embodiments, a UTR can be altered relative to a wild type or native UTR to produce a variant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5' or 3' UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR.

[0374] Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, and sequences available at www.addgene.org / Derrick_Rossi / .

[0375] UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence, a 5' and / or 3' UTR can be inverted, shortened, lengthened, or combined with one or more other 5' UTRs or 3' UTRs.

[0376] In some embodiments, the polynucleotide comprises multiple UTRs, e.g., a double, a triple or a quadruple 5'UTR or 3'UTR. For example, a double UTR comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3'UTR can be used (see US2010 / 0129877).

[0377] In certain embodiments, the polynucleotides of the invention comprise a 5'UTR and / or a 3'UTR selected from any of the UTRs disclosed herein. In some embodiments, the 5'UTR comprises: 5'UTR-001 (Upstream UTR) (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 39); 5'UTR-002 (Upstream UTR) (GGGAGAUCAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 40); 5'UTR-003 (Upstream UTR) (See SEQ ID NO. 41); 5'UTR-004 (Upstream UTR) (GGGAGACAAGCUUGGCAUUCCGGUACUGUUGGUAAAGCCACC) (SEQ ID NO. 42); 5'UTR-005 (Upstream UTR) (GGGAGAUCAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 43); 5'UTR-006 (Upstream UTR) (See SEQ ID NO. 44); 5'UTR-007 (Upstream UTR) (GGGAGACAAGCUUGGCAUUCCGGUACUGUUGGUAAAGCCACC) (SEQ ID NO. 45); 5'UTR-008 (Upstream UTR) (GGGAAUUAACAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 46); 5'UTR-009 (Upstream UTR) (GGGAAAUUAGACAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 47); UTR 5'UTR-010, Upstream (GGGAAAUAAGAGAGUAAAGAACAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 48); S'UTR-011 (Upstream UTR) (GGGAAAAAAGAGAGAAAAGAAGACUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 49); 5'UTR-012 (Upstream UTR) (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAUAUAUAAGAGCCACC) (SEQ ID NO. 50); 5'UTR-013 (Upstream UTR) (GGGAAAUAAGAGACAAAACAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 51); 5'UTR-014 (Upstream UTR) (GGGAAAUUAGAGAGUAAAGAACAGUAAGUAGAAUUAAAAGAGCCACC) (SEQ ID NO. 52); 5'UTR-15 (Upstream UTR) (GGGAAAUAAGAGAGAAUAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) (SEQ ID NO. 53); 5'UTR-016 (Upstream UTR) (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAAUUAAGAGCCACC) (SEQ ID NO. 54); 5'UTR-017 (Upstream UTR) (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUUUAAGAGCCACC) (SEQ ID NO. 55); or S'UTR-018 (Upstream UTR)

[0378] In some embodiments, the 3'UTR comprises: 142-3p 3'UTR (UTR including miR142-3p binding site) 142-3p 3'UTR (UTR including miR142-3p binding site) 142-3p 3'UTR (UTR including miR142-3p binding site) 142-3p 3'UTR (UTR including miR142-3p binding site) 142-3p 3'UTR (UTR including miR142-3p binding site) 142-3p 3'UTR (UTR including miR142-3p binding site) 142-3p 3'UTR (UTR including miR142-3p binding site) 3'UTR-001 (Creatine Kinase UTR) (See SEQ ID NO. 64); 3'UTR-002 (Myoglobin UTR) (See SEQ ID NO. 65); 3'UTR-003 (α-actin UTR) (See SEQ ID NO. 66); 3'UTR-004 (Albumin UTR) (See SEQ ID NO. 67); 3'UTR-005 (α-globin UTR) (See SEQ ID NO. 68); 3'UTR-006 (G-CSF UTR) (See SEQ ID NO. 69); 3'UTR-007 (Col1a2; collagen, type I, alpha 2 UTR) (See SEQ ID NO. 70); 3'UTR-008 (Col6a2; collagen, type VI, alpha 2 UTR) (See SEQ ID NO. 71); 3'UTR-009 (RPN1; ribophorin I UTR) (See SEQ ID NO. 72); 3'UTR-010 (LRP1; low density lipoprotein receptor-related protein 1 UTR) (See SEQ ID NO. 73); 3'UTR-011 (Nnt1; cardiotrophin-like cytokine factor 1 UTR) (See SEQ ID NO. 74); 3'UTR-012 (Col6a1; collagen, type VI, alpha 1 UTR) (See SEQ ID NO. 75); 3'UTR-013 (Calr; calreticulin UTR) (See SEQ ID NO. 76); 3'UTR-014 (Col1a1; collagen, type I, alpha 1 UTR) (See SEQ ID NO. 77); 3'UTR-015 (Plod1; procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 UTR) (See SEQ ID NO. 78); 3'UTR-016 (Nucb1; nucleobindin 1 UTR) (See SEQ ID NO. 79); 3'UTR-017 (α-globin) (See SEQ ID NO. 80); 3'UTR-018 (See SEQ ID NO. 81); 3'UTR (miR 142-3p and miR 126-3p binding sites variant 1) 3'UTR (miR 142-3p and miR 126-3p binding sites variant 2) or 3'UTR (miR 142-3p binding site variant 3)

[0379] In certain embodiments, the 5'UTR and / or 3'UTR sequence comprises a nucleotide sequence at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 5'UTR sequences comprising any of SEQ ID NOs: 39 to 56, 83, 189 to 191 and / or 3'UTR sequences comprises any of SEQ ID NOs: 57 to 81, 84, 149 to 151, 161 to 172, 192 to 199, and any combination thereof.

[0380] The polynucleotides can comprise combinations of features. For example, the ORF can be flanked by a 5'UTR that comprises a strong Kozak translational initiation signal and / or a 3'UTR comprising an oligo(dT) sequence for templated addition of a poly-A tail. A 5'UTR can comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different UTRs (see, e.g., US2010 / 0293625).

[0381] Other non-UTR sequences can be used as regions or subregions within the polynucleotides. For example, introns or portions of intron sequences can be incorporated into the polynucleotides. Incorporation of intronic sequences can increase protein production as well as polynucleotide expression levels. In some embodiments, the polynucleotide comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1):189-193). In some embodiments, the polynucleotide comprises an IRES instead of a 5'UTR sequence. In some embodiments, the polynucleotide comprises an ORF and a viral capsid sequence. In some embodiments, the polynucleotide comprises a synthetic 5'UTR in combination with a non-synthetic 3'UTR.

[0382] In some embodiments, the UTR can also include at least one translation enhancer polynucleotide, translation enhancer element, or translational enhancer elements (collectively, "TEE," which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can include those described in US2009 / 0226470, and others known in the art. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5'UTR comprises a TEE.

[0383] In one aspect, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation.

[0384] In one non-limiting example, the TEE comprises the TEE sequence in the 5'-leader of the Gtx homeodomain protein. See Chappell et al., PNAS 2004 101:9590-9594.

[0385] In some embodiments, the polynucleotide comprises one or multiple copies of a TEE. The TEE in a translational enhancer polynucleotide can be organized in one or more sequence segments. A sequence segment can harbor one or more of the TEEs provided herein, with each TEE being present in one or more copies. When multiple sequence segments are present in a translational enhancer polynucleotide, they can be homogenous or heterogeneous. Thus, the multiple sequence segments in a translational enhancer polynucleotide can harbor identical or different types of the TEE provided herein, identical or different number of copies of each of the TEE, and / or identical or different organization of the TEE within each sequence segment. In one embodiment, the polynucleotide comprises a translational enhancer polynucleotide sequence. Non-limiting examples of TEE sequences are described in U.S. Publication 2014 / 0200261.12. MicroRNA (miRNA) Binding Sites

[0386] Polynucleotides can include regulatory elements, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof. In some embodiments, polynucleotides including such regulatory elements are referred to as including "sensor sequences". Non-limiting examples of sensor sequences are described in U.S. Publication 2014 / 0200261.

[0387] In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). Inclusion or incorporation of miRNA binding site(s) provides for regulation of polynucleotides, and in turn, of the polypeptides encoded therefrom, based on tissue-specific and / or cell-type specific expression of naturally-occurring miRNAs.

[0388] The present invention also provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. The composition or formulation further comprises a delivery agent.

[0389] In some embodiments, the composition or formulation can contain a mRNA polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (i.e., an mRNA) comprising a polynucleotide (i.e., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds

[0390] A miRNA, e.g., a natural-occurring miRNA, is a 19-25 nucleotide long noncoding RNA that binds to a polynucleotide and down-regulates gene expression either by reducing stability or by inhibiting translation of the polynucleotide. A miRNA sequence comprises a "seed" region, i.e., a sequence in the region of positions 2-8 of the mature miRNA. A miRNA seed can comprise positions 2-8 or 2-7 of the mature miRNA. In some embodiments, a miRNA seed can comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) opposed to miRNA position 1. In some embodiments, a miRNA seed can comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) opposed to miRNA position 1. See, for example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105. miRNA profiling of the target cells or tissues can be conducted to determine the presence or absence of miRNA in the cells or tissues. In some embodiments, a polynucleotide i.e., a messenger RNA (mRNA)) comprises one or more microRNA binding sites, microRNA target sequences, microRNA complementary sequences, or microRNA seed complementary sequences. Such sequences can correspond to, e.g., have complementarity to, any known microRNA such as those taught in US Publication US2005 / 0261218 and US Publication US2005 / 0059005.

[0391] microRNAs derive enzymatically from regions of RNA transcripts that fold back on themselves to form short hairpin structures often termed a pre-miRNA (precursor-miRNA). A pre-miRNA typically has a two-nucleotide overhang at its 3' end, and has 3' hydroxyl and 5' phosphate groups. This precursor-mRNA is processed in the nucleus and subsequently transported to the cytoplasm where it is further processed by DICER (a RNase III enzyme), to form a mature microRNA of approximately 22 nucleotides. The mature microRNA is then incorporated into a ribonuclear particle to form the RNA-induced silencing complex, RISC, which mediates gene silencing. Art-recognized nomenclature for mature miRNAs typically designates the arm of the pre-miRNA from which the mature miRNA derives; "5p" means the microRNA is from the 5 prime arm of the pre-miRNA hairpin and "3p" means the microRNA is from the 3 prime end of the pre-miRNA hairpin. A miR referred to by number herein can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (e.g., either the 3p or 5p microRNA). All miRs referred to herein are intended to include both the 3p and 5p arms / sequences, unless particularly specified by the 3p or 5p designation.

[0392] As used herein, the term "microRNA (miRNA or miR) binding site" refers to a sequence within a polynucleotide, e.g., within a DNA or within an RNA transcript, including in the 5'UTR and / or 3'UTR, that has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA. In some embodiments, a polynucleotide comprising an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). In exemplary embodiments, a 5'UTR and / or 3'UTR of the polynucleotide (i.e., a messenger RNA (mRNA)) comprises the one or more miRNA binding site(s).

[0393] A miRNA binding site having sufficient complementarity to a miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated regulation of a polynucleotide, e.g., miRNA-mediated translational repression or degradation of the polynucleotide. In exemplary aspects of the invention, a miRNA binding site having sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA-induced silencing complex (RISC)-mediated cleavage of mRNA. The miRNA binding site can have complementarity to, for example, a 19-25 nucleotide long miRNA sequence, to a long 19-23 nucleotide miRNA sequence, or to a long 22 nucleotide miRNA sequence. A miRNA binding site can be complementary to only a portion of a miRNA, e.g., to a portion less than 1, 2, 3, or 4 nucleotides of the full length of a naturally-occurring miRNA sequence, or to a portion less than 1, 2, 3, or 4 nucleotides shorter than a naturally-occurring miRNA sequence. Full or complete complementarity (e.g., full complementarity or complete complementarity over all or a significant portion of the length of a naturally-occurring miRNA) is preferred when the desired regulation is mRNA degradation.

[0394] In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA seed sequence. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA sequence. In some embodiments, a miRNA binding site has complete complementarity with a miRNA sequence but for 1, 2, or 3 nucleotide substitutions, terminal additions, and / or truncations.

[0395] In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotide(s) shorter than the corresponding miRNA at the 5' terminus, the 3' terminus, or both. In still other embodiments, the microRNA binding site is two nucleotides shorter than the corresponding microRNA at the 5' terminus, the 3' terminus, or both. The miRNA binding sites that are shorter than the corresponding miRNAs are still capable of degrading the mRNA incorporating one or more of the miRNA binding sites or preventing the mRNA from translation.

[0396] In some embodiments, the miRNA binding site binds the corresponding mature miRNA that is part of an active RISC containing Dicer. In another embodiment, binding of the miRNA binding site to the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. In some embodiments, the miRNA binding site has sufficient complementarity to miRNA so that a RISC complex comprising the miRNA cleaves the polynucleotide comprising the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA induces instability in the polynucleotide comprising the miRNA binding site. In another embodiment, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA represses transcription of the polynucleotide comprising the miRNA binding site.

[0397] In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve mismatch(es) from the corresponding miRNA.

[0398] In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one contiguous nucleotides complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one, respectively, contiguous nucleotides of the corresponding miRNA.

[0399] By engineering one or more miRNA binding sites into a polynucleotide, the polynucleotide can be targeted for degradation or reduced translation, provided the miRNA in question is available. This can reduce off-target effects upon delivery of the polynucleotide. For example, if a polynucleotide is not intended to be delivered to a tissue or cell but ends up is said tissue or cell, then a miRNA abundant in the tissue or cell can inhibit the expression of the gene of interest if one or multiple binding sites of the miRNA are engineered into the 5'UTR and / or 3'UTR of the polynucleotide. Thus, in some embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure may reduce the hazard of off-target effects upon nucleic acid molecule delivery and / or enable tissue-specific regulation of expression of a polypeptide encoded by the mRNA. In yet other embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate immune responses upon nucleic acid delivery in vivo. In further embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate accelerated blood clearance (ABC) of lipid-comprising compounds and compositions described herein.

[0400] Conversely, miRNA binding sites can be removed from polynucleotide sequences in which they naturally occur in order to increase protein expression in specific tissues. For example, a binding site for a specific miRNA can be removed from a polynucleotide to improve protein expression in tissues or cells containing the miRNA.

[0401] Regulation of expression in multiple tissues can be accomplished through introduction or removal of one or more miRNA binding sites, e.g., one or more distinct miRNA binding sites. The decision whether to remove or insert a miRNA binding site can be made based on miRNA expression patterns and / or their profilings in tissues and / or cells in development and / or disease. Identification of MiRNAs, miRNA binding sites, and their expression patterns and role in biology have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and Cheresh Curr Opin Hematol 2011 18:171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi: 10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al, Cell, 2007 129:1401-1414; Gentner and Naldini, Tissue Antigens. 2012 80:393-403 and all references therein).

[0402] miRNAs and miRNA binding sites can correspond to any known sequence, including non-limiting examples described in U.S. Publication Nos. 2014 / 0200261, 2005 / 0261218, and 2005 / 0059005.

[0403] Examples of tissues where miRNA are known to regulate mRNA, and thereby protein expression, include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-1d, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).

[0404] Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, etc. Immune cell specific miRNAs are involved in immunogenicity, autoimmunity, the immune-response to infection, inflammation, as well as unwanted immune response after gene therapy and tissue / organ transplantation. Immune cells specific miRNAs also regulate many aspects of development, proliferation, differentiation and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are exclusively expressed in immune cells, particularly abundant in myeloid dendritic cells. It has been demonstrated that the immune response to a polynucleotide can be shut-off by adding miR-142 binding sites to the 3'-UTR of the polynucleotide, enabling more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous polynucleotides in antigen presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al., blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med. 2006, 12(5), 585-591; Brown BD, et al., blood, 2007, 110(13): 4144-4152).

[0405] An antigen-mediated immune response can refer to an immune response triggered by foreign antigens, which, when entering an organism, are processed by the antigen presenting cells and displayed on the surface of the antigen presenting cells. T cells can recognize the presented antigen and induce a cytotoxic elimination of cells that express the antigen.

[0406] Introducing a miR-142 binding site into the 5'UTR and / or 3'UTR of a polynucleotide can selectively repress gene expression in antigen presenting cells through miR-142 mediated degradation, limiting antigen presentation in antigen presenting cells (e.g., dendritic cells) and thereby preventing antigen-mediated immune response after the delivery of the polynucleotide. The polynucleotide is then stably expressed in target tissues or cells without triggering cytotoxic elimination.

[0407] In one embodiment, binding sites for miRNAs that are known to be expressed in immune cells, in particular, antigen presenting cells, can be engineered into a polynucleotide to suppress the expression of the polynucleotide in antigen presenting cells through miRNA mediated RNA degradation, subduing the antigen-mediated immune response. Expression of the polynucleotide is maintained in non-immune cells where the immune cell specific miRNAs are not expressed. For example, in some embodiments, to prevent an immunogenic reaction against a liver specific protein, any miR-122 binding site can be removed and a miR-142 (and / or mirR-146) binding site can be engineered into the 5'UTR and / or 3'UTR of a polynucleotide.

[0408] To further drive the selective degradation and suppression in APCs and macrophage, a polynucleotide can include a further negative regulatory element in the 5'UTR and / or 3'UTR, either alone or in combination with miR-142 and / or miR-146 binding sites. As a non-limiting example, the further negative regulatory element is a Constitutive Decay Element (CDE).

[0409] Immune cell specific miRNAs include, but are not limited to, hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-1--3p, hsa-let-7f-2--5p, hsa-let-7f-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-1-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-1-5p,miR-24-2-5p, miR-24-3p, miR-26a-1-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p, miR-27b-3p,miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-1-5p, miR-29b-2-5p, miR-29c-3p, miR-29c-5p,, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR-345-3p, miR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-363-3p, miR-363-5p, miR-372, miR-377-3p, miR-377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p, and miR-99b-5p. Furthermore, novel miRNAs can be identified in immune cell through micro-array hybridization and microtome analysis (e.g., Jima DD et al, Blood, 2010, 116:e118-e127; Vaz C et al., BMC Genomics, 2010, 11,288.)

[0410] miRNAs that are known to be expressed in the liver include, but are not limited to, miR-107, miR-122-3p, miR-122-5p, miR-1228-3p, miR-1228-5p, miR-1249, miR-129-5p, miR-1303, miR-151a-3p, miR-151a-5p, miR-152, miR-194-3p, miR-194-5p, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-199b-5p, miR-296-5p, miR-557, miR-581, miR-939-3p, and miR-939-5p. MiRNA binding sites from any liver specific miRNA can be introduced to or removed from a polynucleotide to regulate expression of the polynucleotide in the liver. Liver specific miRNA binding sites can be engineered alone or further in combination with immune cell (e.g., APC) miRN...

Claims

1. A composition comprising (a) an mRNA comprising an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide and (b) a delivery agent, wherein the delivery agent comprises: (i) a compound having the Formula (IId): or a salt or stereoisomer thereof, wherein n is selected from 2, 3, and 4; m is selected from 5, 7, and 9; R2 is C8 alkyl; R3 is C5-9 alkyl; R5 and R6 are H; each R' is independently selected from the group consisting of C1-18 alkyl, C2-18 alkenyl, -R*YR", -YR", and H; each R" is independently selected from the group consisting of C3-14 alkyl and C3-14 alkenyl; each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; each Y is independently a C3-6 carbocycle; or (ii) a compound of Formula (IIa), (IIb), (IIc), or (IIe): or or a salt or isomer thereof, wherein: R4 is unsubstituted C1-3 alkyl, or -(CH2)nQ, in which n is 1, 2, 3, 4, or 5 and Q is OH, -NHC(S)N(R)2, or -NHC(O)N(R)2; each R is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H.

2. The composition of claim 1, wherein the compound of Formula (IId) or (IIa) is Compound 18, a salt or a stereoisomer thereof.

3. The composition of claim 1 wherein the compound of Formula (IId) or (IIe) is Compound 25, a salt or a stereoisomer thereof.

4. The composition of any one of claims 1 to 3, wherein the delivery agent further comprises a phospholipid, a structural lipid, and a PEG lipid.

5. The composition of claim 4, wherein: (a) the phospholipid is selected from the group consisting of: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16:0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and any mixtures thereof; and / or (b) the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and any mixtures thereof.

6. The composition of any one of claims 1 to 5, wherein the mRNA comprises: (i) a 5'-terminal cap; (ii) a 5' untranslated region (UTR); (iii) an open reading frame (ORF) encoding a human porphobilinogen deaminase (PBGD) polypeptide, wherein the ORF has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO:9 to 33 and 89 to 117; (iv) a 3' UTR; and (v) a poly-A tail.

7. The composition of any one of claims 1 to 6, wherein the ORF has at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO:9 to 33 and 89 to 117.

8. The composition of claim 6, wherein the uracil content of the ORF is between about 105% and about 145%, about 105% and about 140%, about 110% and about 140%, about 110% and about 145%, about 115% and about 135%, about 105% and about 135%, about 110% and about 135%, about 115% and about 145%, or about 115% and about 140% of the theoretical minimum, wherein the theoretical minimum is determined by dividing the number of uracils in the ORF by the total number of uracils in a reference nucleotide sequence in which all the codons of the ORF are replaced with synonymous codons having the lowest possible uracil content.

9. The composition of any one of claims 6 to 8, wherein the 5' UTR comprises the nucleotide sequence of SEQ ID NO:39.

10. The composition of any one of claims 6 to 9, wherein the 3' UTR comprises the nucleotide sequence of SEQ ID NO:149, SEQ ID NO:150, or SEQ ID NO:151.

11. The composition of any one of claims 6 to 10, wherein the mRNA comprises the miR-142-3p binding site depicted in SEQ ID NO:36.

12. The composition of any one of claims 6 to 11, wherein the 5' terminal cap is Cap1.

13. The composition of any one of claims 6 to 11, wherein the poly-A tail is 80 to 250 residues in length, optionally 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues in length.

14. The composition of any one of claims 1 to 13 wherein the composition is a nanoparticle composition.

15. The composition of any one of claims 1 to 14 for use in treating acute intermittent porphyria (AIP) in a human subject.