GENETIC MODULATION OF PHOTOSYNTHETIC ORGANISMS FOR IMPROVED GROWTH

DE602018091574T2Active Publication Date: 2026-05-27PHYKION INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
PHYKION INC
Filing Date
2018-12-27
Publication Date
2026-05-27

AI Technical Summary

Technical Problem

Existing strategies are inadequate for increasing the total protein content and photosynthetic efficiency of biomass in photosynthetic organisms, such as algae, for improved commercial applications like biofuels and high-value products.

Method used

Genetic manipulation of photosynthetic organisms by modulating genes encoding chloroplastic and cytosolic signal recognition proteins (cpSRP54 and cytoSRP54) and significant growth improvement genes (SGI1 and SGI2) to enhance photosynthetic efficiency and productivity, using methods like CRISPR/Cas systems, RNAi, and mutagenesis.

Benefits of technology

The modified organisms exhibit increased biomass productivity, higher lipid content, and improved carbon fixation rates, with reduced chlorophyll under low light conditions and enhanced quantum yield, leading to higher oxygen evolution and lipid productivity.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

BACKGROUND OF THE INVENTION

[0001] Improvements in biomass productivity of photosynthetic organisms are relevant to various commercial applications-from biofuels to high-value products. Genetic manipulation to increase the total protein content of biomass is highly desirable, but strategies to do so are not apparent in the art.

[0002] Engineering photosynthetic organisms to increase photosynthetic efficiency for higher productivity is a long-standing goal of plant and algal biologists. US 2014 / 0220638 and US 2016 / 030489 describe mutant screens to obtain algal mutants having reduced chlorophyll that are impaired in their ability to low light acclimation, that is, they retain the low chlorophyll state of high light adapted cells even in low light. US 2014 / 0220638 describes algal mutants having mutations in the Light Acclimation Regulator LAR1, LAR2, and LAR3 genes, and US 2016 / 0304896 discloses algal mutants having mutations in the chloroplastic SRP54 gene.SUMMARY OF THE INVENTION

[0003] The present invention is as set out in the appended claims.

[0004] The technical information set out below may in some respects go beyond the scope of the present invention, which is defined by the appended claims. The additional technical information is provided to place the present invention in a broader technical context and to illustrate possible related technical developments.

[0005] Disclosed herein are photosynthetic organisms comprising modulated genes having increased photosynthetic efficiency and productivity, their use in producing products under photoautotrophic conditions, and methods of producing such photosynthetic organisms, and nucleic acid molecules and constructs for modulating such genes.

[0006] In one aspect, provided are mutant photosynthetic organisms comprising a mutated or attenuated gene encoding significant growth improvement gene 2 (SGI2).

[0007] In one aspect, provided are mutant photosynthetic organisms comprising a mutated or attenuated gene encoding a chloroplastic signal recognition protein 54 (cpSRP54) and a mutated or attenuated significant growth improvement gene 2 (SGI2).

[0008] In one aspect, provided are mutant photosynthetic organisms comprising a mutated or attenuated gene encoding a chloroplastic signal recognition protein 54 (cpSRP54) and a mutated or attenuated significant growth improvement gene 1 (SGI1).

[0009] In one aspect provided are mutant photosynthetic organism comprising a mutated or attenuated gene encoding a chloroplastic signal recognition protein 54 (cpSRP54), a mutated or attenuated significant growth improvement gene 1 (SGI1), and a mutated or attenuated significant growth improvement gene 2 (SGI2).

[0010] In one aspect, provided are mutant photosynthetic organisms comprising a mutated or attenuated gene encoding a cytosolic signal recognition protein 54 (cytoSRP54) and a mutated or attenuated significant growth improvement gene 2 (SGI2).

[0011] In one aspect, provided are mutant photosynthetic organisms comprising a mutated or attenuated gene encoding a cytosolic signal recognition protein 54 (cytoSRP54) and a mutated or attenuated significant growth improvement gene 1 (SGI1).

[0012] In one aspect, provided are mutant photosynthetic organisms comprising a mutated or attenuated gene encoding a cytosolic signal recognition protein 54 (cytoSRP54) a mutated or attenuated significant growth improvement gene 1 (SGI1), and a mutated or attenuated significant growth improvement gene 2 (SGI2).

[0013] In one aspect, provided are biomass comprising mutant photosynthetic organisms in which the mutant photosynthetic organisms comprise a mutated or attenuated gene encoding a chloroplastic signal recognition protein 54 (cpSRP54), and a mutated or attenuated significant growth improvement gene 1 (SGI1) and / or a mutated or attenuated significant growth improvement gene 2 (SGI2).

[0014] In one aspect, provided are methods of producing a biological product. The methods include culturing mutant photosynthetic organisms in which the mutant photosynthetic organisms comprise a mutated or attenuated gene encoding a chloroplastic signal recognition protein 54 (cpSRP54), and a mutated or attenuated significant growth improvement gene 1 (SGI1) and / or a mutated or attenuated significant growth improvement gene 2 (SGI2); and isolating at least one product from the culture.

[0015] In one aspect, provided are methods of inserting a single copy of a CRISPR gene into a selected locus of a microorganism. In some embodiments, the CRISPR gene is codon optimized for expression in the microorganism. In some embodiments, the inserted CRISPR gene comprises multiple heterologous introns. In some embodiments, the number of heterologous introns can be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, or more. Non-limiting examples of the CRISPR gene include Cas9 and Cpf1. In some embodiments, the CRISPR gene can be operably linked to a promoter native to the microorganism. In some embodiments, the promoter is inducible. In some embodiments, the CRISPR gene can be operably linked to a promoter heterologous to the microorganism.

[0016] In some embodiments, the biological product is a lipid, a protein, a peptide, one or more amino acids, an amino acid, one or more nucleotides, a vitamin, a cofactor, a hormone, an antioxidant, or a pigment or colorant. In some embodiments, the biological product is a biomass. In some embodiments, the mutant photosynthetic organism is algae and the biomass is algal biomass.

[0017] In some embodiments, the mutant photosynthetic organism is engineered to include at least one exogenous gene encoding a polypeptide that participates in the production of a lipid. In some embodiments, the mutant photosynthetic organism is cultured phototrophically. In some embodiments, the mutant photosynthetic organism is algae, and the algae are cultured in pond or raceway.

[0018] In one aspect, provided are nucleic acid molecule constructs for homologous recombination comprising a nucleotide sequence from or adjacent to a naturally-occurring photosynthetic organism gene encoding SGI2 protein, wherein the SGI2 protein comprises an amino acid sequence having at least 55% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, and SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0019] In one aspect, provided are plurality of nucleic acid molecule constructs for homologous recombination comprising a nucleotide sequence from or adjacent to a naturally-occurring photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding a SGI1 protein, wherein the cpSRP54 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, and SEQ ID NO:85 prior to mutation or attenuation of the gene., and wherein the SGI1 gene encodes a polypeptide having an amino acid sequence comprises an amino acid sequence having at least 55% identity to an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39 prior to mutation or attenuation of the SGI1 gene.

[0020] In one aspect, provided are plurality of nucleic acid molecule constructs for homologous recombination comprising a nucleotide sequence from or adjacent to a naturally-occurring photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding SGI2 protein, wherein the cpSRP54 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene, and wherein the SGI2 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0021] In one aspect, provided are nucleic acid molecule constructs for expression of an antisense RNA, shRNA, microRNA, or ribozyme comprising a nucleotide sequence complementary to at least a portion of a naturally-occurring a photosynthetic organism gene encoding SGI2 protein, wherein the SGI2 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0022] In one aspect, provided are a plurality of nucleic acid molecule constructs for expression of an antisense RNA, shRNA, microRNA, or ribozyme comprising a nucleotide sequence complementary to at least a portion of a naturally-occurring a photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding SGI1 protein, wherein the cpSRP54 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene, and wherein the SGI1 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39 prior to mutation or attenuation of the SGI1 gene.

[0023] In some embodiments, the construct comprises at least a portion of a 5'UTR of a cpSRP54, SGI1, SGI2, or a combination of two or more of the genes, at least a portion of the promoter region of a cpSRP54, SGI1, SGI2, or a combination of two or more of the genes, and / or at least a portion of a 3' UTR of a cpSRP54, SGI1, SGI2, or a combination of two or more of the genes. In some examples, the construct can be an RNAi, ribozyme, or antisense construct and can include a sequence from the transcribed region of the cpSRP54, SGI1, SGI2, or a combination of two or more of the genes in either sense or antisense orientation. In further examples, a construct can be designed for the in vitro or in vivo expression of a guide RNA designed to target a cpSRP54, SGI1, SGI2, or a combination of two or more of the genes, and can include a sequence homologous to a portion of any of the genes, including, for example, an intron, a 5'UTR, a promoter region, and / or a 3' UTR of the gene. In yet further examples, a construct for attenuating expression a gene encoding a cpSRP54, SGI1, or SGI2 polypeptide can be a guide RNA or antisense oligonucleotide, where the sequence having homology to a transcribed region of a cpSRP54, SGI1, SGI2, or a combination of two or more genes in antisense orientation.

[0024] In one aspect, provided are a plurality of nucleic acid molecule constructs for expression of an antisense RNA, shRNA, microRNA, or ribozyme comprising a nucleotide sequence complementary to at least a portion of a naturally-occurring a photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding SGI2 protein, wherein the cpSRP54 encodes a protein that comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene, and wherein the SGI2 gene encodes a protein that comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0025] In one aspect, provided are a plurality of nucleic acid molecules encoding a guide RNAs, wherein the guide RNAs comprises at least a portion of a naturally-occurring a photosynthetic organism gene SGI2, wherein SGI2 gene encodes a protein that comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0026] In one aspect, provided are a plurality of nucleic acid molecules encoding at least two guide RNAs, wherein the guide RNAs comprises at least a portion of a naturally-occurring a photosynthetic organism gene encoding a cpSRP54 and a photosynthetic organism gene encoding SGI1, wherein the cpSRP54 encodes a protein that comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene, and wherein the SGI1 gene comprises an amino acid sequence having at least 55% identity to SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39 prior to mutation or attenuation of the SGI1 gene.

[0027] In one aspect, provided are a plurality of nucleic acid molecules encoding at least two guide RNAs, wherein the guide RNAs comprises at least a portion of a naturally-occurring a photosynthetic organism cpSRP54 gene and a photosynthetic organism gene SGI2 gene, wherein the cpSRP54 gene encodes a protein that comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene, and wherein the SGI2 gene comprises an amino acid sequence having at least SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0028] In one aspect, provided are methods of increasing the biomass of a photosynthetic organism, comprising modulating the SGI2 gene.

[0029] In one aspect, provided are methods of increasing the biomass of a photosynthetic organism, comprising modulating the chloroplastic signal recognition protein 54 (cpSRP54) and Significant Growth Improvement Gene 1 (SGI1), wherein the cpSRP54 gene encodes a protein that comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene, and wherein the SGI1 gene comprises an amino acid sequence having at least SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39 prior to mutation or attenuation of the SGI1 gene.

[0030] In one aspect, provided are method of increasing the biomass of a photosynthetic organism, comprising modulating the chloroplastic signal recognition protein 54 gene (cpSRP54) and Significant Growth Improvement Gene 2 (SGI2), wherein the cpSRP54 gene encodes a protein that comprises an amino acid sequence having at least 55% identity to SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene, and wherein the SGI2 gene comprises an amino acid sequence having at least SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0031] In one aspect, provided are method of increasing the biomass of a photosynthetic organism, comprising modulating the cytosolic signal recognition protein 54 (cytoSRP54) and Significant Growth Improvement Gene 2 (SGI2), wherein the SGI2 gene encodes a protein that comprises an amino acid sequence having at least SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0032] In some embodiments, the culture of the mutant photosynthetic organism exhibits greater biomass productivity than does a culture of a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism demonstrates greater biomass productivity in photoautotrophic culture. In some embodiments, the mutant photosynthetic organism exhibits greater biomass productivity than does a culture of a control photosynthetic organism of the same species under continuous light conditions. In some embodiments, the mutant photosynthetic organism exhibits greater biomass productivity than does a culture of a control photosynthetic organism of the same species under diel cycle conditions. In some embodiments, the mutant photosynthetic organism exhibits greater biomass productivity than does a culture of a control photosynthetic organism of the same species under diel cycle conditions in which the light profile mimics a natural daylight profile.

[0033] In some embodiments, increasing the biomass of a photosynthetic organism comprises an increase in total organic carbon. In some embodiments, increasing the biomass of a photosynthetic organism comprises an increase in total lipid content. In some embodiments, increasing the biomass of a photosynthetic organism comprises an increase in total nitrogen content.

[0034] In some embodiments, mutant photosynthetic organism exhibits a reduction in chlorophyll under low light conditions and higher maximum quantum yield of photochemistry in photosystem II (F v / F M ) at all physiologically relevant irradiances above 100, 125, 150, 200, or 250 µE m -2< s -1< with respect to a control photosynthetic organism of the same species. In some embodiments, the reduction in chlorophyll is at least 20%, 30%, 40%, 50%, 60%, or 70% reduction with respect to a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism exhibits lower nonphotochemical quenching (NPQ) at all physiologically relevant irradiances above 125, 150, 200, or 250 µE m -2< s -1< with respect to a control photosynthetic organism of the same species.

[0035] In some embodiments, the mutant photosynthetic organism exhibits a higher rate of carbon fixation on a per chlorophyll basis than does a control photosynthetic organism of the same species. In some embodiments, the rate of carbon fixation is at least 50%, 60%, 70%, 80%, 90%, or 100% higher than a control photosynthetic organism of the same species.

[0036] In some embodiments, the mutant photosynthetic organism exhibits at least 100%, 150%, 200%, 300%, 400% or higher rate of oxygen evolution per mg chlorophyll than a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism exhibits at least 100%, 150%, 200%, 300%, 400% or higher rate of oxygen evolution per □g of total organic carbon (TOC).

[0037] In some embodiments, the mutant photosynthetic organism exhibits greater lipid productivity than does a culture of a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism exhibits greater lipid productivity in photoautotrophic culture. In some embodiments, the mutant photosynthetic organism is algae.

[0038] In some embodiments, the mutant photosynthetic organisms are generated by modulating the SGI2 genes of the organisms. In some embodiments, the mutant photosynthetic organisms are generated by modulating the cpSRP54 gene together with the SGI1 gene or SGI2 gene of the organisms. In some embodiments, modulating the genes comprises UV radiation, gamma radiation, or chemical mutagenesis. In some embodiments, modulating the genes comprises base substitution mutation, insertional mutagenesis, gene replacement, RNAi, antisense RNA, meganuclease genome engineering, one or more ribozymes, and / or a CRISPR / Cas system in the cpSRP54 gene, SGI1 gene, SGI2 gene, or a combination of the genes.

[0039] In some embodiments, the mutant photosynthetic organisms comprise a cpSRP54 gene encoding a protein having an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene. In some embodiments, the mutant photosynthetic organisms comprise a cpSRP54 gene encodes a protein having an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity to at least 30, 35, 40, 45, 50, 60, 70, 80, 100, 150, 200, 250, 300 amino acids, or to the entire length of an amino acid sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85 prior to mutation or attenuation of the gene.

[0040] In some embodiments, the mutant photosynthetic organisms comprise a mutation in the cpSRP54 gene that occurs outside the sequence encoding the first 169 amino acids of the cpSRP54 GTPase domain. In some embodiments, the mutation in the cpSRP54gene encoding an SRP54 protein occurs outside the sequence encoding the cpSRP54 GTPase domain. In some embodiments, the mutation in the cpSRP54 gene does not include a gene-disrupting mutation in the cpSRP54 GTPase domain.

[0041] In some embodiments, the SGI2 gene of the mutant photosynthetic organisms encoding a protein having an amino acid sequence that is at least 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identity to an amino acid sequence of SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene. In some embodiments, the SGI2 gene of the mutant photosynthetic organisms encoding a protein having an amino acid sequence that is at least 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identity to at least 30, 35, 40, 45, 50, 60, 70, 80, 100, 150, 200, 250, 300 amino acids, or to the entire length of an amino acid sequence of SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56 prior to mutation or attenuation of the gene.

[0042] In some embodiments, the SGI1 gene of the mutant photosynthetic organisms encoding a protein having an amino acid sequence that is at least 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identity to an amino acid sequence of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39 prior to mutation or attenuation of the SGI1 gene. In some embodiments, the SGI1 gene of the mutant photosynthetic organisms encoding a protein having an amino acid sequence that is at least 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identity to at least 30, 35, 40, 45, 50, 60, 70, 80, 100, 150, 200, 250, 300 amino acids, or to the entire length of an amino acid sequence of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39 prior to mutation or attenuation of the SGI1 gene.

[0043] In some embodiments of the above aspects, the photosynthetic organism is multiploidy, e.g., diploid, triploid, tetraploid. In some embodiments, one or more copies of the gene: cpSRP54, SGI1, or SGI2 is mutated or attenuated leaving other copies of the genes unaltered or unattenuated to generate a mutant photosynthetic organism. In some embodiments, the mutant photosynthetic organism thus generated, exhibit a reduction in chlorophyll under low light conditions and higher maximum quantum yield of photochemistry in photosystem II (F v / F M ) at all physiologically relevant irradiances above 100, 125, 150, 200, or 250 µE m -2< s -1< with respect to a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism thus generated, exhibits greater biomass productivity than a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism thus generated, exhibits greater lipid productivity than a control photosynthetic organism of the same species.

[0044] In some embodiments of the above aspects, the mutant photosynthetic organism is algae. In some embodiments, the algae belong to genus Achnanthes, Amphiprora, Amphora, Ankistrodesmus, Asteromonas, Boekelovia, Bolidomonas, Borodinella, Botrydium, Botryococcus, Bracteococcus, Chaetoceros, Carteria, Chlamydomonas, Chlorococcum, Chlorogonium, Chlorella, Chroomonas, Chrysosphaera, Cricosphaera, Crypthecodinium, Cryptomonas, Cyclotella, Dunaliella, Ellipsoidion, Emiliania, Eremosphaera, Ernodesmius, Euglena, Eustigmatos, Franceia, Fragilaria, Gloeothamnion, Haematococcus, Halocafeteria, Heterosigma, Hymenomonas, Isochrysis, Lepocinclis, Micractinium, Monodus, Monoraphidium, Nannochloris, Nannochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmis, Nitzschia, Ochromonas, Oedogonium, Oocystis, Ostreococcus, Pavlova, Parachlorella, Pascheria, Pelagomonas, Phaeodactylum, Phagus, Picochlorum, Platymonas, Pleurochrysis, Pleurococcus, Prototheca, Pseudochlorella, Pseudoneochloris, Pseudostaurastrum, Pyramimonas, Pyrobotrys, Scenedesmus, Skeletonema, Spyrogyra, Stichococcus, Tetraselmis, Thalassiosira, Tribonema, Vaucheria, Viridiella, Vischeria, and Volvox. In some embodiments, the mutant photosynthetic organism is a member of the chlorophytes or charophytes, and may be, for example, a member of any of the Chlorophyte classes Chlorophyceae, Trebouxiophyceae, Chlorodendrophyceae, Ulvophyceae, Pedinophyceae, or Prasinophyceae. For example, the algal mutant can be a species belonging to Chlorophyceae, Trebouxiophyceae, or Chlorodendrophyceae. In some embodiments, the mutant algal cell is a Chlorophyte algal cell, and may be a Chlorophyte algal cell of the Trebouxiophyceae class, for example, an algal cell of a species of a genus such as Botryococcus, Chlorella, Auxenochlorella, Heveochlorella, Marinichlorella, Parachlorella, Pseudochlorella, Tetrachlorella, Eremosphaera, Franceia, Micractinium, Nannochloris, Oocystis, Picochlorum, or Prototheca. In some embodiments, the mutant alga can be a species belonging to a species of Auxenochlorella, Chlorella, Heveochlorella, Marinichlorella, Parachlorella, Pseudochlorella or Tetrachlorella.

[0045] In some embodiments, the mutant photosynthetic microorganism is a cyanobacterium. In some embodiments, the cyanobacterium is an Acaryochloris, Agmenellum, Anabaena, Anabaenopsis, Anacystis, Aphanizomenon, Arthrospira, Asterocapsa, Borzia, Calothrix, Chamaesiphon, Chlorogloeopsis, Chroococcidiopsis, Chroococcus, Crinalium, Cyanobacterium, Cyanobium, Cyanocystis, Cyanospira, Cyanothece, Cylindrospermopsis, Cylindrospermum, Dactylococcopsis, Dermocarpella, Fischerella, Fremyella, Geitleria, Geitlerinema, Gloeobacter, Gloeocapsa, Gloeothece, Halospirulina, Iyengariella, Leptolyngbya, Limnothrix, Lyngbya, Microcoleus, Microcystis, Myxosarcina, Nodularia, Nostoc, Nostochopsis, Oscillatoria, Phormidium, Planktothrix, Pleurocapsa, Prochlorococcus, Prochloron, Prochlorothrix, Pseudanabaena, Rivularia, Schizothrix, Scytonema, Spirulina, Stanieria, Starria, Stigonema, Symploca, Synechococcus, Synechocystis, thermosynechocystis, Tolypothrix, Trichodesmium, Tychonema, or Xenococcus species.

[0046] In some embodiments, the mutant photosynthetic microorganism is a plant. Non-limiting examples of plants include monocotyledonous and dicotyledonous plants, such as crops including grain crops (e.g., wheat, maize, rice, millet, barley), fruit crops (e.g., tomato, apple, pear, strawberry, orange), forage crops (e.g., alfalfa), root vegetable crops (e.g., carrot potato, sugar beets, yam), leafy vegetable crops (e.g., lettuce, spinach); flowering plants (e.g., petunia, rose, chrysanthemum), conifers and pine trees (e.g., pine fir, spruce), plants used in phytoremediation (e.g., heavy metal accumulating plants); oil crops (e.g., sunflower, rapeseed) and plants used for experimental purposes (e.g., Arabidopsis).

[0047] Non-limiting examples of mutated dicotyledonous plants include plants belonging to the orders Magniolales, Miciales, Laurales, Piperales, Aristochiales, Nymphaeales, Ranunculales, Papeverales, Sarraceniaceae, Trochodendrales, Hamamelidales, Eucomiales, Leitneriales, Myricales, Fagales, Casuarinales, Caryophyllales, Batales, Polygonales, Plumbaginales, Dilleniales, Theales, Malvales, Urticales, Lecythidales, Violales, Salicales, Capparales, Ericales, Diapensales, Ebenales, Primulales, Rosales, Fabales, Podostemales, Haloragales, Myrtales, Cornales, Proteales, San tales, Rafflesiales, Celastrales, Euphorbiales, Rhamnales, Sapindales, Juglandales, Geraniales, Polygalales, Umbellales, Gentianales, Polemoniales, Lamiales, Plantaginales, Scrophulariales, Campanulales, Rubiales, Dipsacales, and Asterales.

[0048] Non-limiting examples of mutated monocotyledonous plants include plants belonging to the orders Alismatales, Hydrocharitales, Najadales, Triuridales, Commelinales, Eriocaulales, Restionales, Poales, Juncales, Cyperales, Typhales, Bromeliales, Zingiberales, Arecales, Cyclanthales, Pandanales, Arales, Lilliales, and Orchid ales, or with plants belonging to Gymnospermae, e.g., those belonging to the orders Pinales, Ginkgoales, Cycadales, Araucariales, Cupressales and Gnetales.

[0049] In some embodiments, the mutated plants can be Arabidopsis arenicola, Arabidopsis arenosa, Arabidopsis cebennensis, Arabidopsis croatica, Arabidopsis halleri, Arabidopsis lyrata, Arabidopsis neglecta, Arabidopsis pedemontana, Arabidopsis suecica, Arabidopsis thaliana, Zea mays, Oryza sativa, Triticum aestivum, Solanum tuberosum, Allium cepa, Allium sativum, Glycine max, Solanum lycopersicum, Gossypium hirsutum, Gossypium herbaceum, Gossypium arboreum, Gossypium tomentosum, Brassica nigra, or Brassica sp.

[0050] In some embodiments, modulation of SRP54, SGI1, SGI2, or a combination of one or more of the genes in a plant can be tissue specific. In some embodiments, the plant tissue can be leaf, stem, or roots. In some embodiments, the modulation of the tissue-specific genes can be achieved by modulating the tissue-specific non-coding regions of the genes, for example, promoters, enhancers, introns, 3'- or 5'-untranslated regions. In some embodiments, modulation of SRP54, SGI1, SGI2, or a combination of one or more of the genes in a plant can be made at different developmental stages of the plant.

[0051] These and other objects and features of the invention will become more fully apparent when the following detailed description of the invention is read in conjunction with the accompanying drawings.BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figures 1A-1B. Figure 1A shows a schematics of the SGI1 gene. A putative location of the gRNA designed to disrupt the SGI1 gene (CRISPR target) is indicated. Figure 1B shows a schematics of the SPR54 gene. A putative location of the gRNA designed to disrupt the SPR54 gene (CRISPR target) is indicated. Figures 2A-2C. Figure 2A shows a schematics of the SGI1 gene. A putative location of the gRNA designed to disrupt the SGI1 gene (CRISPR target) is indicated. Figure 2B shows a schematics of the SGI1 protein. Figure 2C shows a schematics of the SPR54 gene. A putative location of the gRNA designed to disrupt the SPR54 gene (CRISPR target) is indicated. Figure 3. Figure 3 shows an exemplary domain architecture analysis of Parachorella sp. SGI2 protein. Figure 4. Figure 4 shows an exemplary domain architecture analysis of Oocystis sp. SGI2 protein. Figure 5. Figure 5 shows an exemplary domain architecture analysis of Tetraselmis sp. SGI2 protein. Figure 6. Figure 6 shows an exemplary domain architecture analysis of Arabidopsis thaliana SGI2 protein. Figure 7. Figure 7 shows an exemplary domain architecture analysis of Arabidopsis thaliana SGI2 protein. Figure 8. Figure 8 shows an exemplary domain architecture analysis of Arabidopsis thaliana SGI2 protein. Figure 9. Figure 9 shows an exemplary domain architecture analysis of Arabidopsis thaliana SGI2 protein. Figures 10A-10B. Figure 10A shows a schematic of a DNA cassette containing a codon optimized Cre gene flanked by nitrite reductase promoter and terminators. Figure 10B shows a schematic of a DNA cassette comprising bleR and GFP sequences. Figure 11. Figure 11 shows the results of the productivity assay for Parachorella wild-type strain, SRP54 knockout strain, SGI2 knockout strain, and the double knockout strain of SGI2 and SRP54. Figures 12A-12B. Figure 12A shows the results of the Semi continuous areal TOC productivity assay for Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), SGI1 / SRP54 double knockout mutants (STR24538 and STR24550). Figure 12B shows the results of the batch TOC productivity assay for Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), SGI1 / SRP54 double knockout mutants (STR24538 and STR24550). Figures 13A-13B. Figure 13A shows the results of the assays indicating semi-continuous areal TOC productivity for the Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR25761), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762). Figure 13B shows the results of the assays indicating batch TOC productivity for the Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR25761), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762). Figure 14. Figure 14 shows the results of the batch FAME productivity assay for Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), SGI1 / SRP54 double knockout mutants (STR24538 and STR24540). Figure 15. Figure 15 shows the results of the batch FAME productivity assay for Parachorella wild-type strain (STR00010), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR00516), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762). Figures 16A-16B. Figure 16A shows the schematics of the selection cassette for knocking out Parachlorella SPR54. Figure 16B shows the schematics of the selection cassette for knocking out Parachlorella SGI2. Figure 17. Figure 17 shows a schematic diagram of the recombinant pCC1BAC vector comprising Cas9, GFP, BleR, Cre genes, and a lox site. DETAILED DESCRIPTION OF THE INVENTION

[0053] Inventors of the present application surprisingly and unexpectedly found that modulating the SGI1 and SGI2 genes in photosynthetic organisms result in a reduction in chlorophyll under low light conditions and higher maximum quantum yield of photochemistry in photosystem II (F v / F M ) at all physiologically relevant irradiances. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits lower nonphotochemical quenching (NPQ) at all physiologically relevant irradiances. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits increased biomass than does a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits a higher rate of carbon fixation on a per chlorophyll basis than does a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits a higher rate of carbon fixation per TOC basis than does a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits a higher rate of oxygen evolution per mg chlorophyll than a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits a higher rate of oxygen evolution per TOC basis than a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits greater lipid productivity than does a culture of a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism comprising a mutated or attenuated SGI1 or SGI2 gene exhibits greater lipid productivity in photoautotrophic culture.

[0054] Inventors of the present application also surprisingly found a synergistic effect upon modulating SGI1 or SGI2 genes together with modulating SRP54 gene in photosynthetic organisms. In some embodiments, the chlorophyll is further reduced, more increased biomass, greater carbon fixation on a per chlorophyll basis, greater carbon fixation per TOC basis, greater lipid productivity in a mutant photosynthetic organism where SRP54 and SGI1 or SGI2 genes are modulated as compared to a mutant photosynthetic organism where only SGI1 or SGI2 genes are modulated.SGI1 Gene

[0055] As described herein, Significant Growth Improvement Gene 1 (SGI1) polypeptides are polypeptides that include two domains: a Response Receiver or "RR" domain (Pfam PF00072) and a Myb domain (Pfam PF00249), where the RR domain is positioned N-terminal to the Myb domain. The RR domain and Myb domain are separated by an amino acid sequence that is found to be poorly conserved or not conserved among SGI1 polypeptides, sometimes referred to herein as a linker between the two domains, where the linker and may range in length from one to 300 amino acids, or from ten to 200 amino acids, for example. The linker region can optionally include a nuclear localization sequence (NLS).

[0056] The presence of a Response Receiver "RR" domain (Pfam PF00072) is responsible for its bioinformatic annotation as a CheY-like polypeptide. This RR domain extends from approximately amino acid 36 to amino acid 148 of the Parachlorella SGI1 polypeptide (SEQ ID NO:3), and is also characterized as a "signal receiver domain", cd00156, in the conserved domain database (CDD), extending approximately from amino acid 37 through amino acid 154. It is also characterized as a "CheY-like receiver (REC) domain", COG0784, in the Clusters of Orthologous Groups of proteins database and as an Interpro "CheY-like superfamily" domain, IPR011006, with both of these characterized domains extending from approximately amino acid 33 to approximately amino acid 161 of the Parachlorella SGI1 polypeptide of SEQ ID NO:3. The RR domain is found in bacterial two-component regulatory systems (like the bacterial chemotaxis two-component system that includes a polypeptide known as CheY), in which it receives a signal from a sensor partner. The RR domain of such systems is often found N-terminal to a DNA binding domain and includes a phosphoacceptor site that can be phosphorylated, which may be responsible for its activation or deactivation.

[0057] An RR domain within an SGI1 protein can be characterized, for example, as Pfam PF00072, or as a "signal receiver domain" or simply "receiver domain", and / or can be classified as cd00156 in the conserved domain database (CDD), as COG0784 in the Clusters of Orthologous Groups of proteins database, or as an Interpro "CheY-like superfamily" domain, IPR011006. The RR domain is found in bacterial two-component regulatory systems (like the bacterial chemotaxis two-component system that includes a polypeptide known as CheY), in which it receives a signal from a sensor partner. The RR domain of such systems is often found N-terminal to a DNA binding domain and includes a phosphoacceptor site that can be phosphorylated, which may be responsible for its activation or deactivation.

[0058] A myb domain within an SGI1 protein can be characterized, for example, as pfamPF00249: "Myb-like DNA-binding domain", and / or may be identified as conserved domain TIGR01557 "myb-like DNA-binding domain, SHAQKYF class ("SHAQKYF" disclosed as SEQ ID NO: 102)", or as an Interpro Homeobox-like domain superfamily domain (IPR009057) and / or an Interpro Myb domain (IPR017930).

[0059] In addition to having an RR domain N-terminal to a myb domain, an SGI1 protein as provided herein can have a score of 300 or higher, 320 or higher, 340 or higher, 350 or higher, 360 or higher, or 370 or higher when scanned with a Hidden Markov Model (HMM) designed to score proteins on the basis of how well the query protein amino acid sequence matches the conserved amino acids of a region of SGI1 homologs in algae, where highly conserved amino acid positions are weighted more heavily than poorly conserved amino acid positions within a compared region of the polypeptides to arrive at the score. Polypeptides having scores of 350 or greater, such as 370 or greater, when scanned with an HMM model based on protein sequences of algal SGI1 polypeptides that include a single continuous sequence that includes the RR domain, linker, and myb domain developed using include, without limitation, polypeptides of the algal and plant species Parachlorella sp. 1185 (SEQ ID NO:3), Coccomyxa subellipsoidea (SEQ ID NO:9), Ostreococcus lucimarinus (SEQ ID NO:10), Chlamydomonas reinhardtii (SEQ ID NO:11), Volvox carteri (SEQ ID NO:13), Tetraselmis sp. 105 (SEQ ID NOs:14, 15, and 16), Oocystis sp. (SEQ ID NO:17), Micromonas sp. RCC299 (SEQ ID NO:18), Micromonas pusilla (SEQ ID NO:19), Sphagnum fallax (SEQ ID NO:20), Physcomitrella patens (SEQ ID NO:21), Arabidopsis thaliana ((SEQ ID NO:22), Arabidopsis halleri (SEQ ID NO:23), Arabidopsis lyrata (SEQ ID NO:24), Helianthus annuus (SEQ ID NO:25), Vitis vinifera (SEQ ID NO:26), Amborella trichopoda (SEQ ID NO:27), Ricinus communis (SEQ ID NO:28), Solanum lycopersicum (SEQ ID NO:29), Solanum tuberosum (SEQ ID NO:30), Gossypium hirsutum (SEQ ID NO:31), Theobroma cacao (SEQ ID NO:32), Phaeolis vulgaris (SEQ ID NO:33), Glycine max (SEQ ID NO:34), Chenopodium quinoa (SEQ ID NO:35), Malus domesticus (SEQ ID NO:36), Zea mays (SEQ ID NO:37), Brassica rapa (SEQ ID NO:38), and Oryza sativa (SEQ ID NO:39), as well as polypeptides having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any of the aforegoing, where the polypeptide has an RR domain and a myb domain, and the RR domain is N-terminal to the myb domain. In various embodiments, the SGI1 polypeptide is from a plant or algal species. A gene encoding an SGI1 polypeptide as provided herein, for example a gene that is disrupted or whose expression is attenuated in a mutant as provided herein can be, in various embodiments, a naturally-occurring gene of a plant or algal species that encodes a polypeptide as disclosed herein.

[0060] In some embodiments, an SGI1 polypeptide as provided herein is an algal SGI1 polypeptide, for example, having the sequence of a naturally-occurring algal SGI1 polypeptide, where the algal polypeptide includes an RR domain and a myb domain, and the RR domain is N-terminal to the myb domain. The algal polypeptide can optionally have at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any of the algal SGI1 polypeptides disclosed herein. In some embodiments, an SGI1 gene can be a gene encoding an algal SGI1 polypeptide, such as for example, a polypeptide having the sequence of a naturally-occurring algal SGI1 polypeptide. An SGI1 gene that encodes a polypeptide having the sequence of a naturally-occurring algal SGI polypeptide can be a gene having a naturally-occurring gene sequence of gene-encoding sequence, or can have a sequence that varies from the sequence of a naturally-occurring gene. In various embodiments, an SGI1 gene that is attenuated, mutated, or disrupted in mutant photosynthetic organisms as disclosed herein can be a gene that is identified through BLAST, for example, using sequences disclosed herein, and / or by HMM scanning, where the HMM is based on a contiguous amino acid sequence, for example derived by comparison of at least six SGI polypeptides, where the contiguous amino acid sequence includes an RR domain and a myb domain, where the RR domain is N-terminal to the myb domain, and where there is a linker sequence between the RR and myb domains that does not belong to either domain.

[0061] In some embodiments, an SGI polypeptide has the sequence of an algal SGI1 polypeptide or is a variant of a naturally-occurring algal SGI1 polypeptide having at least 85%, at least 90%, or at least 95% identity to a naturally-occurring algal SGI1 polypeptide and / or has has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19.

[0062] In some embodiments, an SGI polypeptide has the sequence of a plant SGI1 polypeptide or is a variant of a naturally-occurring plant SGI1 polypeptide having at least 85%, at least 90%, or at least 95% identity to a naturally-occurring algal SGI polypeptide and / or has has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any of SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39.

[0063] A Parachlorella SGI1 gene sequence is provided as SEQ ID NO:1 was found to encode a polypeptide (SEQ ID NO:3) that includes two major functional domains, both occurring in the N-terminal half of the 619 amino acid protein. An exemplary Parachlorella SGI1 cDNA sequence is provided as SEQ ID NO: 2.

[0064] No conserved protein domains could be found in the region of the SGI1 polypeptide C-terminal to the myb domain, i.e., in the C-terminal (approximately) half of the protein. The RR and Myb domains, on the other hand, where the myb domain is positioned C-terminal to the RR domain, can be found in many proteins coded for in Viridiplantae (green plant, encompassing algae) genomes. Bioinformatic analysis was used to identify likely orthologs of SGI1 in additional plant and algal species.

[0065] To identify a class of SGI1 proteins in additional photosynthetic organisms, a Hidden Markov Model (HMM) was built for the RR domain - myb domain architecture found in Parachlorella SGI1. As a first step, the Parachlorella SGI1 polypeptide sequence (SEQ ID NO:3) was used to BLAST search the JGI Phytozome database v.12 that included the genomes of plants and algae. Four proprietary algal genomes (from Parachlorella, Nannochloropsis, Tetraselmis, and Oocystis species) were also added to the database that was searched. The search was halted when it reached approximately 2,000 hits. These results were then analyzed by InterProScan (available from the EMBL-EBI [European Molecular Biology Laboratories-European Bioinformatics Institute, for example, at ebi.ac.uk]) to ensure that selected results had both the Interpro CheY-like superfamily domain (IPR011006) and the Interpro Homeobox-like or Myb domain (IPR009057 or IPR017930). This step reduced the number of selected hits to between 900 and 1,000, with polypeptides having the two domain architecture (RR domain N-terminal to myb domain) clearly identified in polypeptides of both algae and higher plants. The resulting sequences were used to assemble a phylogenetic tree based on sequence homology. The phylogenetic tree showed a clear grouping of related polypeptides from algal species, including SGI1 homologs of Parachlorella, Tetraselmis, Oocystis, Chlamydomonas, Volvox, Ostreococcus, Micromonas, and Coccomyxa. Table: SGI1 Orthologs in Algal speciesOrganismPolypeptide SequenceHMM ScoreParachlorella sp. 1185SEQ ID NO:3400.20Coccomyxa subellipsoideaSEQ ID NO:9403.0Ostreococcus lucimarinusSEQ ID NO:10425.8Chlamydomonas reinhardtiiSEQ ID NO:11413.3Chromochloris zofingiensisSEQ ID NO:12292.6Volvox carteriSEQ ID NO:13441.4Tetraselmis sp. 105SEQ ID NO:14403.6Tetraselmis sp. 105SEQ ID NO:15403.0Tetraselmis sp. 105SEQ ID NO:16402.9Oocystis sp.SEQ ID NO:17426.9Micromonas sp. RC299SEQ ID NO:18418.4Micromonas pusillaSEQ ID NO:19405.9

[0066] To establish a criterion for likely SGI1 orthologs in other photosynthetic organisms then, a Hidden Markov Model (HMM) was developed based on the algal cluster of SGI1 polypeptide sequences. The HMM was developed based on the N-terminal portion of the SGI1 polypeptide that encompasses both the RR and myb domains, including the linker region between the two conserved domains. The sequence of the polypeptides C-terminal to the myb domain that did not include any recognizable conserved structure were excluded from the model-building. HMMER 3.1b2 was used to build the HMM using Multiple Sequence Alignments (MSAs) from proprietary sequences of Parachlorella, Oocystis, and Tetraselmis polypeptides as well as sequences of public databases of polypeptides of Chlamydomonas reinhardtii, Volvox carteri, Chromochloris zofingiensis, Coccomyxa subellipsoidea, Micromonas sp. RCC299, and Ostreococcus luminarinus. Multiple sequence alignments (MSAs) of the N-terminal half of the protein were generated using the ETE3 toolkit and eggnog41 workflow. This program internally uses the programs Muscle, MAFFT, Clustal Omega, and M-coffee for alignment, trimAI for alignment trimming, and PhyML for phylogeny interference. An HMM, unlike a single protein sequence used for homology comparison, for example, captures information from multiple protein sequences and is therefore able to distinguish highly conserved from highly divergent residues and take that into account when determining relatedness of sequences. When an HMM is used to score a sequence, highly conserved residues receive more weight that highly divergent residues, thereby providing superior sensitivity and accuracy than simpler PSAs.

[0067] The SGI1 HHM was used to assign a score to the polypeptides identified in the BLAST search that also were verified as having the two conserved domain (RR and myb). The highest scores, found almost in algal species and a single plant polypeptide, in a bioinformatic search allowed identification of proteins of interest in other algal species (Table 1). These represent likely orthologs whose genes may be attenuated or knocked out to provide high productivity mutants in other organisms. Table 2: SGI1 Orthologs in Plant speciesOrganismPolypeptide SequenceHMM ScoreSphagnum fallaxSEQ ID NO:20397.3Physcomitrella patensSEQ ID NO:21372.3Arabidopsis_thalianaSEQ ID NO:22371.1Arabidopsis halleriSEQ ID NO:23475.9Arabidopsis lyrataSEQ ID NO:24395.5Helianthus annuusSEQ ID NO:25391.2Vitis viniferaSEQ ID NO:26390.6Amborella trichopodaSEQ ID NO:27390.1Ricinus communisSEQ ID NO:28390.1Solanum lycopersicumSEQ ID NO:29388.4Solanum tuberosumSEQ ID NO:30387.2Gossypium hirsutumSEQ ID NO:31385.8Theobroma cacaoSEQ ID NO:32383.0Phaseolus vulgarisSEQ ID NO:33381.6Glycine maxSEQ ID NO:34381.4Chenopodium quinoSEQ ID NO:35373.7Malus domesticaSEQ ID NO:36372.6Zea maysSEQ ID NO:37371.5Brassica rapaSEQ ID NO:38370.5Oryza sativaSEQ ID NO:39369.6

[0068] A schematics of SGI1 gene is shown in Figure 1A.

[0069] In some embodiments, modulations of the SGI1 gene such as mutation, attenuation, or a knockout of the SGI1 gene in algal species, e.g., increases the maximum quantum yield of photochemistry in photosystem II (F v / F M ) (by about 10-14%) while exhibiting reduced antenna size (i.e., functional absorption cross-section) as compared to the wild-type strain from which they were derived.

[0070] In some embodiments, modulations of the SGI1 gene may also cause reduced antenna size (i.e., functional absorption cross-section) of photosystem II (PSII) and photosystem I (PSI) (down 40-50% with respect to wild-type), high rates of electron transport on the acceptor side of PSII (1 / τ '< Qa) under saturating light (increased between about 35% and about 130%, and by at least approximately 100% with respect to wild-type in the engineered mutants) and high rates of carbon fixation (Pmax) (up at least 30-40% with respect to wild-type), while, as determined by Multiple Reaction Monitoring protein determination, the number of photosystems on a per TOC basis is maintained.SGI2 Gene

[0071] Inventors of the present application have identified Significant Growth Improvement Gene 2 (SGI2) as orthologs present in photosynthetic organisms, e.g., algae, plants of a class of regulatory genes called two-component systems (TCS) because they are known to regulate important cellular processes including bacterial cell cycle progression and development (Skerker et al. 2015; Two-component signal transduction pathways regulating growth and cell cycle progression in a bacterium: a system-level analysis, PLoS Biology. 3 (10): e334), nitrogen sensing (Sanders et al., 1992; Phosphorylation site of NtrC, a protein phosphatase whose covalent intermediate activates transcription. Journal of Bacteriology. 174 (15): 5117-22), and bacterial chemotaxis (Sanders et al. 1989; Identification of the site of phosphorylation of the chemotaxis response regulator protein, CheY; The Journal of Biological Chemistry. 264 (36): 21770-8). In bacteria, these proteins typically consist of a histidine kinase that senses a specific environmental stimulus and a corresponding response regulator domain (PF00072) that mediates the cellular response, mostly through differential expression of target genes. However, in the photosynthetic organisms, the SGI2 genes comprise the corresponding response regulator domain (PF00072) and lacks the other domain of the two-component system.

[0072] A schematics of SGI1 gene is shown in Figure 2A and the schematics of the corresponding protein in Figure 2B.

[0073] An exemplary Parachlorella SGI2 gene sequence is provided as SEQ ID NO:4 was found to encode a polypeptide (SEQ ID NO:5) that comprises a response regulator domain (SEQ ID NO: 6).

[0074] Exemplary orthologous polypeptide sequences in various photosynthetic organisms are shown below in Table 3 below. Table 3: Orthologous SGI2 sequences in various photosynthetic organismsPhotosynthetic OrganismPolypeptide SequenceOocystis sp.SEQ ID NO: 40Tetraselmis sp.SEQ ID NO: 41Arabidopsis thalianaSEQ ID NO: 42Arabidopsis thalianaSEQ ID NO: 43Arabidopsis thalianaSEQ ID NO: 44Arabidopsis thalianaSEQ ID NO: 45Arabidopsis thalianaSEQ ID NO: 46Glycine maxSEQ ID NO: 47Vitis viniferaSEQ ID NO: 48Theobroma cacaoSEQ ID NO: 49Oryza sativaSEQ ID NO: 50Zea maysSEQ ID NO: 51Physcomitrella patensSEQ ID NO: 52Volvox carteriSEQ ID NO: 53Chlamydomonas reinhardtiiSEQ ID NO: 54Chlorella zofingiensisSEQ ID NO: 55Coccomyxa subellipsoidea C-169SEQ ID NO: 56

[0075] An exemplary Parachlorella SGI2 cDNA sequence is provided as SEQ ID NO: 7. Orthologous cDNA sequences of SGI2 gene in other photosynthetic organisms are shown in Table 4 below. Table 4: Orthologous cDNA sequences of SGI2 gene in other photosynthetic organismsPhotosynthetic OrganismcDNA SequenceOocystis sp.SEQ ID NO: 57Tetraselmis sp.SEQ ID NO: 58Glycine maxSEQ ID NO: 59Vitis viniferaSEQ ID NO: 60Theobroma cacaoSEQ ID NO: 61Oryza sativaSEQ ID NO: 62Zea maysSEQ ID NO: 63Physcomitrella patensSEQ ID NO: 64Volvox carteriSEQ ID NO: 65Chlamydomonas reinhardtiiSEQ ID NO: 66Coccomyxa subellipsoideaSEQ ID NO: 67

[0076] In some embodiments, the SGI2 polypeptide of a photosynthetic organism comprise an amino acid sequence that is at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 percent identical to SEQ ID NO: 6. In some embodiments, the SGI2 polypeptide of a photosynthetic organism comprise an amino acid sequence that is at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 percent identical to at least 100, 150, 200, 250 amino acids or the entire length of SEQ ID NOs: 5, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or 56.

[0077] In some embodiments, a photosynthetic organism comprise a polynucleotide encoding a SGI2 polypeptide in which the nucleic acid sequence of the polynucleotide is at least 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 percent identical to at least 100, 150, 200, 250 nucleotides or the entire length of SEQ ID NOs: 4, 7, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, or 67.

[0078] In some embodiments, the modulation of the SGI2 gene such as mutation, attenuation, or a knockout of the SGI2 gene in photosynthetic organisms such as algal species, increases the maximum quantum yield of photochemistry in photosystem II (F v / F M ) (by about 10-14%), decreased chlorophyll / per total organic carbon(TOC), increased biomass.SPR54 Gene

[0079] Modulation of the SPR54 gene has been described in US Patent Application Publication 2016 / 0304896. An exemplary Parachlorella chloroplastic SRP54 (cpSRP54) cDNA sequence is provided as SEQ ID NO: 8 that encodes a polypeptide having SEQ ID NO: 68.

[0080] Other non-limiting exemplary cpSRP54 orthologus polypeptides include GenBank Accession Nos: EDP00260 for Chlamydomonas reinhardtii (SEQ ID NO: 75); EEH59526 for Micromonas pusilla (SEQ ID NO: 76); EEH59526 for Micromonas sp. (SEQ ID NO: 77); ACB42577 for Paulinella chromatophora (SEQ ID NO: 78); ABO94038 for Ostreococcus lucimarinus (SEQ ID NO: 79); Q01H03 for Ostreococcus tauri (SEQ ID NO: 80); EFJ41797 for Volvox carteri (SEQ ID NO: 81); EEC48599 for Phaeodactylum tricornutum (SEQ ID NO: 82); EED94755 for Thalassiosira pseudonana( SEQ ID NO: 83); EGB12501 for Aureococcus anophagefferens (SEQ ID NO: 84); CBN76263 for Ectocarpus siliculosus (SEQ ID NO: 85).

[0081] In some embodiments, cpSRP54 gene of a photosynthetic organism that encodes a polypeptide that is at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80% or at least 85%, at least 90%, or at least 95% sequence identity to a cpSRP54 disclosed above.

[0082] Modulation of SGI2, a combination of SGI1 and SRP54, a combination of SGI2 and SRP54 genes, or a combination of SGI1, SGI2, and SRP54 genes of photosynthetic organisms

[0083] Modulation of SGI2, a combination of SGI1 and SRP54, a combination of SGI2 and SRP54 genes, or a combination of SGI1, SGI2, and SRP54 genes of photosynthetic organisms results in mutant photosynthetic organisms. The SGI1, SGI2, SRP54 genes can be modulated by UV mutagenesis, gamma irradiation, or genetic engineering techniques. The gene sequences can be altered, gene sequences can be partially or completely deleted, the expression of the genes can be altered.

[0084] In some embodiments, the SGI1, SGI2, and / or SRP54 genes can operably linked to algal promoters and terminator sequences as described in US Application Publication 2017 / 0058303.

[0085] In some embodiments, a mutant photosynthetic organism, e.g., plant, alga has at least a 20%, at least a 30%, at least a 40%, at least a 50%, at least a 55%, at least a 60%, at least a 65%, or at least a 70% reduction in total chlorophyll with respect to a control cell, optionally further wherein the mutant has a chlorophyll a to chlorophyll b ratio that is increased by at least with respect to a control cell, further optionally wherein the ratio of chlorophyll a to chlorophyll b is at least about 2.8:1, at least about 3:1, at least about 3.2:1, about 3.3:1, at least about 3.5:1, at least about 3.7:1, at least about 3.9:1, at least about 4:1, or at least about 4.3:1.

[0086] In some embodiments, the mutant photosynthetic organism, e.g., plant or alga exhibits: a) higher qP with respect to a control photosynthetic organism of the same species at all irradiances between about 100 and about 2800 µmol photons m -2< sec -1< , between about 150 and about 2800 µmol photons m-2 sec-1, between about 75 and about 2800 µmol photons m -2< sec -1< , between about 40 and about 2800 µmol photons m -2< sec -1< , or between about 10 and about 2800 µmol photons m-2 sec-1;

[0087] (b) lower NPQ with respect to a control alga at all irradiances between about 100 and about 2800 µmol photons m -2< sec -1< , between about 150 and about 2800 µmol photons m-2 sec-1, between about 75 and about 2800 µmol photons m -2< sec -1< , between about 40 and about 2800 µmol photons m -2< sec -1< , or between about 10 and about 2800 µmol photons m -2< sec -1< ;

[0088] (c) higher Y(II) with respect to a photosynthetic organism, e.g., alga at all irradiances between about 100 and about 2800 µmol photons m -2< sec -1< , between about 150 and about 2800 µmol photons m -2< sec -1< , between about 75 and about 2800 µmol photons m -2< sec -1< , between about 40 and about 2800 µmol photons m -2< sec -1< , or between about 10 and about 2800 µmol photons m -2< sec -1< ;

[0089] (d) higher F v / F M with respect to a control alga between about 100 and about 2800 µmol photons m -2< sec -1< , between about 150 and about 2800 µmol photons m -2< sec -1< , between about 75 and about 2800 µmol photons m -2< sec -1< , between about 40 and about 2800 µmol photons m -2< sec -1< , or between about 10 and about 2800 µmol photons m -2< sec -1< ;

[0090] (e) higher ESR(II) with respect to a control alga between about 250 and about 2800 µmol photons m -2< sec -1< , between about 150 and about 2800 µmol photons m -2< sec -1< , between about 75 and about 2800 µmol photons m -2< sec -1< , between about 40 and about 2800 µmol photons m -2< sec -1< , or between about 10 and about 2800 µmol photons m -2< sec -1< ;

[0091] (f) oxygen evolution on a per chlorophyll basis increased by at least 50%, at least 100% at least 200%, at least 300%, at least 350%, or at least 400% with respect to a control alga; and

[0092] (g) carbon fixation on a per chlorophyll basis increased by at least 50%, at least 60% at least 70%, at least 80%, at least 90%, or at least 100% with respect to a control photosynthetic organism of the same species.

[0093] In some embodiments, the mutant photosynthetic organism demonstrates at least 5%, at least 6%, at least 8%, or at least 10%, at least 15%, at least 25%, or at least 30% greater biomass productivity than a control alga cultured under identical conditions.

[0094] In some embodiments, the mutant photosynthetic organism, e.g., plant, alga demonstrates greater productivity with respect to the control alga in a diel cycle culture having a variable light intensity mimicking natural daylight, optionally wherein the light intensity peaks at between about 1900 and about 2000 µmol photons m -2< sec -1< .

[0095] In some embodiments, the mutant photosynthetic organism, e.g., plant or alga has higher lipid productivity, for example, at least 5%, at least 10%, at least 15%, at least 20%, or at least 25% higher lipid productivity with respect to a control photosynthetic organism of the same species that does not have an altered or attenuated gene(s).Definitions

[0096] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present application including the definitions will control. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0097] As used in the present disclosure and claims, the singular forms "a," "an," and "the" also include plural forms unless the context clearly dictates otherwise.

[0098] All ranges provided within the application are inclusive of the values of the upper and lower ends of the range.

[0099] The term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B", "A or B", "A", and "B".

[0100] The term "gene" is used broadly to refer to any segment of a nucleic acid molecule (typically DNA, but optionally RNA) encoding a polypeptide or expressed RNA. Thus, genes include sequences encoding expressed RNA (which can include polypeptide coding sequences or, for example, functional RNAs, such as ribosomal RNAs, tRNAs, antisense RNAs, microRNAs, short hairpin RNAs, ribozymes, etc.). Genes may further comprise regulatory sequences required for or affecting their expression, as well as sequences associated with the protein or RNA-encoding sequence in its natural state, such as, for example, intron sequences, 5' or 3' untranslated sequences, etc. In some examples, "gene" may only refer to a protein-encoding portion of a DNA or RNA molecule, which may or may not include introns. A gene is preferably greater than 50 nucleotides in length, more preferably greater than 100 nucleotide in length, and can be, for example, between 50 nucleotides and 500,000 nucleotides in length, such as between 100 nucleotides and 100,000 nucleotides in length or between about 200 nucleotides and about 50,000 nucleotides in length, or about 200 nucleotides and about 20,000 nucleotides in length. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information.

[0101] The term "nucleic acid" or "nucleic acid molecule" refers to, a segment of DNA or RNA (e.g., mRNA), and also includes nucleic acids having modified backbones (e.g., peptide nucleic acids, locked nucleic acids) or modified or non-naturally-occurring nucleobases. The nucleic acid molecules can be double-stranded, partially double-stranded, or single-stranded; a single-stranded nucleic acid that comprises a gene or a portion thereof can be a coding (sense) strand or a non-coding (antisense) strand.

[0102] A nucleic acid molecule may be "derived from" an indicated source, which includes the isolation (in whole or in part) of a nucleic acid segment from an indicated source. A nucleic acid molecule may also be derived from an indicated source by, for example, direct cloning, PCR amplification, or artificial synthesis from the indicated polynucleotide source or based on a sequence associated with the indicated polynucleotide source. Genes or nucleic acid molecules derived from a particular source or species also include genes or nucleic acid molecules having sequence modifications with respect to the source nucleic acid molecules. For example, a gene or nucleic acid molecule derived from a source (e.g., a particular referenced gene) can include one or more mutations with respect to the source gene or nucleic acid molecule that are unintended or that are deliberately introduced, and if one or more mutations, including substitutions, deletions, or insertions, are deliberately introduced the sequence alterations can be introduced by random or targeted mutation of cells or nucleic acids, by amplification or other gene synthesis or molecular biology techniques, or by chemical synthesis, or any combination thereof. A gene or nucleic acid molecule that is derived from a referenced gene or nucleic acid molecule that encodes a functional RNA or polypeptide can encode a functional RNA or polypeptide having at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, sequence identity with the referenced or source functional RNA or polypeptide, or to a functional fragment thereof. For example, a gene or nucleic acid molecule that is derived from a referenced gene or nucleic acid molecule that encodes a functional RNA or polypeptide can encode a functional RNA or polypeptide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the referenced or source functional RNA or polypeptide, or to a functional fragment thereof.

[0103] As used herein, an "isolated" nucleic acid or protein is removed from its natural milieu or the context in which the nucleic acid or protein exists in nature. For example, an isolated protein or nucleic acid molecule is removed from the cell or organism with which it is associated in its native or natural environment. An isolated nucleic acid or protein can be, in some instances, partially or substantially purified, but no particular level of purification is required for isolation. Thus, for example, an isolated nucleic acid molecule can be a nucleic acid sequence that has been excised from the chromosome, genome, or episome that it is integrated into in nature.

[0104] A "purified" nucleic acid molecule or nucleotide sequence, or protein or polypeptide sequence, is substantially free of cellular material and cellular components. The purified nucleic acid molecule or protein may be substantially free of chemicals beyond buffer or solvent, for example. "Substantially free" is not intended to mean that other components beyond the novel nucleic acid molecules are undetectable.

[0105] The terms "naturally-occurring" and "wild-type" refer to a form found in nature. For example, a naturally occurring or wild-type nucleic acid molecule, nucleotide sequence or protein may be present in an isolated from a natural source, and is not intentionally modified by human manipulation.

[0106] As used herein "attenuated" means reduced in amount, degree, intensity, or strength. Attenuated gene expression may refer to a significantly reduced amount and / or rate of transcription of the gene in question, or of translation, folding, or assembly of the encoded protein. As nonlimiting examples, an attenuated gene may be a mutated or disrupted gene (e.g., a gene disrupted by partial or total deletion, truncation, frameshifting, or insertional mutation), having decreased expression due to alteration or disruption of gene regulatory sequences, or may be a gene targeted by a construct that reduces expression of the gene, such as, for example, an antisense RNA, microRNA, RNAi molecule, or ribozyme.

[0107] "Exogenous nucleic acid molecule" or "exogenous gene" refers to a nucleic acid molecule or gene that has been introduced ("transformed") into a cell. A transformed cell may be referred to as a recombinant cell, into which additional exogenous gene(s) may be introduced. A descendant of a cell transformed with a nucleic acid molecule is also referred to as "transformed" if it has inherited the exogenous nucleic acid molecule. The exogenous gene may be from a different species (and so "heterologous"), or from the same species (and so "homologous"), relative to the cell being transformed. An "endogenous" nucleic acid molecule, gene or protein is a native nucleic acid molecule, gene or protein as it occurs in, or is naturally produced by, the host.

[0108] The term "native" is used herein to refer to nucleic acid sequences or amino acid sequences as they naturally occur in the host. The term "non-native" is used herein to refer to nucleic acid sequences or amino acid sequences that do not occur naturally in the host. A nucleic acid sequence or amino acid sequence that has been removed from a cell, subjected to laboratory manipulation, and introduced or reintroduced into a host cell is considered "non-native." Synthetic or partially synthetic genes introduced into a host cell are "non-native." Non-native genes further include genes endogenous to the host microorganism operably linked to one or more heterologous regulatory sequences that have been recombined into the host genome.

[0109] A "recombinant" or "engineered" nucleic acid molecule is a nucleic acid molecule that has been altered through human manipulation. As non-limiting examples, a recombinant nucleic acid molecule includes any nucleic acid molecule that: 1) has been partially or fully synthesized or modified in vitro, for example, using chemical or enzymatic techniques (e.g., by use of chemical nucleic acid synthesis, or by use of enzymes for the replication, polymerization, digestion (exonucleolytic or endonucleolytic), ligation, reverse transcription, transcription, base modification (including, e.g., methylation), integration or recombination (including homologous and site-specific recombination) of nucleic acid molecules); 2) includes conjoined nucleotide sequences that are not conjoined in nature; 3) has been engineered using molecular cloning techniques such that it lacks one or more nucleotides with respect to the naturally occurring nucleic acid molecule sequence; and / or 4) has been manipulated using molecular cloning techniques such that it has one or more sequence changes or rearrangements with respect to the naturally occurring nucleic acid sequence. As non-limiting examples, a cDNA is a recombinant DNA molecule, as is any nucleic acid molecule that has been generated by in vitro polymerase reaction(s), or to which linkers have been attached, or that has been integrated into a vector, such as a cloning vector or expression vector.

[0110] The term "recombinant protein" as used herein refers to a protein produced by genetic engineering.

[0111] When applied to organisms, the term recombinant, engineered, or genetically engineered refers to organisms that have been manipulated by introduction of a heterologous or exogenous recombinant nucleic acid sequence into the organism, and includes gene knockouts, targeted mutations, gene replacement, and promoter replacement, deletion, or insertion, as well as introduction of transgenes or synthetic genes into the organism. Recombinant or genetically engineered organisms can also be organisms into which constructs for gene "knock down" have been introduced. Such constructs include, but are not limited to, RNAi, microRNA, shRNA, siRNA, antisense, and ribozyme constructs. Also included are organisms whose genomes have been altered by the activity of meganucleases, zinc finger nucleases, TALENs, or Cas / CRISPR systems. An exogenous or recombinant nucleic acid molecule can be integrated into the recombinant / genetically engineered organism's genome or in other instances may not be integrated into the host genome. As used herein, "recombinant microorganism" or "recombinant host cell" includes progeny or derivatives of the recombinant microorganisms of the invention. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny or derivatives may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0112] The term "promoter" refers to a nucleic acid sequence capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. A promoter includes the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. A promoter can include a transcription initiation site as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters often, but not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters may contain -10 and -35 prokaryotic promoter consensus sequences. A large number of promoters, including constitutive, inducible and repressible promoters, from a variety of different sources are well known in the art. Representative sources include for example, algal, viral, mammalian, insect, plant, yeast, and bacterial cell types, and suitable promoters from these sources are readily available, or can be made synthetically, based on sequences publicly available online or, for example, from depositories such as the ATCC as well as other commercial or individual sources. Promoters can be unidirectional (initiate transcription in one direction) or bidirectional (initiate transcription in either direction). A promoter may be a constitutive promoter, a repressible promoter, or an inducible promoter. A promoter region can include, in addition to the gene-proximal promoter where RNA polymerase binds to initiate transcription, additional sequences upstream of the gene that can be within 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more of the transcriptional start site of a gene, where the additional sequences can influence the rate of transcription of the downstream gene and optionally the responsiveness of the promoter to developmental, environmental, or biochemical (e.g., metabolic) conditions.

[0113] The term "heterologous" when used in reference to a polynucleotide, gene, nucleic acid, polypeptide, or enzyme refers to a polynucleotide, gene, nucleic acid, polypeptide, or enzyme that is from a source or derived from a source other than the host organism species. In contrast a "homologous" polynucleotide, gene, nucleic acid, polypeptide, or enzyme is used herein to denote a polynucleotide, gene, nucleic acid, polypeptide, or enzyme that is derived from the host organism species. When referring to a gene regulatory sequence or to an auxiliary nucleic acid sequence used for maintaining or manipulating a gene sequence (e.g. a promoter, a 5' untranslated region, 3' untranslated region, poly A addition sequence, intron sequence, splice site, ribosome binding site, internal ribosome entry sequence, genome homology region, recombination site, etc.), "heterologous" means that the regulatory sequence or auxiliary sequence is not naturally associated with the gene with which the regulatory or auxiliary nucleic acid sequence is juxtaposed in a construct, genome, chromosome, or episome. Thus, a promoter operably linked to a gene to which it is not operably linked to in its natural state (i.e. in the genome of a non-genetically engineered organism) is referred to herein as a "heterologous promoter," even though the promoter may be derived from the same species (or, in some cases, the same organism) as the gene to which it is linked.

[0114] As used herein, the term "protein" or "polypeptide" is intended to encompass a singular "polypeptide" as well as plural "polypeptides," and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, "protein," "amino acid chain," or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of "polypeptide," and the term "polypeptide" can be used instead of, or interchangeably with any of these terms.

[0115] Gene and protein Accession numbers, commonly provided herein in parenthesis after a gene or species name, are unique identifiers for a sequence record publicly available at the National Center for Biotechnology Information (NCBI) website (ncbi.nlm.nih.gov) maintained by the United States National Institutes of Health. The "GenInfo Identifier" (GI) sequence identification number is specific to a nucleotide or amino acid sequence. If a sequence changes in any way, a new GI number is assigned. A Sequence Revision History tool is available to track the various GI numbers, version numbers, and update dates for sequences that appear in a specific GenBank record. Searching and obtaining nucleic acid or gene sequences or protein sequences based on Accession numbers and GI numbers is well known in the arts of, e.g., cell biology, biochemistry, molecular biology, and molecular genetics.

[0116] As used herein, the terms "percent identity" or "homology" with respect to nucleic acid or polypeptide sequences are defined as the percentage of nucleotide or amino acid residues in the candidate sequence that are identical with the known polypeptides, after aligning the sequences for maximum percent identity and introducing gaps, if necessary, to achieve the maximum percent homology. N-terminal or C-terminal insertion or deletions shall not be construed as affecting homology, and internal deletions and / or insertions into the polypeptide sequence of less than about 30, less than about 20, or less than about 10 amino acid residues shall not be construed as affecting homology. Homology or identity at the nucleotide or amino acid sequence level can be determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn, and tblastx (Altschul (1997), Nucleic Acids Res. 25, 3389-3402, and Karlin (1990), Proc. Natl. Acad. Sci. USA 87, 2264-2268), which are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments, with and without gaps, between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified, and finally to summarize only those matches which satisfy a preselected threshold of significance. For a discussion of basic issues in similarity searching of sequence databases, see Altschul (1994), Nature Genetics 6, 119-129. The search parameters for histogram, descriptions, alignments, expect (i.e., the statistical significance threshold for reporting matches against database sequences), cutoff, matrix, and filter (low complexity) can be at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff (1992), Proc. Natl. Acad. Sci. USA 89, 10915-10919), recommended for query sequences over 85 in length (nucleotide bases or amino acids).

[0117] For blastn, designed for comparing nucleotide sequences, the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N can be +5 and -4, respectively. Four blastn parameters can be adjusted as follows: Q=10 (gap creation penalty); R=10 (gap extension penalty); wink=1 (generates word hits at every winkth position along the query); and gapw=16 (sets the window width within which gapped alignments are generated). The equivalent Blastp parameter settings for comparison of amino acid sequences can be: Q=9; R=2; wink=1; and gapw=32. A Bestfit comparison between sequences, available in the GCG package version 10.0, can use DNA parameters GAP=50 (gap creation penalty) and LEN=3 (gap extension penalty), and the equivalent settings in protein comparisons can be GAP=8 and LEN=2.

[0118] Thus, when referring to the polypeptide or nucleic acid sequences of the present invention, included are sequence identities of at least 40%, at least 45%, at least 50%, at least 55%, of at least 70%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%, for example at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% sequence identity with the full-length polypeptide or nucleic acid sequence, or to fragments thereof comprising a consecutive sequence of at least 50, at least 75, at least 100, at least 125, at least 150 or more amino acid residues of the entire protein; variants of such sequences, e.g., wherein at least one amino acid residue has been inserted N-and / or C-terminal to, and / or within, the disclosed sequence(s) which contain(s) the insertion and substitution. Contemplated variants can additionally or alternately include those containing predetermined mutations by, e.g., homologous recombination or site-directed or PCR mutagenesis, and the corresponding polypeptides or nucleic acids of other species, including, but not limited to, those described herein, the alleles or other naturally occurring variants of the family of polypeptides or nucleic acids which contain an insertion and substitution; and / or derivatives wherein the polypeptide has been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid which contains the insertion and substitution (for example, a detectable moiety such as an enzyme).

[0119] As used herein, the phrase "conservative amino acid substitution" or "conservative mutation" refers to the replacement of one amino acid by another amino acid with a common property. A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz (1979) Principles of Protein Structure, Springer-Verlag). According to such analyses, groups of amino acids can be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz (1979) Principles of Protein Structure, Springer-Verlag). Examples of amino acid groups defined in this manner can include: a "charged / polar group" including Glu, Asp, Asn, Gln, Lys, Arg, and His; an "aromatic or cyclic group" including Pro, Phe, Tyr, and Trp; and an "aliphatic group" including Gly, Ala, Val, Leu, Ile, Met, Ser, Thr, and Cys. Within each group, subgroups can also be identified. For example, the group of charged / polar amino acids can be sub-divided into sub-groups including: the "positively-charged sub-group" comprising Lys, Arg and His; the "negatively-charged sub-group" comprising Glu and Asp; and the "polar sub-group" comprising Asn and Gln. In another example, the aromatic or cyclic group can be sub-divided into sub-groups including: the "nitrogen ring sub-group" comprising Pro, His, and Trp; and the "phenyl sub-group" comprising Phe and Tyr. In another further example, the aliphatic group can be sub-divided into sub-groups including: the "large aliphatic non-polar sub-group" comprising Val, Leu, and Ile; the "aliphatic slightly-polar sub-group" comprising Met, Ser, Thr, and Cys; and the "small-residue sub-group" comprising Gly and Ala. Examples of conservative mutations include amino acid substitutions of amino acids within the sub-groups above, such as, but not limited to: Lys for Arg or vice versa, such that a positive charge can be maintained; Glu for Asp or vice versa, such that a negative charge can be maintained; Ser for Thr or vice versa, such that a free -OH can be maintained; and Gln for Asn or vice versa, such that a free -NH2 can be maintained. A "conservative variant" is a polypeptide that includes one or more amino acids that have been substituted to replace one or more amino acids of the reference polypeptide (for example, a polypeptide whose sequence is disclosed in a publication or sequence database, or whose sequence has been determined by nucleic acid sequencing) with an amino acid having common properties, e.g., belonging to the same amino acid group or sub-group as delineated above.

[0120] As used herein the term "modulating" or "modulation" of a gene refers to altering the nucleic acid sequence of the gene, completely or partially deleting the gene, causing a fragmentation in the gene, altering the expression of the gene, inhibiting or silencing the expression of the gene. In some embodiments, altering the sequence of a gene is by insertion of one or more nucleotides, deletion of one or more nucleotides, substitution of the nucleotides. Altering the sequences can be achieved by UV radiation, gamma radiation, genetic engineering.

[0121] As used herein "attenuating expression of a gene" means reducing or eliminating expression of the gene in any manner that reduces production of the fully functional protein.

[0122] As used herein, "expression" includes the expression of a gene at least at the level of RNA production, and an "expression product" includes the resultant product, e.g., a polypeptide or functional RNA (e.g., a ribosomal RNA, a tRNA, an antisense RNA, a micro RNA, a shRNA, a ribozyme, etc.), of an expressed gene. The term "increased expression" includes an alteration in gene expression to facilitate increased mRNA production and / or increased polypeptide expression. "Increased production" includes an increase in the amount of polypeptide expression, in the level of the enzymatic activity of a polypeptide, or a combination of both, as compared to the native production or enzymatic activity of the polypeptide.

[0123] Some aspects of the present invention include the partial, substantial, or complete deletion, silencing, inactivation, or down-regulation of expression of particular polynucleotide sequences. The genes may be partially, substantially, or completely deleted, silenced, inactivated, or their expression may be down-regulated in order to affect the activity performed by the polypeptide they encode, such as the activity of an enzyme. Genes can be partially, substantially, or completely deleted, silenced, inactivated, or down-regulated by insertion of nucleic acid sequences that disrupt the function and / or expression of the gene (e.g., viral insertion, transposon mutagenesis, meganuclease engineering, homologous recombination, or other methods known in the art). The terms "eliminate," "elimination," and "knockout" can be used interchangeably with the terms "deletion," "partial deletion," "substantial deletion," or "complete deletion." In certain embodiments, a microorganism of interest may be engineered by site-directed homologous recombination to knockout a particular gene of interest. In still other embodiments, RNAi or antisense DNA (asDNA) constructs may be used to partially, substantially, or completely silence, inactivate, or down-regulate a particular gene of interest.

[0124] These insertions, deletions, or other modifications of certain nucleic acid molecules or particular polynucleotide sequences may be understood to encompass "genetic modification(s)" or "transformation(s)" such that the resulting strains of the microorganisms or host cells may be understood to be "genetically modified", "genetically engineered" or "transformed."

[0125] As used herein, "up-regulated" or "up-regulation" includes an increase in expression of a gene or nucleic acid molecule of interest or the activity of an enzyme, e.g., an increase in gene expression or enzymatic activity as compared to the expression or activity in an otherwise identical gene or enzyme that has not been up-regulated.

[0126] As used herein, "down-regulated" or "down-regulation" includes a decrease in expression of a gene or nucleic acid molecule of interest or the activity of an enzyme, e.g., a decrease in gene expression or enzymatic activity as compared to the expression or activity in an otherwise identical gene or enzyme that has not been down-regulated.

[0127] As used herein, "mutant" refers to an organism that is non-naturally occurring and has a mutation in a gene that has arisen as a result of classical mutagenesis, for example, using gamma irradiation, UV, or chemical mutagens. "Mutant" as used herein also refers to a recombinant cell that has altered structure or expression of a gene as a result of genetic engineering that may include, as non-limiting examples, overexpression, including expression of a gene under different temporal, biological, or environmental regulation and / or to a different degree than occurs naturally and / or expression of a gene that is not naturally expressed in the recombinant cell; homologous recombination, including knock-outs and knock-ins (for example, gene replacement with genes encoding polypeptides having greater or lesser activity than the wild-type polypeptide, and / or dominant negative polypeptides); gene attenuation via RNAi, antisense RNA, or ribozymes, or the like; and genome engineering using meganucleases, TALENs, and / or CRISPR technologies, and the like. A mutant organism of interest will typically have a phenotype different than that of the corresponding wild-type or progenitor strain that lacks the mutation, where the phenotype can be assessed by growth assays, product analysis, photosynthetic properties, biochemical assays, etc. When referring to a gene "mutant" means the gene has at least one base (nucleotide) change, deletion, or insertion with respect to a native or wild-type gene. The mutation (change, deletion, and / or insertion of one or more nucleotides) can be in the coding region of the gene or can be in an intron, 3' UTR, 5' UTR, or promoter region, e.g., within 2 kb of the transcriptional start site or within 3 kb or the translational start site. As nonlimiting examples, a mutant gene can be a gene that has an insertion within the promoter region that can either increase or decrease expression of the gene; can be a gene that has a deletion, resulting in production of a nonfunctional protein, truncated protein, dominant negative protein, or no protein; can be a gene that has one or more point mutations leading to a change in the amino acid of the encoded protein or results in aberrant splicing of the gene transcript, etc. As used herein, "mutant" refers to an organism that is non-naturally occurring and has a mutation in a gene that has arisen as a result of classical mutagenesis, for example, using gamma irradiation, UV, or chemical mutagens. "Mutant" as used herein also refers to a recombinant cell that has altered structure or expression of a gene as a result of genetic engineering that may include, as non-limiting examples, overexpression, including expression of a gene under different temporal, biological, or environmental regulation and / or to a different degree than occurs naturally and / or expression of a gene that is not naturally expressed in the recombinant cell.

[0128] The term "Pfam" refers to a large collection of protein domains and protein families maintained by the Pfam Consortium and available at Welcome Trust, Sanger Institute); pfam.sbc.su.se (Stockholm Bioinformatics Center; Janelia Farm, Howard Hughes Medical Institute; Institut national de la Recherche Agronomique. The latest release of Pfam is Pfam 27.0 (March 2013) based on the UniProt protein database release 2012_06. Pfam domains and families are identified using multiple sequence alignments and hidden Markov models (HMMs). Pfam-A family or domain assignments, are high-quality assignments generated by a curated seed alignment using representative members of a protein family and profile hidden Markov models based on the seed alignment. (Unless otherwise specified, matches of a queried protein to a Pfam domain or family are Pfam-A matches.) All identified sequences belonging to the family are then used to automatically generate a full alignment for the family (Sonnhammer (1998) Nucleic Acids Research 26, 320-322; Bateman (2000) Nucleic Acids Research 26, 263-266; Bateman (2004) Nucleic Acids Research 32, Database Issue, D138-D141; Finn (2006) Nucleic Acids Research Database Issue 34, D247-251; Finn

[0129] (2010) Nucleic Acids Research Database Issue 38, D211-222). By accessing the Pfam database, for example, using any of the above-referenced websites, protein sequences can be queried against the HMMs using HMMER homology search software (e.g., HMMER2, HMMER3, or a higher version). Significant matches that identify a queried protein as being in a Pfam family (or as having a particular Pfam domain) are those in which the bit score is greater than or equal to the gathering threshold for the Pfam domain. Expectation values (e values) can also be used as a criterion for inclusion of a queried protein in a Pfam or for determining whether a queried protein has a particular Pfam domain, where low e values (much less than 1.0, for example less than 0.1, or less than or equal to 0.01) represent low probabilities that a match is due to chance.

[0130] As used herein, the term "photosynthetic organism" refers to an organism that can convert light energy into chemical energy. In some embodiments, the chemical energy can later be released to fuel the organisms' activities (energy transformation). In some embodiments, this chemical energy is stored in carbohydrate molecules, such as sugars, which are synthesized from carbon dioxide and water.

[0131] Non-limiting examples of photosynthetic organisms include plants, algae, and cyanobacteria. Non-limiting examples of algae belong to genus Achnanthes, Amphiprora, Amphora, Ankistrodesmus, Asteromonas, Boekelovia, Bolidomonas, Borodinella, Botrydium, Botryococcus, Bracteococcus, Chaetoceros, Carteria, Chlamydomonas, Chlorococcum, Chlorogonium, Chlorella, Chroomonas, Chrysosphaera, Cricosphaera, Crypthecodinium, Cryptomonas, Cyclotella, Dunaliella, Ellipsoidon, Emiliania, Eremosphaera, Ernodesmius, Euglena, Eustigmatos, Franceia, Fragilaria, Gloeothamnion, Haematococcus, Halocafeteria, Heterosigma, Hymenomonas, Isochrysis, Lepocinclis, Micractinium, Monodus, Monoraphidium, Nannochloris, Nannochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmis, Nitzschia, Ochromonas, Oedogonium, Oocystis, Ostreococcus, Pavlova, Parachlorella, Pascheria, Pelagomonas, Phaeodactylum, Phagus, Picochlorum, Platymonas, Pleurochrysis, Pleurococcus, Prototheca, Pseudochlorella, Pseudoneochloris, Pseudostaurastrum, Pyramimonas, Pyrobotiys, Scenedesmus, Skeletonema, Spyrogyra, Stichococcus, Tetraselmis, Thalassiosira, Tribonema, Vaucheria, Viridiella, Vischeria, and Volvox.

[0132] Non-limiting examples of plants include Arabidopsis arenicola, Arabidopsis arenosa, Arabidopsis cebennensis, Arabidopsis croatica, Arabidopsis halleri, Arabidopsis lyrata, Arabidopsis neglecta, Arabidopsis pedemontana, Arabidopsis suecica, Arabidopsis thaliana, Zea mays, Oryza sativa, Triticum aestivum, Solanum tuberosum, Allium cepa, Allium sativum, Glycine max, Solanum lycopersicum, Gossypium hirsutum, Gossypium herbaceum, Gossypium arboreum, Gossypium tomentosum, Brassica nigra, and Brassica sp.

[0133] As used herein, the term "mutant photosynthetic organism" or "mutant algae" refer to a photosynthetic organism or algae in which at least the SGI1, SGI2, a combination of SGI1 and SRP54, a combination of SGI2 and SRP54, or a combination of SGI1, SGI2, and SRP54 is modulated. Such modulations may include a change in the nucleic acid sequence or alternation of the expression of the gene(s).

[0134] As used herein, modulation of a combination of SGI1 and SRP54 genes refer to modulation of SGI1 and modulation of SRP54 genes in the same photosynthetic organism. Similarly, modulation of a combination of SGI2 and SRP54 genes refer to modulation of SGI2 and modulation of SRP54 genes in the same photosynthetic organism. Likewise, modulation of a combination of SGI1, SGI2, and SRP54 genes refer to modulation of SGI1, modulation of SGI2, and modulation of SRP54 genes in the same photosynthetic organism.

[0135] As used herein, the term control photosynthetic organism refers to a photosynthetic organism that is genetically substantially identical in all relevant respects to the mutant photosynthetic organism with the exception that the control photosynthetic organism does not have a mutated or attenuated SRP54, SGI1, SGI2, or a combination of two or more of the genes. For example, a control photosynthetic organism is of the same species and, with the exception of alterations to the cpSRP54, cytosolic SRP54, SGI1, or SGI2 genes or constructs for attenuating the cpSRP54, cytosolic SRP54, SGI1, SGI2 genes present in the mutant, is genetically identical with the exception of small genome changes (e.g., "SNPs") that do not affect cell physiology that may be incurred during mutagenesis through normal propagation. In various embodiments, a control photosynthetic organism is a strain from which the mutant photosynthetic organism having attenuated expression of a cytosolic SRP54, cpSRP54, SGI1, SGI2, or a combination of at least two genes is derived.

[0136] When referring to a photosynthetic organism, such as an algal, the term "acclimated to low light" means having the increased chlorophyll and photosynthetic properties of the photosynthetic organism after being exposed to a low light intensity for a period of time that is sufficient for changes in chlorophyll and photosynthetic properties to stabilize at the low light condition. Low light can be for example, less than 200 µE·m -2< ·s -1< and preferably about 100 µE·m -2< ·s -1< or less or 50 µE·m -2< ·s -1< or less, and the period of time for acclimation can be for at least about four hours, at least about six hours, at least about eight hours, or at least about twelve hours, at least 24 hours, or at least 48 hours, and may be as long as 2, 3, 4, or 5 days.

[0137] A "cDNA" is a DNA molecule that comprises at least a portion of the nucleotide sequence of a mRNA molecule, with the exception that the DNA molecule substitutes the nucleobase thymine, or T, in place of uridine, or U, occurring in the mRNA sequence. A cDNA can be double-stranded or single stranded and can be, for example, the complement of the mRNA sequence. In preferred examples, a cDNA does not include one or more intron sequences that occur in the naturally-occurring gene that the cDNA corresponds to (i.e., the gene as it occurs in the genome of an organism). For example, a cDNA can have sequences from upstream of an intron of a naturally-occurring gene juxtaposed to sequences downstream of the intron of the naturally-occurring gene, where the upstream and downstream sequences are not juxtaposed in a DNA molecule in nature (i.e., the sequences are not juxtaposed in the naturally occurring gene). A cDNA can be produced by reverse transcription of mRNA molecules, or can be synthesized, for example, by chemical synthesis and / or by using one or more restriction enzymes, one or more ligases, one or more polymerases (including, but not limited to, high temperature tolerant polymerases that can be used in polymerase chain reactions (PCRs)), one or more recombinases, etc., based on knowledge of the cDNA sequence, where the knowledge of the cDNA sequence can optionally be based on the identification of coding regions from genome sequences or compiled from the sequences multiple partial cDNAs.

[0138] An algal mutant "deregulated in low light acclimation" (or a "Locked in High Light Acclimation" or LIHLA mutant) is a mutant that does not exhibit the changes in phenotype and gene expression that are characteristic of a low light acclimated wild type algal cell, including: a substantial increase in chlorophyll and a substantial increase in the expression of the majority of light harvesting complex protein (LHCP) genes. An algal mutant deregulated in low light acclimation, when acclimated to low light, has decreased expression with respect to low light acclimated wild type cells, of multiple genes (for example, at least ten, at least twenty, at least thirty, at least forty or at least fifty genes) that are upregulated during low light acclimation of wild-type cells. Further, an algal mutant deregulated in low light acclimation has increased expression of genes with respect to low light acclimated wild type cells (for example, at least five, at least six, at least seven, at least eight, at least nine, or at least ten genes) that are downregulated during low light acclimation of wild-type cells. Further, as disclosed herein, an algal mutant deregulated in low light acclimation may have photosynthetic properties that are significantly different than the photosynthetic properties of wild-type cells when both mutant and wild-type cells are acclimated to low light.

[0139] "Photosynthetic properties", "photosynthetic properties", "photophysiological properties", or photophysiological parameters" include, without limitation, maximal photosynthetic rate, Pmax (calculated on a per cell or per mg chlorophyll basis), the intensity at which photosynthesis saturates, Ek, as measured by oxygen evolution, and α ("alpha") the initial slope of the photosynthesis (oxygen evolution) versus irradiance intensity (P / I) curve. Additional photosynthetic properties include various parameters that can be measured using fluorescence detection, including, for example, maximum quantum yield of photochemistry in photosystem II, F v / F M ; the photosynthetic quantum yield of photosystem II (PSII), φPSII ; photochemical quenching, or the proportion of open PSII centers, qP; non-photochemical quenching, NPQ; PSII electron transport rate, ETRPSII; PSI electron transport rate, ETR PSI ; functional absorption cross-sectional size of PSI (σ PSI ), and functional absorption cross-section of PSII (σ PSII ). The listing here is not exhaustive, and the terms do not exclude other parameters that measure various aspects of photosynthesis.

[0140] Reference to properties that are "substantially the same" are intended to mean the properties are within 10%, and preferably within 5%, of the reference value.

[0141] Although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and are not intended to be limiting. Other features and advantages of the invention will be apparent from the detailed description and from the claims.Gene Attenuation

[0142] A mutant photosynthetic organism can be a mutant generated by any feasible method, including but not limited to UV irradiation, gamma irradiation, or chemical mutagenesis, and screening for low chlorophyll mutants having the photosynthetic properties disclosed herein. Methods for generating mutants of microbial strains are well-known. Mutants can be identified by methods known in the art, including, for example, genome sequencing, PCR, immunodetection of the cpSRP54 or cytoSRP54 protein, and expression analysis (e.g., reverse transcription / PCR).

[0143] A mutant photosynthetic organism as provided herein can also be genetically engineered in the SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 for example, that has been targeted by homologous recombination for knock-out or gene replacement (for example with a mutated form of the gene that may encode a polypeptide having reduced activity with respect to the wild-type polypeptide). In additional examples, an algal strain of interest may be engineered by site-directed homologous recombination to insert a particular gene of interest with or without an expression control sequence such as a promoter, into a particular genomic locus, or to insert a promoter into a genetic locus of the host microorganism to affect the expression of a particular gene or set of genes at the locus.

[0144] For example, gene knockout or replacement by homologous recombination can be by transformation of a nucleic acid (e.g., DNA) fragment that includes a sequence homologous to the region of the genome to be altered, where the homologous sequence is interrupted by a foreign sequence, typically a selectable marker gene that allows selection for the integrated construct. The genome-homologous flanking sequences on either side of the foreign sequence or mutated gene sequence can be for example, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,200, at least 1,500, at least 1,750, or at least 2,000 nucleotides in length. A gene knockout or gene "knock in" construct in which a foreign sequence is flanked by target gene sequences, can be provided in a vector that can optionally be linearized, for example, outside of the region that is to undergo homologous recombination, or can be provided as a linear fragment that is not in the context of a vector, for example, the knock-out or knock-in construct can be an isolated or synthesized fragment, including but not limited to a PCR product. In some instances, a split marker system can be used to generate gene knock-outs by homologous recombination, where two DNA fragments can be introduced that can regenerate a selectable marker and disrupt the gene locus of interest via three crossover events (Jeong et al. (2007) FEMS Microbiol Lett 273: 157-163).

[0145] In one aspect the invention provides genetically modified organisms, e.g. microorganisms having one or more genetic modifications for attenuating expression of a SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 genes. As used herein "attenuating expression of a SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene" means reducing or eliminating expression of one or more above mentioned genes in any manner that reduces production of the fully functional protein.

[0146] For example, a recombinant photosynthetic organism engineered to have attenuated expression of a SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene can have a disrupted SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene, in which the recombinant microorganism can have a SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene that includes as least one insertion, mutation, or deletion that reduces or abolishes expression of the gene such that a fully functional SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene, or cytoSRP54 gene is not produced or is produced in lower amounts than is produced by a control photosynthetic organism of the same species. The disrupted SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, a combination of SGI2 and cpSRP54, or cytoSRP54 gene can be disrupted by, for example, an insertion or gene replacement mediated by homologous recombination and / or by the activity of a meganuclease, zinc finger nuclease (Perez-Pinera et al. (2012) Curr. Opin. Chem. Biol. 16: 268-277), TALEN (WO 2014 / 207043; WO 2014 / 076571), or an RNA-guided endonuclease such as a cas protein (e.g., a Cas9 protein) of a CRISPR system.

[0147] CRISPR systems, reviewed recently by Hsu et al. (Cell 157:1262-1278, 2014) include, in addition to the Cas nuclease polypeptide or complex, a targeting RNA, often denoted "crRNA", that interacts with the genome target site by complementarity with a target site sequence, a trans-activating ("tracr") RNA that complexes with the Cas polypeptide and also includes a region that binds (by complementarity) the targeting crRNA.

[0148] The invention contemplates the use of two RNA molecules (a "crRNA" and a "tracrRNA") that can be cotransformed into a host strain (or expressed in a host strain) that expresses or is transfected with a cas protein for genome editing, or the use of a single guide RNA that includes a sequence complementary to a target sequence as well as a sequence that interacts with a cas protein. That is, in some strategies a CRISPR system as used herein can comprise two separate RNA molecules (RNA polynucleotides: a "tracr-RNA" and a "targeter-RNA" or "crRNA", see below) and referred to herein as a "double-molecule DNA-targeting RNA" or a "two-molecule DNA-targeting RNA." Alternatively, as illustrated in the examples, the DNA-targeting RNA can also include the trans-activating sequence for interaction with the Cas protein (in addition to the target-homologous ("cr") sequences), that is, the DNA-targeting RNA can be a single RNA molecule (single RNA polynucleotide) and is referred to herein as a "chimeric guide RNA," a "single-guide RNA," or a "sgRNA." The terms "DNA-targeting RNA" and "gRNA" are inclusive, referring both to double-molecule DNA-targeting RNAs and to single-molecule DNA-targeting RNAs (i.e., sgRNAs). Both single-molecule guide RNAs and two RNA systems have been described in detail in the literature and for example, in U.S. Patent Application Publication No.US 2014 / 0068797.

[0149] Any Cas protein can be used in the methods herein, e.g., Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. In some embodiments, the Cas protein is a class II Cas protein. The Cas protein can be a Cas9 protein, such as a Cas9 protein of Staphylococcus pyogenes, S. thermophilus, S. pneumonia, S. aureus, or Neisseria meningitidis, as nonlimiting examples. Other Cas proteins of interest include, without limitation, the Cpf1 RNA-guided endonuclease (Zetsche et al. (2015) Cell 163:1-13) as well as the C2c1, C2c2, C2c3 RNA-guided nucleases (Shmakov et al. (2015) Molecular Cell 60:1-13). Also considered are the Cas9 proteins provided as SEQ ID NOs:1-256 and 795-1346 in U.S. Patent Application Publication No. US 2014 / 0068797, and chimeric Cas9 proteins that may combine domains from more than one Cas9 protein, as well as variants and mutants of identified cas9 proteins. (For example, a Cas9 protein encoded by a nucleic acid molecule introduced into a host cell can comprise at least one mutation with respect to a wild-type Cas9 protein; for example, the Cas9 protein can be inactivated in one of the cleavage domains of the protein resulting in a "nickase" variant. Nonlimiting examples of mutations include D10A, H840A, N854A, and N863A.) The nucleic acid sequence encoding the Cas protein can be codon optimized for the host cell of interest.

[0150] Cas nuclease activity cleaves target DNA to produce double-strand breaks. These breaks are then repaired by the cell in one of two ways: non-homologous end joining or homology-directed repair. In non-homologous end joining (NHEJ), the double-strand breaks are repaired by direct ligation of the break ends to one another. In this case, no new nucleic acid material is inserted into the site, although some nucleic acid material may be lost, resulting in a deletion, or altered, often resulting in a mutation. In homology-directed repair, a donor polynucleotide (sometimes referred to as a "donor DNA" or "editing DNA") which may have homology to the cleaved target DNA sequence is used as a template for repair of the cleaved target DNA sequence, resulting in the transfer of genetic information from the donor polynucleotide to the target DNA. As such, new nucleic acid material may be inserted / copied into the site. The modifications of the target DNA due to NHEJ and / or homology-directed repair (for example using a donor DNA molecule) can lead to, for example, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, gene mutation, etc.

[0151] In some instances, cleavage of DNA by a site-directed modifying polypeptide (e.g., a Cas nuclease, zinc finger nuclease, meganuclease, or TALEN) may be used to delete nucleic acid material from a target DNA sequence by cleaving the target DNA sequence and allowing the cell to repair the sequence in the absence of an exogenously provided donor polynucleotide. Such NHEJ events can result in mutations ("mis-repair") at the site of rejoining of the cleaved ends that can result in gene disruption.

[0152] Alternatively, if a DNA-targeting RNA is co-administered to cells that express a cas nuclease along with a donor DNA, the subject methods may be used to add, i.e. insert or replace, nucleic acid material to a target DNA sequence (e.g. "knock out" by insertional mutagenesis, or "knock-in" a nucleic acid that encodes a protein (e.g., a selectable marker and / or any protein of interest), an siRNA, an miRNA, etc., to modify a nucleic acid sequence (e.g., introduce a mutation), and the like.

[0153] A donor DNA can in particular embodiments include a gene regulatory sequence (e.g., a promoter) that can, using CRISPR targeting, be inserted upstream of the coding regions of the gene and upstream of the presumed proximal promoter region of the gene, for example, at least 50 bp, at least 100 bp, at least 120 bp, at least 150 bp, at least 200 bp, at least 250 bp, at least 300 bp, at least 350 bp, at least 400 bp, at least 450 bp, or at least 500 bp upstream of the initiating ATG of the coding region of the cpSRP54 gene. The donor DNA can include a sequence, such as for example a selectable marker or any convenient sequence, that may interfere with the native promoter. The additional sequence inserted upstream of the initiating ATG of the SGI1, SGI2, cpSRP54, cytoSRP54, a combination of the genes, or a combination of the open reading frame (e.g., in the 5'UTR or upstream of the transcriptional start site of the cpSRP54 gene) can decrease or even eliminate expression of the endogenous SGI1, SGI2, cpSRP54, cytoSRP54, a combination of the genes,. Alternatively or in addition, the native SGI1, SGI2, cpSRP54, cytoSRP54, or a combination of the genes, can have its endogenous promoter wholly or partially replaced by a weaker or differently regulated promoter, or a non-promoter sequence.

[0154] In some examples, a nucleic acid molecule introduced into a host cell for generating a high efficiency genome editing cell line encodes a Cas9 enzyme that is mutated to with respect to the corresponding wild-type enzyme such that the mutated Cas9 enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (an enzyme that cleaves a single strand). Other examples of mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A. In some embodiments, a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ. Two nickase targets (within close proximity but targeting different strands of the DNA) can be used to inducing mutagenic NHEJ. Such targeting of a locus using enzymes that cleave opposite strains at staggered positions can also reduce nontarget cleavage, as both strands must be accurately and specifically cleaved to achieve genome mutation.

[0155] In additional examples, a mutant Cas9 enzyme that is impaired in its ability to cleave DNA can be expressed in the cell, where one or more guide RNAs that target a sequence upstream of the transcriptional or translational start site of the targeted gene are also introduced. In this case, the Cas enzyme may bind the target sequence and block transcription of the targeted gene (Qi et al. (2013) Cell 152:1173-1183).

[0156] In some cases, a Cas polypeptide such as a Cas9 polypeptide is a fusion polypeptide, comprising, e.g.: i) a Cas9 polypeptide (which can optionally be variant Cas9 polypeptide as described above); and b) a covalently linked heterologous polypeptide (also referred to as a "fusion partner"). A heterologous nucleic acid sequence may be linked to another nucleic acid sequence (e.g., by genetic engineering) to generate a chimeric nucleotide sequence encoding a chimeric polypeptide. In some embodiments, a Cas9 fusion polypeptide is generated by fusing a Cas9 polypeptide with a heterologous sequence that provides for subcellular localization (i.e., the heterologous sequence is a subcellular localization sequence, e.g., a nuclear localization signal (NLS) for targeting to the nucleus; a mitochondrial localization signal for targeting to the mitochondria; a chloroplast localization signal for targeting to a chloroplast; an ER retention signal; and the like). In some embodiments, the heterologous sequence can provide a tag (i.e., the heterologous sequence is a detectable label) for ease of tracking and / or purification (e.g., a fluorescent protein, e.g., green fluorescent protein (GFP), YFP, RFP, CFP, mCherry, tdTomato, and the like; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag; and the like).

[0157] Host cells can be genetically engineered (e.g. transduced or transformed or transfected) with, for example, a vector construct that can be, for example, a vector for homologous recombination that includes nucleic acid sequences homologous to a portion of a SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene locus of the host cell or to regions adjacent thereto, or can be an expression vector for the expression of any or a combination of: a Cas protein (e.g., a Class II Cas protein), a CRISPR chimeric guide RNA, a crRNA, and / or a tracrRNA, an RNAi construct (e.g., a shRNA), an antisense RNA, or a ribozyme. The vector can be, for example, in the form of a plasmid, a viral particle, a phage, etc. A vector for expression of a polypeptide or RNA for genome editing can also be designed for integration into the host, e.g., by homologous recombination. A vector containing a polynucleotide sequence as described herein, e.g., sequences having homology to host SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene sequences (including sequences that are upstream and downstream of the cpSRP54 or cytoSRP54-encoding sequences), as well as, optionally, a selectable marker or reporter gene, can be employed to transform an appropriate host to cause attenuation of a SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene.

[0158] The recombinant photosynthetic organism in some examples can have reduced but not abolished expression of the SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, and the recombinant photosynthetic organism can have a reduction in chlorophyll from about 10% to about 90%, for example, a reduction in total chlorophyll from about 20% to about 80%. A genetically modified microorganism as provided herein can in some examples include a nucleic acid construct for attenuating the expression of an SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. For example, a host microorganism can include a construct for expressing an RNAi molecule, ribozyme, or antisense molecule that reduces expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 genes. In some examples, a recombinant microorganism as provided herein can include at least one introduced (exogenous or non-native) construct for reducing expression of an SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 genes.

[0159] Engineered strains can be selected for expression of an SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 genes that is decreased with respect to a control cell that does not include a genetic modification for attenuating SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene expression, but not eliminated, using methods known in the art, such as, for example, RNA-Seq or reverse transcription-PCR (RT-PCR).

[0160] A genetically engineered strain as provided herein can be engineered to include a construct for attenuating gene expression by reducing the amount, stability, or translatability of mRNA of a gene encoding an SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. For example, a photosynthetic organism such as a plant or an algal or heterokont strain can be transformed with an antisense RNA, RNAi, or ribozyme construct targeting a mRNA of an SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes using methods known in the art. For example, an antisense RNA construct that includes all or a portion of the transcribed region of a gene can be introduced into a microorganism to decrease gene expression (Shroda et al. (1999) The Plant Cell 11:1165-78; Ngiam et al. (2000) Appl. Environ. Microbiol. 66: 775-782; Ohnuma et al. (2009) Protoplasma 236: 107-112; Lavaud et al. (2012) PLoS One 7:e36806). Alternatively or in addition, an RNAi construct (for example, a construct encoding a short hairpin RNA) targeting a cpSRP54 or cytoSRP54 gene can be introduced into a microorganism such as an alga or heterokont for reducing expression of the cpSRP54 or cytoSRP54 gene (see, for example, Cerruti et al. (2011) Eukaryotic Cell (2011) 10: 1164-1172; Shroda et al. (2006) Curr. Genet. 49:69-84).

[0161] Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity. For example, U.S. Pat. No. 5,354,855 reports that certain ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes. Catalytic RNA constructs (ribozymes) can be designed to base pair with a mRNA encoding a gene as provided herein to cleave the mRNA target. In some examples, ribozyme sequences can be integrated within an antisense RNA construct to mediate cleavage of the target. Various types of ribozymes can be considered, their design and use is known in the art and described, for example, in Haseloff et al. (1988) Nature 334:585-591.

[0162] Ribozymes are targeted to a given sequence by virtue of annealing to a site by complementary base pair interactions. Two stretches of homology are required for this targeting. These stretches of homologous sequences flank the catalytic ribozyme structure defined above. Each stretch of the homologous sequence can vary in length from 7 to 15 nucleotides. The only requirement for defining the homologous sequences is that, on the target RNA, they are separated by a specific sequence which is the cleavage site. For hammerhead ribozyme, the cleavage site is a dinucleotide sequence on the target RNA is a uracil (U) followed by either an adenine, cytosine or uracil (A, C, or U) (Thompson et al., (1995) Nucl Acids Res 23:2250-68). The frequency of this dinucleotide occurring in any given RNA is statistically 3 out of 16. Therefore, for a given target messenger RNA of 1,000 bases, 187 dinucleotide cleavage sites are statistically possible.

[0163] The general design and optimization of ribozyme directed RNA cleavage activity has been discussed in detail (Haseloff and Gerlach (1988) Nature 334:585-591; Symons (1992) Ann Rev Biochem 61: 641-71; Chowrira et al. (1994) J Biol Chem 269:25856-64; Thompson et al. (1995) supra). Designing and testing ribozymes for efficient cleavage of a target RNA is a process well known to those skilled in the art. Examples of scientific methods for designing and testing ribozymes are described by Chowrira et al., (1994) supra and Lieber and Strauss (1995) Mol Cell Biol. 15: 540-51. The identification of operative and preferred sequences for use in down-regulating a given gene is a matter of preparing and testing a given sequence, and is a routinely practiced "screening" method known to those of skill in the art.

[0164] The use of RNAi constructs is described in the literature cited above as well as in US2005 / 0166289 and WO 2013 / 016267, for example. A double-stranded RNA with homology to the target gene is delivered to the cell or produced in the cell by expression of an RNAi construct, for example, an RNAi short hairpin (sh) construct. The construct can include a sequence that is identical to the target gene, or at least 70%, 80%, 90%, 95%, or between 95% and 100% identical to a sequence of the target gene. The construct can have at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1 kb of sequence homologous to the target gene. Expression vectors can be engineered using promoters selected for continuous or inducible expression of an RNAi construct, such as a construct that produces a shRNA.

[0165] A nucleic acid construct for gene attenuation, e.g., a ribozyme, RNAi, or antisense construct can include at least fifteen, at least twenty, at least thirty, at least forty, at least fifty, or at least sixty nucleotides having at least 80% identity, such as at least 85%, at least 90%, at least 95%, or at least 99% or complementarity to at least a portion of the sequence of an endogenous SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes of the microorganism to be engineered. A nucleic acid construct for gene attenuation, e.g., a ribozyme, RNAi, or antisense construct can include at least fifteen, at least twenty, at least thirty, at least forty, at least fifty, or at least sixty nucleotides having at least 80%, such as at least 95% or about 100%, identity or complementarity to the sequence of a naturally-occurring gene, such as a gene having encoding a polypeptide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80% or at least 85%, at least 90%, or at least 95% sequence identity to an endogenous SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. For example, a nucleic acid construct for gene attenuation, e.g., a ribozyme, RNAi, or antisense construct can include at least fifteen, at least twenty, at least thirty, at least forty, at least fifty, or at least sixty nucleotides having at least 80% identity or complementarity to the sequence of a naturally-occurring cpSRP54 gene, such as any provided herein. The nucleotide sequence can be, for example, from about 30 nucleotides to about 3 kilobases or greater, for example, from 30-50 nucleotides in length, from 50 to 100 nucleotides in length, from 100 to 500 nucleotides in length, from 500 nucleotides to 1 kb in length, from 1 kb to 2 kb in length, or from 2 to 5 kb. For example, an antisense sequence can be from about 100 nucleotides to about 1 kb in length. For example, a nucleic acid construct for gene attenuation, e.g., a ribozyme, RNAi, or antisense construct can include at least fifteen, at least twenty, at least thirty, at least forty, at least fifty, at least sixty, or at least 100 nucleotides having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%, for example at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% identity or complementarity to an endogenous SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes or a portion thereof.

[0166] Promoters used in antisense, RNAi, or ribozyme constructs can be any that are functional in the host organism and that are suitable for the levels of expression required for reducing expression of the target gene to a desired amount. Promoters functional in algae and heterokonts are known in the art and disclosed herein. The construct can be transformed into algae using any feasible method, include any disclosed herein. A recombinant organism or microorganism transformed with a nucleic acid molecule for attenuating SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 gene expression, such as but not limited to an antisense, RNAi, or ribozyme construct, can have the properties of a SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 mutant as described herein, including, for example, reduced chlorophyll, increased photosynthetic efficiency, and increased productivity in culture, with respect to a host organism or microorganism that does not include the exogenous nucleic acid molecule that results in attenuated gene expression.Nucleic Acid Molecules and Constructs

[0167] One skilled in the art will appreciate that a number of transformation methods can be used for genetic transformation of microorganisms and, therefore, can be deployed for the methods of the present invention. "Stable transformation" is intended to mean that the nucleic acid construct introduced into an organism integrates into the genome of the organism or is part of a stable episomal construct and is capable of being inherited by the progeny thereof. "Transient transformation" is intended to mean that a polynucleotide is introduced into the organism and does not integrate into the genome or otherwise become established and stably inherited by successive generations.

[0168] Genetic transformation can result in stable insertion and / or expression of transgenes, constructs from either the nucleus or the plastid, and in some cases can result in transient expression of transgenes. The transformation methods can also be used for the introduction of guide RNAs or editing DNAs. Genetic transformation of microalgae has been reported successful for more than 30 different strains of microalgae, which belong to at least ~22 species of green, red, and brown algae, diatoms, euglenids, and dianoflagellates (see, e.g., Radakovits et al., Eukaryotic Cell, 2010; and Gong et al., J. Ind. Microbiol. Biotechnol., 2011). Non-limiting examples of such useful transformation methods include agitation of cells in the presence of glass beads or silicon carbide whiskers as reported by, for example, Dunahay, Biotechniques, 15(3):452-460, 1993; Kindle, Proc. Natl. Acad. Sci. U.S.A., 1990; Michael and Miller, Plant J., 13, 427-435, 1998. Electroporation techniques have been successfully used for genetic transformation of several microalgal species including Nannochloropsis sp. (see, e.g., Chen et al., J. Phycol., 44:768-76, 2008), Chlorella sp. (see, e.g., Chen et al., Curr. Genet., 39:365-370, 2001; Chow and Tung, Plant Cell Rep. Vol.18, No. 9, 778-780, 1999), Chlamydomonas (Shimogawara et al., Genetics, 148: 1821-1828, 1998), Dunaliella (Sun et al., Mol. Biotechnol., 30(3): 185-192, 2005). Micro-projectile bombardment, also referred to as microparticle bombardment, gene gun transformation, or biolistic bombardment, has been used successfully for several algal species including, for example, diatoms species such as Phaeodactylum (Apt et al., Mol. Gen. Genet., 252:572-579, 1996), Cyclotella and Navicula (Dunahay et al., J. Phycol., 31:1004-1012, 1995), Cylindrotheca (Fischer et al., J. Phycol., 35:113-120, 1999), and Chaetoceros sp. (Miyagawa-Yamaguchi et al., Phycol. Res. 59: 113-119, 2011), as well as green algal species such as Chlorella (El-Sheekh, Biologia Plantarum, Vol.42, No.2: 209-216, 1999), and Volvox species (Jakobiak et al., Protist, 155:381-93, 2004). Additionally, Agrobacterium-mediated gene transfer techniques can also be useful for the genetic transformation of microalgae, as has been reported by, for example, Kumar, Plant Sci., 166(3):731-738, 2004, and Cheney et al., J. Phycol., Vol. 37, Suppl. 11, 2001.

[0169] A transformation vector or construct as described herein will typically comprise a marker gene that confers a selectable or scorable phenotype on target host cells, e.g., algal cells or may be co-transformed with a construct that includes a marker. A number of selectable markers have been successfully developed for efficient isolation of genetic transformants of algae. Common selectable markers include antibiotic resistance, fluorescent markers, and biochemical markers. Several different antibiotic resistance genes have been used successfully for selection of microalgal transformants, including blastocydin, bleomycin (see, for example, Apt et al., 1996, supra; Fischer et al., 1999, supra; Fuhrmann et al., Plant J., 19, 353- 61, 1999, Lumbreras et al., Plant J., 14(4):441-447, 1998; Zaslavskaia et al., J. Phycol., 36:379-386, 2000), spectinomycin (Cerutti et al., Genetics, 145: 97-110, 1997; Doetsch et al., Curr. Genet., 39, 49-60, 2001; Fargo, Mol. Cell. Biol., 19:6980-90, 1999), streptomycin (Berthold et al., Protist, 153:401-412, 2002), paromomycin (Jakobiak et al., Protist, supra.; Sizova et al., Gene, 277:221-229, 2001), nourseothricin (Zaslavskaia et al., 2000, supra), G418 (Dunahay et al., 1995, supra; Poulsen and Kroger, FEBS Lett., 272:3413-3423, 2005, Zaslavskaia et al., 2000, supra), hygromycin (Berthold et al., 2002, supra), chloramphenicol (Poulsen and Kroger, 2005, supra), and many others. Additional selectable markers for use in microalgae such as Chlamydomonas can be markers that provide resistance to kanamycin and amikacin resistance (Bateman, Mol. Gen. Genet. 263:404-10, 2000), zeomycin and phleomycin (e.g., ZEOCIN ™< pheomycin D1) resistance (Stevens, Mol. Gen. Genet. 251:23-30, 1996), and paramomycin and neomycin resistance (Sizova et al., 2001, supra). Other fluorescent or chromogenic markers that have been used include luciferase (Falciatore et al., J. Mar. Biotechnol., 1: 239-251, 1999; Fuhrmann et al., Plant Mol. Biol., 2004; Jarvis and Brown, Curr. Genet., 19: 317-322, 1991), β-glucuronidase (Chen et al., 2001, supra; Cheney et al., 2001, supra; Chow and Tung, 1999, supra; El-Sheekh, 1999, supra; Falciatore et al., 1999, supra; Kubler et al., J. Mar. Biotechnol., 1:165-169, 1994), β-galactosidase (Gan et al., J. Appl. Phycol., 15:345-349, 2003; Jiang et al., Plant Cell Rep., 21:1211-1216, 2003; Qin et al., High Technol. Lett., 13:87-89, 2003), and green fluorescent protein (GFP) (Cheney et al., 2001, supra; Ender et al., Plant Cell, 2002, Franklin et al., Plant J., 2002; 56, 148, 210).

[0170] One skilled in the art will readily appreciate that a variety of known promoter sequences can be usefully deployed for transformation systems of microalgal species in accordance with the present invention. For example, the promoters commonly used to drive transgene expression in microalgae include various versions of the of cauliflower mosaic virus promoter 35S (CaMV35S), which has been used in both dinoflagellates and Chlorophyta (Chow et al, Plant Cell Rep., 18:778-780, 1999; Jarvis and Brown, Curr. Genet., 317-321, 1991; Lohuis and Miller, Plant J., 13:427-435, 1998). The SV40 promoter from the simian virus has also reported being active in several algae (Gan et al., J. Appl. Phycol., 151 345-349, 2003; Qin et al., Hydrobiologia 398-399, 469-472, 1999). The promoters of RBCS2 (ribulose bisphosphate carboxylase, small subunit) (Fuhrmann et al., Plant J., 19:353-361, 1999) and PsaD (abundant protein of photosystem I complex; Fischer and Rochaix, FEBS Lett. 581:5555-5560, 2001) from Chlamydomonas can also be useful. The fusion promoters of HSP70A / RBCS2 and HSP70A / β2TUB (tubulin) (Schroda et al., Plant J., 21:121-131, 2000) can also be useful for an improved expression of transgenes, in which HSP70A promoter may serve as a transcriptional activator when placed upstream of other promoters. High-level expression of a gene of interest can also be achieved in, for example diatoms species, under the control of a promoter of an fcp gene encoding a diatom fucoxanthin-chlorophyll a / b binding protein (Falciatore et al., Mar. Biotechnol., 1:239-251, 1999; Zaslavskaia et al., J. Phycol. 36:379-386, 2000) or the vcp gene encoding a eustigmatophyte violaxanthin-chlorophyll a / b binding protein (see U.S. Patent No. 8,318,482). If so desired, inducible promoters can provide rapid and tightly controlled expression of genes in transgenic microalgae. For example, promoter regions of the NR genes encoding nitrate reductase can be used as such inducible promoters. The NR promoter activity is typically suppressed by ammonium and induced when ammonium is replaced by nitrate (Poulsen and Kroger, FEBS Lett 272:3413-3423, 2005), thus gene expression can be switched off or on when microalgal cells are grown in the presence of ammonium / nitrate. Additional algal promoters that can find use in the constructs and transformation systems provided herein include those disclosed in U.S. Patent No. 8,883,993; U.S. Patent Appl. Pub. No. US 2013 / 0023035; U.S. Patent Application Pub. No. US 2013 / 0323780; and U.S. Patent Application Pub. No. US 2014 / 0363892.

[0171] Host cells can be either untransformed cells or cells that are already transfected with at least one nucleic acid molecule. For example, an algal host cell that is engineered to have attenuated expression of a cpSRP54 gene can further include one or more genes that may confer any desirable trait, such as, but not limited to, increased production of biomolecules of interest, such as one or more proteins, pigments, alcohols, or lipids.Methods of Producing Products from Photosynthetic Organisms

[0172] Also provided herein are methods of producing products from photosynthetic organisms, such as algae by culturing the photosynthetic organism having increased photosynthetic efficiency, such as the SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 mutants disclosed herein. The methods include culturing a photosynthetic organism mutant SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 gene, or a combination of SGI2 and cpSRP54 in a suitable medium to provide a photosynthetic organism culture and recovering biomass or at least one product from the culture. In some embodiments the product is a lipid. The culture comprising photosynthetic organism is preferably a photoautotrophic culture, and the culture medium preferably does not include a substantial amount of reduced carbon, that is, the culture does not include reduced carbon in a form or at a level that can be used by the algae for growth.

[0173] In some embodiments, the photosynthetic organism may be cultured in any suitable vessel, including flasks or bioreactors, where the photosynthetic organism may be exposed to artificial or natural light. The culture comprising mutant photosynthetic organism may be cultured on a light / dark cycle that may be, for example, a natural or programmed light / dark cycle, and as illustrative examples, may provide twelve hours of light to twelve hours of darkness, fourteen hours of light to ten hours of darkness, sixteen hours of light to eight hours of darkness, etc.

[0174] Culturing refers to the intentional fostering of growth (e.g., increases in cell size, cellular contents, and / or cellular activity) and / or propagation (e.g., increases in cell numbers via mitosis) of one or more cells by use of selected and / or controlled conditions. The combination of both growth and propagation may be termed proliferation. As demonstrated in the examples herein, the mutants provided herein exhibiting deregulated adaptation to low light intensity can achieve higher cell density of the culture over time, for example, over a period of a week or more, with respect to a culture wild type algal cells of the same strain that are not deregulated in low light acclimation. For example, a cpSRP54 mutant may be cultured for at least five, at least six, at least seven at least eight, at least nine, at least ten, at least eleven at least twelve, at least thirteen, at least fourteen, or at least fifteen days, or at least one, two three, four, five, six, seven, eight, nine, or ten weeks, or longer.

[0175] Non-limiting examples of selected and / or controlled conditions that can be used for culturing the recombinant microorganism can include the use of a defined medium (with known characteristics such as pH, ionic strength, and / or carbon source), specified temperature, oxygen tension, carbon dioxide levels, growth in a bioreactor, or the like, or combinations thereof. In some embodiments, the microorganism or host cell can be grown mixotrophically, using both light and a reduced carbon source. Alternatively, the microorganism or host cell can be cultured phototrophically. When growing phototrophically, the algal strain can advantageously use light as an energy source. An inorganic carbon source, such as CO 2 or bicarbonate can be used for the synthesis of biomolecules by the microorganism. "Inorganic carbon", as used herein, includes carbon-containing compounds or molecules that cannot be used as a sustainable energy source by an organism. Typically "inorganic carbon" can be in the form of CO 2 (carbon dioxide), carbonic acid, bicarbonate salts, carbonate salts, hydrogen carbonate salts, or the like, or combinations thereof, which cannot be further oxidized for sustainable energy nor used as a source of reducing power by organisms. A microorganism grown photoautotrophically can be grown on a culture medium in which inorganic carbon is substantially the sole source of carbon. For example, in a culture in which inorganic carbon is substantially the sole source of carbon, any organic (reduced) carbon molecule or organic carbon compound that may be provided in the culture medium either cannot be taken up and / or metabolized by the cell for energy and / or is not present in an amount sufficient to provide sustainable energy for the growth and proliferation of the cell culture.

[0176] Microorganisms and host cells that can be useful in accordance with the methods of the present invention can be found in various locations and environments throughout the world. The particular growth medium for optimal propagation and generation of lipid and / or other products can vary and may be optimized to promote growth, propagation, or production of biomass or a product such as a lipid, protein, pigment, antioxidant, etc. Solid and liquid growth media are generally available from a wide variety of sources, as are instructions for the preparation of particular media suitable for a wide variety of strains of microorganisms. For example, various fresh water and salt water media can include those described in Barsanti (2005) Algae: Anatomy, Biochemistry & Biotechnology, CRC Press for media and methods for culturing algae. Algal media recipes can also be found at the websites of various algal culture collections, including, as nonlimiting examples, the UTEX Culture Collection of Algae (www.sbs.utexas.edu / utex / media.aspx); Culture Collection of Algae and Protozoa (www.ccap.ac.uk); and Katedra Botaniky (botany.natur.cuni.cz / algo / caup-media.html).

[0177] The culture methods can optionally include inducing expression of one or more genes for the production of a product, such a but not limited to a protein that participates in the production of a lipid, one or more proteins, antioxidants, or pigments, and / or regulating a metabolic pathway in the microorganism. Inducing expression can include adding a nutrient or compound to the culture, removing one or more components from the culture medium, increasing or decreasing light and / or temperature, and / or other manipulations that promote expression of the gene of interest. Such manipulations can largely depend on the nature of the (heterologous) promoter operably linked to the gene of interest.

[0178] In some embodiments of the present invention, the microorganisms deregulated in acclimation to low light intensity can be cultured in a "photobioreactor" equipped with an artificial light source, and / or having one or more walls that is transparent enough to light, including sunlight, to enable, facilitate, and / or maintain acceptable microorganism growth and proliferation. For the production of fatty acid products or triglycerides, photosynthetic microorganisms or host cells can additionally or alternatively be cultured in shake flasks, test tubes, vials, microtiter dishes, Petri dishes, or the like, or combinations thereof.

[0179] Additionally or alternatively, recombinant photosynthetic microorganisms or host cells may be grown in ponds, canals, sea-based growth containers, trenches, raceways, channels, or the like, or combinations thereof. In such systems, the temperature may be unregulated, or various heating or cooling method or devices may be employed. As with standard bioreactors, a source of inorganic carbon (such as, but not limited to, CO 2 , bicarbonate, carbonate salts, and the like), including, but not limited to, air, CO 2 -enriched air, flue gas, or the like, or combinations thereof, can be supplied to the culture. When supplying flue gas and / or other sources of inorganic that may contain CO in addition to CO 2 , it may be necessary to pre-treat such sources such that the CO level introduced into the (photo)bioreactor do not constitute a dangerous and / or lethal dose with respect to the growth, proliferation, and / or survival of the microorganisms.

[0180] The mutant photosynthetic organism can include one or more non-native genes encoding a polypeptide for the production of a product, such as, but limited to, a lipid, a colorant or pigment, an antioxidant, a vitamin, a nucleotide, a nucleic acid, an amino acid, a hormone, a cytokine, a peptide, a protein, or a polymer. For example, the encoded polypeptide can be an enzyme, metabolic regulator, cofactor, carrier protein, or transporter. The methods include culturing a cpSRP54 mutant or cytoSRP54 mutant that includes at least one non-native gene encoding a polypeptide that participates in the production of a product, to produce biomass or at least one algal product. Products such as lipids and proteins can be recovered from the culture by the recovery means known to those of ordinary skill in the art, such as by whole culture extraction, for example, using organic solvents. In some cases, recovery of fatty acid products can be enhanced by homogenization of the cells. For example, lipids such as fatty acids, fatty acid derivatives, and / or triglycerides can be isolated from algae by extraction of the algae with a solvent at elevated temperature and / or pressure, as described in the co-pending, commonly-assigned U.S. Patent Application Publication No. US 2013 / 0225846.

[0181] Other alternative embodiments and methods will be apparent to those of skill in the art upon review of this disclosure. The discussion of the general methods given herein is intended for illustrative purposes only. The following non-limiting examples are provided below.EXAMPLES EXAMPLE 1 GENERATION OF PARACHLORELLA STRAINS OVEREXPRESSING CAS9

[0182] Generation of Parachlorella strains overexpressing Cas9 was described in US Patent Application Publication 2016 / 0304896.

[0183] Briefly, a vector, pSGE-6709, was engineered for the expression of the Streptococcus pyogenes Cas9 gene in Parachlorella. The vector included the following three elements: 1) a Cas9 expression cassette which contained an engineered Cas9 gene codon optimized for Parachlorella and containing introns from Parachlorella, that also included an N-terminal FLAG tag, nuclear localization signal, and peptide linker operably linked to the Parachlorella RPS17 promoter and terminated by the Parachlorella RPS17 terminator a selectable marker expression cassette, which contained the blasticidin resistance gene from Aspergillus terreus codon optimized for Parachlorella and containing Parachlorella introns, operably linked to the Parachlorella RPS4 promoter and terminated by the Parachlorella RPS4 terminator, a GFP reporter expression cassette, which contained the TurboGFP gene (Evrogen, Moscow, Russia), driven by the Parachlorella ACP1 promoter and terminated by the Parachlorella ACP1 terminator.

[0184] The vector was transformed into Parachlorella by biolistics. Transformation of Parachlorella wild-type strain WT-1185 was accomplished using the BioRad Helios ®< Gene Gun System essentially as described in US Patent Publication No. 2014 / 0154806. DNA for transformation was precipitated onto gold particles, the gold particles adhered to the inside of lengths of tubing, and a burst of helium gas was fired through the tubing positioned within the Gene Gun to propel the DNA-coated gold particles into Parachlorella strain WT-1185 cells which were adhered on solid non-selective media (2% agar plates containing PM074 algal growth medium). The Helios ®< Gene Gun was used to fire two bullets per cell circle at 600 psi from a distance of 3-6 cm from the plate. The following day, cells were transferred onto a selective medium for growth of transformed colonies.

[0185] Colonies were screened for full GFP penetrance by flow cytometry and identification of transformed strains that had a single fluorescence peak shifted to a higher value than the wild-type fluorescence peak. Fully penetrant Cas9 strains demonstrating a clearly shifted fluorescence peak with respect to nontransformed cells were tested for Cas9 expression by anti-Cas9 western blotting for evidence of Cas9 expression. Based on these screens, isolate 6709-2 was carried forward and given strain identifier GE-15699.EXAMPLE 2: KNOCKOUT OF CPSRP54 USING FULLY PENETRANT PARACHLORELLA CAS9 EDITOR LINE

[0186] Knockout of cpSRP54 using fully penetrant Parachlorella Cas9 editor line was described in US Patent Application Publication 2016 / 0304896. Briefly, a chimeric gRNA (SEQ ID NO:103) was designed, the last three nucleotides represent the PAM, and synthesized in vitro to target the chloroplastic SRP54 gene in Parachlorella coding sequence.

[0187] GE-15699 was transformed by electroporation with 1-2 µg of purified chimeric guide RNA, and 1 µg of selectable marker DNA which contained a bleomycin resistance "BleR" gene codon-optimized for Parachlorella and containing introns from Parachlorella (SEQ ID:70). The BleR gene was operably linked to the Parachlorella RPS4 promoter (SEQ ID:71) and terminated by the Parachlorella RPS4 terminator (SEQ ID:72).

[0188] Electroporation was performed by inoculating a 100 mL seed culture inoculated to 1 x 10 6< cells / mL six days before the transformation was used to inoculate a 1L culture to 1 x 10 6< cells / mL two days before transformation. On the day of transformation, cells were pelleted by centrifugation at 5000 x g for 20 minutes, washed three times with 0.1um filtered 385 mM sorbitol, and resuspended to 5x10 9< cells / mL in 385 mM sorbitol. Electroporation of 100 µL concentrated cells was performed in 0.2 cm cuvettes in a BioRad Gene Pulser Xcell ™< under varied conditions. The DNA used for optimization of electroporation was linearized pSG6640 including the bleR and TurboGFP expression cassettes. The TurboGFP cassette included the Parachlorella ACP1 promoter (SEQ ID NO:67) operably linked to the TurboGFP gene (SEQ ID NO:24) and the Parachlorella ACP1 terminator (SEQ ID NO:68). Immediately after electroporating pre-chilled cells and cuvettes, 1mL cold sorbitol was added and used to transfer cells into 10 mL PM074. After overnight recovery, cells were concentrated and spread onto 13cm-diameter PM074 media containing zeocin at 250 mg / L and grown under the conditions listed in the biolistics section.

[0189] Electroporation conditions were 1.0-1.2 kV (5000-6000 V / cm), 200-300 ohms, and 25-50 µF. Use of larger quantities of DNA increased the resulting number of zeocin-resistant colonies, though the effect plateaued at amounts larger than 4 µg. Following electroporation, cells were plated on agar medium (PM130) containing 250 µg / ml zeocin to select for transformants that incorporated the ble cassette. Transformants were screened by colony PCR using primers designed to amplify across the native targeted locus (oligo-AE596 and oligo-AE597). The primers were designed to produce a 700 bp band in the absence of integration (e.g., "knock-in" of the BleR cassette) into the locus, or a 4.3kb band if there was the integration of a single ble cassette into the targeted locus. In addition, colony PCR was also performed using primers designed to amplify a fragment extending from the cpSRP54 gene (oligo-AE597) into the selectable marker. Depending on the orientation of the integrated ble cassette, a 1.2kb band would result from either amplification by primers 405 / 597 or primers 406 / 597 spanning from within the ble cassette out into the cpSRP54 gene. The results showed a high frequency (between 40 and 45% in this sample) of knock-in of the BleR cassette into the targeted locus in the absence of homology arms. The cpSRP54 knockouts resulted in a pale green phenotype.EXAMPLE 3 KNOCKOUT OF SGI2 USING FULLY PENETRANT PARACHLORELLA CAS9 EDITOR LINE

[0190] The knockout of SGI2 using fully penetrant Parachlorella Cas9 editor Line was done essentially as described for cpSRP54 above. Briefly, a chimeric gRNA (SEQ ID NO:104) was designed, the last three nucleotides represent the PAM, and synthesized in vitro to target the chloroplastic SGI2 gene in Parachlorella coding sequence.

[0191] GE-15699 was transformed by electroporation with 1-2 µg of purified chimeric guide RNA, and 1 µg of selectable marker DNA which contained a bleomycin resistance "BleR" gene codon-optimized for Parachlorella and containing introns from Parachlorella (SEQ ID:70). The BleR gene was operably linked to the Parachlorella RPS4 promoter (SEQ ID:71) and terminated by the Parachlorella RPS4 terminator (SEQ ID:72).

[0192] The Ble-resistant colonies were selected and the knockout is confirmed by PCR.EXAMPLE 4 KNOCKOUT OF SGI1 USING FULLY PENETRANT PARACHLORELLA CAS9 EDITOR LINE

[0193] SGI1 knockout strain 24183 was created starting with the Cas9 expressing mother-strain, GE-15699. The GE-15699 cells were electroporated with a chimeric gRNA (SEQ ID NO:105, the last three nucleotides of SEQ ID NO: 105 represent the PAM), and a DNA cassette containing a codon optimized Cre gene flanked by nitrite reductase promoter and terminators and shown in Figure 10A. The cassette also contained ble and GFP genes that have been previously used. Ble and GFP were flanked by lox2272 sites. When Cre is expressed, the lox sites recombine, looping out the DNA between these sequences. Homologous sequences to the SGI1 gene surrounding the CRISPR target were also on the ends of the cassette, to enhance single copy integration. The sequence was confirmed by DNA sequencing for the presence of the cassette in the SGI1 locus. The copy number was confirmed to be a single copy integrant using ddPCR. We then cultured the strain in non-ammonium containing media, to express Cre. When Cre is expressed, the lox sites recombine, looping out the DNA between these sequences.EXAMPLE 5 DOUBLE KNOCKOUT OF SGI2 AND CPSRP54 USING FULLY PENETRANT PARACHLORELLA CAS9 EDITOR LINE

[0194] The double knockout of SGI2 and SRP54 using fully penetrant Parachlorella Cas9 editor Line was done essentially as described for cpSRP54 above. Briefly, two chimeric gRNAs, one for cpSRP54 (SEQ ID NO:69) and another for SGI2 (SEQ ID NO: 73) was designed, the last three nucleotides represent the PAM, and synthesized in vitro to target the chloroplastic SGI1 gene in Parachlorella coding sequence.

[0195] GE-15699 was transformed by electroporation with 1-2 µg of purified chimeric guide RNAs, and 1 µg of selectable marker DNA which contained a bleomycin resistance "BleR" gene codon-optimized for Parachlorella and containing introns from Parachlorella (SEQ ID:70). The BleR gene was operably linked to the Parachlorella RPS4 promoter (SEQ ID:71) and terminated by the Parachlorella RPS4 terminator (SEQ ID:72).

[0196] The Ble-resistant colonies were selected and the knockout is confirmed by PCR.EXAMPLE 6 DOUBLE KNOCKOUT OF SGI1 AND CPSRP54 USING FULLY PENETRANT PARACHLORELLA CAS9 EDITOR LINE

[0197] The Parachlorella SGI1 knockout strain 24183 as described above was electroporated with chimeric gRNA targeting cpSRP54 (SEQ ID NO: 69) with a DNA cassette comprising ble and GFP sequences (Figure 10B) to generate the double knockout of SGI1 and cpSRP54. The Ble-resistant colonies were selected and the knockout is confirmed by PCR. Three double knockout strains were generated: STR24538, STR24540, and STR24541 which were identical in their photophysiological properties and physical phenotypes.EXAMPLE 7 GENERATION OF A PARACHLORELLA SGI1 KNOCKOUT STRAIN COMPRISING A SINGLE COPY CAS9 GENE

[0198] A bleomycin resistance "BleR" gene codon-optimized for Parachlorella and comprising the introns from Parachlorella (SEQ ID:70), GFP gene, Cre gene, a lox site, and Cas9 gene were cloned into a pCC1BAC vector. The Cas9 gene was operably linked to the Parachlorella RPS17 promoter and comprises 29 native PBP introns and was outside of the lox2272 sites. The Cas9 gene was terminated by the Parachlorella RPS17 terminator. The BleR gene was operably linked to the Parachlorella RPS4 promoter (SEQ ID:71) and terminated by the Parachlorella RPS4 terminator (SEQ ID:72). The GFP gene was operably linked to the Parachlorella ACP1 promoter and terminated by the Parachlorella ACP1 terminator. The Cre gene was operably linked to the Parachlorella nitrite reductase promoter and Parachlorella nitrite reductase terminator. These genes are flanked by portions of SGI1 (CheY) sequences which serves as homologous recombination sites. A schematic diagram of the recombinant pCC1BAC vector is shown in Figure 17.

[0199] Transformation WT Parachlorella host strain: STR00010

[0200] A Cas9 gene, WT Parachlorella host strain was co-transformed with gRNA targeting SGI1 gene (SEQ ID NO: 74) and a PvuI-digested and spin-purified selection cassette (NAS00460, SEQ ID NO: 86).

[0201] The selection cassette (NAS00460) comprises a fragment that includes 1.7kb of the vector backbone (corresponding to sequences 1-1761 of SEQ ID NO: 86) upstream of the SGI1 homologous recombination (HR) up arm and no portion of the vector downstream of the SGI1 HR down arm, bleomycin resistance "BleR" gene codon-optimized for Parachlorella and containing introns from Parachlorella (SEQ ID:70), GFP gene (corresponding to sequences 8260-8961 of SEQ ID NO: 86), and Cas9 gene. Selection cassette contains ble and GFP within lox sites. The CRE gene (corresponding to sequences 10418-13326 of SEQ ID NO: 86) comprises 6 Nitrite reductase codon optimized Parachlorella introns. was under the nitrite reductase inducible promoter (corresponding to sequences 9906-10417 of SEQ ID NO: 86). The Cre gene is terminated by Nitrite reductase terminator (corresponding to sequences 13327-15140 of SEQ ID NO: 86). The Cas9 gene including the 29 native PBP introns corresponds to sequence 15754 to sequence 25918 of SEQ ID NO: 86. The Cas9 gene was under the Parachlorella RPS17 promoter (corresponding to sequences 15166-15753 of SEQ ID NO: 86) and containing 29 native PBP introns and was outside of the lox sites. The Cas9 gene was terminated by the Parachlorella RPS17 terminator (corresponding to sequences 25919-26373 of SEQ ID NO: 86). T

[0202] The BleR gene was operably linked to the Parachlorella RPS4 promoter (SEQ ID:71) and terminated by the Parachlorella RPS4 terminator (SEQ ID:72). The GFP gene was operably linked to the Parachlorella ACP1 promoter (corresponding to sequences 7688 to 8259 of SEQ ID NO: 86) and terminated by the Parachlorella ACP1 terminator (corresponding to sequences 8692-9830 of SEQ ID NO: 86). The SGI1 homologous recombination (HR) up arm corresponds to sequences 1762-3578 of SEQ ID NO: 86. The SGI1 homologous recombination (HR) downstream arm corresponds to sequences 26448-28447 of SEQ ID NO: 86. The 5' lox2272 site corresponds to sequences 3831-3864 of SEQ ID NO: 86 and the 3' lox2272 corresponds to sequences 9839-9872 of SEQ ID NO: 86. All the sequences are within 2kb homologous regions upstream and downstream of the SGI1 CRISPR target.

[0203] Upon co-transformation of the SGI1 gRNA (SEQ ID NO: 105) and selection cassette (SEQ ID NO: 86), the SGI1 gene is knocked out and a selection cassette comprising the Cas9, BleR, and GFP genes is inserted into the SGI1 site by homologous recombination. The BleR, and GFP genes are flanked by lox2272 sites, while the Cas9 and the Cre genes of the selection cassette are outside the lox2272 sites but within the portions of the SGI1 sequences that serve as homologous recombination sites.

[0204] Once the selection cassette is inserted into the SGI1 locus, the Cre gene is operably linked to an inducible nitrite reductase promoter. Thus, when the microorganism is grown in a growth media comprising nitrite, the Cre gene expression is induced. Upon the expression of the Cre gene, the Cre enzyme acts on the lox2272 sites and removes the BleR and GFP sequences that are flanked within the lox sites. This results in a system where the selectable markers (e.g., GFP, other antibiotic markers, e.g., BleR) can be reintroduced during subsequent transformation of other sequences.Screening of transformed Parachlorella strains for Cas9 insertion

[0205] The transformed Parachlorella cells were plated to single colonies on selective plates containing ammonium to repress CRE expression, patched colonies again on selective repressive plates, and screened for knockouts using PCR and GFP shifts. PCR primers used for confirming the knockout are shown below:

[0206] AE803: AGGCTACTCTCAGACATGACGGTGGCTCTG (SEQ ID NO: 87)

[0207] ST815: GCCACAAATGAAGGTTGGCAGGGTCAGTGC (SEQ ID NO: 88)

[0208] PCR positive reactions were sent for sequencing to confirm knockouts (insertion of the cassette) and perfect HR. Inventors of the present application surprisingly and unexpectedly found that a single copy Cas9 gene was inserted in the SGI1 locusEXAMPLE 8 TRIPLE KNOCKOUT OF SGI1, SGI2, AND CPSRP54 USING FULLY PENETRANT PARACHLORELLA SINGLE COPY CAS9 EDITOR LINE

[0209] A Parachlorella SGI1 knockout strain STR24129 as described above was created, which has a single copy of Cas9 and Cre inserted into SGI1 locus, with markers (ble / GFP) floxed out using an SGI1 knockout guide sequence: ACACCACCTTAAGGCACATGAGG (SEQ ID NO: 89).

[0210] SGI1 knockout strain STR24129 was used as a transformation host for knocking out SGI2 and SRP54 genes. Host strain STR24129 was co-transformed with gRNA targeting SGI2 and SRP54 genes and Selection cassette (pSGE06866) comprising Ultramers comprising homologous recombination (HR) arms for each target (e.g., SRP54 and SGI2). The BleR gene was operably linked to the Parachlorella RPS4 promoter (SEQ ID:71) and terminated by the Parachlorella RPS4 terminator (SEQ ID:72). The GFP gene was operably linked to the Parachlorella ACP1 promoter and terminated by the Parachlorella ACP1 terminator. Selection cassette comprises ble and GFP markers surrounded by lox sites for potential marker recycling. When Cre is expressed, the lox sites recombine, looping out the DNA between these sequences.

[0211] Transformed host cells were plated on selective plates, patched colonies and single colonies were picked, and screened for knockouts using PCR. PCR positive reactions were sent for sequencing to confirm knockout (insertion of the cassette) of each target.

[0212] Figures 16 Aand 16B shows the schematics of the selection cassettes for knocking out Parachlorella SRP54 and Parachlorella SGI2. The sequences of the gRNA, Ultramers with HR arms are shown below. SRP54- EMRE3EUKT592650 gRNA sequence: GGCGTGGGACATGGTGCGCAAGG (SEQ ID NO: 90) Ultramers with HR-arms to amplify pSGE06866: ST938_HR_SRP54-UP ST939_HR_SRP54-DOWN Primer sequences: ST949_CasPipe9GT_SRP54-fwd: caagctatgcgaggaagggagggtc (SEQ ID NO: 93) ST950_CasPipe9GT_SRP54-rev: ctgccgcaagtgagtgtgctgtc (SEQ ID NO: 94) Other Primers used for screening- located in selection cassette: JV946-Linker5-For: caccagatataggtgacccgataac (SEQ ID NO: 95) AE608 ble rev: AAAACTCCACTGCACCTGCAACAT (SEQ ID NO: 96) SGI2-EMRE3EUKT590485 gRNA sequence: ST937_crRNA_064_EMRE3EUKT590485: TGCGGTGAAGCTTGGAGCTG (SEQ ID NO: 97) Ultramer sequences to put HR arms onto PSGE06866 ST940_HR_SGI2-UP ST941_HR_SGI2-DOWN Primers sequences: ST046CasPipe9GT-064-fwd: gaggtgggtggtagtgcttcgcgaggtg (SEQ ID NO: 100) ST047CasPipe9GT-064-rev: atcacagctcacagggcagacactgcgtc (SEQ ID NO: 101) Primers sequences: Primers JV946 and AE608 were also used as screening primers. EXAMPLE 9 BIOINFORMATIC ANALYSIS OF THE DOMAIN ARCHITECTURE OF SGI2 PROTEINS

[0213] Domain architecture of exemplary SGI2 proteins from Parachlorella sp., Oocystis sp., Tetraselmis sp., Arabidopsis thaliana were analyzed using an online tool InterProScan (tool version 5.27, database version 66.0, from EMBL-EBI, Hinxton, Cambridgeshire, CB10 1SD, UK.)

[0214] A single conserved response receiver domain was identified in the N-terminus of the SGI2 proteins as shown in Figures 3-9.EXAMPLE 10 BIOINFORMATIC ANALYSIS OF RESPONSE RECEIVER DOMAINS OF VARIOUS SGI2 PROTEINS

[0215] Local alignment of Parachlorella response receiver domain (SEQ ID NO: 6) was performed with other orthologous proteins from other algal species and various plants using BLOSUM62 Matrix, Gap penalty of 10 and Extend penalty of 0.5. Local alignment of Parachlorella response receiver domain (SEQ ID NO: 6) with various photosynthetic organisms are shown below in Table 5. Table 5: Results of local alignments of Parachlorella response receiver domain with various orthologous proteins.SpeciesSEQ ID NO:Alignment ResultArabidopsis thaliana42Length: 121Identity: 39 / 121 (32.2%)Similarity: 61 / 121 (50.4%)Gaps: 9 / 121 (7.4%)Score: 149.5Arabidopsis thaliana43Length: 128Identity: 30 / 128 (23.4%)Similarity: 60 / 128 (46.9%)Gaps: 20 / 128 (15.6%)Score: 84.5Arabidopsis thaliana44Length: 121Identity: 37 / 121 (30.6%)Similarity: 59 / 121 (48.8%)Gaps: 9 / 121 (7.4%)Score: 133.5Length: 121Identity: 37 / 121 (30.6%)Arabidopsis thaliana45Similarity: 60 / 121 (49.6%)Gaps: 9 / 121 (7.4%)Score: 136.5Length: 129Identity: 29 / 129 (22.5%)Arabidopsis thaliana46Similarity: 54 / 129 (41.9%)Gaps: 22 / 129 (17.1%)Score: 66.0Length: 120Identity: 53 / 120 (44.2%)Oocystis sp.40Similarity: 77 / 120 (64.2%)Gaps: 4 / 120 (3.3%)Score: 242.5Length: 125Identity: 45 / 125 (36.0%)Tetraselmis sp.41Similarity: 69 / 125 (55.2%)Gaps: 16 / 125 (12.8%)Score: 167.5Length: 121Identity: 36 / 121 (29.8%)Glycine max47Similarity: 61 / 121 (50.4%)Gaps: 9 / 121 (7.4%)Score: 140.5Length: 121Identity: 37 / 121 (30.6%)Vitis vinifera48Similarity: 62 / 121 (51.2%)Gaps: 9 / 121 (7.4%)Score: 143.5Length: 121Identity: 38 / 121 (31.4%)Theobroma cacao49Similarity: 60 / 121 (49.6%)Gaps: 9 / 121 (7.4%)Score: 148.5Length: 121Identity: 40 / 121 (33.1%)Oryza sativa50Similarity: 64 / 121 (52.9%)Gaps: 9 / 121 (7.4%)Score: 169.5Length: 121Identity: 41 / 121 (33.9%)Zea mays51Similarity: 61 / 121 (50.4%)Gaps: 9 / 121 (7.4%)Score: 153.5Physcomitrella patensLength: 121Identity: 39 / 121 (32.2%)52Similarity: 64 / 121 (52.9%)Gaps: 9 / 121 (7.4%)Score: 164.5Length: 123Identity: 39 / 123 (31.7%)Volvox carteri53Similarity: 63 / 123 (51.2%)Gaps: 14 / 123 (11.4%)Score: 143.0Chlamydomonas reinhardtiiLength: 125Identity: 35 / 125 (28.0%)54Similarity: 61 / 125 (48.8%)Gaps: 12 / 125 (9.6%)Score: 135.5Chlorella zofingiensisLength: 121Identity: 38 / 121 (31.4%)55Similarity: 60 / 121 (49.6%)Gaps: 11 / 121 (9.1%)Score: 138.0Coccomyxa subellipsoidea C-169Length: 120Identity: 57 / 120 (47.5%)56Similarity: 79 / 120 (65.8%)Gaps: 1 / 120 (0.8%)Score: 256.0

[0216] The response receiver domain of Parachlorella sp. showed higher percent of identity with other algal species and a high degree of similarity with various plant species.EXAMPLE 11 SCREENS FOR LOW CHLOROPHYLL PARACHLORELLA SP. STRAIN WT-1185 MUTANTS

[0217] Following knockout of SGI1, SGI2, double knockout of SGI1 and cpSRP54, or double knockout of SGI2 and cpSRP54 of Parachlorella sp. genes, as described above, cells from pale-colored colonies were selected and allowed to grow from between one and five days in low (100 µmol photons m -2< sec -1< ) light, after which they were sorted by flow cytometry using a BD FACSAria II flow cytometer (BD Biosciences, San Jose, CA) to select cells having low chlorophyll fluorescence. In general, the portion of cells with the lowest approximately 0.5 to 2% of chlorophyll fluorescence compared to the total population of cells was selected. Further primary screening of antenna-reduced lines isolated through flow cytometry was conducted through the selection of pale green or yellow colonies visually after sorted cells were plated. In order to screen putative antenna-reduced lines from other reduced pigment mutants and false positives, selected colonies were subjected to a medium-throughput secondary cultivation screen to acclimate the isolates to low light conditions prior to photo-physiological measurements. Chlorophyll fluorescence was monitored during low light acclimation to select clones that retained the reduced chlorophyll fluorescence characteristic of the high light acclimated state. Clones that were selected demonstrated only small increases in chlorophyll (relative to wild-type cells) when transferred from high to low light.

[0218] Semicontinuous culture assays in constant high light (approximately 1,700 µmol photons m -2< sec -1< ) using 165 ml cultures in 75 cm 2< tissue culture flasks were performed to identify strains having increased productivity (increased rate of biomass production, measured as Total Organic Carbon (TOC) accumulation) with respect to the wild-type progenitor strain WT-1185. Two 75 cm 2< flasks were inoculated with seed culture of a given mutant strain. The flasks had stoppers having tubing connected with syringe filters for delivering CO 2 -enriched air (1% CO 2 ) that was bubbled through the cultures. The flasks were aligned with the width (narrowest dimension) against an LED light bank. The depth of the cultures (the distance from the wall of the flask nearest the light source to the wall at the back of the flask) was approximately 8.0 cm. The cultures were diluted daily at the beginning of the light period by removing 65% of the culture volume and replacing it with fresh PM119 media diluted to adjust for the increase in salinity due to evaporation occurring in the cultures (212 ml di H 2 O to 1 L PM119 medium). Samples for TOC analysis were taken from the culture removed for the dilution.EXAMPLE 12 SEMI-CONTINUOUS PRODUCTIVITY ASSAYS OF PARACHLORELLA SP. MUTANTS

[0219] Among the Parachlorella strains that were found to have reduced chlorophyll under low light conditions were analyzed for increased productivity. In the productivity assay, photoautotrophic cultures of the mutants were grown over several days in constant light semi-continuous mode (CL-SCPA) with culture samples removed daily for biomass determination. The light was kept at a constant 1900-2000 µmol photons m -2< sec -1< for 24 hours per day. In this assay PM119 culture medium in a 225 cm 2< flask was inoculated with seed culture of a given mutant strain. Three cultures were initiated per strain. The flasks included stir bars and had stoppers having tubing connected with syringe filters for delivering CO 2 enriched air (1% CO 2 ) that was bubbled through the cultures. The flasks were aligned with the width (narrowest dimension) against an LED light bank. The "depth" dimension of the flasks, extending back from the light source, was 13.7 cm. Taking into account the positioning of the flasks the farthest distance of the cells in the flasks from the surface of the light source was approximately 15.5 cm. The cultures were diluted daily by removing 65% of the culture volume and replacing it with fresh PM119 culture medium diluted to adjust for the increase in salinity due to evaporation occurring in the cultures. Samples for TOC analysis were taken from the culture removed for the dilution. The semi-continuous productivity assay was run for 12 days once the cultures had reached steady state.

[0220] Productivity for the assay was assessed by measuring total organic carbon (TOC) from the samples that were removed daily. Total organic carbon (TOC) was determined by diluting 2 mL of cell culture to a total volume of 20 mL with DI water. Three injections per measurement were injected into a Shimadzu TOC-Vcsj Analyzer for determination of Total Carbon (TC) and Total Inorganic Carbon (TIC). The combustion furnace was set to 720°C, and TOC was determined by subtracting TIC from TC. The 4 point calibration range was from 2 ppm to 200 ppm corresponding to 20-2000 ppm for non-diluted cultures with a correlation coefficient of r2 > 0.999.EXAMPLE 13 SEMI-CONTINUOUS UREA BATCH ASSAY OF PARACHLORELLA SP. MUTANTS

[0221] In the SCUBA (Semi-Continuous Urea Batch Assay), photoautotrophic cultures of the mutants were grown over several days in diel light nitrogen replete semi-continuous mode followed by a nitrogen deplete batch mode. The light was programmed to mimic an average May 4th day in the Imperial Valley, Ca ranging from darkness to 2000 µmol photons m -2< sec -1< at noon. Samples were taken at "dusk" each day. In this assay 420ml of urea based PM153 culture medium in a 500ml square flask was inoculated with seed culture of a given mutant strain.

[0222] The PM152 is a nutrient deplete medium that is based on PM074 but includes urea instead of nitrate as the nitrogen source. It is made by adding 1.3 ml PROLINE ®< F / 2 Algae Feed Part A (Aquatic Eco-Systems) and 1.3 ml 'Solution C' to a final volume of 1 liter of a solution of Instant Ocean salts (17.5 g / L) (Aquatic Eco Systems, Apopka, FL). Solution C is 38.75 g / L NaH2PO4 H2O, 758 mg / L Thiamine HCl, 3.88 mg / L vitamin B12, and 3.84 mg / L biotin.

[0223] Three cultures were initiated per strain. The flasks included stir bars and had stoppers having tubing connected with syringe filters for delivering CO 2 enriched air (1% CO 2 ) that was bubbled through the cultures. The flasks were aligned with an aperture towards the light of 0.0875m 2< and "depth" dimension of the flasks, extending back from the light source, was 8 cm. For semi-continuous biomass determination the cultures were diluted daily by removing 40% of the culture volume and replacing it with fresh PM153 culture medium diluted to adjust for the increase in salinity due to evaporation occurring in the cultures. Samples for TOC analysis were taken from the culture removed for the dilution. The semi-continuous productivity assay was run until the cultures had reached steady state. Following semi-continuous, cultures were removed from the assay, pelleted in using centrifugation and resuspended in 420ml of nitrogen deplete PM152 media. Cultures were grown in batch for 4-5 days using the same growth conditions as the semi-continuous mode. During the batch mode, FAME samples were taken to determine lipid productivity and TOC samples were taken to determine FAME / TOC.EXAMPLE 14 CHLOROPHYLL CONTENT, ANTENNA SIZE, AND PHOTOPHYSIOLOGY OF PARACHLORELLA KNOCKOUT MUTANTS OF SGI1, SGI2 GENES, DOUBLE KNOCKOUT OF SGI1 AND SRP54 AND SGI2 AND SRP54 GENES

[0224] Chlorophyll content of the high productivity mutants was determined by extracting cells with methanol and analyzing the supernatant by spectrophotometry. Briefly, 500 µl aliquots of culture were pipetted into 2.0 ml twist top tubes and pelleted using a table top microcentrifuge at 15,000 rpm for 10 minutes. The supernatants were aspirated from the pellets, and each pellet was resuspended in 1.5 ml 99.8% methanol (previously neutralized with magnesium carbonate). 0.2 ml of glass beads (0.1 mm diameter) were added to each vial and bead beat for 3 min. 1.0 ml of supernatant was transferred to new 1.7 ml flip-top tubes and were centrifuged in a table top microcentrifuge at 15,000 rpm for 10 minutes. The resulting pellets were white indicating that a complete extraction had been performed. 0.8 ml of each supernatant was pipetted into an optical glass cuvette and absorption wavelengths were read immediately at 720 nm, 665 nm and 652 nm wavelengths. Spectrophotometric measurements were carried out in a dual-beam mode using a 99.8% methanol blank. The following equations were used to calculate the concentration of chlorophyll: Chlorophyll a [g m -3< ] = 16.72(A665-A720) + 9.16 (A652-A720) and Chlorophyll b [g m -3< ] = 34.09(A652-A720) - 15.28(A665-A720). The amount of chlorophylls a and b were standardized on a per cell and per TOC basis. While the amount of total chlorophyll per cell varied somewhat among the SGI1-2261 mutants, it was universally decreased with respect to wild-type cells by an amount ranging from about 30% to about 65%, consistent with the observed reduction in antenna size. On a per TOC basis, the reduction in total chlorophyll in SGI1 mutants with respect to wild-type cells ranged from about 30% to about 50%.

[0225] In addition to chlorophyll content, SGI1 and SGI2 knockout mutants and the double knockout of SGI1 and SRP54 and SGI2 and SRP54 were analyzed for functional absorption cross-section of PSII, functional absorption cross-section of PSI, 1 / τ' Qa (the light saturated rate of electron transport on the acceptor side of photosystem II at light saturation, a measure of the efficiency of linear photosynthetic electron transport) as well as maximal rate of carbon fixation, Pmax. Cells of the wild-type and mutant strains were cultured in the constant light semicontinuous culture assay (CL-SCPA) described above.

[0226] Analysis of various photosynthetic parameters was performed using the Fluorescence Induction and Relaxation (FIRe) technique developed to measure a comprehensive series of photosynthetic and physiological characteristics of photosynthetic organisms (Gorbunov and Falkowski (2005) "Fluorescence Induction and Relaxation (FIRe) Technique and Instrumentation for Monitoring Photosynthetic Processes and Primary Production in Aquatic Ecosystems" in: Photosynthesis: Fundamental Aspects to Global Perspectives, Proc. 13th International Congress of Photosynthesis, Montreal, Aug.29 - Sept. 3, 2004. (Eds: A. van der Est and D. Bruce), Allen Press, V.2, pp. 1029-1031). The FIRe technique relies on measurement and analysis of chlorophyll "variable fluorescence" profiles (reviewed by Falkowski et. al., 2004 "Development and Application of Variable Chlorophyll Fluorescence Techniques in Marine Ecosystems" in: Chlorophyll a Fluorescence: A Signature of Photosynthesis (C. Papageorgiou and Govingjee, eds), Springer, pp. 757-778) which depend on the relationship between chlorophyll fluorescence and the efficiency of photosynthetic processes. This technique provides a set of parameters that characterize photosynthetic light-harvesting processes, the photochemistry in Photosystem II (PSII), and photosynthetic electron transport down to carbon fixation. The measurements performed herein used a mini-FIRe device produced by Maxim Gorbunov of Rutgers University, East Brunswick, NJ. A commercially available FIRe device is available from Sea-Bird Scientific (Halifax, Canada, satlantic.com and planet-ocean.co.uk). Further information regarding the use of the FIRe device is available in company manuals. All measurements were taken using constant light (2000 µmol photons ·m -2< ·sec -1< ) semicontinuous cultures (CL-SCPA) cultures (see Example 3). To obtain FV / FM and σPSII measurements of Fluorescence Induction and Relaxation (FIRe) kinetics were performed in the dark. The values for F v / F M and σPSII presented in Table 6 were calculated as an average of 6 measurements (3 measurements of each of the 2 biological replicates), errors for these parameters did not exceed 5%.

[0227] Measurements of PSI cross-section were performed using a modified JTS-10 spectrometer with a filter set to measure the electrochromic shift (ECS) at 520 nm equipped with a custom-built single turnover flasher (STF). The peak power density in the sample chamber was high enough to ensure full closure of reaction centers within approximately 10 µs. The resulting excitation rate was ~ 1 to 3 hits per reaction center per 10 µs (depending on the functional absorption cross-section of the photosystem). The STF generated short ultra-bright pulses of blue light (455 nm, with 30 nm half bandwidth), and the pulse timing was controlled by the trigger from the JTS-10 Spectrometer. The pulse duration was controlled by the STF Pulse Control Box and was adjustable in the range from 1 µs to 50 µs using the potentiometer on the front panel. To measure the PSI cross-section, we diluted cultures to an OD of about 0.2 at the chlorophyll maximum (~440 nm) based on measurement of absorption spectra of cell suspension using a Perkin Elmer Lambda 650 spectrophotometer equipped with an integrating sphere. The ECS was measured using 10 µs flashes with intensities ranging from 4000 to 120,000 µmol photons m-2 s-1 in the presence of DCMU and hydroxylamine. The experimental curve was fitted with a simple exponential function ECS = ECS M × 1 − e It × σ PSI where ECS M ECS M is the maximal ECS signal; ItIt is photon density in photons / m2; and σ PSI σ PSI is a functional cross-section of PSI. Obtained values for a functional cross-section of PSI for the wild type of Parachlorella (WT-1185) was (4.0 ± 0.5) × 10 -18< (4.0 ± 0.5) × 10 -18< m 2< . These values are close to those obtained for the functional cross-section of PSII grown under the same conditions (σ PSII = (4.3 ± 0.1) × 10 -18< σ PSII = (4.3 ± 0.1) × 10 -18< m2). Errors for these parameters were estimated not to exceed 20%.

[0228] Carbon fixation rates (C 14< Pmax) were measured using cultures normalized to 5 µg chl ml-1 in media containing 0.5 g 1-1 (5.95 mM) sodium bicarbonate. 20.4 µCi ml-1 C14 labeled sodium bicarbonate was added to each culture and exposed to 2500 µE for a duration of 10 minutes. Samples were immediately acidified with 2N HCl and allowed to off-gas overnight. The following day samples were measured using a Beckman LS6500 scintillation counter and quantified.

[0229] τ' Qa (the time of electron transport on the acceptor side of PSII measured under saturating light conditions - effectively determined by the slowest step of linear photosynthetic electron transport) was measured from FIRe light curves and dark induced relaxation kinetics (DIRK) profiles. Volumetric PSII concentration relative to wild-type was estimated as (Fv / σ 530PSII ). Errors for these parameters were estimated not to exceed 15%. Optical absorption cross section (averaged over emission spectrum of a light source) was estimated using the following equation: a chl / TOC = 1 Chl / TOC ∫ 400 700 ln 10 × OD λ Δl × I λ ∫ 400 700 I λ dλ dλ where [Chl / TOC] is the chlorophyll / TOC of the sample, OD(λ)OD(λ) is the measured optical density of the sample at a wavelength λλ, ΔlΔl is the measuring beam pathlength in the cuvette (1 cm), I(λ)I(λ) is the intensity of the light source used to grow algae at the wavelength λλ. Table 6. Fluorescent and Photosynthetic Parameters Measured with the FIRe Technique FIRe, JTS-10 retrieved parameters Description F V / F M Maximum quantum yield of photochemistry in PSII, measured in a dark-adapted state (dimensionless). This parameter characterizes the efficiency of primary photosynthetic reactions.GPSIIFunctional absorption cross section of PSII (Å 2< ) in a dark-adapted state. The parameter is the product of the optical absorption cross section of PSII (i.e., the physical size of the PSII unit) and the quantum yield of photochemistry in PSII. Could be measured using different excitation wavelengths, e.g., 450 nm, 530nm, or 590nmGPSIFunctional absorption cross section of PSI (Å 2< ) in a dark-adapted state. The parameter is the product of the optical absorption cross section of PSII (i.e., the physical size of the PSI unit) and the quantum yield of photochemistry in PSI.1 / τ' Qa Light saturated rate of electron transport on the acceptor side of photosystem II. This parameter indicates the efficiency of linear photosynthetic electron transport

[0230] The photophysiological data, the chlorophyll content and the productivity data of the wild-type Parachlorella strain WT-1185, single knockout of SRP54 and SGI2 genes, and the double knockout of SGI2 and SRP54 genes in Parachlorella are summarized were evaluated. All measurements were taken using CL-SCPA cultures. To obtain FV / FM and σPSII measurements of Fluorescence Induction and Relaxation (FIRe) kinetics were performed in the dark. Presented values for Fv / Fm and σPSII were calculated as an average of 6 measurements (3 measurements of each of the 2 biological replicates) - errors for these parameters did not exceed 5%. τ'Qa (time of electron transport on the acceptor side of PSII measured under saturating light conditions - effectively determined by the slowest step of linear photosynthetic electron transport) were measured from FIRe light curves and DIRK profile. Measurements of PSI cross-section were performed as described above. The results are summarized below in Table 7. Table 7. Photophysiology, Chlorophyll, and Productivity DataStrain FIReChlorophyll 14< C P max ProductivityF V / F M σ PSII (Å 2< , 530nm) τ' Qa (ms) [PSII] / TOC (relative) (Chl / TOC) Chl b:a nmol 14< C / µg TOC / h g m -2< day -1< WT-1185 0.6215212.7206.8%0.359.431.4SGI2 / SRP54 0.67765.9143.3%0.2111.941.4SRP54 0.65917.083.7%0.2410.536.6SGI2 0.641207.085.0%0.3111.436.7

[0231] There is a substantial decrease in the functional absorption cross-section of PSII (50%) and some decrease in the number of functional PSII complexes. The cells have improved carbon fixation capacity (26% increase in Pmax). Single knockout of SGI2 or SRP54 showed at least 17% increase TOC productivity as compared to wildtype strain. Overall, the double SGI2 / SRP54 knockout strain showed a 32% improvement in TOC productivity (both times the double SGI2 / SRP54 knockout strain was run on the CL-SCPA assay it showed productivities >40 g / m 2< / day), among the highest increases in productivity observed for Parachlorella and higher than the average improvements of the single knockout of either SRP54 or SGI2 as shown in Figure11. The results demonstrate that there appears to be a synergistic effect on productivity when both SGI2 and SRP54 genes are knocked out.

[0232] The photophysiological data, of the wild-type Parachlorella strain WT-1185, single knockout of SRP54 and SGI1 genes, and three strains with the double knockout of SGI1 and SRP54 genes in Parachlorella were evaluated. All measurements were taken using CL-SCPA cultures. To obtain FV / FM and σPSII measurements of Fluorescence Induction and Relaxation (FIRe) kinetics were performed in the dark. Presented values for F V / F M and σ PSII were calculated as an average of 6 measurements (3 measurements of each of the 2 biological replicates) - errors for these parameters did not exceed 5%. τ' Qa (time of electron transport on the acceptor side of PSII measured under saturating light conditions - effectively determined by the slowest step of linear photosynthetic electron transport) were measured from FIRe light curves and DIRK profiles. The results are summarized in Table 8 below. Table 8. Photophysiology of Parachlorella strainsStrain FIReF V / F M σ PSII (Å 2< , 530 nm< ) τ' Qa (ms) [PSII] / TOC (relative) STR24538 (SRP54 / SGI1 KO) 0.707644.519.3STR24540 (SRP54 / SGI1 KO) 0.699614.618.6STR24541 (SRP54 / SGI1 KO) 0.694614.719.4GE-17407 (SRP54 KO) 0.646855.516.4STR24183 (SGI1 KO) 0.6371026.218.2

[0233] There is a substantial decrease in the functional cross-section of PSII of the SGI1 / SRP54 double knockout strain as compared to single SGI1 or SRP54 genes knockouts, as well as a decrease in light saturated rate of electron transport, indicating improved rates of photosynthesis. There is also some increase in the number of functional PSII complexes. There is an improved maximum quantum yield of photochemistry in photosystem II (F V / F M ) in the double knockout strain as compared to single knock of SRP54 or SGI1 alone.EXAMPLE 15 MICROPROXIMATE ANALYSIS OF SGI1 / SGI2, SGI1 / SRP54, AND SGI1 / SGI2 / SRP54 KNOCKOUT MUTANTS

[0234] To determine the overall biomass composition of the SGI1 / SGI2, SGI1 / SRP54, and SGI1 / SGI2 / SRP54 knockout mutants, quantitative analysis of samples from cultures grown in semicontinuous mode with 40% daily dilution was performed to determine the total organic carbon (TOC) and lipid content of the cells in semi-continuous culture. After the cultures reached steady state, aliquots of the culture removed for daily dilution was used for analysis of lipid, protein, and carbohydrate. Total organic carbon (TOC) of the algal culture samples was determined by diluting 2 mL of cell culture to a total volume of 20 mL with DI water. Three injections per measurement were injected into a Shimadzu TOC-Vcsj Analyzer for determination of Total Carbon (TC) and Total Inorganic Carbon (TIC). The combustion furnace was set to 720°C, and TOC was determined by subtracting TIC from TC. The 4 point calibration range was from 2 ppm to 200 ppm corresponding to 20-2000 ppm for non-diluted cultures with a correlation coefficient of r2 > 0.999.

[0235] To determine lipid content, FAME analysis was performed on 2 mL samples that were dried using a GeneVac HT-4X. To the dried pellets the following was added: 500 µL of 500 mM KOH in methanol, 200 µL of tetrahydrofuran containing 0.05% butylated hydroxyl toluene, 40 µL of a 2 mg / ml C11:0 free fatty acid / C13:0 triglyceride / C23:0 fatty acid methyl ester internal standard mix and 500 µL of glass beads (425-600 µm diameter). The vials were capped with open top PTFE septa-lined caps and placed in an SPEX GenoGrinder at 1.65 krpm for 7.5 minutes. The samples were then heated at 80°C for five minutes and allowed to cool. For derivatization, 500 µL of 10% boron trifluoride in methanol was added to the samples prior to heating at 80°C for 30 minutes. The tubes were allowed to cool prior to adding 2 mL of heptane and 500 µL of 5 M NaCl. The samples were then vortexed for five minutes at 2 krpm and finally centrifuged for three minutes at 1 krpm. The heptane layer was sampled using a Gerstel MPS Autosampler. Quantitation used the 80 µg of C23:0 FAME internal standard.

[0236] The results of the assays indicating semi-continuous areal TOC productivity and batch TOC for the Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), SGI1 / SRP54 double knockout mutants (STR24538 and STR24540) are shown in Figures 12A and 12B, respectively. SRP54 knockout mutant, SGI1 knockout mutant, SGI1 / SRP54 double knockout mutants showed increased TOC productivity over the Parachorella wild-type strain.

[0237] The results of the assays indicating semi-continuous areal TOC productivity and batch TOC for the Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR00516), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762) are shown in Figures 13A and 13B, respectively. SGI1 knockout mutant, SGI2 / SRP54 double knockout mutant and SGI1 / SGI2 / SRP54 triple knockout mutants showed increased TOC productivity over the Parachorella wild-type strain.

[0238] The results of the batch FAME productivity assay for Parachorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), SGI1 / SRP54 double knockout mutants (STR24538 and STR24540) are shown in Figure 14. SGI1 knockout mutant and SGI / SRP54 knockout mutants showed increased FAME productivity over the Parachorella wild-type strain.

[0239] The results of the batch FAME productivity assay for Parachorella wild-type strain (STR00010), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR00516), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762) are shown in Figure 15.

[0240] Headings within the application are solely for the convenience of the reader, and do not limit in any way the scope of the invention or its embodiments.

Claims

1. A mutant Parachlorella algal organism comprising a knock out of a gene encoding a significant growth improvement gene 2 (SGI2) having at least 80% sequence identity to SEQ ID NO: 5.

2. The mutant Parachlorella algal organism of claim 1, further comprising a knockout of a gene encoding a chloroplastic signal recognition protein 54 (cpSRP54) having at least 80% sequence identity to SEQ ID NO: 68.

3. The mutant Parachlorella algal organism of any one of claims 1-2 further comprising a knockout of a gene encoding a significant growth improvement gene 1 (SGI1) having at least 80% sequence identity to SEQ ID NO: 3.

4. The mutant Parachlorella algal organism according to any one of claims 1-3, wherein the mutant exhibits a reduction in chlorophyll under low light conditions and higher maximum quantum yield of photochemistry in photosystem II (Fv / FM) at all physiologically relevant irradiances above 100 µE m-2s-1 with respect to a control photosynthetic organism of the same species.

5. The mutant Parachlorella algal organism of any one of claims 1-4 wherein the mutant Parachlorella algal exhibits a reduction in chlorophyll of at least 20% reduction with respect to a control photosynthetic organism of the same species.

6. The mutant Parachlorella algal organism of claim 5 wherein the organism exhibits a reduction of chlorophyll of at least 30% with respect to a control photosynthetic organism of the same species.

7. The mutant Parachlorella algal organism of any one of claims 1-6 wherein the mutant demonstrates a higher rate of carbon fixation on a per chlorophyll basis than does a control photosynthetic organism of the same species.

8. A method of producing a biological product, comprising culturing the mutant Parachlorella algal organism according to any one of claims 1-7 and isolating at least one product from the culture.

9. The method according to claim 8, wherein the culture demonstrates greater lipid productivity than does a culture of a control photosynthetic organism of the same species.

10. The mutant Parachlorella algal organism according to any one of claims 1-7, wherein (i) the mutant Parachlorella algal organism has been genetically engineered by insertional mutagenesis, gene replacement, meganuclease genome engineering, one or more ribozymes, and / or a CRISPR / Cas system.

11. The mutant Parachlorella organism according to claim 10 wherein the mutant has been genetically engineered by a CRISPR / Cas system.

12. A method of producing lipid, comprising culturing an algal mutant according to any one of claims 1-7, 10 and 11, and isolating at least one lipid from the culture.