Fusion polypeptide with a polypeptide region that can be O-glycosylated

DE602019074518T2Active Publication Date: 2025-08-20LG CHEM LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602019074518
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-09-05
Filing Date
2019-09-04
Publication Date
2025-08-20
Estimated Expiration
2039-09-04

AI Technical Summary

Technical Problem

Existing protein or peptide drugs have a short in vivo activity period and low absorption rate when administered via methods other than intravenous injection, necessitating frequent dosing and posing challenges for sustained release formulations due to issues like high viscosity, solvent denaturation, and instability in body fluids.

Method used

Fusing a target polypeptide with an O-glycosylatable polypeptide region, such as a hinge region of immunoglobulin, to form a fusion polypeptide that enhances in vivo stability and half-life, allowing for extended dosage intervals.

Benefits of technology

The fusion polypeptide increases the in vivo half-life and stability of target polypeptides, enabling longer sustained periods and reduced frequency of administration.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

[TECHNICAL FIELD ]

[0001] The present disclosure relates to a fusion polypeptide including a target polypeptide and an O-glycosylatable polypeptide region, a pharmaceutical composition containing the fusion polypeptide; and a method for increasing the in vivo sustained period of a target polypeptide, including a step of fusing an O-glycosylatable polypeptide region.[BACKGROUND OF THE INVENTION ]

[0002] Most protein or peptide drugs shorten the period of maintaining the in vivo activity, and has a low absorption rate when administered by methods other than intravenous administration. When long-term drug treatment is required, there is an inconvenience that these drugs must be repeatedly and continuously injected at short dosage intervals. In order to eliminate such inconvenience, there is a need to develop a technique that continuously releases the drug in a single administration. In an attempt to meet these needs, sustained-release formulations for continuous release are being developed.

[0003] For example, research on sustained-release dosage forms is being actively conducted in which fine particles in the form of enclosing a protein or peptide drug with a biodegradable polymer matrix are prepared, and the drug is gradually released at the time of administration while the matrix substance is gradually decomposed and removed in the body.

[0004] For example, U.S. Patent No. 5,416,017 discloses a sustained-release injection of erythropoietin using a gel with a hyaluronic acid concentration of 0.01 to 3%, Japanese Unexamined Patent Publication No. (Hei) 1-287041 discloses a sustained-release injection containing insulin in a gel with a hyaluronic acid concentration of 1%, and Japanese Unexamined Patent Publication No. (Hei) 2-213 discloses a sustained-release formulation containing calcitonin, elkatonin, or a human target polypeptide in 5% concentration of hyaluronic acid. In such a formulation, the protein drug dissolved in the hyaluronic acid gel passes at a low speed through the gel matrix having a high viscosity, and thus can exhibit a sustained release effect. However, there is a disadvantage that it is not easy to administer the drug by injection due to the high viscosity, the gel is easily diluted or decomposed by body fluids after injection, so that it is difficult to sustainably release the drug longer than a day.

[0005] Meanwhile, there are examples in which solid microparticles are prepared by an emulsion solvent extraction method using a hyaluronic acid derivative (e.g., hyaluronic acid-benzyl ester) having hydrophobicity (N.S. Nightlinger, et al., Proceed. Intern. Symp. Control. Rel. Bioact. Mater., 22nd, Paper No. 3205 (1995); L. Ilum, et al., J. Controlled Rel ., 29, 133(1994)). When the drug release formulation particles are produced using a hydrophobic hyaluronic acid derivative, an organic solvent must be used, and thus, the protein drug may come into contact with the organic solvent to be denatured, and there is a high possibility of denaturing proteins due to the hydrophobicity of the hyaluronic acid derivative.

[0006] Therefore, in order to improve the in vivo sustained period of protein or peptide drugs, approach to aspects different from existing studies is required.

[0007] WO 2008 / 147143 relates to immunoglobulin fusion proteins.

[0008] WO 2017 / 198435 relates to glycosylated VWF fusion proteins with improved pharmacokinetics.

[0009] Fares, Therapeutic Proteins, 6 February 2012, pages 81-94, relates to half-life extension through o-glycosylation: strategies to modulate their plasma half-lives.

[0010] Fares et al., PNAS, vol. 89, no. 10, 15 May 1992, pages 4304-4308, relates to design of a long-acting follitropin agonist by fusing the C-terminal sequence of the chorionic gonadotropin beta subunit to the follitropin beta subunit.[DETAILED DESCRIPTION OF THE INVENTION]

[0011] The present invention is defined in the claims

[0012] Provided herein is a technique, as defined in the claims, which an O-glycosylatable polypeptide (e.g., a hinge region of immunoglobulin, or the like) is linked to a target polypeptide to form a fusion polypeptide, thereby increasing the in vivo half-life of a target polypeptide and thus enhancing the in vivo sustained period, and increasing the dosage interval, as compared with the case that is not fused with an O-glycosylatable polypeptide region.

[0013] One example provides a fusion polypeptide comprising a target polypeptide and an O-glycosylatable polypeptide region, as defined in the claims.

[0014] In the fusion polypeptide, the O-glycosylatable polypeptide region may be included at the N-terminus, C-terminus, or both the N- and C-termini of the target polypeptide.

[0015] The total number of O-glycosylatable polypeptide regions contained in the fusion polypeptide may be 1 or more, for example, 2 to 10, 2 to 8, 2 to 6, 2 to 4 (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10).

[0016] In one embodiment, the fusion polypeptide may be represented by the following general formula:         N'-(Z)n-Y-(Z)m-C'     [General Formula] in the above formula, N' is the N-terminus of the fusion polypeptide, C' is the C-terminus of the fusion polypeptide, Y is the target polypeptide, Z is the O-glycosylatable polypeptide region, n is the number of O-glycosylatable polypeptide regions (bound to the N-terminus of the target polypeptide) located at the N-terminus of the fusion polypeptide, and is an integer of 0 to 10 (i.e., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), 0 to 7, 0 to 5, 1 to 10, 1 to 7, 1 to 5, or 1 to 3, m is the number of O-glycosylatable polypeptide regions (bound to the C-terminus of the target polypeptide) located at the C-terminus of the fusion polypeptide, and is an integer of 0 to 10 (i.e., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), 0 to 7, 0 to 5, 1 to 10, 1 to 7, 1 to 5, or 1 to 3, at least one of n and m is not zero, and n+m is the total number of the O-glycosylatable polypeptide regions contained in the fusion polypeptide, and is an integer of 2 to 10, 2 to 8, 2 to 6, or 2 to 4.

[0017] The n+m O-glycosylatable polypeptide regions contained in the fusion polypeptide may each independently be selected from polypeptide moieties including O-glycosylatable amino acid residues. The polypeptide moiety comprising O-glycosylatable amino acid residues is a hinge region of immunoglobulin. The O-glycosylatable polypeptide region is each independently be selected from a group consisting of a hinge region of immunoglobulin D (IgD) and a hinge region of immunoglobulin A (IgA, such as IgA1) (That is, the hinge regions of n+m immunoglobulins may be the same or different from each other).

[0018] In the fusion polypeptide, the stability (sustained period) in the body (or blood) of the target polypeptide fused with an O-glycosylatable polypeptide region is increased as compared with a target polypeptide not fused with an O-glycosylatable polypeptide region (for example, increase of the half-life in the body or blood).

[0019] Another embodiment provides a nucleic acid molecule encoding the fusion polypeptide.

[0020] Another embodiment provides a recombinant vector comprising the nucleic acid molecule.

[0021] Another embodiment provides a recombinant cell comprising the recombinant vector.

[0022] Another embodiment provides a method for producing a target polypeptide having an increased half-life in the body (or blood), comprising the step of expressing the recombinant vector in cells, or a method for producing a fusion polypeptide containing the target polypeptide having an increased half-life in the body (or blood).

[0023] Another embodiment provides a method of increasing the in vivo sustained period of a target polypeptide including the step of fusing (or linking or binding) a target polypeptide with an O-glycosylatable polypeptide region, or a method of increasing the in vivo (or blood) stability and / or increasing the in vivo (or blood) half-life of the target polypeptide (protein or peptide) drug. In one embodiment, the fusing step may include a step of fusing (or linking or binding) one or more O-glycosylatable polypeptide regions to the N-terminus, C-terminus, or both the N- and C-termini of the target polypeptide via a linker or without through the linker. The fusing (or linking or binding) step may be performed in vitro.

[0024] Another embodiment provides a pharmaceutical composition comprising the fusion polypeptide

[0025] The present invention is defined in the claims. Further disclosure of the specification is provided below.

[0026] Disclosed herein is a use of the O-glycosylatable polypeptide region for promoting the in vivo (or blood) stability and / or increasing the in vivo (or blood) half-life of the target polypeptide (protein or peptide) drug. Specifically, disclosed herein is a composition for enhancing the in vivo (or blood) stability and / or increasing the vivo (or blood) half-life of the target polypeptide (protein or peptide) drug comprising an O-glycosylatable polypeptide region.

[0027] The present disclosure provides the form of a fusion polypeptide in which an O-glycosylatable polypeptide region, such as an immunoglobulin hinge region, is fused to a target polypeptide, and thereby, provides a technique capable of enhancing the stability in the body (or blood) and / or the sustained period in the body (or blood) and increasing the dosage interval, when the target polypeptide is applied in vivo.

[0028] Disclosed herein is a fusion polypeptide comprising a target polypeptide and an O-glycosylatable polypeptide region.

[0029] In the fusion polypeptide, the O-glycosylatable polypeptide region may be included at the N-terminus, C-terminus, or both the N- and C-termini of the target polypeptide.

[0030] The total number of O-glycosylatable polypeptide regions contained in the fusion polypeptide may be 1 or more, for example, 1 to 10, 1 to 8, 1 to 6, 1 to 4, 2 to 10, 2 to 8, 2 to 6, 2 to 4 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10).

[0031] The fusion polypeptide may be represented by the following general formula:         N'-(Z)n-Y-(Z)m-C'     [General Formula] in the above formula, N' is the N-terminus of the fusion polypeptide, C' is the C-terminus of the fusion polypeptide, Y is the target polypeptide, Z is an O-glycosylatable polypeptide region, n is the number of O-glycosylatable polypeptide regions (bound to the N-terminus of the target polypeptide) located at the N-terminus of the fusion polypeptide, and is an integer of 0 to 10 (i.e., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), 0 to 7, 0 to 5, 1 to 10, 1 to 7, 1 to 5, or 1 to 3, m is the number of O-glycosylatable polypeptide regions (bound to the C-terminus of the target polypeptide) located at the C-terminus of the fusion polypeptide, and is an integer of 0 to 10 (i.e., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), 0 to 7, 0 to 5, 1 to 10, 1 to 7, 1 to 5, or 1 to 3, at least one of n and m is not zero (for example, if n is 0, m is not 0, and if m is 0, n is not 0), and n+m is the total number of O-glycosylatable polypeptide regions contained in the fusion polypeptide, and is an integer of 1 to 10, 1 to 8, 1 to 6, 1 to 4, 2 to 10, 2 to 8, 2 to 6, or 2 to 4.

[0032] When the active site of the target polypeptide is located at the N-terminus, the O-glycosylatable polypeptide region may be fused to the C-terminus (i.e., n is 0, and m is not 0), and when the active site is located at the C-terminus, the O-glycosylatable polypeptide region can be fused to the N-terminus (i.e., n is not 0, and m is 0).

[0033] The n+m O-glycosylatable polypeptide regions contained in the fusion polypeptide may each independently be selected from polypeptides containing O-glycosylatable amino acid residues. For example, the polypeptide moiety containing O-glycosylatable amino acid residues may be a hinge region of immunoglobulin. The O-glycosylatable polypeptide region may each independently be selected from a group consisting of a hinge region of immunoglobulin D (IgD) and a hinge region of immunoglobulin A (IgA, such as IgA1). The hinge regions of n+m immunoglobulins may be the same or different from each other.

[0034] When the n+m O-glycosylatable polypeptide regions contained in the fusion polypeptide are located at both the N-terminus and C-terminus of the fusion polypeptide (that is, when one or more O-glycosylatable polypeptide regions each independently exist at the N-terminus and C-terminus of the fusion polypeptide), the type and number of the O-glycosylatable polypeptide region located at the N-terminus and the O-glycosylatable polypeptide region located at the C-terminus may be the same or different from each other. One or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) O-glycosylatable polypeptide regions located at the N-terminus may all be hinge regions of IgD or hinge regions of IgA (e.g., IgA1), or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) hinge regions of IgD and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) hinge regions of IgA (e.g., IgA1) may be included in various orders. The one or more hinge regions of immunoglobulins located at the C-terminus all are hinge regions of IgD or hinge regions of IgA (e.g., IgA1), or one or more hinge regions of IgD and one or more hinge regions of IgA (e.g., IgA1) may be included in various orders.

[0035] When all the n+m O-glycosylatable polypeptide regions contained in the fusion polypeptide are located only at the N-terminus of the fusion polypeptide (i.e., when one or more O-glycosylatable polypeptide regions exist only at the N-terminus of the fusion polypeptide), the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) O-glycosylatable polypeptide regions all are hinge regions of IgD or hinge regions of IgA, or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) hinge regions of IgD and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) hinge regions of IgA may be included in various orders.

[0036] When all the n+m O-glycosylatable polypeptide regions contained in the fusion polypeptide are located only at the C-terminus (i.e., when one or more O-glycosylatable polypeptide regions exist only at the C-terminus of the fusion polypeptide), the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) O-glycosylatable polypeptide regions may all be hinge regions of IgD or hinge regions of IgA (e.g., IgA1), or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) hinge regions of IgD and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) hinge regions of IgA (e.g., IgA1) may be included in various orders.

[0037] The O-glycosylatable polypeptide region (each region when there are two or more O-glycosylatable polypeptide regions) may include 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, or 7 or more (the upper limit is 100, 50, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8) (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) O-glycosylatable polypeptide residues (O-glycosylatable amino acid residues). For example, the O-glycosylatable polypeptide region (each region when there are two or more O-glycosylatable polypeptide regions) may include 1 to 10 or 3 to 10 O-glycosylated residues (O-glycosylatable amino acid residues).

[0038] The O-glycosylatable polypeptide region may be selected from one or more hinge regions of immunoglobulins (e.g., human immunoglobulins), and for example, it may be an IgD hinge region, an IgA hinge region, or a combination thereof.

[0039] The IgD may be human IgD (e.g., UniProKB P01880 (constant region; SEQ ID NO: 7), etc.), and the hinge region of IgD may be at least one selected from the group consisting of: a polypeptide ("IgD hinge") comprising an amino acid sequence of "N'-ESPKAQASS VPT AQPQAEGSLAKATT APATT RNT-C' (SEQ ID NO: 1); the amino acid residues shown in bold are O-glycosylated residues (7 in total)", or consisting essentially of the amino acid sequence, a polypeptide comprising 5 or more, 7 or more, 10 or more, 15 or more, 20 or more, 22 or more, or 24 or more (the upper limit is 34 or 33) consecutive amino acids containing 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, or 7 O-glycosylated residues in the amino acid sequences of SEQ ID NO: 1, or consisting essentially of the amino acids ("a part of IgD hinge"; for example, a polypeptide comprising 5 or more consecutive amino acids containing "SSVPT" (SEQ ID NO: 9) in SEQ ID NO: 1 or a polypeptide comprising 7 or more consecutive amino acids containing "TTAPATT" (SEQ ID NO: 10)), and a polypeptide comprising 34 or more or 35 or more consecutive amino acids containing an amino acid sequence of SEQ ID NO: 1 (IgD hinge) in IgD (e.g., SEQ ID NO: 7), or 7 or more, 10 or more, 15 or more, 20 or more, 22 or more, or 24 or more consecutive amino acids containing a part of the IgD hinge, or consisting essentially of the amino acids ("extension of IgD hinge"; for example, SEQ ID NO: 1 in "ESPKAQASS VPTAQPQAEG SLAKATTAPA TTRNTGRGGE EKKKEKEKEE QEERETKTP" (SEQ ID NO: 11) among IgD (SEQ ID NO: 7) or comprising 34 or more or 35 or more consecutive amino acids containing a part of the IgD hinge.

[0040] The IgA may be human IgA (e.g., IgA1 (UniProKB P01876, constant region; SEQ ID NO: 8), etc.), and the hinge region of the IgA may be at least one selected from the group consisting of: a polypeptide ("IgA hinge") comprising an amino acid sequence of "N'-VPST PPT PS PS TPPT PS PS -C' (SEQ ID NO: 2); the amino acid residues shown in bold are O-glycosylated residues (8 in total)", or consisting essentially of the amino acid sequence, a polypeptide comprising 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 12 or more, 15 or more, 17 or more, or 18 consecutive amino acids containing 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, or 8 O-glycosylated residues in the amino acid sequence of SEQ ID NO: 2, or consisting essentially of the amino acids ("a part of IgA hinge"; for example, a polypeptide comprising 8 or more or 9 or more consecutive amino acids containing "STPPTPSP" (SEQ ID NO: 12) in SEQ ID NO: 2, and a polypeptide ("extension of IgA hinge") comprising 19 or more or 20 or more consecutive amino acids containing the amino acid sequence of SEQ ID NO: 2 in IgA (e.g., IgA1) hinge) in IgA (e.g., IgA1 (SEQ ID NO: 8)), or 7 or more, 10 or more, 12 or more, 15 or more, 17 or more, or 18 consecutive amino acids containing a part of IgA (e.g., IgA1) hinge, or consisting essentially of the amino acid sequence.

[0041] The O-glycosylatable polypeptide region may be a polypeptide region comprising 5 or more, 7 or more, 10 or more, 12 or more, 15 or more, 17 or more, 20 or more, 22 or more, 25 or more, 27 or more, 30 or more, 32 or more or 35 or more consecutive amino acids (the upper limit is 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, or the total number of amino acids in each protein) containing 1 or more, 2 or more, 5 or more, 7 or more, 10 or more, 12 or more, 15 or more, 17 or more, 20 or more, or 22 or more (e.g., 1 to 10, 3 to 10; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 ) O-glycosylatable amino acid residues (O-glycosylation site) in the proteins exemplified in Table 1 below (for example, a protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 23 to 113), or consisting essentially of the amino acid sequences. It is preferable that the O-glycosylatable polypeptide region as used herein does not affect the function of the target polypeptide. The O-glycosylatable polypeptide region of the proteins exemplified in Table 1 below may be selected from regions that are not involved in the intrinsic function of the full-length protein. This allows the O-glycosylatable polypeptide region to serve only to increase the half-life without affecting the function of the target polypeptide: [Table 1]UniProtK B Entry No. UniProtK B Entry name Protein names Gene names Lengt h O-Glycosylation (site) SE Q ID NOQ96DR8MUCL1_H UMANMucin-like protein 1MUCL19023T, 24T, 30T, 34T, 46T, 47T, 51T, 52T, 54T, 55T, 59T, 60T, 62T, 63T, 66S, 67T, 68T23SBEMUNQ590 / PRO1160Q0VAQ4SMAGP_H UMANSmall cell adhesion glycoproteinSMAGP972T, 3S, 6T, 7T, 9S, 16T, 17T, 23T24P04921GLPC_HU MANGlycophorin-CGYPC3S, 4T, 6S, 9S, 10T, 15S, 24S, 26S, 27T, 28T, 31T, 32T, 33T, 42S25GLPC128GPCP16860ANFB_HU MANNatriuretic peptides BNPPB13462T, 63S, 70S, 74T, 79S, 84T, 97T26P04141CSF2_HU MANGranulocyte-macrophage colony-stimulating factorCSF214422S, 24S, 26S, 27T27GMCSFP02724GLPA_HU MANGlycophorin-AGYPA21S, 22T, 23T, 29T, 30S, 31T, 32S, 36T, 38S, 41S, 44T, 52T, 56T, 63S, 66S, 69T28GPA150P10124SRGN_HU MANSerglycinSRGN94S, 96S, 100S, 102S, 104S, 106S, 108S, 110S29PRG158PRG1Q86YL7PDPN_HU MANPodoplaninPDPN25T, 32T, 34T, 35T, 52T, 55T, 65T, 66T, 76T, 85T, 86S, 88S, 89T, 96S, 98S, 100T, 102S, 106T, 107S, 109S, 110T, 117T, 119T, 120T30GP36PSEC000 3162PSEC002 5P0DN87CGB7_HU MANChoriogonadotropin subunit beta 7CGB7165139S, 141S, 147S, 150S, 152S, 158S31P0DN86CGB3_HU MANChoriogonadotropin subunit beta 3CGB3165139S, 141S, 147S, 150S, 152S, 158S32CGB;CGB5;CGB8P01344IGF2_HU MANInsulin-like growth factor IIIGF218096T, 99T, 163T33PP1446P07498CASK_HU MANKappa-caseinCSN3182133T, 143T, 148T, 151T, 157T, 167T, 169T, 178T34CASKCSN10CSNKP31431SDC4_HU MANSyndecan-4SDC419839S, 61S, 63S35P34741SDC2_HU MANSyndecan-2SDC220141S, 55S, 57S, 101T36HSPG1Q99075HBEGF_H UMANProheparin-binding EGF-like growth factorHBEGF20837T, 38S, 44T, 47T, 75T, 85T37DTRDTSHEGFLP13727PRG2_HU MANBone marrow proteoglycan (BMPG)PRG222223T, 24S, 25T, 34T, 62S38MBPP24592IBP6_HU MANInsulin-like growth factor-binding protein 6 (IBP-6)IGFBP6240126T, 144S, 145T, 146T, 152S39IBP6Q9UHG2PCSK1_H UMANProSAAS (Proprotein convertase subtilisin / kexin type 1 inhibitor)PCSK1N26053T, 228S, 247T40P01589IL2RA_H UMANInterleukin-2 receptor subunit alpha (IL-2 receptor subunit alpha)IL2RA272218T, 224T, 229T, 237T41P21583SCF_HUM ANKit ligand (Mast cell growth factor) (MGF)KITLG273167S, 168T, 180T42MGFSCFA1E959ODAM_H UMANOdontogenic ameloblast-associated protein (Apin)ODAM279115T, 119T, 244T, 249S, 250T, 251T, 255T, 256S, 261T, 263T, 273T, 275S43APINP10451OSTP_HU MANOsteopontinSPP1314134T, 138T, 143T, 147T, 152T44BNSPOPNPSEC015 6P21815SIAL_HU MANBone sialoprotein 2 (Bone sialoprotein II) (BSP II)IBSP317119T, 122T, 227T, 228T, 229T, 238T, 239T45BNSPP02649APOE_HU MANApolipoprotein E (Apo-E)APOE31726T, 36T, 212T, 307T, 308S, 314S46Q99645EPYC_HU MANEpiphycan (Dermatan sulfate proteoglycan 3)EPYC32260T, 64S, 96S47DSPG3PGLBSLRR3BQ6UXG3CLM9_HU MANCMRF35-like molecule 9 (CLM-9)CD300L332137T, 143T, 144T, 155T, 161T, 170T, 171T, 177T, 187T, 195T, 196S, 199T, 201T, 202S, 207T, 208S, 213S, 214S, 222S, 223T, 224S, 228T, 229S, 237S48G CLM9TREM4UNQ422 / PRO846Q9GZM5YIPF3_HU MANProtein YIPF3 (Killer lineage protein 1)YIPF3350333T, 334T, 339T, 346T49C6orf109KLIP1P51681CCR5_HU MANC-C chemokine receptor type 5 (C-C CKR-5)CCR53526S, 7S, 16T, 17S50CMKBR 5P40225TPO_HU MANThrombopoietin (C-mpl ligand) (ML)THPO35322S, 58T, 131T, 179T, 180T, 184S, 213T, 265S51MGDFP01876IGHA1_H UMANImmunoglobulin heavy constant alpha 1 (Ig alpha-1 chain C region)IGHA1353105S, 106T, 109T, 111S, 113S, 117T, 119S, 121S8P02765FETUA_H UMANAlpha-2-HS-glycoprotein (Alpha-2-Z-globulin)AHSG367270T, 280S, 293S, 339T, 341T, 346S52FETUAPRO2743P21810PGS1_HU MANBiglycanBGN36842S, 47S, 180S, 198S53SLRR1AP01860IGHG3_HImmunoglobulinIGHG3377122T, 137T, 152T54UMANheavy constant gamma 3 (HDC)P80370DLK1_HU MANProtein delta homolog 1 (DLK-1)DLK138394S, 143T, 163S, 214S, 222T 251S 256T, 260S55DLKP01880IGHD_HU MANImmunoglobulin heavy constant delta (Ig delta chain C region)IGHD384109S, 110S, 113T, 126T, 127T, 131T, 132T7P15529MCP_HU MANMembrane cofactor protein (TLX)CD46392290S, 291S, 292T, 298S, 300S, 302S, 303T, 304S, 305S, 306T, 307T, 309S, 312S, 313S, 315S, 320T, 326S56MCPMIC10P04280PRP1_HU MANBasic salivary proline-rich protein 1PRB139240S, 87S, 150S, 330S57P78423X3CL1_H UMANFractalkine (C-X3-C motif chemokine 1)CX3CL1397183T, 253S, 329T58FKNNTTSCYD1A-152E5.2P16150LEUK_HU MANLeukosialin (GPL115)SPN40021T, 22T, 26T, 28T, 29S, 35S, 36T, 37S, 41S, 42S, 46T, 47T, 48S, 50T, 58T, 69T, 99S, 103S, 109T, 113T, 114S, 136T, 137T, 173T, 178T59CD43P13473LAMP2_H UMANLysosome-associated membrane glycoprotein 2 (LAMP-2)LAMP2410195S, 196T, 200T, 203T, 204T, 207S, 209T, 210T, 211T, 213T60P11279LAMP1_H UMANLysosome-associated membrane glycoprotein 1 (LAMP-1)LAMP1417197S, 199T, 200T, 207S, 209S, 211S,61P21754ZP3_HUMZona pellucidaZP3424156T, 162T, 163T62ANsperm-binding protein 3 (Sperm receptor)ZP3AZP3BZPCP05783K1C18_H UMANKeratin, type I cytoskeletal 18KRT1843030S, 31S, 49S63CYK18PIG46Q08629TICN1_H UMANTestican-1 (Protein SPOCK)SPOCK1439228T, 383S, 388S64SPOCKTIC1TICN1O75056SDC3_HU MANSyndecan-3 (SYND3)SDC344280S, 82S, 84S, 91S, 314S, 367S65KIAA04 68P10645CMGA_H UMANChromogranin-A (CgA)CHGA457181T, 183T, 251T66P15169CBPN_HU MANCarboxypeptidase N catalytic chain (CPN)CPN1458400T, 402T, 409T67ACBPP00740FA9_HUM ANCoagulation factor IX (EC 3.4.21.22)F946185T, 99S, 107S68P20333TNR1B_H UMANTumor necrosis factor receptor superfamily member 1BTNFRSF46130T, 206T, 221S, 222T, 224S, 230T, 234S, 235T, 239T, 240S, 248S691BTNFBRTNFR2P08670VIME_HU MANVimentinVIM4667S, 33T, 34S70Q8WXD2SCG3_HU MANSecretogranin-3 (Secretogranin III) (SgIII)SCG3468216T, 231T, 359S71UNQ2502 / PRO59 90Q16566KCC4_HU MANCalcium / calmodulin -dependent protein kinase type IV (CaMK IV) (EC 2.7.11.17)CAMK447357T, 58S, 137S, 189S, 344S, 345S, 356S72CAMKCAMK-GRCAMKI VP31749AKT1_HU MANRAC-alpha serine / threonine-protein kinase (EC 2.7.11.1)AKT1480126S, 129S, 305T, 312T, 473S73PKBRACP31751AKT2_HU MANRAC-beta serine / threonine-AKT2481128S, 131S, 306T, 313T74protein kinase (EC 2.7.11.1)O60883G37L1_H UMANG-protein coupled receptor 37-like 1GPR37L 148179T, 85T, 86S, 95T, 107T75ETBRLP 2Q9BXF9TEKT3_H UMANTektin-3TEKT34907T, 9T, 10T76P05155IC1_HUM ANPlasma protease C1 inhibitor (C1 Inh)SERPIN50047T, 48T, 64S, 71T, 83T, 88T, 92T, 96T77G1 C1INC1NHP11831SRF_HUM ANSerum response factor (SRF)SRF508277S, 307S, 309S, 316S, 383S78P0DOX3IGD_HUM ANImmunoglobulin delta heavy chain512238S, 255T, 256T, 260T, 261T,79O75487GPC4_HU MANGlypican-4 (K-glypican)GPC4556494S, 498S, 500S80UNQ474 / PRO937P35052GPC1_HU MANGlypican-1GPC1558486S, 488S, 490S81P78333GPC5_HU MANGlypican-5GPC5572441S, 486S, 495S, 507S, 509S82Q8N158GPC2_HU MANGlypican-2GPC257955S, 92S, 155S, 500S, 502S83P00748FA12_HU MANCoagulation factor XII (EC 3.4.21.38)F12615109T, 299T, 305T, 308S, 328T, 329T, 337T84P01042KNG1_HU MANKininogen-1 (Alpha-2-thiol proteinase inhibitor)KNG1644401T, 533T, 542T, 546T, 557T, 571T, 577S, 628T85BDKKNGP51693APLP1_H UMANAmyloid-like protein 1 (APLP) (APLP-1)APLP1650215T, 227S, 228T86Q9NQ79CRAC1_H UMANCartilage acidic protein 1 (68 kDa chondrocyte-expressed protein) (CEP-68) (ASPIC)CRTAC1661608T, 618T, 619T, 621T, 626T87ASPIC1CEP68Q14515SPRL1_H UMANSPARC-like protein 1 (High endothelial venule protein) (Hevin) (MAST 9)SPARCL 166431T, 40T, 44S, 116T88Q16820MEP1B_H UMANMeprin A subunit beta (EC 3.4.24.63)MEP1B701593S, 594T, 599T, 603S89P17600SYN1_HU MANSynapsin-1 (Brain protein 4.1) (Synapsin I)SYN170555S, 87T, 96S, 103S, 261S, 432S, 526T, 564T, 578S90P19835CEL_HU MANBile salt-activated lipase (BAL) (EC 3.1.1.13) (EC 3.1.1.3)CEL BAL753558T, 569T, 579T, 607T, 618T, 629T, 640T, 651T, 662T, 673T91Q9HCU0CD248_H UMANEndosialin (Tumor endothelial marker 1) (CD antigen CD248)CD24875760T, 401T, 428T, 448T, 456T, 459T, 472T, 519T, 541T, 543T, 544T, 545T, 587T, 593T, 594T, 595T, 598S, 601S, 612T, 619T, 623S, 625S, 627T, 630T, 631S, 636T, 640S,92CD164L1 TEM1P05067A4_HUM ANAmyloid-beta precursor protein (APP)APP A4770633T, 651T, 652T, 656S, 659T, 663T, 667S,93AD1Q9NR71ASAH2_H UMANNeutral ceramidase (N-CDase) (NCDase) (EC 3.5.1.-) (EC 3.5.1.23)ASAH278062T, 67S, 68T, 70T, 73S, 74T, 76T, 78S, 79S, 80T, 82T, 84T94HNAC1P08047SP1_HUM ANTranscription factor Sp1SP1785491S, 612S, 640T, 641S, 698S, 702S95TSFP1Q17R60IMPG1_H UMANInterphotoreceptor matrix proteoglycan 1IMPG1403T, 421T, 432T, 442T96IPM150797SPACRP19634SL9A1_H UMANSodium / hydrogen exchanger 1 (APNH)SLC9A181542T, 56S, 61T, 62T, 68T97APNH1NHE1P12830CADH1_H UMANCadherin-1 (CAM 120 / 80)CDH1882280S, 285T, 358T, 470T, 472T, 509T, 576T, 578T, 580T98CDHEUVOQ14118DAG1_HU MANDystroglycan (Dystrophin-associated glycoprotein 1)DAG189563T, 317T, 319T, 367T, 369T, 372T, 379T, 388T, 455T99Q14624ITIH4_HU MANInter-alpha-trypsin inhibitor heavy chain H4 (ITI heavy chain H4) (ITI-HC4)ITIH4930719T, 720T, 722T100IHRPITIHL1PK120PRO1851P19823ITIH2_HU MANInter-alpha-trypsin inhibitor heavy chain H2 (ITI heavy chain H2) (ITI-HC2)ITIH2946666T, 673S, 675T, 691T101IGHEP2Q9UPV9TRAK1_H UMANTrafficking kinesin-binding protein 1TRAK1953447S, 680S, 719S, 935T102KIAA10 42OIP106P15941MUC1_H UMANMucin-1 (MUC-1)MUC11255131T, 139T, 140S, 144T103PUMQ7Z589EMSY_H UMANBRCA2-interacting transcriptional repressor EMSYEMSY1322228S, 236S, 271T, 501T, 506T, 557S, 1120T104C11orf30GL002Q92954PRG4_HU MANProteoglycan 4 (Lubricin)PRG41404123S, 136S, 240T, 253T, 277T, 291T, 305T, 306S, 310T, 317S, 324T, 332T, 338T, 367T, 373S, 376T, 384T, 385T, 388S, 391T, 399T, 400T, 407T, 408T, 415T, 423T, 427S, 430T, 438T, 439T, 446T, 447T, 454T, 455T, 477T, 478T, 485T, 493T, 494T, 501T, 502T, 509T, 525T, 529S, 532T, 540T, 541T, 553S, 555T, 563T, 564T, 571T, 572T, 579T, 580T, 587T, 588T, 595T, 603T, 604T, 611T, 612T, 616T, 619T, 627T, 676T, 683T, 684T, 691T, 692T, 699T, 700T, 704T, 707T, 723T, 724T, 736T, 768T, 769T, 776T, 777T, 792T, 793T, 805T, 812S, 829T, 837T, 838T, 892S, 900T, 930T, 931T, 962S, 963T, 968T, 975T, 978T, 979T, 980T, 1039T, 1161T105MSFSZPQ76LX8ATS13_H UMANA disintegrin and metalloproteinase with thrombospondin motifs 13 (ADAMTS 13)ADAMT S131427399S, 698S, 757S,907S, 965S, 1027S, 1087S106C9orf8UNQ6102 / PRO20 085P49790NU153_H UMANNuclear pore complex protein Nup153 (153 kDa nucleoporin) (Nucleoporin Nup153)NUP1531475534S, 544S, 908S, 909S, 1113S, 1156T107P31327CPSM_HU MANCarbamoyl-phosphate synthase [ammonia], mitochondrial (EC 6.3.4.16)CPS11500537S, 1331S, 1332T108Q8N6G6ATL1_HU MANADAMTS-like protein 1 (ADAMTSL-1) (Punctin-1)ADAMT176248T, 312T, 391S, 451T109SL1ADAMTSR1C9orf94UNQ528 / PRO1071P46531NOTC1_H UMANNeurogenic locus notch homolog protein 1 (Notch 1) (hN1)NOTCH1255565S, 73T, 116T, 146S, 194T, 232T, 311T, 341S, 349T, 378S, 435S, 458S, 466T, 496S, 534S, 609S, 617T, 647S, 692T, 722S, 759S, 767T, 784S, 797S, 805T, 921S, 951S, 997T, 1027S, 1035T, 1065S, 1159T, 1189S, 1197T, 1273S, 1362T, 1379T, 1402T,110TAN1P04275VWF_HU MANvon Willebrand factor (vWF)VWF28131248T, 1255T, 1256T, 1263S, 1468T, 1477T, 1486S, 1487T,111F8VWFQ9UPA5BSN_HU MANProtein bassoon (Zinc finger protein 231)BSN39261343T, 1384T, 2314T, 2691T, 2936T112KIAA04 34ZNF231Q86WI1PKHL1_H UMANFibrocystin-L (Polycystic kidney and hepatic disease 1-like protein 1) (PKHD1-like protein 1)PKHD1L 14243122T, 445T, 1803T, 1839T, 2320T, 3736T113

[0042] In the fusion polypeptide, the total number of O-glycans actually contained may be 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, or 21 or more (the maximum value is determined by the number of O-glycosylatable polypeptide regions described above and the number of O-glycosylated residues contained in respective O-glycosylatable polypeptide regions), or the total number of O-glycans contained theoretically may be 20 or more, 21 or more, 23, or 24 or more (the maximum value is determined by the number of O-glycosylatable polypeptide regions described above and the number of O-glycosylated residues contained in respective O-glycosylatable polypeptide regions). Further, the total number of O-glycans actually contained in the fusion polypeptide may be associated with the stability when administered in vivo (e.g., in blood). Specifically, as the total number of O-glycans actually contained in the fusion polypeptide increases, the in vivo stability of the fusion polypeptide or the target polypeptide contained in the fusion polypeptide may increase (that is, increased half-life in the body (in blood) and / or increased concentration in the body (blood) and / or decreased degradation rate in the body (in blood), etc.).

[0043] The fusion polypeptide may further comprise a peptide linker between the target polypeptide and the O-glycosylatable polypeptide region, and / or O-glycosylatable polypeptide regions when the fusion polypeptide includes two or more O-glycosylatable polypeptide regions. In one embodiment, the peptide linker may be a GS linker that repeatedly contains one or more Gly (G) and one or more Ser (S), and for example, it may be (GGGGS) n (where n is an integer of 1 to 10 or 1 to 5 as the number of repetitions of GGGGS (SEQ ID NO: 13) (e.g., 1, 2, 3, 4, or 5)), without being limited thereto.

[0044] In the fusion polypeptide, the stability (sustained period) in the body (or blood) of the target polypeptide fused with an O-glycosylatable polypeptide region is increased as compared with a target polypeptide not fused with an O-glycosylatable polypeptide region (for example, increase of the half-life in the body or blood).

[0045] Provided is a nucleic acid molecule encoding the fusion polypeptide. Provided is a recombinant vector comprising the nucleic acid molecule.

[0046] Provided is a recombinant cell comprising the recombinant vector. Provided is a method for producing a target polypeptide having an increased half-life in the body (or blood), comprising the step of expressing the recombinant vector in cells, or a method for producing a fusion polypeptide containing the target polypeptide having an increased half-life in the body (or blood).

[0047] Provided is a method of increasing the in vivo sustained period of a target polypeptide including the step of fusing (or linking or binding) a target polypeptide with an O-glycosylatable polypeptide region. The fusing step may include a step of fusing (or linking or binding) one or more O-glycosylated polypeptide regions to the N-terminus, C-terminus, or both the N- and C-termini of the target polypeptide via a linker or without through the linker. The fusing (or linking or binding) step may be performed in vitro.

[0048] Provided is a pharmaceutical composition comprising at least one selected from the group consisting of the fusion polypeptide, a nucleic acid molecule encoding the fusion polypeptide, a recombinant vector comprising the nucleic acid molecule, and a recombinant cell containing the recombinant vector.

[0049] Provided is an application thereof for use in the manufacture of a pharmaceutical composition containing at least one selected from the group consisting of the fusion polypeptide, a nucleic acid molecule encoding the fusion polypeptide, a recombinant vector containing the nucleic acid molecule, and a recombinant cell containing the recombinant vector.

[0050] Provided is the use of the O-glycosylatable polypeptide region for enhancing the in vivo (or blood) stability and / or increasing the in vivo (or blood) half-life of the target polypeptide (protein or peptide) drug. Specifically, provided is a composition for enhancing the in vivo (or blood) stability and / or increasing the in vivo (or blood) half-life of the polypeptide (protein or peptide) drug comprising an O-glycosylatable polypeptide region. As used herein, enhancing the stability and / or increasing the half-life means that the stability is improved and / or the half-life is increased as compared with a polypeptide (protein or peptide) that does not contain an O-glycosylatable polypeptide region.

[0051] Hereinafter, the present disclosure will be described in more detail: The target polypeptide (Y) may be at least one selected from all soluble proteins. In one embodiment, the target polypeptide is a protein and / or peptide having a desired in vivo activity (for example, preventive, alleviating, and / or therapeutic activity of a particular disease or condition, and / or activity as a marker, or activity of replacing substances necessary for living organisms) (for example, including about 100 or less or about 50 or less amino acids). For example, it may be at least one selected from the group consisting of an enzymatically active protein or peptide (e.g., proteases, kinases, phosphatases, etc.), a receptor protein or peptide, a transporter protein or peptide, a sterile and / or endotoxin-binding polypeptide, a structural protein or peptide, an immunogenic polypeptide, an antibody-mimetic protein (e.g., protein scaffolds, fc-fusion protein, etc.), toxins, antibiotics, hormones, growth factors, vaccines, and the like.

[0052] The target polypeptide may be at least one selected from the group consisting of hormone, cytokine, tissue plasminogen activator, immunoglobulin, and the like (for example, antibodies or antigen binding fragments or variants thereof), antibody-mimetic protein (e.g., protein scaffold, fc-fusion protein, etc.).

[0053] The target polypeptide may include at least one selected from the group consisting of: growth hormone (e.g., human growth hormone (hGH)), p40, BMP-1 (bone morphogenetic protein-1), growth hormone-releasing hormone, growth hormone-releasing peptide, interferons (e.g., interferon-alpha, -beta, -gamma, etc.), interferon receptors (e.g., watersoluble type I interferon receptors, etc.), G-CSF (granulocyte colony stimulating factor), GMCSF (granulocyte-macrophage colony stimulating factor), glucagon-like peptides (e.g., GLP-1, etc.), insulin-like growth factor (IGF), G-protein-coupled receptor, interleukins (e.g., interleukin-1, -2, -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15,- 16, -17, -18, -19, -20, -21, -22, -23, -24, -25, -26, -27, 28, -29, -30, etc.), interleukin receptors (e.g., IL-1 receptor, IL-4 receptor, etc.), enzymes (e.g. glucocerebrosidase), iduronate-2-sulfatase, alpha-galactosidase-A, agalsidase alpha and beta, alpha-L-iduronidase, butyrylcholinesterase, chitinase, glutamate decarboxylase, imiglucerase, lipase, uricase, platelet-activating factor acetylhydrolase, neutral endopeptidase, myeloperoxidase, etc.), interleukin or cytokine binding protein (e.g., IL-18bp, TNF-binding protein, etc.), macrophage activating factor, macrophage peptide, B cell factor, T cell factor, protein A, allergy inhibitor, cell necrosis glycoproteins, immunotoxin, lymphotoxin, tumor necrosis factor, tumor suppressors, metastasis growth factor, alpha-1 antitrypsin, albumin, alpha-lactalbumin, apolipoprotein-E, erythropoietin, highly glycosylated erythropoietin, angiopoietins; hemoglobin, thrombin, thrombin receptor activating peptide, thrombomodulin, blood factor VII, blood factor VIIa, blood factor IX, blood factor IX, blood factor XIII, plasminogen activating factor, fibrin-binding peptide, urokinase, streptokinase, hirudin, protein C, C-reactive protein, renin inhibitor, collagenase inhibitor, superoxide dismutase, leptin, platelet-derived growth factor, epithelial growth factor, epidermal growth factor, angiostatin, angiotensin, bone growth factor, bone stimulating protein, calcitonin, insulin, atriopeptin, cartilage inducing factor, elcatonin, connective tissue activating factor, tissue factor pathway inhibitor, follicle stimulating hormone, luteinizing hormone, luteinizing hormone releasing hormone, nerve growth factor (e.g., nerve growth factor, ciliary neurotrophic factor, AF-1 (axogenesis factor-1), brain-natriuretic peptide, glial derived neurotrophic factor, netrin, neutrophil inhibitor factor, neurotrophic factor, nuturin, etc.), parathyroid hormone, relaxin, secretin, somatomedin, adrenocortical hormone, glucagon, cholecystokinin, pancreatic polypeptide, gastrin releasing peptide, corticotropin releasing factor, thyroid stimulating hormone, autotaxin, lactoferrin, myostatin, receptor (e.g., TNF receptor (e.g., TNFR(p75), TNFR(p55), etc.)), IL-1 receptor, VEGF receptor, EGF receptor, B cell activating factor receptor, etc.), receptor antagonists (IL1-Ra, etc.), cell surface antigen (e.g., CD2, 3, 4, 5, 7, 11a, 11b, 18, 19, 20, 23, 25, 33, 38, 40, 45, 69, etc.), virus vaccine antigen, antibody (e.g., monoclonal antibody, polyclonal antibody), antibody fragment (e.g. scFv, Fab, Fab', F(ab')2 and Fd), virus-derived vaccine antigen, and variants / fragments thereof (e.g., variants / fragments that maintain the desired function and / or structure), antibody-mimetic protein (e.g., protein scaffold, fc-fusion protein, etc.), and the like, without being limited thereto.

[0054] The antibody may be of any isotype (e.g., IgA (IgA1, IgA2, etc.), IgD, IgG (IgG1, IgG2, IgG3, IgG4, etc.), IgM or IgE), and the antibody fragment is an antigen-binding fragment that retains the antigen-binding ability of the original antibody, and may be any fragment of an antibody comprising at least about 20 amino acids, such as at least about 100 amino acids (e.g., CDR, Fab, Fab', F(ab)2, Fd, Fv, scFv, scFv-Fc, etc.). The Fab fragment includes a variable domain (VL) and a constant domain (CL) of the light chain and a variable domain (VH) and a first constant domain (CH1) of the heavy chain. The Fab' fragment differs from Fab fragments in that an amino acid residue containing at least one cysteine residue has been added from the hinge region to the carboxyl terminal of the CH1 domain. The Fd fragment includes only the VH and CH1 domains, and the F(ab')2 fragment is produced by pairing the Fab' fragments via disulfide bonds or chemical reactions. The scFv (single-chain Fv) fragment exists as a single polypeptide chain since it contains VL and VH domains linked by a peptide linker. The antibody-mimetic protein may mean any protein including a site capable of binding to a specific antigen other than an antibody. For example, it may be at least one selected from the group consisting of antibody-mimetic protein scaffold, such as a repebody, Fc-fusion proteins such as nanobody and peptibody (fusion protein of Fc and antigen-binding polypeptide), without being limited thereto.

[0055] The target polypeptide may be at least one selected from the group consisting of all secretory proteins.

[0056] The above-mentioned target polypeptide may be a mammalian-derived (isolated from mammals) polypeptide, including primates such as humans and monkeys, and rodents such as mice and rats, and may be, for example, a human-derived (isolated from human) polypeptide.

[0057] In the fusion polypeptide comprising the target polypeptide and an O-glycosylatable polypeptide region provided herein, a target polypeptide and an O-glycosylatable polypeptide region, and / or two or more O-glycosylatable polypeptide regions may be covalently or non-covalently linked directly (e.g., without a linker), or may be linked through a suitable linker (e.g., a peptide linker). The peptide linker may be a polypeptide consisting of 1 to 20, 1 to 15, 1 to 10, 2 to 20, 2 to 15, or 2 to 10 arbitrary amino acids, and the type of amino acid contained therein is not limited. The peptide linker may include, for example, Gly, Asn and / or Ser residues, and may also include neutral amino acids such as Thr and / or Ala, without being limited thereto, and amino acid sequences suitable for peptide linkers are known in the art. In one embodiment, the peptide linker may be a GS linker that repeatedly includes one or more Gly(G) and one or more Ser(S), and for example, it may be (GGGGS)n (where n is the number of repetitions of GGGGS (SEQ ID NO: 13) and may be an integer of 1 to 10 or an integer of 1 to 5 (1, 2, 3, 4, or 5)), without being limited thereto.

[0058] In addition, the fusion polypeptide may contain a total of 1 or more or a total of 2 or more (e.g., 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 2 or 3) O-glycosylatable polypeptide regions. When the fusion polypeptide contains two or more O-glycosylatable polypeptide regions, the fusion polypeptide may be those in which two or more O-glycosylatable polypeptide regions are bound to the N-terminus or C-terminus of the target polypeptide, or one or more O-glycosylatable polypeptide regions are each independently bound to the N-terminus and C-terminus of the target polypeptide (in this case, the type and number of hinge regions bound to the N-terminus and C-terminus of the target polypeptide may be the same or different). In this case, the above-mentioned peptide linker may be further contained between the O-glycosylatable polypeptide regions and / or between the O-glycosylatable polypeptide region and the human target polypeptide.

[0059] The fusion polypeptide provided herein may be recombinantly or synthetically produced, and may not be naturally occurring.

[0060] The in vivo (or blood) half-life in mammals of the target polypeptide contained in the fusion polypeptide provided herein may increase by about 1.5 times or more, about 2 times or more, about 2.5 times or more, about 3 times or more, about 3.5 times or more, about 4 times or more, about 5 times or more, about 6 times or more, about 7 times or more, about 8 times or more, about 9 times or more, or about 10 times or more, as compared with the target polypeptide not fused with an O-glycosylated polypeptide region.

[0061] Due to the increased half-life of the target polypeptide in this way, the target polypeptide in the form of a fusion polypeptide in which the O-glycosylatable polypeptide region is bound has the advantage that the dosage interval can be extended as compared with the target polypeptide in the form in which the O-glycosylatable polypeptide region is not linked.

[0062] The fusion polypeptide including a target polypeptide and an O-glycosylatable polypeptide region can be produced by a conventional chemical synthesis method or a recombinant method.

[0063] As used herein, the term "vector" refers to an expression means for expressing a target gene in a host cell, and may be selected, for example, from the group consisting of plasmid vectors, cosmids vector, and bacteriophage vectors, viral vectors such as adenovirus vectors, retroviral vectors and adeno-associated virus vectors, and the like. In one embodiment, the vector that can be used in the recombinant vector may be prepared based on a plasmid (e.g., pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, pUC19, etc.), phage (e.g., λgt4λB, λ-Charon, λΔz1, M13, etc.) or virus (e.g., SV40, etc.), without being limited thereto.

[0064] In the recombinant vector, the nucleic acid molecule encoding the fusion polypeptide may be operably linked to a promoter. The term "operatively linked" refers to a functional linkage between a nucleic acid expression regulatory sequence (e.g., a promoter sequence) and a different nucleic acid sequence. The regulatory sequences can be "operatively linked" to regulate transcription and / or translation of the different nucleic acid sequence.

[0065] The recombinant vector can be typically constructed as a vector for cloning or an expression vector for expression. As the expression vector, a conventional one used for expressing a foreign protein in plants, animals or microorganisms in the art can be used. The recombinant vector can be constructed via various methods known in the art.

[0066] The recombinant vector can be expressed using eukaryotic cells as a host. When a eukaryotic cell is expressed as a host, the recombinant vector may include a nucleic acid molecule to be expressed and the above-mentioned promoter, ribosome binding site, and secretory signal sequence (see Korean Unexamined Patent Publication No. 2015-0125402) and / or the transcription / translation termination sequence. In addition, the replication origin that operates in eukaryotic cells may include an f1 origin of replication, a SV40 origin of replication, a pMB1 origin of replication, an adeno origin of replication, a AAV origin of replication, and / or a BBV origin of replication, and the like, without being limited thereto. Further, promoters derived from the genome of mammalian cells (e.g., metallotionein promoter) or promoter derived from mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used, and all secretory signal sequences commonly available as secretory signal sequences can be used. For example, the secretory signal sequence described in Korean Unexamined Patent Publication No. 2015-0125402 may be used, without being limited thereto, and a polyadenylation sequence may be included as a transcription termination sequence.

[0067] The recombinant cell may be obtained by introducing (transforming or transfecting) the recombinant vector into an appropriate host cell. The host cell may be selected from all eukaryotic cells capable of stably and continuously cloning or expressing the recombinant vector. The eukaryotic cells that can be used as hosts include yeast (Saccharomyces cerevisiae), insect cells, plant cells, animal cells, and the like, and examples thereof include cells derived from mouse (e.g., COP, L, C127, Sp2 / 0, NS-0, NS-1, At20, or NIH3T3), rat (e.g., PC12, PC12h, GH3, or MtT), hamster (e.g., BHK, CHO, GS gene-deficient CHO, or DHFR gene-deficient CHO), monkey (e.g., COS (COS1, COS3, COS7, etc.), CV1 or Vero), human (e.g., HeLa, HEK-293, retinal-derived PER-C6, diploid fibroblasts, myeloma cells or HepG2), or other animal cells (e.g., MDCK, etc.), insect cells (e.g., Sf9 cells, Sf21 cells, Tn-368 cells, BTI-TN-5B1-4 cells, etc.), hybridoma, and the like, without being limited thereto.

[0068] The nucleic acid molecule encoding the fusion polypeptide provided herein can expressed in the appropriate host cell described above to thereby produce a target polypeptide having improved in vivo stability as compared with a non-fused form, or a fusion polypeptide comprising the same. The method for producing the fusion polypeptide may include a step of culturing the recombinant cell containing the nucleic acid molecule. The culturing step may be performed under normal culturing conditions. Further, the production method may further include a step of isolating and / or purifying the fusion polypeptide from the culture after the culturing step.

[0069] Transport (introduction) of the nucleic acid molecule or a recombinant vector containing the same into a host cell may use a transport method widely known in the art. The usable transport method may, when the host cell is a eukaryotic cell, include microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, gene bombardment, and the like, without being limited thereto.

[0070] The method of selecting the transformed (recombinant vector-introduced) host cells can be easily carried out according to a method widely known in the art by using a phenotype expressed by the selection label. For example, if the selection label is a specific antibiotic resistance gene, the recombinant cells having an introduced recombinant vector can be easily selected by culturing in a medium containing the antibiotic.

[0071] The fusion polypeptide may be used for the prevention and / or treatment of any disease that is associated with a deficiency and / or functional abnormality of the target polypeptide, or enables treatment, alleviation or amelioration by the activity of the target polypeptide. Therefore, in one embodiment, there is provided a pharmaceutical composition comprising at least one selected from the group consisting of the fusion polypeptide, a nucleic acid molecule encoding the fusion polypeptide, a recombinant vector containing the nucleic acid molecule, and a recombinant cell containing the recombinant vector. The pharmaceutical composition may be a pharmaceutical composition for the prevention and / or treatment of a disease associated with a deficiency and / or functional abnormality of the target polypeptide, or a disease in which the target polypeptide has therapeutic and / or prophylactic effects. Another embodiment provides a method for preventing and / or treating a disease associated with a deficiency and / or functional abnormality of the target polypeptide contained in the fusion protein or a disease in which the target polypeptide has therapeutic and / or prophylactic effects, the method comprising the step of administering at least one selected from the group consisting of the fusion polypeptide, a nucleic acid molecule encoding the fusion polypeptide, a recombinant vector containing the nucleic acid molecule, and a recombinant cell containing the recombinant vector, to a patient in need of prevention and / or treatment of diseases associated with a deficiency and / or functional abnormality of the target polypeptide contained in the fusion protein or diseases in which the target polypeptide has therapeutic and / or prophylactic effects. The method may further include, prior to the administering step, a step of identifying a patient in need of prevention and / or treatment of diseases associated with a deficiency and / or functional abnormality of the target polypeptide contained in the fusion protein or diseases in which the target polypeptide has therapeutic and / or prophylactic effects.

[0072] The pharmaceutical composition may contain a pharmaceutically effective amount of one or more active ingredients selected from the group consisting of the fusion polypeptide, the nucleic acid molecule, the recombinant vector, and the recombinant cell. The pharmaceutically effective amount refers to the content or dose of an active ingredient capable of obtaining the intended effects. The content or dose of the active ingredient in the pharmaceutical composition may vary depending on factors, such as formulation method, administration method, age, body weight, sex or disease condition of the patient, diet, administration time, dosage interval, administration route, excretion speed, and response sensitivity. For example, a single dose of the active ingredient may be within a range of 0.001 to 1000 mg / kg, 0.01 to 100 mg / kg, 0.01 to 50 mg / kg, 0.01 to 20 mg / kg, or 0.01 to 1 mg / kg, without being limited thereto.

[0073] In addition, the pharmaceutical composition may further include a pharmaceutically acceptable carrier in addition to the active ingredient. The carrier is commonly used during formulation of a drug containing a protein, a nucleic acid, or a cell, and may be at least one selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, without being limited thereto. The pharmaceutical composition may further include at least one selected from the group consisting of a diluent, an excipient, a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, which are commonly used in the manufacture of pharmaceutical compositions.

[0074] The object for administering the pharmaceutical composition may be mammals, including primates such as humans and monkeys, and rodents such as mice, rats, and the like, or cells, tissues, cell cultures or tissue cultures derived therefrom.

[0075] The pharmaceutical composition may be administered by oral administration or parenteral administration, or may be administered by contacting cells, tissues, or body fluids. Specifically, in the case of parenteral administration, it can may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, intrapulmonary administration, rectal administration and the like. Since the protein or peptide is digested upon oral administration, the oral composition should be formulated so as to coat with an active agent or to be protected from degradation in the stomach.

[0076] In addition, the pharmaceutical composition may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or may be formulated in the form of an extract, powder, granule, tablet or capsule, and a dispersing agent or a stabilizer may be further included for formulation.[ADVANTAGEOUS EFFECTS]

[0077] The target polypeptide fused with an O-glycosylatable polypeptide region provided herein and defined in the claims has a long sustained period when administered to the body and thus can prolong the dosing interval and reduce the dosage, which has an advantageous effect in terms of ease of administration and / or economic aspects, and can be usefully applied to a field where treatment of the target polypeptide is required.[BRIEF DESCRIPTION OF THE DRAWINGS]

[0078] FIG. 1 is a diagram schematically showing the structure of the fusion polypeptide IgD-hGH-His (DHDD-8His), IgD-hGH (DHDD), IgA-hGH (AHAA), IgD-hGH-IgA (DHAA), and IgA-hGH-IgD (AHDD) according to one embodiment. FIG. 2 is a graph showing the results of the analysis of the fusion polypeptide IgD-hGH according to one embodiment by Q-TOF Mass Spectrometry. FIG. 3 is a result showing the isomer distribution of the fusion polypeptide IgD-hGH-His analyzed by IEF (Isoelectric focusing). FIG. 4 is a graph showing the results of the analysis of the fusion polypeptide IgD-hGH-His according to one embodiment by Q-TOF Mass Spectrometry. FIG. 5 is a diagram schematically showing the structure of the fusion polypeptide Dulaglutide-ID and Dulaglutide-ID2 according to one embodiment. FIG. 6 is the results showing the isomer distribution of the fusion polypeptide Dulaglutide-ID2 analyzed by IEF (Isoelectric focusing). FIG. 7 is a graph showing the change in blood concentration with time after administration of the fusion polypeptide IgD-hGH compared to when hGH is administered. FIG. 8 is a graph showing the change in blood concentration with time after administration of the fusion polypeptide IgD-hGH-His compared to when hGH is administered. FIG. 9 is a graph showing the change in blood concentration with time after administration of the fusion polypeptides IgA-hGH F3, IgA-hGH F4, and IgA-hGH F5. FIG. 10 is a graph showing the change in blood concentration with time after administration of the fusion polypeptide Dulaglutide-ID2 (pGIgG4DD) compared to when Dulaglutide (Trulicity) is administered. [DETAILED DESCRIPTION OF THE EMBODIMENTS]

[0079] Hereinafter, the present disclosure will be described in detail with reference to the following examples. However, these examples are for illustration purposes only, and the disclosure is not limited by these examples.Example 1: Production of fusion polypeptide 1.1. Production of fusion polypeptide containing human growth hormone (hGH) as target polypeptide

[0080] A fusion polypeptide IgD-hGH-His (DHDD-8His), IgD-hGH (DHDD), IgA-hGH (AHAA), IgD-hGH-IgA (DHAA), and IgA-hGH-IgD (AHDD) (see FIG. 1; the underlined part of the sequences of IgD and IgA1 is the part capable of performing O-Glycosylation) was produced in which IgD hinge (ESPKAQASS VPT AQPQAEGSLAKATT APATT RNT; SEQ ID NO: 1), IgA1 hinge (VPST PPT PS PS TPPT PS PS ; SEQ ID NO: 2), or a combination of the hinge of IgD and the hinge of IgA1 was fused with the target polypeptide (human growth hormone: hGH; SEQ ID NO: 3). The amino acid sequences of each part contained in the fusion polypeptide were summarized in Table 2 below. [Table 2]Amino acid sequence(N-terminus→C-terminus)SEQ ID NOSignal Peptide (SP7.2)MHRPEAMLLL LTLALLGGPT WA4Target polypeptide (hGH)3Hinge region of Immunoglobulin IgD (ID)1Hinge region of Immunoglobulin IgA1 (IA)VPSTPPTPSP STPPTPSPS2His-TagHHHHHHHH5 1.1.1. IgD-hGH (DHDD)

[0081] Plasmid pAF-D1G1 (including the promoter of Korean Patent No. 10-1868139B1), which is a variant of pcDNA3.1(+) (Invitrogen, Cat. No. V790-20), was treated with BamHI (restriction site: GGATCC) and NotI (restriction site: GCGGCCGC), into which the gene encoding the fusion polypeptide of '(N-terminus)-[BamHI restriction site-signal peptide (SEQ ID NO: 4)-IgD hinge (IgDH1; SEQ ID NO: 1)-human growth hormone (hGH; SEQ ID NO: 3)-IgD hinge (IgDH1; SEQ ID NO: 1)- IgD hinge (IgDH1; SEQ ID NO: 1)-NotI restriction site]-(C-terminus)' was inserted to prepare a recombinant vector pDHDD-D1G1 for the production of a fusion polypeptide containing the target polypeptide (human growth hormone) and the hinge region of immunoglobulin (IgD) (293 aa in total (excluding signal peptide); the number of O-Glycosylatable sites: a total of 21); hereinafter, referred to as 'IgD-hGH').

[0082] The prepared recombinant vector pDHDD-D1G1 was introduced into ExpiCHO-S ™< cells (Thermo Fisher Scientific), and cultured in ExpiCHO Expression Medium (Thermo Fisher Scientific; 400 mL) for 12 days (Fed-Batch Culture; Day 1 & Day 5 Feeding) to produce the fusion polypeptide IgD-hGH. The fusion polypeptide IgD-hGH theoretically has a molecular weight of 32.2 kDa (excluding O-Glycans) and 21 O-Glycans.

[0083] The fusion polypeptide IgD-hGH produced through the expression of the recombinant vector was purified and O-Glyan site Occupancy was analyzed using Q-TOF Mass Spectrometry.

[0084] Specifically, the first purification process was performed by mounting a column made by CaptureSelectTM Human Growth Hormone Affinity Matrix (Life Technologies) having Binding Specificity to hGH on an AKTATM Purifier (GE Healthcare Life Sciences), and loading a sample. The primary washing was performed with an equilibration buffer, and eluted with 20mM citric acid pH 3.0 or 0.1M Acetic acid pH 3.0. Immediately after completion of the process, the elution solution was adjusted to pH 7.0 using 2M Tris Buffer and left in a frozen state until before the next purification process.

[0085] The second purification process was performed by applying Anion Exchange Chromatography and using TMAE as a resin. After the frozen sample obtained through the first process was dissolved, the conductivity was measured and the sample was diluted with water for injection so as to have a conductivity suitable for loading, and subjected to a pretreatment with a 0.22um PES Filtration System (Corning, USA). Columns were mounted on AKTA Avant (GE Healthcare Life Sciences) and the sample was loaded. Elution was made in gradient form for isolation according to the conductivity, and fractions were divided and pooled with reference to elution peak.

[0086] Concentration or buffer exchange was performed to prepare an analytical sample and an animal experimental sample during the purification process. The sample was placed in Amicon Ultra System (Millipore), centrifuged at low temperature and subjected to concentration or diafiltration. 25mM Sodium Phosphate pH 7.0 was used as a buffer for analysis, and PBS Buffer was used to prepare animal experimental samples.

[0087] The concentration of samples was measured after the purification process, concentration process, or diafiltration, in which the Extinction Coefficient of the substance was calculated using the amino acid sequence, and absorbances at 280nm and 340nm were measured with a UV Spectrophotometer (G1103A, Agilent Technologies) and calculated using the following Equation. A 280 nm − A 340 nm Extinction Coefficient × Dilution Factor

[0088] In the case of animal experimental samples, they were diluted to a predetermined concentration using PBS Buffer, and filtered with 0.22um Syringe Filter (Millex-GV, 0.22um, Millipore) in a Biosafety Cabinet before administration, and then stored in a frozen state until subsequent administration.

[0089] The results of analyzing IgD-hGH by Q-TOF Mass Spectrometry are shown in FIG. 2 (Y-axis: %; X-axis: mass; the numbers 7 to 21 shown above the peak are O-Glycan numbers). As shown in FIG. 2, O-Glycans were distributed from 7 to 21 in IgD-hGH, and the average number of O-Glycans was 13.5.1.1.2. IgD-hGH-His

[0090] Primers in Table 3 were synthesized to add 8His-tag to the C-terminus of IgD-hGH (Example 1.1.1) for convenience of purification. [Table 3]Primer NameDNA Sequence (5'→3')SEQ ID NOhGH-Pst_FAAGTATTCCTTCCTGCAGAACCCCCAG14DD_R15DD_F16DHis_R17His-Not_R18

[0091] PCR was performed using each primer, and then overlapping PCR was performed again with an appropriate combination of primers to finally obtain a PCR product of 693 bp ('(N-terminus)-[PstI restriction site-signal peptide (SEQ ID NO:4) - IgD hinge (IgDH1; SEQ ID NO:1) - human growth hormone (hGH; SEQ ID NO: 3) - IgD hinge (IgDH1; SEQ ID NO: 1) - IgD hinge (IgDH1; SEQ ID NO: 1) - 8His-NotI restriction site]-gene encoding (C-terminus)'). Then, the pDHDD-D1G1 and PCR products were treated with PstI and NotI, respectively, and then ligated to finally prepare the recombinant vector pDHDD-8His-D1G1 for the preparation of a fusion polypeptide (total 301 aa (excluding signal peptide); O-Glycosylatable sites - total 21); hereinafter, referred to as 'IgD-hGH-His') including the target polypeptide (human growth hormone) and the hinge region of immunoglobulin (IgD) and 8His Tag.

[0092] The fusion polypeptide IgD-hGH-His produced through the expression of the recombinant vector was purified and O-Glycan site occupancy was analyzed using IEF (Isoelectric focusing) analysis and Q-TOF Mass Spectrometry.

[0093] Specifically, the first column used in the purification process was TMAE which is an anion exchange resin, and IgD-hGH-His was partially isolated from a culture solution and eluted as a first eluate. Then, the first eluate was supplied to a HIS-Tag binding column, a metal affinity resin, which is a second column, and IgD-hGH-His was selectively eluted as a second eluate. Then, the second eluate was supplied to TMAE, an anion exchange resin, which is a third column, to remove a fraction with a low sialic acid content, and eluted as a third eluate. The third eluate was then supplied to a gel filtration column, which is a fourth column, to remove multimers and fragmented proteins, thereby obtaining a fourth eluate.

[0094] More specifically, it includes the following steps.

[0095] Step 1: equilibrating with a buffer containing TMAE, 0.5x25 cm (4 mL), v= 150 cm / hr, 10 mM trolamine (pH 7.0). After loading the culture solution, the column was washed once with an equilibration buffer, and an elution buffer containing 10 mM trolamine and 250 mM sodium chloride (pH 7.0) was eluted in a linear gradient to obtain a first eluate.

[0096] Step 2: equilibrating with a buffer containing Ni-NTA His*Bind, 1.0 x 5 cm (4 mL), v= 80 cm / hr, 10 mM sodium phosphate, 1M sodium chloride, 10 mM imidazole (pH 7.0). After loading the first eluate, the column was washed once with an equilibrium buffer, and an elution buffer containing 10 mM sodium phosphate, 1 M sodium chloride, and 500 mM imidazole (pH 7.0) was eluted in a linear gradient to obtain a second eluate.Step 3: Diafiltration

[0097] Step 4: Equilibrating with a buffer containing TMAE, 0.5x25 cm (4 mL), v= 150 cm / hr, 10 mM trolamine (pH 7.0). After loading the second eluate, the column was washed once with an equilibrium buffer, and an elution buffer containing 10 mM trolamine and 100 mM sodium chloride (pH 7.0) was eluted in a linear gradient to obtain a third eluate.Step 5: Ultrafiltration

[0098] Step 6: equilibrating with a buffer containing Sephacryl S-100, 1.6 x 30 cm (60 mL), v= 30 cm / hr, 20 mM sodium phosphate, 140 mM sodium chloride, pH 7.0. After loading the third eluate, the monomer fraction was eluted with an equilibration buffer to obtain a fourth eluate.

[0099] The isomer distribution of the obtained fourth eluate was shown in FIG. 3. In FIG. 3, the theoretical pI value of IgD-hGH-His is 6.65. The value lower than this means that IgD-hGH-His is O-Glycosylation and sialic acid is bound to this O-Glycan to becomes more acidic.

[0100] The results of analyzing IgD-hGH-His by Q-TOF Mass Spectrometry are shown in FIG. 4 (Y-axis: %; X-axis: mass; values of 7 to 21 shown above the peak are the numbers of O-Glycans). As shown in FIG. 4, in IgD-hGH-His, O-Glycans were distributed from 8 to 21, and the average number of O-Glycans was 14.7.1.1.3. IgA-hGH (AHAA)

[0101] In the recombinant vector pDHDD-D1G1 constructed in Example 1.1.1, a recombinant vector pAHAA-D1G1 was constructed to have the same configuration, except that the coding genes of three IgD hinges (one on the N-terminus side and two on the C-terminus side of hGH, three in total) were replaced with the coding genes of the IgA1 hinges, respectively., and then expressed in the same manner as in Example 1.1.1 to produce a fusion polypeptide having a configuration of IgA1 hinge (IgA; SEQ ID NO: 2) - human growth hormone (hGH; SEQ ID NO: 3) - IgA1 hinge (IgA; SEQ ID NO: 2) - IgA1 hinge (IgA; SEQ ID NO: 2) (see Fig. 1; hereinafter referred to as 'IgA-hGH'). The fusion polypeptide IgA-hGH theoretically has 24 O-Glycans. The fusion polypeptide IgA-hGH produced through expression of the recombinant vector was purified by referring to the method described in Example 1.1.1.

[0102] As a result of analyzing the purified IgA-hGH by Q-TOF Mass Spectrometry, the average number of O-Glycans in IgA-hGH was 12.8 in Fraction 3, 14.3 in Fraction 4, and 15.6 in Fraction 5.1.1.4. IgD-hGH-IgA (DHAA)

[0103] 7574 bp vector where the recombinant vector pDHDD-D1G1 produced in Example 1.1.1 was cut with BamHI and NotI was ligated with 489 bp of Insert I where pDHDD-D1G1 was cut with BamHI and Kas1, and 383 bp of Insert II where the recombinant vector pAHAA-D1G1 used in Example 1.1.3 was cut with KasI and NotI, and thus the recombinant vector pDHAA-D1G1 was constructed so as to have the same configuration except that in the recombinant vector pDHDD-D1G1, 3 IgD hinges (1 on the N-terminus side and 2 on the C-terminus side of hGH, 3 in total), two on the 3' terminal side were replaced by the coding gene of the IgA1 hinge. The recombinant vector pDHAA-D1G1 was expressed in the same manner as in Example 1.1.1 to produce a fusion polypeptide having the configuration of IgD hinge (IgD; SEQ ID NO: 1)-human growth hormone (hGH; SEQ ID NO: 3)-IgA1 hinge (IgA; SEQ ID NO: 2)-IgA1 hinge (IgA; SEQ ID NO: 2). The fusion polypeptide IgD-hGH-IgA theoretically has 23 O-Glycans.1.1.5. IgA-hGH-IgD (AHDD)

[0104] 7574 bp vector where the recombinant vector pDHDD-D1G1 produced in Example 1.1.1 was cut with BamHI and NotI was ligated with 444 bp of Insert I where pAHAA-D1G1 used in Example 1.1.3 was cut with BamHI and KasI, and 473 bp of Insert II where pDHDD-D1G1 used in Example 1.1.1 was cut with KasI and NotI, and thus the recombinant vector pADD-D1G1 was constructed so as to have the same configuration except that one at the 5' terminal of the three IgD hinge coding genes was replaced by the coding gene for the IgA1 hinge, and then expressed in the same manner as in Example 1.1.1 to produce a fusion polypeptide having the configuration of IgA1 hinge (IgA; SEQ ID NO: 2) - human growth hormone (hGH; SEQ ID NO: 3) - IgD hinge (IgD; SEQ ID NO: 1) - IgD hinge (IgD; SEQ ID NO: 1) (see FIG. 1; hereinafter referred to as 'IgA-hGH-IgD'). The fusion polypeptide IgA-hGH-IgD theoretically has 22 O-Glycans.1.2. Protein of interest: GLP-1-Fc fusion protein

[0105] The fusion polypeptides Dulaglutide-ID (including one IgD hinge area) and Dulaglutide-ID2 (including two IgD hinge regions) (see FIG. 5) were prepared in which IgD hinge (ESPKAQASS VPT AQPQAEGSLAKATT APATT RNT; SEQ ID NO: 1) was fused with the target polypeptide (GLP-1 (Glucagon-like peptide-1)-Fc fusion protein: GLP-1-Fc). The GLP-1-Fc fusion protein exists as a dimer. The encoded amino acid sequence is summarized in Table 4 below. [Table 4]Amino acid sequence(N-terminus→C-terminus)SEQ ID NOSignal Peptide (SP7.2)MHRPEAMLLL LTLALLGGPT WA4Target polypeptide (GLP-1-Fc)Modified GLP-16GS LinkerGGGGSGGGGS GGGGSModified IgG4 (IgG4 hinge- CH2-IgG4-CH3_mod ified)Hinge region of Immunoglobulin IgD (ID)1 1.2.1. Dulaglutide-ID1

[0106] The expression vector pGIg4 (including the promoter of Korean Patent No. 10-1868139B1) expressing GLP-1-Fc, which is a variant of pcDNA3.1(+) (Invitrogen, Cat. No. V790-20), was used as a template, and PCR was performed using Primers IgG4mCH2_F and IgG4ID_R in Table 4 to obtain a PCR product (mIgG4) of 659 bp Modified IgG4. And, the pDHDD-D1G1 prepared in Example 1.1.1 was used as a template, and PCR was performed using Primers IgG4ID_F and ID_NotR in Table 4 to obtain PCR products of 129 bp (ID1) and 231 bp (ID2). The obtained 659 bp mIgG4 PCR Product and 129 bp ID1 PCR Product were purified, which was then used as a template. Overlapping PCR was performed using Primers IgG4mCH2_F and ID_NotR in Table 5 below to obtain a PCR product of 770 bp ('(N-terminus)-[Modified IgG4 Fc part (including BsrGI restriction site))-IgD hinge (IgDH1; SEQ ID NO: 1)-NotI restriction site]- gene encoding (C-terminus)'). [Table 5]Primer NameDNA Sequence (5'→3')SEQ ID NOIgG4mCH2_F19IgG4ID_R20IgG4ID_F21ID_NotR22

[0107] A 7574 bp vector where pDHDD-D1G1 prepared in Example 1.1.1 was cut with BamHI and NotI was ligated with 607 bp of Insert I where pGIg4 was cut with BamHI and BsrGI and 403 bp of Insert II where the 770 bp PCR product obtained through the overlapping PCR was cut with BsrGI and NotI to prepare a recombinant vector pGIg4D-D1G1 for the production of a fusion polypeptide including the target polypeptide (GLP-1-Fc) and a hinge region of immunoglobulin (IgD) (total 309 aa (excluding signal peptide); O-Glycosylated sites - total 7, exists as dimers, so finally 14); hereinafter, referred to as 'Dulaglutide-ID1').1.2.2. Dulaglutide-ID2

[0108] 659 bp of mIgG4 PCR product and 231 bp of ID2 PCR product obtained in Example 1.2.1 were used as a template, and overlapping PCR was performed using Primers IgG4mCH2_F and ID_NotR in Table 4 to obtain a PCR product of 882 bp ('(N-terminus)-[Modified IgG4 Fc part (including BsrGI restriction site)- IgD hinge (IgDH1; SEQ ID NO: 1)- IgD hinge (IgDH1; SEQ ID NO: 1)-NotI restriction site)- gene encoding (C-terminus)').

[0109] A 7574 bp vector where pDHDD-D1G1 prepared in Example 1.1.1 was cut with BamHI and NotI was ligated with 607 bp of Insert I where pGIg4 was cut with BamHI and BsrGI and 505 bp of Insert II where the PCR product of 882 bp obtained through the overlapping PCR was cut with BsrGI and NotI to prepare a recombinant vector pGIg4DD-D1G1 for the production of a fusion polypeptide including the target polypeptide (GLP-1-Fc) and two hinge regions of immunoglobulin (IgD) (total 343 aa (excluding signal peptide); O-Glycosylated sites-14 in total, 28 as it exists as dimer); hereinafter, referred to as 'Dulaglutide-ID2').

[0110] The fusion polypeptide Dulaglutide-ID2 produced through the expression of the recombinant vector was purified, and O-Glyan site occupancy was analyzed using isoelectric focusing (IEF) analysis and Q-TOF Mass Spetrometry.

[0111] Specifically, proteins were isolated and purified through Protein A affinity chromatography using the Fc region of substance, and then anion exchange chromatography and hydrophobic interaction chromatography were sequentially performed and purified.

[0112] The culture solution was filtered using a 0.22 um filtration membrane, injected into Protein A affinity resin equilibrated with an equilibration buffer (10 mM Sodium phosphate, 150 mM Sodium chloride, pH 7.4), and then washed with an equilibrium buffer. After washing, the protein was eluted with an elution buffer (100mM Sodium citrate pH 3.5), and peaks were collected.

[0113] The collected eluate was subjected to a buffer exchange with 20 mM Tris pH 8.0.

[0114] The buffer exchanged sample was injected and purified into anion exchange chromatography (Source 15Q, GE Healthcare).

[0115] The equilibration buffer and elution buffer used were 20mM Tris, pH 8.0, 20mM Tris, 0.5 M NaCl, and pH 8.0, respectively. The equilibration buffer and the elution buffer were used as channels A and B, respectively, to elute the protein under concentration gradient conditions and collect peaks.

[0116] The collected protein solution was further purified using hydrophobic interaction chromatography (Butyl sepharose, GE Healthcare).

[0117] The equilibration buffer and elution buffer used were 0.1M sodium phosphate pH 6.0, 1.8 ammonium sulfate, pH 8.0, and 0.1M sodium phosphate pH 6.0, respectively. The equilibration buffer and the elution buffer were used as channels A and B, respectively, to elute the protein under concentration gradient conditions and collect peaks.

[0118] The isomer distribution of Dulaglutide-ID2 obtained by analyzing the collected peaks by isoelectric focusing (IEF) is shown in FIG. 6. In FIG. 6, the theoretical pI value of Dulaglutide-ID2 is 5.78, but in the case of Fraction #3, the value lower than this means that Dulaglutide-ID2 is O-Glycosylated, and this O-Glycan is attached to sialic acid and becomes more acidic.

[0119] As a result of analyzing Dulaglutide-ID2 Fraction #3 by Q-TOF Mass Spectrometry, ID could be performed up to 26, and the average number of O-Glycans was 17.5.

[0120] The finally purified protein solution was buffer-exchanged with the same excipients as Trulicity (Sodium citrate hydrate: 2.74 mg / mL, Anhydrous citric acid: 0.14 mg / mL, D-mannitol: 46.4 mg / mL, polysorbate 80: 0.20 mg / mL, pH 6.0- 7.0), and concentrated and used as a test material for the animal PK test.Example 2: Pharmacokinetic properties (PK Profile) test of fusion polypeptide (in vivo) 2-1. Target protein: human growth hormone (hGH)

[0121] Fusion polypeptides IgD-hGH, IgD-hGH-His, IgA-hGH F3 (Fraction 3 of Example 1.1.3), IgA-hGH F4 (Fraction 4 of Example 1.1.3), and IgA-hGH F5 (Execution Fraction 5 of Example 1.1.3) prepared in Example 1.1 were subcutaneously administered to SD rats (Orientbio, 7 weeks old, about 300g; n=3) at a dose of 2mg / kg, and Pharmacokinetics were tested. Sampling was performed at 0, 0.5, 1, 2, 4, 6, 8, 24, 48 hours, and for comparison, hGH (Eutropin, LG Chem) was administered subcutaneously at a dose of 2 mg / kg in the same manner as above, and tested.

[0122] After administration to SD rat as described above, the blood collected by time-point was centrifuged to obtain a serum. ELISA was performed using Human Growth Hormone Quantikine ELISA Kit (R&D Systems), and the concentrations of hGH and fusion polypeptides (IgD-hGH, IgD-hGH-His, IgA-hGH FP3, IgA-hGH FP4 and IgA-hGH FP5) in the blood by time-point were confirmed. Using this data, parameters including AUC (area under the curve) were calculated using software for PK analysis (WinNonlin (Certara L.P.), etc.).2-1-1. hGH vs. IgD-hGH

[0123] PK results of hGH and IgD-hGH are shown in Table 6 and FIG. 7. [Table 6]ParameterhGHIgD-hGHMeanSDMeanSDCmax (ng / mL)178850.6973233Tmax (hr)1-4-AUCinf (ng*hr / mL)4703111160272941AUClast (ng*hr / mL)4695111158452881T1 / 2 (hr)2.171.797.110.327AUCextp (%)0.1670.0591.110.197(C max : Maximum blood concentration, T max : Time when peak blood concentration is reached, AUC inf : Area under the blood concentration-time curve calculated by extrapolating from the last measurable blood collection time point to infinite time, AUC last : Area under the blood concentration-time curve until the last measurable blood collection time point, T 1 / 2 : elimination half-life, AUC Extp (%): [(AUC inf -AUC last ) / AUC inf ]*100)

[0124] As can be seen in Table 6 and FIG. 7, it can be confirmed that the half-life of the hGH fused with the hinge region (IgD-hGH) increased by about 3.3 times compared to the hGH not fused with the hinge region.2-1-2. hGH vs. IgD-hGH-His

[0125] PK results of hGH and IgD-hGH-His are shown in Table 7 and FIG. 8. [Table 7]ParameterhGHIgD-hGH-HisMeanSDMeanSDCmax (ng / mL)502.2239.88886.67195.63Tmax (hr)1-4-AUCinf (ng*hr / mL)1028.80120.0313436.052680.39AUClast (ng*hr / mL)1003.74115.7613332.392710.64T1 / 2 (hr)2.550.206.610.71AUCextp (%)2.430.230.820.39(C max : Maximum blood concentration, T max : Time when peak blood concentration is reached, AUC inf : Area under the blood concentration-time curve calculated by extrapolating from the last measurable blood collection time point to infinite time, AUC last : Area under the blood concentration-time curve until the last measurable blood collection time point, T 1 / 2 : elimination half-life, AUC Extp (%): [(AUC inf -AUC last ) / AUC inf ]*100)

[0126] As can be seen in Table 7 and FIG. 8, it can be confirmed that the half-life of hGH (IgD-hGH-His) fused with the hinge region with His-Tag increased by about 2.6 times compared to the hGH not fused with the hinge region.2-1-3. IgA-hGH (Effect on PK by O-Glycan number)

[0127] In order to see the effect of the number of O-glycans on PK, PK results for each IgA-hGH fraction are shown in Table 8 and FIG. 9. [Table 8]ParameterIgA-hGH FP3 (Average number of O-glycan: 12.8)IgA-hGH FP4 (Average number of O-glycan: 14.3)IgA-hGH FP5 (Average number of O-glycan: 15.6)MeanSDMeanSDMeanSDCmax (ng / mL)29080.530510219532.8Tmax (hr)2-4-2-AUCinf (ng*hr / mL)25104742832814218689.2AUClast (ng*hr / mL)25094752826816216096.8T1 / 2 (hr)1.980.2052.530.2873.560.335AUCextp (%)0.0500.0350.2400.1821.210.573(C max : Maximum blood concentration, T max : Time when peak blood concentration is reached, AUC inf : Area under the blood concentration-time curve calculated by extrapolating from the last measurable blood collection time point to infinite time, AUC last : Area under the blood concentration-time curve until the last measurable blood collection time point, T 1 / 2 : elimination half-life, AUC Extp (%): [(AUC inf -AUC last ) / AUC inf ]*100)

[0128] As can be seen in Table 8 and FIG. 9, it can be confirmed that the half-life increases as the number of O-glycan increases.2-2. Target protein: GLP-1-Fc fusion protein (GLP-1-Fc, Dulaglutide)

[0129] Fusion polypeptide Dulaglutide-ID2 prepared in Example 1.2 was subcutaneously administered to SD rats (Orientbio, 7 weeks old, about 300g; n=3) at a dose of 0.1 mg / kg, and Pharmacokinetics were tested. Sampling was performed at 0, 0.5, 1, 2, 4, 6, 8, 24, 48, 96 and 144 hours, and for comparison, Dulaglutide (Trulicity, Lilly Korea) was administered subcutaneously at a dose of 0.1 mg / kg in the same manner as above, and tested.

[0130] After administration to the SD rat as above, the blood collected by time-point was centrifuged to obtain a serum. ELISA was performed using Anti-GLP-1 antibody (NovousBio) and Anti-Human IgG4 Fc Antibody (Sigma-Aldrich), and the concentrations of Dulaglutide and fusion polypeptide Dulaglutide-ID2 in the blood by time-point were confirmed. Using this data, parameters including AUC (area under the curve) were calculated using software for PK analysis (WinNonlin (Certara L.P.), etc.).

[0131] The obtained results are shown in Table 9 and FIG. 10. [Table 9]ParameterDulaglutideDulaglutide-ID2MeanSDMeanSDCmax (ng / mL)26824.246.82.43Tmax (hr)24-24-AUCinf (ng*hr / mL)1150012303430535AUClast (ng*hr / mL)1170012003870786T1 / 2 (hr)26.93.0640.97.04AUCextp (%)1.970.54210.94.09(C max : Maximum blood concentration, T max : Time when peak blood concentration is reached, AUC inf : Area under the blood concentration-time curve calculated by extrapolating from the last measurable blood collection time point to infinite time, AUC last : Area under the blood concentration-time curve until the last measurable blood collection time point, T 1 / 2 : elimination half-life, AUC Extp (%): [(AUC inf -AUC last ) / AUC inf ]*100)

[0132] As can be seen in Table 9 and FIG. 10, it can be confirmed that the half-life of GLP-1-Fc (Dulaglutide-ID2) fused with the hinge region increased by about 1.5 times as compared with Dulaglutide, which is not fused with the hinge area. Further, Cmax was about 1 / 5, and AUClast was about 1 / 3.

[0133] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without changing the technical idea or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and non-limiting.

Claims

1. A fusion polypeptide, comprising: a target polypeptide and a total of 2 to 10 O-glycosylatable polypeptide regions bound to the N-terminus, C-terminus, or both the N- and C-termini of the target polypeptide, wherein the 2 to 10 O-glycosylatable polypeptide regions are 2 to 10 hinge regions of immunoglobulin, wherein each of the 2 to 10 hinge regions of immunoglobulin is independently selected from the group consisting of a hinge region of Immunoglobulin D (IgD) and a hinge region of Immunoglobulin A (IgA)2. The fusion polypeptide according to claim 1, which is represented by the following formula:         N'-(Z)n-Y-(Z)m-C' in the above formula, N' is the N-terminus of the fusion polypeptide, C' is the C-terminus of the fusion polypeptide, Y is the target polypeptide, Z is the O-glycosylatable polypeptide region, n is the number of O-glycosylatable polypeptide regions bound to the N-terminus of the target polypeptide, and is an integer of 0 to 10, m is the number of O-glycosylatable polypeptide regions bound to the C-terminus of the target polypeptide, and is an integer of 0 to 10, n and m are not zero at the same time, and n+m is the total number of the O-glycosylatable polypeptide regions contained in the fusion polypeptide, and is an integer of 2 to 10.

3. The fusion polypeptide according to claim 1 or 2, wherein each of the 2 to 10 hinge regions of immunoglobulin is independently selected from the group consisting of: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, (2) a polypeptide comprising 5 or more consecutive amino acids containing 3 to 7 O-glycosylated residues in the amino acid sequence of SEQ ID NO: 1, (3) a polypeptide comprising 34 or more consecutive amino acids containing the polypeptide of (1) or (2) in Immunoglobulin D (IgD), (4) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, (5) a polypeptide comprising 8 or more consecutive amino acids containing 3 to 8 O-glycosylated residues in the amino acid sequence of SEQ ID NO: 2, and (6) a polypeptide comprising 19 or more consecutive amino acids containing the polypeptide of (4) or (5) in Immunoglobulin A (IgA), or wherein each of the 2 to 10 hinge regions of immunoglobulin is independently selected from the group consisting of: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, (2) a polypeptide comprising 5 or more consecutive amino acids containing SEQ ID NO: 9 or 7 or more consecutive amino acids containing SEQ ID NO: 10 in the amino acid sequence of SEQ ID NO: 1, (3) a polypeptide comprising 34 or more consecutive amino acids containing the polypeptide of (1) or (2) in Immunoglobulin D (IgD), (4) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, (5) a polypeptide comprising 8 or more consecutive amino acids containing SEQ ID NO: 12 in the amino acid sequence of SEQ ID NO: 2, and (6) A polypeptide comprising 19 or more consecutive amino acids containing the polypeptide of (4) or (5) in Immunoglobulin A (IgA).

4. The fusion polypeptide according to any one of claims 1 to 3, wherein an in vivo half-life of the target polypeptide bound to the O-glycosylatable polypeptide region in the fusion polypeptide increases by 1.5 times as compared with the target polypeptide that is not bound to the O-glycosylated polypeptide region.

5. The fusion polypeptide according to any one of claims 1 to 4, wherein each of the 2 to 10 O-glycosylatable polypeptide regions is a polypeptide containing 3 to 10 O-glycosylatable amino acid residues.

6. A nucleic acid molecule encoding the fusion polypeptide of any one of claims 1 to 5.

7. A recombinant vector comprising the nucleic acid molecule of claim 6.

8. A recombinant cell comprising the recombinant vector of claim 7.

9. A method for producing a fusion polypeptide of any one of claims 1 to 5, the method comprising the step of culturing the recombinant cell of claim 8.

10. A method of enhancing an in-vivo stability of a target polypeptide comprising the step of linking a total of 2 to 10 O-glycosylatable polypeptide regions to the N-terminus, C-terminus, or both the N- and C-termini of the target polypeptide, wherein the 2 to 10 O-glycosylatable polypeptide regions are 2 to 10 hinge regions of immunoglobulin, wherein each of the 2 to 10 hinge regions of immunoglobulin is independently selected from the group consisting of a hinge region of Immunoglobulin D (IgD) and a hinge region of Immunoglobulin A (IgA).

11. The method of enhancing an in-vivo stability of a target polypeptide according to claim 10, wherein each of the 2 to 10 hinge regions of immunoglobulin is independently selected from the group consisting of: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, (2) a polypeptide comprising 5 or more consecutive amino acids containing 3 to 7 O-glycosylated residues in the amino acid sequence of SEQ ID NO: 1, (3) a polypeptide comprising 34 or more consecutive amino acids containing the polypeptide of (1) or (2) in Immunoglobulin D (IgD), (4) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, (5) a polypeptide comprising 8 or more consecutive amino acids containing 3 to 8 O-glycosylated residues in the amino acid sequence of SEQ ID NO: 2, and (6) a polypeptide comprising 19 or more consecutive amino acids containing the polypeptide of (4) or (5) in Immunoglobulin A (IgA), or wherein each of the 2 to 10 hinge regions of immunoglobulin is independently selected from the group consisting of: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, (2) a polypeptide comprising 5 or more consecutive amino acids containing SEQ ID NO: 9 or 7 or more consecutive amino acids containing SEQ ID NO: 10 in the amino acid sequence of SEQ ID NO: 1, (3) a polypeptide comprising 34 or more consecutive amino acids containing the polypeptide of (1) or (2) in Immunoglobulin D (IgD), (4) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, (5) a polypeptide comprising 8 or more consecutive amino acids containing SEQ ID NO: 12 in the amino acid sequence of SEQ ID NO: 2, and (6) a polypeptide comprising 19 or more consecutive amino acids containing the polypeptide of (4) or (5) in Immunoglobulin A (IgA).

12. The method of enhancing an in-vivo stability of a target polypeptide according to claim 10 or 11, wherein each of the 2 to 10 O-glycosylatable polypeptide regions is a polypeptide containing 3 to 10 O-glycosylatable amino acid residues.

13. A pharmaceutical composition for the prevention or treatment of diseases associated with a deficiency or functional abnormality of the target polypeptide, comprising the fusion polypeptide of any one of claims 1 to 5.

14. The fusion polypeptide of any one of claims 1 to 5 for use in the prevention or treatment of diseases associated with a deficiency or functional abnormality of the target polypeptide.