METHOD FOR DETERMINING THE RISK OF OCCURRING A NURSING-ASSOCIATED INFECTION IN A PATIENT
Patent Information
- Application Number
- DE602020062146
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-09-27
- Filing Date
- 2020-09-25
- Publication Date
- 2025-11-12
- Estimated Expiration
- 2040-09-25
AI Technical Summary
Current clinical practice lacks a diagnostic test to identify patients at high risk of developing healthcare-associated infections (HAIs), which are a significant complication in healthcare settings, contributing to increased morbidity, mortality, and healthcare costs.
A process is developed to measure the expression of the CX3CR1 gene in a patient's biological sample to determine the risk of nosocomial infections, involving gene expression analysis through techniques like RT-PCR and immunoassays, and includes a healthcare management step to reduce the risk based on the biomarker results.
The method effectively predicts the occurrence of healthcare-associated infections within 15 days, improving patient management and reducing associated risks through tailored healthcare interventions.
Description
[0001] The present invention relates to a process in vitro Or ex vivo to determine the risk of a healthcare-associated infection occurring in a patient, including a step of measuring the expression of CX3CR1 in a biological sample of said patient.
[0002] The development of healthcare-associated infections (HAIs) is a significant complication of medical care, particularly in healthcare settings such as hospitals (where they are more specifically referred to as nosocomial infections). Nosocomial infections in intensive care units, occurring in 20% to 40% of patients, have been shown to be associated with increased morbidity and mortality, a longer duration of the need for organ support, a longer hospital stay, higher healthcare costs, and increased antibiotic use, contributing to antimicrobial resistance. The occurrence of HAIs has been particularly exacerbated in recent years by the rise in multidrug-resistant pathogens.The World Health Organization (WHO) estimates that there are approximately 5 million nosocomial infections in European hospitals, leading to around 50,000 deaths and an annual cost of €13 to €24 billion. Numerous factors influence the occurrence and development of healthcare-associated infections, such as the patient's overall health status, but also factors related to patient care (e.g., the administration of antibiotics and / or the use of invasive medical devices), factors related to the hospital environment (e.g., the nurse-to-patient ratio), and the variable use of aseptic techniques by hospital staff. Recommendations have been published, and the implementation of infection control programs has been encouraged, particularly by the [organization name missing]. US Department of Health and Human Services,The European Centre for Disease Prevention and Control, the WHO, and national agencies have made the prevention and reduction of healthcare-associated infections a major priority. Infection control programs have been shown to be particularly effective in reducing severe infections. However, it has been estimated that up to 65–70% of catheter-related bloodstream and urinary tract infections, and 55% of ventilator-associated pneumonia and surgical site infections could be avoided. Furthermore, adherence to and implementation of recommended procedures can be challenging in some hospitals, particularly in low- and middle-income countries.Early identification of patients at risk of developing healthcare-associated infections (HAIs) is a key step in preventing and managing these infections. According to some models, a biomarker that reduces the time to identify HAIs in a high-risk population could reduce mortality in these patients, with a good cost-effectiveness ratio. However, no diagnostic test is currently available in clinical practice. in vitro allowing the identification of patients at high risk of contracting a healthcare-associated infection.
[0003] Surprisingly, it has been discovered that measuring the expression of the CX3CR1 gene, which codes for the fractalkine receptor (or CX3CL1), can determine a patient's risk of developing a healthcare-associated infection (HAI). Patients at high risk of HAI could benefit from immunostimulatory therapy or individualized care. While decreased CX3CR1 expression has been shown in the literature to be associated with increased mortality, particularly in septic patients, especially those in septic shock (Pachot et al. (2008), J Immunol 180: 6421-6429), the usefulness of measuring CX3CR1 expression for predicting HAIs had never before been demonstrated or suggested.
[0004] Thus, the present invention relates to a process in vitro Or ex vivo to determine the risk of occurrence of a nosocomial infection in a patient within a health facility, including a step of measuring the expression of CX3CR1 (chromosomal location of the gene according to GRCh38 / hg38: chr3:39,263,494-39,281,735), in a biological sample of said patient.
[0005] Within the scope of the present invention: The term "patient" refers to an individual (human being) who has come into contact with a healthcare professional, such as a physician (for example, a general practitioner) or a medical facility or healthcare establishment (for example, a hospital, and more specifically the emergency department, the intensive care unit, a critical care unit, or a step-down unit, or a nursing home for the elderly). The patient may, for example, be an elderly person receiving a vaccination (particularly in a nursing home or at a general practitioner's office). An infection is considered "healthcare-associated" if it occurs during or following the care (diagnostic, therapeutic, palliative, preventive, educational, or surgical) of a patient by a healthcare professional, and if it was neither present nor incubating at the start of that care.Healthcare-associated infections (HAIs) include infections acquired within a healthcare facility (known as nosocomial infections) as well as those acquired during care provided outside of such a setting. When the infectious status at the start of care is not precisely known, a delay of at least 48 hours, or a delay exceeding the incubation period, is commonly accepted to define an HAI. For surgical site infections, infections occurring within 30 days of the procedure are generally considered healthcare-associated, or, if an implant, prosthesis, or prosthetic material is inserted, within one year of the procedure. The infection may be bacterial, fungal, or viral in origin.It may also involve the reactivation of potentially pathogenic latent viruses, such as TTV or herpes viruses, for example CMV; By "biological sample", we refer to any sample taken from a patient, and which may be of various kinds, such as blood or its derivatives, sputum, urine, stool, skin, cerebrospinal fluid, bronchoalveolar lavage fluid, saliva, gastric secretions, semen, seminal fluid, tears, spinal cord, trigeminal nerve ganglion, adipose tissue, lymphoid tissue, placental tissue, gastrointestinal tract tissue, genital tract tissue, central nervous system tissue.In particular, this sample may be a biological fluid, such as a blood sample or a blood-derived sample, which may include whole blood (as collected from the venous route, i.e., containing white and red blood cells, platelets and plasma), plasma, serum, as well as any type(s) of cells extracted from blood, such as peripheral blood mononuclear cells (or PBMCs, containing lymphocytes (B, T and NK cells), dendritic cells and monocytes), B cell subpopulations, purified monocytes, or neutrophils.
[0006] Preferably, in the process as described above: the patient is a patient within a health facility, preferably within a hospital, preferably still within the emergency department, the resuscitation department, in an intensive care unit or in a continuous care unit; particularly preferably, the patient is a patient in a septic state (more particularly, in septic shock), a patient with burns (more particularly, severe burns), a patient with trauma (more particularly, severe trauma), or a patient undergoing surgery (more particularly, major surgery); and the method makes it possible to determine the risk of occurrence of a nosocomial infection in said patient.
[0007] In the case of a patient in a septic state (already suffering from a first infection), the method according to the invention makes it possible to determine the risk of occurrence of a secondary infection.
[0008] A patient in a septic state (or a patient with sepsis) is defined as a patient with at least one life-threatening organ failure caused by an inappropriate host response to infection. Septic shock is defined as a subtype of sepsis in which hypotension persists despite adequate fluid resuscitation.
[0009] Preferably, the method according to the invention, as described above, in all its embodiments, makes it possible to determine the risk of occurrence of a healthcare-associated infection in a patient: within 15 days from the day of the immuno-inflammatory attack ( i.e.trauma for patients with trauma, burns for patients with burns, surgery for patients undergoing surgery or the diagnosis of sepsis for patients in a septic state), that is, during the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th or 15th day from the immuno-inflammatory insult (the 1st day here corresponding to the day of occurrence of the immuno-inflammatory insult);the collection of the biological sample may in particular have been carried out during the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th or 15th day from the immuno-inflammatory insult, preferably during the 1st, 2nd, 3rd, 4th, 5th, 6th or 7th day from the immuno-inflammatory insult, preferably again during the 3rd, 4th, 5th, from the 6th or 7th day from the immuno-inflammatory attack;and / or within 7 days, within 6 days, within 5 days or within 4 days following the day on which the biological sample was taken (regardless of the day on which this sample was taken), that is to say during the 1st, 2nd, 3rd, 4th, 5th, 6th or 7th day following the day on which the biological sample was taken (the 1st day here corresponding to the day after the day on which the biological sample was taken). ;
[0010] Preferably, in the process as described above, in all its embodiments, the biological sample is a blood sample, preferably a whole blood sample or a blood-derived sample (e.g., PBMCs, which can be obtained by the Ficoll method, well known to those skilled in the art, or purified monocytes).
[0011] Preferably, the method as described above, in all its embodiments, further includes a step of measuring, in the patient's biological sample, the expression of another gene of interest, selected from the list consisting of: ADGRE3, BTLA, CD3D, CD74, CD274 (also known as PD-L1), CTLA4 (also known as CD152), HP, ICOS, IFNG, IL1RN, IL6, IL7R (also known as CD127), IL10, IL15, MDC1, PDCD1 (also known as PD-1 and CD279), S100A9, TDRD9 and ZAP70; Preferably, the other gene of interest is selected from the list consisting of: BTLA, CD3D, CD74, CD274, CTLA4, HP, ICOS, IFNG, IL1RN, IL7R, IL10, IL15, PDCD1 and S100A9. Table 1. Chromosomal location of genes whose expression can be measured in combination with CX3CR1 expression measurement Biomarker (gene) Chromosomal localization (GRCh38 / hg38) ADGRE3 chr19:14,619,117-14,690,027 BTLA chr3:112,463,966-112,499,702 CD3D chr11:118,338,954-118,342,744 CD74 chr5: 150,400,041-150,412,936 CD274 chr9:5,450,381-5,470,567 CTLA4 chr2:203,867,771-203,873,965 HP chr16:72,054,592-72,061,056 ICOS chr2:203,936,731-203,961,579 IFNG chr12:68,154,768-68,159,741 IL1RN chr2:113,099,365-113,134,016 IL6 chr7:22,725,442-22,732,002 IL7R chr5:35,852,695-35,879,603 IL10 chr1:206,767,602-206,774,607 IL15 chr4:141,636,583-141,733,987 MDC1 chr6:30,699,807-30,717,966 PDCD1 chr2:241,849,881-241,858,908 S100A9 chr1:153,357,854-153,361,027 TDRD9 chr14:103,928,438-104,052,667 ZAP70 chr2:97,713,560-97,744,327
[0012] Measuring gene expression (or expression level) involves quantifying at least one gene expression product. A gene expression product, as defined in this invention, is any biological molecule resulting from the expression of said gene.
[0013] More specifically, the gene expression product can be an RNA transcript. By "transcript," we mean RNAs, and in particular messenger RNAs (mRNAs), resulting from gene transcription. More precisely, transcripts are RNAs produced by the transcription of a gene followed by post-transcriptional modifications of the pre-RNA forms. Within the scope of the present invention, the measurement of the expression level of one or more RNA transcripts of the same gene can be performed. Thus, preferably, in the method as described above, in all its embodiments, the expression of the gene(s) ( i.e.The expression of CX3CR1 (and possibly another gene of interest from the list indicated above) is measured at the RNA or mRNA transcript level. In the case of an mRNA transcript, detection can be performed by a direct method, by any method known to those skilled in the art that allows the presence of said transcript in the sample to be determined, or by indirect detection of the transcript after its conversion to DNA, or after amplification of said transcript, or after amplification of the DNA obtained after its conversion to DNA. Numerous methods exist for the detection of nucleic acids (see, for example, Kricka et al., Clinical Chemistry, 1999, No. 45(4), pp. 453–458; Relier GH et al., DNA Probes, 2nd ed., Stockton Press, 1993, sections 5 and 6, pp. 173–249). Gene expression can notably be measured by Reverse Transcription-Polymerase Chain Reactionor RT-PCR, preferably by quantitative RT-PCR or RT-qPCR (for example using FilmArray ®< technology), by sequencing (preferably by high-throughput sequencing) or by hybridization techniques (for example with hybridization microchips or by techniques of the NanoString ®< nCounter ®< type).
[0014] The gene expression product can also be a protein and / or a polypeptide, which is the product of the translation of at least one of the transcripts of said gene. Thus, in the procedure as described above, gene expression can also be measured at the protein level. All isoforms of the protein(s), the gene expression product(s), can be measured, alone or in combination, as marker(s) to determine the risk of a healthcare-associated infection occurring in a patient. The measurement of gene expression at the protein level in a biological sample can be performed using techniques widely known to those skilled in the art for determining the quantity, or dose, of one or more analytes in a biological sample. Examples include immunoassays, such as ELISA ( Enzyme Linked Immuno Sorbent Assay ), ELFA ( Enzyme Linked Fluorescent Assay ) and RIA ( Radio Immuno Assay ), and mass spectrometry assays.
[0015] Measuring gene expression levels allows us to determine the quantity of one or more transcripts (or one or more proteins) present in a biological sample, or to obtain a derived value. A derived value of the quantity can, for example, be the absolute concentration, calculated using a calibration curve obtained from successive dilutions of a solution of amplicons (or proteins or polypeptides) of known concentration. It can also correspond to the value of the normalized and calibrated quantity, such as the CNRQ (Calibrated Normalized Relative Quantity, (Hellemans et al (2007), Genome biology 8(2):R19), which integrates the values of a reference sample (or calibrator) and one or more housekeeping genes (also called reference genes). Examples of housekeeping genes include DECR1, HPRT1, PPIB, RPLP0, PPIA, GLYR1, RANBP3, 18S, GAPDH, and ACTB.
[0016] Thus, preferably, in the process as described above, in all its embodiments, the expression of the gene(s) of interest is normalized with respect to the expression of one or more housekeeping genes (or reference genes), as is known to those skilled in the art; preferably still using one or more of the following housekeeping genes: DECR1 (chromosomal location of the gene according to GRCh38 / hg38: chr8:90,001,352-90,053,633), HPRT1 (chromosomal location of the gene according to GRCh38 / hg38: chrX:134,452,842-134,520,513) and PPIB (chromosomal location of the gene according to GRCh38 / hg38: chr15:64,155,812-64,163,205).
[0017] Preferably, in the method as described above, in all its embodiments, the expression of the gene(s) of interest (preferably, the normalized expression) in the patient's biological sample is compared to a reference value or to the expression of the same gene(s) of interest (preferably, the normalized expression) in a reference biological sample (these data being used for the calculation of the CNRQ, as mentioned above). The reference sample may be, for example, a sample from a volunteer (healthy individual), a patient, or a mixture of samples from several volunteers (on the one hand) or several patients (on the other hand). The reference sample may also be a sample taken from a volunteer (or a mixture of samples taken from several volunteers) and then processed ex vivoby an immune system stimulant (such as LPS or lipopolysaccharide). The reference sample may also be a mixture of untreated and treated sample(s). ex vivo by an immune system stimulant.
[0018] Preferably, the process for determining the risk of developing a healthcare-associated infection, as described above, in all its embodiments, also includes a healthcare management step to reduce the risk of developing a healthcare-associated infection. A patient identified as being at increased risk of developing a healthcare-associated infection may receive tailored healthcare management aimed at reducing the risk of developing a healthcare-associated infection and, for example, reducing the risk of developing sepsis, septic shock, or death.Examples of care management include patient-specific immunomodulatory therapy or prophylactic antibiotic therapy. These two treatments can be combined and / or referral to a continuous care or intensive care unit may be necessary to reduce the risk of healthcare-associated infections, such as developing sepsis, septic shock, or even death in the days following biomarker expression measurement. Preferably, immunomodulatory treatment is an immunostimulatory treatment if the individual is determined to have immunosuppression, or an anti-inflammatory treatment if the individual is determined to have inflammation.Examples of immunostimulatory treatments include interleukins, particularly IL-7, IL-15, or IL-3; growth factors, especially GM-CSF; interferons, particularly IFNγ; Toll agonists; antibodies, particularly anti-PD1, anti-PDL1, anti-LAG3, anti-TIM3, anti-IL-10, or anti-CTLA4; transferrins; apoptosis inhibitors such as FLT3L and Thymosin α1; and adrenergic antagonists. Anti-inflammatory treatments include glucocorticoids; cytostatic agents; immunophilin and cytokine receptor blockers; IL-1 receptor blockers; and anti-TNF therapies. Examples of appropriate prophylactic antibiotic treatments to prevent pneumonia are described in particular in the Annales Françaises d'Anesthésie et de Réanimation (30; 2011; 168-190).Conversely, a patient who does not present a risk of developing a healthcare-associated infection can be quickly referred to a day hospital service, for example an infectious disease service, rather than remaining in a service with close monitoring which he will not need.
[0019] Without being part of the invention, the application describes a kit comprising means for amplifying and / or detecting the expression (preferably primers and / or probes, or antibodies) of CX3CR1 and another gene, selected from the list consisting of: ADGRE3, BTLA, CD3D, CD74, CD274, CTLA4, HP, ICOS, IFNG, IL1RN, IL6, IL7R, IL10, IL15, MDC1, PDCD1, S100A9, TDRD9 and ZAP70 (preferably, the other gene is selected from the list consisting of: BTLA, CD3D, CD74, CD274, CTLA4, HP, ICOS, IFNG, IL1RN, IL7R, IL10, IL15, PDCD1 and S100A9 or from the list consisting of: ADGRE3, BTLA, CD3D, CD74, CD274, CTLA4, HP, IFNG, IL1RN, IL6, IL7R, IL10, MDC1, PDCD1, S100A9, TDRD9 and ZAP70; preferably still in the list consisting of: BTLA, CD3D, CD74, CD274, CTLA4, HP, IFNG, IL1RN, IL7R, IL10, PDCD1 and S100A9);said kit being characterized in that the set of amplification and / or detection means of said kit allows the detection and / or amplification of at most 100, preferably at most 90, preferably at most 80, preferably at most 70, preferably at most 60, preferably at most 50, preferably at most 40, preferably at most 30, preferably at most 20, preferably at most 10, preferably at most 5 biomarkers, preferably at most 4, preferably at most 3, preferably at most 2, in total. By "biomarker" (or "marker"), we mean an objectively measurable biological characteristic that represents an indicator of normal or pathological biological processes or of pharmacological response to a therapeutic intervention. This biomarker may, in particular, be detectable at the mRNA or protein level. More specifically, the biomarker may be an endogenous biomarker or loci (such as a gene or a HERV / ; Human Endogenous Retroviruswhich are found in an individual's chromosomal material) or an exogenous biomarker (such as a virus).
[0020] Thus, the kit may, for example, also include means for amplifying and / or detecting one or more housekeeping genes (preferably selected from the list consisting of: DECR1, HPRT1, and PPIB). The kit may also include means for positive control to assess the quality of the RNA extraction and the quality of any amplification and / or hybridization process.
[0021] A "primer" or "amplification primer" is defined as a nucleotide fragment that can be 5 to 100 nucleotides long, preferably 15 to 30 nucleotides, and that has specificity for hybridization with a target nucleotide sequence under specific conditions for initiating enzymatic polymerization, for example, in an enzymatic amplification reaction of the target nucleotide sequence. Generally, "primer pairs," consisting of two primers, are used. When amplifying several different biomarkers (e.g., genes), several different primer pairs are preferably used, each ideally having the capacity to hybridize specifically with a different biomarker.
[0022] A "probe" or "hybridization probe" is defined as a nucleotide fragment typically consisting of 5 to 100 nucleotides, preferably 15 to 90 nucleotides, and even more preferably 15 to 35 nucleotides, possessing hybridization specificity under determined conditions to form a hybridization complex with a target nucleotide sequence. The probe also includes a reporter (such as a fluorophore, an enzyme, or any other detection system) that enables the detection of the target nucleotide sequence. In the present invention, the target nucleotide sequence may be a nucleotide sequence contained in messenger RNA (mRNA) or a nucleotide sequence contained in complementary DNA (cDNA) obtained by reverse transcription of said mRNA. When targeting multiple biomarkers (e.g.,different genes), several different probes are preferably used, each preferably having the ability to hybridize specifically with a different biomarker.
[0023] Hybridization refers to the process by which, under appropriate conditions, two nucleotide fragments, such as a hybridization probe and a target nucleotide fragment, with sufficiently complementary sequences, can form a double strand with stable and specific hydrogen bonds. A nucleotide fragment "capable of hybridizing" with a polynucleotide is a fragment that can hybridize with said polynucleotide under hybridization conditions, which can be determined in a known manner in each case. These hybridization conditions are determined by stringency, that is, the severity of the operating conditions. Hybridization is more specific the higher the stringency. Stringency is defined, in particular, by the base composition of a probe / target duplex, as well as by the degree of mismatch between two nucleic acids.Stringency can also depend on reaction parameters, such as the concentration and type of ionic species present in the hybridization solution, the nature and concentration of denaturing agents, and / or the hybridization temperature. The stringency of the conditions under which a hybridization reaction must be carried out depends primarily on the hybridization probes used. All of this data is well known, and the appropriate conditions can be determined by those skilled in the art. In general, depending on the length of the hybridization probes used, the temperature for the hybridization reaction is between approximately 20 and 70°C, specifically between 35 and 65°C in a saline solution with a concentration of approximately 0.5 to 1 M. A detection step of the hybridization reaction is then performed.
[0024] An "enzymatic amplification reaction" is a process that generates multiple copies of a target nucleotide fragment through the action of at least one enzyme. Such amplification reactions are well known to those skilled in the art, and examples include the following techniques: PCR ( Polymerase Chain Reaction ), LCR ( Ligase Chain Reaction ), CPR ( Repair Chain Reaction ), 3SR ( Self-Sustained Sequence Replication ) with patent application WO-A-90 / 06995, NASBA ( Nucleic Acid Sequence-Based Amplification ), TMA ( Transcription Mediated Amplification ) with US patent A-5,399,491, and LAMP ( Loop mediated isothermal amplification ) with patent US6410278. When the enzymatic amplification reaction is a PCR, it is more specifically referred to as RT-PCR (RT for " reverse transcription "), when the amplification step is preceded by a reverse transcription step of messenger RNA (mRNA) into complementary DNA (cDNA), and by qPCR or RT-qPCR when the PCR is quantitative.
[0025] The invention also relates to the use of: means of amplification and / or means of detection of the expression (preferably primers and / or probes, or antibodies) of CX3CR1, to determine the risk of developing a healthcare-associated infection, preferably a nosocomial infection, in a patient, preferably a patient within a health facility, preferably still within a hospital, preferably still within the emergency department, the resuscitation department, in an intensive care unit or in a continuous care unit; particularly preferably, the patient is a patient in a septic state (more particularly in septic shock), a patient with burns (more particularly, severe burns), a patient with trauma (more particularly, severe trauma), or a patient undergoing surgery (more particularly, major surgery).
[0026] The present invention is illustrated in a non-limiting way by the following examples. Example 1: Measuring CX3CR1 expression can predict the risk of developing a healthcare-associated infection in a patient Materials and Methods
[0027] A prospective, longitudinal, single-center observational clinical study was conducted at Edouard Herriot Hospital (Lyon, France). The design of this clinical study was published in Rol et al (2017), BMJ Open 7(6): e015734. The clinical study was approved by the French National Agency for Medicines and Health Products Safety (ANSM) in November 2015 and by the South-East II Ethics Committee in December 2015. Amendments to the protocol were made in July 2016 and then in January 2017. Briefly, a total of 377 patients, in a septic state (n=35) or in septic shock (n=72), with severe burns (n=24), severe trauma (n=137) or hospitalized in a resuscitation or intensive care unit after major surgery (n=109), and 175 healthy volunteers were included between December 2015 and March 2018. Patients in a septic state / in shockSeptic: According to the first clinical protocol, only patients in septic shock were included, based on a suspicion of an infectious focus, the initiation of catecholamine treatment within 48 hours of admission to the intensive care unit, and catecholamine (norepinephrine) treatment > 0.25 µg / kg / min for at least 2 hours. Subsequently, the eligibility criteria were modified in August 2016, following the publication of a new definition of septic shock, Sepsis 3 (Singer et al (2016), JAMA 810-801:(8)315). Patients in septic shock were therefore included on the basis of a suspicion of an infectious focus, the start of treatment with catecholamines within 48 hours of admission to intensive care and vasopressor therapy necessary to maintain a blood pressure ≥ 65 mm Hg and lactate concentration > 2 mmol / L (18 mg / dL), despite the correction of hypovolemia.In 2017, the possibility was added to include patients in a septic state (according to the Sepsis 3 definition), namely the suspicion of an infectious focus and an increase in the SOFA score ≥ 2 points compared to the baseline SOFA score within 48 hours of admission to intensive care. For this population, day 1 corresponds to the day of diagnosis of sepsis or septic shock; Trauma severe: in the first protocol, only patients with severe trauma were included (Injury Severity Score (ISS) ≥ 25). In August 2016, the possibility of also including less severe trauma (16 < ISS < 24) was added. For this population, day 1 corresponds to the day of admission to the resuscitation service or intensive care unit (~day of trauma); Major surgeryIn the first protocol, only esophagogastroduodenosectomy, Bricker-type bladder resection, pancreaticoduodenectomy, and abdominal aortic surgery via laparotomy were considered. Other types of surgery with a high risk of complications were added in January 2017: pancreatectomy (total or caudal), neuroendocrine tumors, hepatectomy (right-sided), extended colectomy (laparotomy), abdoperineal resection, nephrectomy (laparotomy, PKD), and iliofemoral bypass (Scarpa). For this population, day 1 corresponds to the day of surgery; Burns severe: patients were selected based on a total burn surface area greater than 30%. For this population, day 1 corresponds to the day of admission to the resuscitation service or intensive care unit ("burn day").
[0028] The exclusion criteria focused primarily on factors that could have impacted immune status and biased the results (e.g., severe neutropenia, corticosteroid treatments, hematological or oncological disease). Each event leading to a suspected healthcare-associated infection, occurring within the hospital before day 30, was independently reviewed by three physicians not involved in patient recruitment. Twenty-six percent of patients developed at least one healthcare-associated infection before day 30, or before hospital discharge.
[0029] Blood samples were collected in PAXgene ®< tubes (ref. 762165, PreAnalytiX GmbH Hombrechtikon Switzerland), once for healthy volunteers, and several times for patients, i.e. 3-4 times in the first week (on days 1 or 2: J1 / 2, on days 3 or 4: J3 / 4 and on days 5, 6 or 7: J5 / 7), then 3 times at later times (around J14, J28 and J60).
[0030] CX3CR1 expression levels were measured in these samples by RT-qPCR. RNA was extracted from whole blood samples using the Maxwell HT Simply RNA kit (ref. AX2420, Promega) and the EVO automated platform (TECAN), following the kit supplier's instructions. Then, 10 ng of total RNA were reverse-transcribed into complementary DNA (cDNA) using the master mix Fluidigm Reverse transcription(ref. PN100-6472 A1, Fluidigm), following the supplier's instructions. CX3CR1 expression was then quantified by qPCR, using Fluidigm's Biomark HD real-time PCR system.
[0031] First, a cDNA pre-amplification step was performed according to the supplier's recommendations using the PreAmp master mix (Ref. PN100-5876 B1, Fluidigm). Next, the pre-amplified cDNAs were diluted 1 / 5, and qPCR was performed on Fluidic 192.24 integrated circuits (Ref. PN100-6170 C1), as recommended by the supplier. The part numbers of the probes and primers used for qPCR are listed in Table 2.
[0032] The threshold cycles (or Ct) were then determined. The normalization of CX3CR1 expression to CNRQ (Calibrated Normalized Relative Quantity or Calibrated Normalized Relative Quantity) was performed using the geometric mean of the Ct values of 3 housekeeping genes (DECR1, HPRT1, PPIB) and a calibrator (corresponding to a mixture of processed samples) ex vivo by LPS (immune system stimulant) (50%) and untreated samples ex vivo (50%), from volunteers / healthy individuals) in each fluidic integrated circuit 192.24, as described in Hellemans et al (2007), Genome biology 8(2):R19. Table 2. Probes and primers used for qPCR Biomarker (gene) Kind Reference of the supplier of the probes and primers used CX3CR1 Gene of interest Hs04971470_s1 (ThermoFisher) DECR1 Reference gene Hs00154728_m1 (ThermoFisher) HPRT1 Reference gene Hs99999909_m1 (ThermoFisher) PPIB Reference gene Hs01018503_m1 (ThermoFisher)
[0033] Regarding data analysis, associations between CX3CR1 expression, measured at different time points during the first week, and the occurrence of a healthcare-associated infection before day 30 from study enrollment were assessed. The results were calculated in the form of 'Hazard Ratiosexpressed as interquartile distance with the associated 95% confidence interval (HR IQR). Then, univariate logistic regressions were implemented to predict the risk of occurrence of a healthcare-associated infection before day 15. The power of the values predicted by the logistic regression to discriminate between healthcare-associated infection and the absence of healthcare-associated infection was quantified by the area under the curve (AUC) of the ROC curve ( Receiver Operating Characteristic ), and 95% confidence intervals were estimated.
[0034] Next, the association between CX3CR1 expression and the occurrence of a healthcare-associated infection (HAI) was assessed for different time intervals of infection onset (i.e., the time between sample collection and the first occurrence of an infection). The different time intervals considered were: an HAI within 4 days and within 7 days after sample collection, regardless of when the sample was collected. For each patient who developed an HAI, the sample considered was the one collected closest to the occurrence of the first HAI. For patients who did not develop an HAI (i.e., control patients), a matching method was used to select, for each case, a control patient with the same sample collection date and similar SOFA and Charlson Comorbidity Index scores.Finally, a single control was selected for each unique case. Univariate logistic regressions were implemented. The power of the values predicted by the logistic regression to discriminate between healthcare-associated infection and the absence of healthcare-associated infection was quantified by the area under the curve (AUC) of the ROC curve, and 95% confidence intervals were estimated. Results
[0035] A decrease in CX3CR1 mRNA expression, measured on days 3 / 4 or 5 / 7 from cohort enrollment, was associated with a higher risk of healthcare-associated infection occurring before day 30 (day 3 / 4: HR IQR=0.54 [0.39-0.74], p=0.0001; day 5 / 7: HR IQR=0.57 [0.42-0.79], p=0.0006) in the overall patient population. This association remained significant at both CX3CR1 expression measurement times after adjustment for SOFA and Charlson scores (day 3 / 4: HR IQR=0.61 [0.44-0.85], p=0.003; day 5 / 7: HR IQR=0.65 [0.46-0.91], p=0.01).
[0036] Furthermore, prediction models showed that CX3CR1 mRNA expression, measured at day 3 / 4 or day 5 / 7 from inclusion in the cohort, could predict the occurrence of a healthcare-associated infection before day 15 from inclusion in the cohort (Table 3). Table 3. Performance (AUC and 95% confidence interval, CI) of CX3CR1 expression measurement, measured at D3 / 4 or D5 / 7 from cohort inclusion, for predicting the occurrence of a healthcare-associated infection before day 15 from cohort inclusion. Sample collection day AUC (IC) J3 / 4 0,677 (0,571-0,783) J5 / 7 0,758 (0,655-0,86)
[0037] Predictive models also showed that CX3CR1 mRNA expression, measured at day 3 / 4 or day 5 / 7, could predict the occurrence of a healthcare-associated infection within 4 days or within 7 days following sample collection (Table 4). Table 4. Performance (AUC and 95% confidence interval, CI) of CX3CR1 expression measurement for predicting the occurrence of a healthcare-associated infection within 4 days or within 7 days of sample collection. Time interval between sample collection and the possible occurrence of the first healthcare-associated infection AUC (IC) 4 days 0,642 (0,542-0,742) 7 days 0,657 (0,567-0,746)
[0038] Thus, the results obtained show that the measurement of CX3CR1 expression alone makes it possible to predict the occurrence of healthcare-associated infection(s) within 15 days of the immuno-inflammatory attack, within 4 days of sample collection or within 7 days of sample collection. Example 2: Measuring the expression of CX3CR1 and another gene improves the predictive performance of the risk of developing a healthcare-associated infection. Materials and Methods
[0039] The Materials and Methods are identical to those of Example 1, except that 1) the cDNA preamplification step was performed with a different PreAmp master mix reference (Ref. PN100-5875 C1, Fluidigm) for certain genes (BTLA and IL15, as well as the reference genes that were measured with both references) and followed by an additional exonuclease I processing step (ref. PN100-5875 C1, Fluidigm), and that, furthermore, for these genes, the amplification step was performed with a different type of Fluidic 192.24 integrated circuit (Ref. PN100-7222 C1), as recommended by the supplier, and 2) that here, multivariate logistic regressions (combining the measurement of CX3CR1 expression and another gene, selected from the list consisting of: BTLA, CD3D, CD74, CD274, CTLA4, HP, ICOS, IFNG, IL1RN, IL7R, IL10, IL15, PDCD1 and S100A9) were carried out.
[0040] Thus, the expression of the genes of interest (except for BTLA and IL15) was measured by TaqMan chemistry, with normalization using the expression of reference genes also measured by TaqMan chemistry (ThermoFisher reference, including two primers and one probe). The expression of the BTLA and IL15 genes was measured by SYBR Green chemistry, with normalization using the expression of reference genes also measured by SYBR Green chemistry (Integrated DNA Technologies reference, including two primers). In addition to the probes and primers already presented in Table 2 (for CX3CR1 and the reference genes in TaqMan chemistry), the additional probes and primers used in this example are presented in Table 5 (for the other genes of interest and the reference genes in SYBR Green chemistry). Table 5. Additional probes and primers used for qPCR Biomarker (gene) Kind Supplier reference or sequences corresponding to the probes and primers used BTLA Gene of interest Hs.PT.58.14525368 (Integrated DNA Technologies) CD3D Gene of interest Hs00174158_m1 (ThermoFisher) CD74 Gene of interest Hs00959493_g1 (ThermoFisher) CD274 Gene of interest Hs01125301_m1 (ThermoFisher) CTLA4 Gene of interest Hs00175480_m1 (ThermoFisher) HP Gene of interest Hs00605928_g1 (ThermoFisher) ICOS Gene of interest Hs04261471_m1 (ThermoFisher) IFNG Gene of interest Hs00174143_m1 (ThermoFisher) IL1RN Gene of interest Hs00893626_m1 (ThermoFisher) IL7R Gene of interest Forward: CTCTGTCGCTCTGTTGGTC Reverse primer: TCCAGAGTCTTCTTATGATCG Probe: CTATCGTATGGCCCAGTCTCC IL10 Gene of interest Hs00961620_g1 (ThermoFisher) IL15 Gene of interest Hs.PT.58.21299580 (Integrated DNA Technologies) PDCD1 Gene of interest Hs01550088_m1 (ThermoFisher) S100A9 Gene of interest Hs00610058_m1 (ThermoFisher) DECR1 Reference gene Hs.PT.58.19871222 (Integrated DNA Technologies) HPRT1 Reference gene Hs.PT.58v.45621572 (Integrated DNA Technologies) PPIB Reference gene Hs.PT.58v.45621572 (Integrated DNA Technologies) Results
[0041] Measuring the expression of one of these other genes of interest, in addition to measuring CX3CR1 expression, improves the predictive performance of the risk of developing a healthcare-associated infection, whether before day 15 from inclusion in the cohort (Table 6) or within 4 or 7 days following sample collection (Table 7). Table 6. Performance (AUC and 95% confidence interval, CI) of CX3CR1 expression measurement, in combination with another biomarker (multivariate analysis), measured at D3 / 4 or D5 / 7 from cohort inclusion, for predicting the occurrence of a healthcare-associated infection before day 15 from cohort inclusion. Sample collection day Biomarkers AUC (IC) J3 / 4 CX3CR1 + BTLA 0,681 (0,576-0,785) J3 / 4 CX3CR1 + ICOS 0,681 (0,578-0,784) J3 / 4 CX3CR1 + IFNG 0,683 (0,58-0,787) J3 / 4 CX3CR1 + IL15 0,684 (0,582-0,785) J3 / 4 CX3CR1 + PDCD1 0,693 (0,587-0,799) J3 / 4 CX3CR1 + HP 0,693 (0,589-0,797) J3 / 4 CX3CR1 + CD74 0,694 (0,591-0,797) J3 / 4 CX3CR1 + IL10 0,725 (0,625-0,825) J3 / 4 CX3CR1 + S100A9 0,729 (0,615-0,844) J5 / 7 CX3CR1 + IFNG 0,759 (0,655-0,862) J5 / 7 CX3CR1 + CD274 0,761 (0,66-0,863) J5 / 7 CX3CR1 + PDCD1 0,763 (0,667-0,86) J5 / 7 CX3CR1 + CTLA4 0,778 (0,674-0,883) J5 / 7 CX3CR1 + HP 0,784 (0,69-0,878) J5 / 7 CX3CR1 + CD74 0,8 (0,708-0,892) J5 / 7 CX3CR1 + ICOS 0,802 (0,707-0,897) J5 / 7 CX3CR1 + CD3D 0,802 (0,708-0,896) J5 / 7 CX3CR1 + BTLA 0,803 (0,701-0,905) J5 / 7 CX3CR1 + S100A9 0,803 (0,702-0,904) J5 / 7 CX3CR1 + IL7R 0,803 (0,718-0,888) J5 / 7 CX3CR1 + IL1RN 0,819 (0,726-0,911) J5 / 7 CX3CR1 + IL10 0,852 (0,775-0,928) Table 7. Performance (AUC and 95% confidence interval, CI) of CX3CR1 expression measurement, in combination with another biomarker (multivariate analysis), for predicting the occurrence of a healthcare-associated infection within 4 days or within 7 days of sample collection. Time interval between sample collection and the possible occurrence of the first healthcare-associated infection Biomarkers AUC (IC) 4 days CX3CR1 + CD3D 0,648 (0,549-0,747) 4 days CX3CR1 + IL15 0,653 (0,545-0,761) 4 days CX3CR1 + ICOS 0,654 (0,555-0,752) 4 days CX3CR1 + S100A9 0,661 (0,563-0,759) 4 days CX3CR1 + CD74 0,663 (0,566-0,761) 4 days CX3CR1 + IFNG 0,671 (0,572-0,771) 4 days CX3CR1 + BTLA 0,679 (0,582-0,776) 4 days CX3CR1 + HP 0,704 (0,61-0,798) 7 days CX3CR1 + CD274 0,664 (0,573-0,754) 7 days CX3CR1 + CD3D 0,667 (0,579-0,756) 7 days CX3CR1 + IL15 0,668 (0,573-0,762) 7 days CX3CR1 + IL10 0,668 (0,576-0,76) 7 days CX3CR1 + IL7R 0,668 (0,579-0,756) 7 days CX3CR1 + IL1RN 0,671 (0,581-0,762) 7 days CX3CR1 + CTLA4 0,671 (0,582-0,759) 7 days CX3CR1 + IFNG 0,676 (0,586-0,765) 7 days CX3CR1 + ICOS 0,686 (0,599-0,773) 7 days CX3CR1 + BTLA 0,692 (0,605-0,779) 7 days CX3CR1 + CD74 0,694 (0,608-0,78) 7 days CX3CR1 + S100A9 0,699 (0,614-0,785) 7 days CX3CR1 + HP 0,707 (0,622-0,792)
Claims
1. An in vitro or ex vivo method for determining the risk of occurrence of a nosocomial infection in a patient within a healthcare facility, comprising a step of measuring the expression of CX3CR1, in a biological sample from said patient.
2. The method according to claim 1, characterized in that the patient is a patient within a hospital, preferably within the emergency unit, the resuscitation unit, the intensive care unit or in an on-going care unit, more preferably a patient with sepsis, a burn patient, a trauma patient, or a surgical patient.
3. The method according to any one of claims 1 or 2, characterized in that it allows determining the risk of occurrence of a nosocomial infection in the patient within 15 days from the immuno-inflammatory attack and / or within 7 days following the day when the biological sample collection has been performed.
4. The method according to any of claims 1 to 3, characterized in that the biological sample is a blood sample.
5. The method according to any of claims 1 to 4, characterized in that the biological sample is a whole blood sample.
6. The method according to any of claims 1 to 5, characterized in that it further comprises a step of measuring, in the biological sample of the patient, the expression of another gene, selected from the list consisting of: ADGRE3, BTLA, CD3D, CD74, CD274, CTLA4, HP, ICOS, IFNG, IL1RN, IL6, IL7R, IL10, IL15, MDC1, PDCD1, S100A9, TDRD9 and ZAP70.
7. The method according to any of claims 1 to 6, characterized in that the expression is measured at the mRNA or protein level.
8. The method according to any of claims 1 to 7, characterized in that the expression is measured at the mRNA level.
9. The method according to any of claims 1 to 8, characterized in that the expression is measured by RT-PCR, preferably by RT-qPCR.
10. The method according to any of claims 1 to 8, characterized in that the expression is measured by sequencing.
11. The method according to any of claims 1 to 8, characterized in that the expression is measured by hybridization.
12. The method according to any of claims 9 to 11, characterized in that the expression is normalized with respect to the expression of one or several housekeeping genes.
13. A use: - of means for amplifying and / or means for detecting the expression of CX3CR1, or - of a kit comprising such amplification and / or detection means, to determine the risk of occurrence of a nosocomial infection in a patient.