Therapeutic nucleic acids and methods of use thereof
Patent Information
- Application Number
- EP2023873948
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-09-30
- Filing Date
- 2023-09-28
- Publication Date
- 2025-08-06
AI Technical Summary
Current treatments for muscle disorders, heart conditions, and inflammatory or fibrotic conditions are inadequate in effectively addressing the underlying pathologies and symptoms, particularly in conditions like muscular dystrophy and myocardial infarction.
Administration of a therapeutically effective amount of an isolated nucleic acid with a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC, which is RNA and no more than 60 nucleotides long, to modulate immune responses and reduce fibrosis and inflammation, either directly or through immunomodulation of macrophages.
The nucleic acid treatment demonstrates disease-modifying bioactivity by improving heart and skeletal muscle function, reducing fibrosis, and altering macrophage subtypes, thereby providing a therapeutic benefit for muscle disorders and heart conditions associated with inflammation and fibrosis.
Smart Images

Figure 1.1
Abstract
Description
THERAPEUTIC NUCLEIC ACIDS AND METHODS OF USE THEREOFINCORPORATION BY REFERENCE TO ANY PRIORITY APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 378009, filed September 30, 2022, which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED R&D
[0002] This invention was made with government support under Grant Nos. R01HL124074 and R01HL155346, awarded by the National Institutes of Health. The Government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING
[0003] The present application is being filed along with a Sequence Listing XML in electronic format. The Sequence Listing XML is provided as a file entitled CSMC021seqlist.xml, created September 20, 2023, which is 8,412 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.BACKGROUNDField
[0004] The present disclosure relates to therapeutic RNA, variants thereof, and treatment of muscle disorders and / or heart conditions and / or inflammatory conditions and / or fibrosis using same.SUMMARY
[0005] An isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) is provided. Also provided are nucleic acids having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to that of SEQ ID NO: 1. Also provided are therapeutic uses of nucleic acids of the present disclosure to treat a muscle disorder, heart condition, or conditions associated inflammation and / or fibrosis.
[0006] Provided herein is a method of treating a condition associated with inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and / or fibrosis a therapeutically effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nucleotides (nt) long.
[0007] Also provided is a method of treating a muscle disorder or symptom thereof, comprising administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
[0008] Provided herein is a method of immunomodulation, comprising contacting an effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) with a population of macrophages, wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
[0009] Also provided is a therapeutic composition comprising: a therapeutically effective amount of any of the isolated nucleic acid of the present disclosure; and a pharmaceutically acceptable excipient. Kits containing any of the isolated nucleic acid(s) of the present disclosure and a transfection reagent are also provided.BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIGs. 1A-1D show the proposed mechanism of action of the immunomodulatory effect of the non-coding RNA, tREX-1, and initial characterization of tREX-1 in vitro bioactivity according to some non-limiting embodiments of the present disclosure, according to some non-limiting embodiments of the present disclosure. FIG. 1 A is a schematic diagram showing a 5’ tRNA half and known bioactivity. FIG. IB is a collection of schematic diagrams showing a proposed mechanism of action of tREX-1, according to some non-limiting embodiments of the present disclosure. FIG. 1C is a heat map diagram showing transcriptome-wide changes in cultured macrophage gene expression. FIG. ID is a plot showing cultured macrophage gene expression changes grouped by gene ontology.
[0011] FIGs. 2A-2D show the disease-modifying bioactivity of tREX-1 in the heart in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure. FIG. 2A is a schematic diagram showing an experimental design. FIG. 2B is a plot showing change over time in ejection fraction as a measure of heart function. FIG. 2C is a collection of images showing Masson’s trichrome staining in the heart. FIG. 2D is a graph showing fibrosis in the heart.
[0012] FIGs. 3A-3E show the disease-modifying bioactivity of tREX-1 in skeletal muscle, in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure. FIG. 3A is a schematic diagram showing an experimental design. FIG. 3B is a plot showing change over time in tetanic torque from baseline as a measure of skeletal muscle function. FIG. 3C is a collection of images showing Masson’s trichrome staining in skeletal muscle (tibialis anterior). FIG. 3D is a graph showing fibrosis in in skeletal muscle. FIG. 3E is a graph showing the number of myofibers in the tibialis anterior.
[0013] FIG. 4 shows the effect of tREX-1 administration on serum inflammatory cytokine levels in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
[0014] FIG. 5 shows the effect of oral tREX- 1 administration in a model of acute myocardial infarction (MI), according to some non-limiting embodiments of the present disclosure.
[0015] FIG. 6 shows nucleotide sequences of tREX-1, tRNAs and a scrambled RNA for tREX-1, according to some non-limiting embodiments of the present disclosure.
[0016] FIGs. 7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted by cardio sphere-derived cells and initial characterization of tREX-1 in vitro bioactivity according to some non-limiting embodiments of the present disclosure. FIG 7A is a heat map diagram showing transcriptomic changes. FIG. 7B is a graph showing mapping of sequences to different RNA. FIG. 7C is a graph showing mapping of sequences to different tRNA. FIG. 7D is a sequence and a collection of graphs showing changes in gene expression levels in cultured macrophages. FIG. 7E is a plot showing cultured macrophage gene expression changes grouped by gene ontology. FIG. 7F is a plot showing cultured macrophage gene expression changes grouped by Kyoto Encyclopedia of Genes and Genomes.
[0017] FIGs. 8A-8F show the disease-modifying bioactivity of tREX-1 in the heart and in skeletal muscle in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure. FIG. 8A is a schematic diagram showing an experimental design. FIG. 8B is a collection of graphs showing change over time in ejection fraction as a measure of heart function. FIG. 8C is a collection of graphs showing change over time in tetanic torque as a measure of skeletal muscle function. FIG. 8D is a collection of images and a graph showing myocardial fibrosis. FIG. 8E is a collection of images and a graph showing muscle fibrosis. FIG. 8F is a graph showing the number of myofibers in the tibialis anterior.
[0018] FIG. 9 shows uptake of tREX-1 by cultured macrophages, according to some non-limiting embodiments of the present disclosure.
[0019] FIG. 10 shows identified tREX-1 protein binding partners, according to some non-limiting embodiments of the present disclosure.
[0020] FIG. 11 shows the effects of tREX-1 on cardiac macrophages in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
[0021] FIG. 12 shows the effects of tREX-1 on skeletal muscle macrophages in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
[0022] FIG. 13 shows that tREX-1 bioactivity is dependent on macrophages in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.DETAILED DESCRIPTION
[0023] Provided herein are nucleic acids that include the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), and methods of using the same for treatment of a condition associated with inflammation and / or fibrosis. The nucleic acids of the present disclosure are generally no more than 60 nucleotides (nt) long. Terms
[0024] As used herein the term “nucleic acid” or “oligonucleotide” refers to multiple nucleotides (e.g., molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substitutedpyrimidine (e.g. cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). The term includes polynuclcosidcs (i.c. a polynucleotide minus the phosphate) and any other organic base containing polymer. Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymidine, inosine, 5-methylcytosine, 2- aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. A nucleic acid can include any other suitable modifications. Thus, the term nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and / or sugars.
[0025] Polypeptide or nucleic acid molecules of the present disclosure may share a certain degree of sequence similarity or identity with the reference molecules (e.g., reference polypeptides or reference polynucleotides), for example, with art-described molecules (e.g., engineered or designed molecules or wild-type molecules). The term “identity” as known in the ail, refers to a relationship between the sequences of two or more polypeptides or polynucleotides, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between them as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g., “algorithms”). Identity of related peptides can be readily calculated by known methods. “% identity” as it applies to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Any suitable methods and computer programs for the alignment can be used. It is understood that identity depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation. Generally, variants of a particular polynucleotide or polypeptide have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described hereinand known to those skilled in the art. Such tools for alignment include those of the BLAST suite (Stephen F. Altschul, ct al (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”. Nucleic Acids Res. 25:3389-3402). Another popular local alignment technique is based on the Smith-Waterman algorithm (Smith, T. F. & Waterman, M. S. (1981) “Identification of common molecular subsequences.” J. Mol. Biol. 147:195-197.) A general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, S. B. & Wunsch. C. D. (1970) “A general method applicable to the search for similarities in the amino acid sequences of two proteins.” J. Mol. Biol. 48:443-453.). More recently a Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed that purportedly produces global alignment of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. Other tools are described herein, specifically in the definition of “identity” below.
[0026] The term “identity” refers to the overall relatedness between polymeric molecules, for example, between polynucleotide molecules (e.g. DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a suitable mathematical algorithm. For example, the percent identity between two nucleic acid sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk,A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects. Smith. D. W., cd., Academic Press. New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleic acid sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleic acid sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48: 1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
[0027] The term “Watson-Crick base-pairing”, or “base-pairing” refers to the formation of hydrogen bonds between specific pairs of nucleotide bases (“complementary base pairs”). For example, two hydrogen bonds form between adenine (A) and uracil (U), and three hydrogen bonds form between guanine (G) and cytosine (C). One method of assessing the strength of bonding between two polynucleotides is by quantifying the percentage of bonds formed between the guanine and cytosine bases of the two polynucleotides (“GC content”). In some embodiments, the GC content of bonding between two nucleic acids of a multimeric molecule (e.g., a multimeric mRNA molecule) is at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the GC content of bonding between two nucleic acids of a multimeric molecule (e.g., a multimeric mRNA molecule) is between 10% and 70%, about 20% to about 60%, or about 30% to about 60%. The formation of a nucleic acid duplex via bonding of complementary base pairs can also be referred to as “hybridization”. Generally, two nucleic acids sharing a region of complementarity are capable, under suitableconditions, of hybridizing (e.g., via nucleic acid base pairing) to form a duplex structure. A region of complementarity can vary in size. In some embodiments, a region of complementarity ranges in length from about 2 base pairs to about 100 base pairs. In some embodiments, a region of complementarity ranges in length from about 5 base pairs to about 75 base pairs. In some embodiments, a region of complementarity ranges in length from about 10 base pairs to about 50 base pairs. In some embodiments, a region of complementarity ranges in length from about 20 base pairs to about 30 base pairs.
[0028] “Isolated” as used herein with reference to an isolated biomolecule, e.g., a nucleic acid, has the ordinary and customary meaning to one of ordinary skill in the art in view of the present disclosure. An isolated biomolecule, e.g., an isolated nucleic acid, is generally in a non-natural environment, or in an environment that the biomolecule would otherwise not have been without human intervention of the biomolecule or its environment. In some embodiments, an isolated biomolecule is not inside a cell or an organism.
[0029] “Extracellular vesicle” or “EV” as used herein have their ordinary and customary meaning as understood by one of ordinary skill in the art, in view of the present disclosure. EVs include lipid bilayer structures generated by cells, and include exosomes, microvesicles, epididimosomes, argosomes, exosome-like vesicles, microparticles, promininosomes, prostasomes, dexosomes, texosomes, dex, tex, archeosomes and oncosomes.
[0030] “Micelle,” as used herein with reference to casein micelles, has its customary and ordinary meaning as understood by one of ordinary skill in the art, in view of the present disclosure. Casein micelles are colloidal particles that can include aggregates of one or more casein phosphoproteins (e.g., one or more, two or more, three or more, or all four of alpha si casein, alpha s2 casein, beta casein, and kappa casein). “Micelle” as used herein with reference to lipid micelles has its customary and ordinary meaning as understood by one of ordinary skill in the art, in view of the present disclosure.
[0031] “Subject,” as used herein refers to any vertebrate animal, including mammals and non-mammals. A subject can include primates, including humans, and nonprimate mammals, such as rodents, domestic animals or game animals. Non-primate mammals can include mouse, rat, hamster, rabbit, dog, fox, wolf, cat, horse, cow, pig, sheep, goat, camel, deer, buffalo, bison, etc. Non-mammals can include bird (e.g., chicken, ostrich, emu, pigeon), reptile (e.g., snake, lizard, turtle), amphibian (e.g., frog, salamander), fish (e.g., salmon, cod,pufferfish, tuna), etc. The terms, “individual,” “patient,” and “subject” are used interchangeably herein.
[0032] “Administering” as used herein can include any suitable routes of administering a therapeutic agent or composition as disclosed herein. Suitable routes of administration include, without limitation, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, cutaneous, injection or topical administration. Administration can be local or systemic.
[0033] As used herein, “treat” and “treatment” includes curing, improving, ameliorating, reducing the severity of, preventing, slowing the progression of, and / or delaying the appearance of a disease, condition and / or symptoms thereof.
[0034] A treatment can be considered “effective,” or “therapeutically effective” as used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response or outcome is induced e.g., by at least 2%, 3%. 4%, 5%, 10%, or more, following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g. exercise endurance. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (e.g., progression of the disease is halted). Treatment includes any treatment of a disease or condition in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease or condition, e.g., preventing a worsening of symptoms (e.g. pain or inflammation); or (2) relieving the severity of the disease or condition, e.g.. causing regression of symptoms. An effective amount for the treatment of a disease or condition means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease or condition. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response or outcome, (e.g. muscle function, mass, or volume, such as heart function, mass, or volume). One skilled in the art can monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters.
[0035] The term “effective amount” or “therapeutically effective amount” as used herein refers to the amount of a composition or an agent needed to alleviate at least one or more symptom of the disease or condition, and relates to a sufficient amount of therapeutic composition to provide the desired effect. The term “effective amount” or “therapeutically effective amount” can refer to an amount of a composition or therapeutic agent that is sufficient to provide a particular anti-inflammatory, anti-fibrotic, immunomodulatory, myoprotective and / or cardioprotective effect when administered to a typical subject. An effective amount as used herein, in various contexts, can include an amount sufficient to delay the development of a symptom of the disease or condition, alter the course of a symptom disease or condition (for example but not limited to, slowing the progression of a symptom of the disease or condition), or reverse a symptom of the disease or condition. In some embodiments, the therapeutically effective amount is administered in one or more doses of the therapeutic agent. In some embodiments, the therapeutically effective amount is administered in a single administration, or over a period of time in a plurality of doses.
[0036] As used herein, the phrase “physiologically compatible” and “pharmaceutically acceptable” are employed interchangeably herein to refer to those compounds, materials, compositions, and / or dosage forms which arc. within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0037] The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. The abbreviation, “e.g.” is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” The term “about” as used herein to, for example, define the values and ranges of molecular weights means that the indicated values and / or range limits can vary within ±20%, e.g., within ±10%, including within ±5%. The use of “about” before a number includes the number itself. For example, “about 5” provides express support for “5.” Numbers provided in ranges include overlapping ranges and integers in between; for example a range of 1-4 and 5-7 includes for example, 1-7, 1-6, 1-5, 2-5, 2-7, 4-7, 1, 2, 3, 4, 5, 6 and 7.NUCLEIC ACIDS
[0038] Provided herein is an isolated nucleic acid that includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), or a variant thereof. In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid includes a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%. 99% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). In some embodiments, the nucleic acid includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) with a sequence variation at up to 1, 2, 3, 4, or 5 positions in the nucleotide sequence. As used herein, a “position” within a nucleotide sequence or nucleic acid is defined relative to the 5’ end of the nucleotide sequence or nucleic acid. In some embodiments, the nucleotide sequence of the nucleic acid is UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), or a sequence variant thereof. In some embodiments, the nucleic acid has the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). As used herein, “tREX-1” refers to an RNA having the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1). The nucleic acid can be any suitable length. In some embodiments, the nucleic acid is or is about 32 nucleotides (nt) long. In some embodiments, the nucleic acid is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38. 39, 40. 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52. 53, 54. 55, 56, 57, 58, 59, 60 nt long, or longer. In some embodiments, the nucleic acid is at most 60 nt long. In some embodiments, the nucleic acid is at most 40 nt long. In some embodiments, the nucleic acid is 20-35 nt long, or 30-35 nt long. In some embodiments, the nucleic acid consists of, or consists essentially of the nucleotide sequence: UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
[0039] In some embodiments, the nucleic acid is derived from a human tRNA. In some embodiments, the nucleic acid is a 5’ fragment of a human tRNA. As used herein, a “5’ fragment” of a reference nucleic acid refers to a polynucleotide that includes at least the 5’ end of the reference nucleic acid, and may be truncated relative to the reference nucleic acid at the 3’ end. In some embodiments, a 5’ fragment of a human tRNA includes a 5’ half of the (full length) human tRNA. In some embodiments, the human tRNA is selected from TRE-CTC1- 7, TRE-CTC1-1, and TRE-CTC2-1. TRE-CTC1-7 (corresponding to Gene ID: 100189269),TRE-CTC1-1 (corresponding to Gene ID: 100189384), and TRE-CTC2-1 (corresponding to Gene ID: 100189409) each has a sequence as shown in FIG. 6.
[0040] A nucleic acid of the present disclosure can be single stranded or double stranded (e.g., RNA / DNA hybrid). In some embodiments, the nucleic acid is single stranded.
[0041] An isolated nucleic acid of the present disclosure in some embodiments includes one or more chemically-modified nucleotides, e.g., nucleotides with a modified backbone. In general, the chemical modification(s) is one that substantially preserves or enhances the therapeutic potency of the nucleic acid. Any suitable number of nucleotides of the nucleic acid can be chemically modified. In some embodiments, the nucleic acid includes 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more chemically-modified nucleotides. In some embodiments, the nucleic acid includes 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1- 15, 1-20, 1-25, or 1-30 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 1-10 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 8 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 6 chemically-modified nucleotides.
[0042] The chemically modified nucleotides can be distributed along the isolated nucleic acid in any suitable manner. In some embodiments, the nucleic acid includes at least one chemically-modified nucleotide within the first half of the nucleic acid, e.g., the 5’ half of the nucleic acid. In some embodiments, the nucleic acid includes at least one chemically- modified nucleotide within the second half of the nucleic acid, e.g., the 3’ half of the nucleic acid. In some embodiments, the nucleic acid includes at least one chemically-modified nucleotide within the first half of the nucleic acid, e.g., the 5’ half of the nucleic acid, and at least one chemically-modified nucleotide within the second half of the nucleic acid, e.g., the 3’ half of the nucleic acid. In some embodiments, the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 5’ end of the nucleic acid. In some embodiments, the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 3’ end of the nucleic acid. In some embodiments, no two chemically-modified nucleotidesare adjacent each other in the nucleic acid. In some embodiments, the nucleic acid includes 1 , 1, 2, 2, 3, 3, 4, 4, 5, 5 chcmically-modificd nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 5’ end of the nucleic acid. In some embodiments, the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 3’ end of the nucleic acid. In some embodiments, the nucleic acid includes the same number of chemically-modified nucleotides in the 5’ half and 3 ’half of the nucleic acid. In some embodiments, the nucleic acid includes a different number of chemically-modified nucleotides in the 5’ half and 3 ’half of the nucleic acid. In some embodiments, the nucleic acid includes a greater number of chemically-modified nucleotides in the 3’ half than in the 5 ’half of the nucleic acid. In some embodiments, the nucleic acid includes a greater number of chemically-modified nucleotides in the 5’ half than in the 3 ’half of the nucleic acid. In some embodiments, the nucleic acid includes 3 chemically- modified nucleotides within 5 nucleotides from the 5’ end of the nucleic acid and / or 3 chemically-modified nucleotides within 5 nucleotides from the 3’ end of the nucleic acid.
[0043] In some embodiments, the chemically-modified nucleotide(s) increases in vitro and / or in vivo stability of the nucleic acid. In some embodiments, the chemically- modified nucleotide(s) increases therapeutic potency of the nucleic acid, e.g., for treating an inflammatory condition, cardiac injury, or muscular dystrophy.
[0044] The isolated nucleic acid in some embodiments includes one type, or two or more different types of chemically-modified nucleotides. In some embodiments, the chemically-modified nucleotide has a methylene bridge connecting the 2’-0 atom and the 4’- C atom of the nucleotide sugar ring to lock the conformation (Locked Nucleic Acid (LNA)).
[0045] The isolated nucleic acid, in some embodiments, can include any suitable chemical modification. In some embodiments, the chemical modification is a backbone modification, e.g., modification of the sugar / phosphate backbone. In some embodiments, the chemical modification is a backbone sugar modification. In some embodiments, the chemically modified nucleotide includes a LNA. In some embodiments, the chemical modification includes the introduction of a phosphorothioate group as linker between nucleotides. Suitable backbone modifications of the chemically-modified nucleotides include, without limitation, phosphorothioates, phosphotriesters, methyl phosphonates, short chainalkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. In some embodiments, the chemical modification is a base modification.
[0046] The nucleic acids of the present disclosure can be prepared using any suitable option. Suitable options include, without limitation, chemical synthesis, enzymatic production and / or biological production. In some embodiments, the nucleic acids are prepared using chemical synthesis. Any suitable option for chemical synthesis of nucleic acids can be used. Suitable options include, without limitation, phosphodiester, phosphotriester, phosphoramidite, phosphite-triester, and solid phase synthesis approaches. In some embodiments, preparing the nucleic acids includes in vitro transcription. In some embodiments, the nucleic acids are prepared using recombinant DNA technology. In some embodiments, the nucleic acids are prepared by chemically modifying an unmodified nucleic acid having a nucleotide sequence of interest.COMPOSITIONS
[0047] Also provided herein are compositions that include the nucleic acid of the present disclosure. In some embodiments, the composition is a pharmaceutical or therapeutic composition. In some embodiments, the composition includes a therapeutically effective amount of the nucleic acid. In some embodiments, the therapeutically effective amount of the nucleic acid is an amount that, when administered to a subject, can bring about a desired outcome in the subject in need of treatment of a condition or disease (e.g., a condition associated with inflammation and / or fibrosis, a muscle disorder or symptom thereof, etc.) as described herein. In some embodiments, the therapeutically effective amount of the nucleic acid is sufficient on its own to bring about the desired outcome (e.g., without administering another therapeutic agent for the same condition or disease). In some embodiments, the composition contains a nucleic acid that includes a nucleotide sequence about 25 to about 35 nt long that is part of a tRNA, where the tRNA is selected from the group consisting of: TRE- CTC1-7, TRE-CTC1-1, and TRE-CTC2-1. In some embodiments, the composition does not include another nucleic acid that includes a nucleotide sequence about 25 to about 35 nt long that is part of a tRNA (e.g., does not include a nucleotide sequence of a 5’ fragment of a tRNA other than TRE-CTC1-7). In some embodiments, the composition does not include another nucleic acid that includes a nucleotide sequence about 30-32 nt long that is derived from atleast one of: TRG-GCC1 -2 (corresponding to Gene ID: 100189252), TRG-GCC4-1 (corresponding to Gene ID: 100189274). In some embodiments, the composition docs not include another nucleic acid that includes a nucleotide sequence about 30-32 nt long that is the 5’ fragment of TRG-GCC1-2 or TRG-GCC4-1.
[0048] In some embodiments the composition includes a pharmaceutically acceptable excipient. In some embodiments, the composition consists of, or consists essentially of the therapeutically effective amount of the isolated nucleic acid and the pharmaceutically acceptable excipient. In some embodiments, the composition is a cell-free composition, e.g., the composition is substantially free of cells such as CDC. In some embodiments, the composition is an extracellular vesicle-free composition, e.g., the composition is substantially free of extracellular vesicles, such as exosomes.
[0049] Some non-limiting examples of materials which can serve as pharmaceutically-acceptable excipients include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations.
[0050] In some embodiments, the composition includes a transfection reagent, e.g., to promote delivery of the nucleic acid to a target cellular target (in vitro or in vivo). Any suitable transfection reagent can be included in the composition. Suitable transfection reagents include, without limitation, a liposome, extracellular vesicle (EV), and a polyethylene glycol(PEG)-cationic lipid complex (PCLC). In some embodiments, the transfection reagent includes a lipid (e.g., a liposome-forming lipid), or a PEGylatcd lipid. In some embodiments, the lipid is a cationic lipid, as provided herein. In some embodiments, the transfection reagent includes DharmaFECT® or Lipofectamine®. In some embodiments, the nucleic acid of the present disclosure is formulated with the transfection reagent in the composition so as to promote cellular uptake and / or pharmacokinetics of the nucleic acid.
[0051] Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of pharmaceutical formulations. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV), which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV), which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV), which may be between 50 and 500 nm in diameter. Liposome design may include, without limitation, opsonins or ligands in order to improve the attachment of liposomes to target tissue / cells, or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or a high pH in order to improve the delivery of the cargo, e.g., a nucleic acid of the present disclosure.
[0052] In some embodiments, the composition includes, without limitation, liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), l,2-dilinoleyloxy-3- dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]- dioxolane (DLin-KC2-DMA), and MC3 and liposomes such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).
[0053] In some embodiments, the composition includes a cationic lipid. Any suitable cationic lipid may be used in the present compositions. Suitable cationic lipids include, without limitation, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids. In some embodiments, the composition includes a cationic lipid complex, e.g., a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the cationic lipid is PEGylated, e.g., 2 kDa PEG (“PEG2000”). Any suitable option can be used to PEGylate the cationic lipid. In some embodiments, PCLC is formed by exposing a mixture of PEG and the cationic lipid to one or more freeze / thaw cycles, e.g., 1, 2,3, 4, 5 or more freeze / thaw cycles. In some embodiments, a freeze / thaw cycle includes freezing the mixture with liquid nitrogen (e.g., around -190 °C) for about 5 minutes, and thawing at about 60 °C for about 5 minutes. A nucleic acid of the present disclosure can be mixed with the PCLC to generate a complex of the nucleic acid and the PCLC.
[0054] In some embodiments, the composition includes extracellular vesicles (EV), e.g., exosomes. The extracellular vesicles (EV) can be those from any suitable source, e.g., EV derived from cardiosphere-derived cells (CDC), or from fibroblasts. Suitable EV, such as CDC-derived EV, are provided in, e.g., U.S. Application Publication Nos. 20080267921, 20160158291 and 20160160181; Smith et al., Circulation. 2007. 115:896-908; Aminzadeh, M. A. et al. Stem Cell Reports 10, 942-955 (2018); and Ibrahim et al., Stem Cell Reports. 2014 May 8;2(5):606-19, Ibrahim, A. G. et al. Nanomedicine 33, 102347 (2020), each of which is incorporated by reference in its entirety. In some embodiments, the EVs are those isolated from serum-free media conditioned by human CDCs in culture. In some embodiments, the composition includes EV and liposomes and / or PCLC as transfection reagents. In some embodiments, the composition is substantially free of CDC-derived EV.
[0055] EVs, e.g., exosomes, disclosed herein can vary in size, depending on the embodiment. Depending on the embodiment, the size of the EVs ranges in diameter from about 15 nm to about 95 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 95 nm, and overlapping ranges thereof. In several embodiments, EVs are larger (e.g., those ranging from about 140 to about 210 nm, including about 140 nm to about 150 nm, about 150 nm to about 160 run, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, 190 nm to about 200 nm, about 200 nm to about 210 nm, and overlapping ranges thereof). In some embodiments, the EV diameter is in a range of about 15 nm to about 200 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 100 nm, about 100 nm to about 110 nm, about 110 nm to about 120 nm, about 120 nm to about 130 nm, about 130 nm to about 140 nm, about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170nm to about 180 nm, about 180 nm to about 190 nm, about 190 nm to about 200 nm, and overlapping ranges thereof. In some embodiments, the EVs that arc generated from the original cellular body are 100, 200, 300. 400, 500, 600, 700. 800, 900, 1,000, 2,000. 5,000, or 10,000 times smaller in at least one dimension (e.g., diameter) than the original cellular body.
[0056] The composition containing the EV and nucleic acid of the present disclosure can be prepared using any suitable option. In some embodiments, loading the nucleic acid into the EV includes: formulating the nucleic acid with liposomes and / or PCLC, e.g.. as provided above, to generate a nucleic acid-liposome mixture; combining the nucleic acid-liposome mixture with the EV; and enriching for EV associated with exosome markers to generate a population of EV enriched for the nucleic acid. Combining the nucleic acidliposome mixture with the EV can be done using any suitable option. In some embodiments, the nucleic acid-liposome mixture is combined with the EV at 37 °C with shaking for about 30 minutes or more. Enriching to generate a population of EV enriched for the nucleic acid can be done using any suitable option. In some embodiments, enriching for EV associated with exosome markers includes immunoprecipitating EV associated with exosome markers using antibodies specific to an exosome marker. In some embodiments, the exosome marker is one or more of CD9, CD63 and CD81. In some embodiments, enriching for EV associated with exosome markers includes immunoprecipitating EV associated with all the exosome markers, CD9, CD63 and CD81. In some embodiments, the size distribution of the population of EV enriched for the nucleic acid is substantially unimodal. In some embodiments, at least 80%, 85%, 90%, 95%, 97%, 99% of the population has a diameter under a single peak in the size distribution. In some embodiments, the population of EV enriched for the nucleic acid has an average diameter of about 50-180 nm, e.g., 60-170 nm, 70-160 nm, 80-150 nm, 90-140 nm, 100-130 nm, or about 110-130 nm.
[0057] In some embodiments, the composition includes casein, e.g., a casein micelle. In some embodiments, the composition includes chitosan. In some embodiments, the composition includes casein and chitosan, e.g., a casein-chitosan micelle. In some embodiments, the composition includes a casein-chitosan complex. In some embodiments, the isolated nucleic acid in the composition is encapsulated in a casein-chitosan complex. In some embodiments, the composition includes one or more of phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the composition includes twoor more, three or more, or all four phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein. The phosphoprotcins may be present in the composition at any suitable concentration (relative to each other, and relative to the total volume of the composition), and in some embodiments, is present in an amount suitable for forming casein micelles. In some embodiments, the casein phosphoproteins are collectively present in the composition at about 5-10 % (weight by volume). In some embodiments, the casein phosphoproteins are collectively present in the composition at about 8 % (weight by volume). In some embodiments, the casein phosphoproteins are collectively present in the composition at about 5 % (weight by volume). The casein phosphoproteins can be those from any suitable animal, e.g., mammal such as, but not limited to, human, non-human primate, cow, pig, horse, camel, goat, and sheep. In some embodiments, the casein phosphoproteins are bovine alpha si casein, alpha s2 casein, beta casein, and kappa casein. Suitable casein formulations with EV are provided in, e.g., Aminzadeh et al., J Extracell Vesicles. 2021 Jan;10(3):el2045, the entirety of which is incorporated herein by reference. In some embodiments, a composition, e.g., pharmaceutical composition, of the present disclosure formulated with casein, as provided herein, is suitable for oral administration to the subject. Suitable oral formulations for the nucleic acids of the present disclosure are provided in, e.g., International Application Nos. PCT / US2022 / 035866 (filed June 30, 2022) and PCT / US2022 / 035870 (filed June 30, 2022), each of which is incorporated herein by reference in its entirety. In some embodiments, an oral formulation of the present disclosure includes any one or more nucleic acids described herein; a cationic lipid; at least one casein protein; and a chitosan. In some embodiments, the oral formulation includes an isolated nucleic acid that includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1); a cationic lipid; at least one casein protein; and a chitosan. In some embodiments, an oral formulation includes an artificial lipid micelle or a liposome; any one or more nucleic acids described herein, wherein the one or more nucleic acids is encapsulated within the artificial lipid micelle or the liposome; and a coating on the artificial lipid micelle or the liposome, wherein the coating comprises a mixture of casein proteins and chitosan polymers. In some embodiments, an oral formulation includes an artificial lipid micelle or a liposome; an isolated nucleic acid that includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is encapsulated within the artificial lipid micelle orthe liposome; and a coating on the artificial lipid micelle or the liposome, wherein the coating comprises a mixture of casein proteins and chitosan polymers. In some embodiments, the artificial lipid micelle includes a cationic lipid micelle. In some embodiments, the liposome includes cationic lipids. In some embodiments, the liposome includes DharmaFECT® or Lipofectamine® .
[0058] In some embodiments, the composition is in a parenteral dosage form. In some embodiments, the parenteral dosage form is sterile or capable of being sterilized before administering to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration to a subject. Suitable excipients that can be used to provide parenteral dosage forms of the nucleic acid include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
[0059] In some embodiments, the composition includes an antisense oligonucleotide, such as those targeting one or more exons of a dystrophin transcript. In some embodiments, the composition includes an antisense oligonucleotide that includes an exonskipping agent that targets a dystrophin transcript.METHODS
[0060] Provided herein are methods of treating a subject in need thereof using the nucleic acids of the present disclosure (also referred to herein as “treatment methods”). Conditions that may be treated by the treatment methods include, without limitation, muscle disorders, heart conditions, fibrotic conditions, and inflammatory conditions. In some embodiments, the conditions include, without limitation, muscular- disorders, myocardial infarction, cardiac disorders, myocardial alterations, muscular dystrophy, fibrotic disease,inflammatory disease, viral infection, sepsis or wound healing. Tn some embodiments, the conditions include acute myocardial infarction. In some embodiments, conditions treated by the treatment methods include, without limitation, conditions associated with inflammation and / or fibrosis. In some embodiments, a subject treated by administering the nucleic acids of the present disclosure, according to the treatment methods herein, are in need of treatment for conditions associated with inflammation and / or fibrosis. The conditions associated with inflammation and / or fibrosis can include, without limitation, inflammation and / or fibrosis of the heart or skeletal muscle. In some embodiments, the conditions treated by the present treatment methods are a symptom and / or sequelae of an infection. In some embodiments, the infection is a viral infection, e.g., a respiratory virus infection, such as COVID-19, infections due to other coronaviruses, or other viral pathogens (e.g., flu, H1N1. Hepatitis C. HIV, etc.). In some embodiments, the method includes identifying a subject having or diagnosed with a muscle disorder, heart condition, or inflammatory condition, as described herein, and administering a therapeutically effective amount of the nucleic acids of the present disclosure to the subject.
[0061] A treatment method of the present disclosure can include administering to a subject in need of treatment a therapeutically effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein) to thereby treat the subject. In some embodiments, a method of treating a muscle disorder or symptom thereof includes administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein), thereby treating the muscle disorder or symptom thereof. In some embodiments, the muscle disorder comprises a skeletal muscle disorder and / or a heart condition. In some embodiments, the muscle disorder comprises muscular dystrophy (e.g., Duchenne muscular dystrophy). In some embodiments, a method of treating muscular dystrophy (e.g., Duchenne muscular dystrophy) further includes administering a second therapy (e.g., an exon-skipping agent and / or gene therapy) for the muscle disorder. In some embodiments, an exon-skipping agent includes an antisense oligonucleotide that targets a dystrophin transcript. In some embodiments, the heart condition includes myocardial infarction, heart failure, or a symptom or sequelae thereof (e.g., reduced heart function, cardiac tissue fibrosis, etc.). In some embodiments, the heart condition includes acute myocardialinfarction. In some embodiments, heart function includes left ventricle function, which can be represented by any suitable option such as, without limitation, ejection fraction. In some embodiments, the method includes identifying a subject having or diagnosed with a muscle disorder or symptom thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject having or diagnosed with muscular dystrophy (e.g., Duchenne muscular dystrophy) or a symptom thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject having or diagnosed with heart failure, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject who is at risk of, or has suffered myocardial infarction, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject who is at risk of, or has suffered acute myocardial infarction, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
[0062] In some embodiments, a method of treating a condition associated with inflammation and / or fibrosis includes administering to a subject in need of treating a condition associated with inflammation and / or fibrosis a therapeutically effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein), thereby treating the condition associated with inflammation and / or fibrosis. In some embodiments, the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart or skeletal muscle, or a symptom and / or sequelae of myocardial infarction, heart failure or muscular dystrophy, or a symptom or sequelae of an infectious disease (e.g., a viral infection) or is associated with immunotherapy, or a symptom or sequelae of an infectious disease, idiopathic pulmonary fibrosis or cirrhosis of the liver. In some embodiments, the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart. In some embodiments, the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of skeletal muscle. Insome embodiments, the condition associated with inflammation and / or fibrosis comprises a symptom and / or sequelae of myocardial infarction or heart failure (c.g., reduced heart function, cardiac tissue fibrosis, etc.). In some embodiments, the condition associated with inflammation and / or fibrosis comprises a symptom and / or sequelae of muscular dystrophy (e.g., reduced muscle function, tissue fibrosis, etc.). In some embodiments, the method includes identifying a subject having or diagnosed with inflammation and / or fibrosis of the heart, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
[0063] In some embodiments, the subject is a subject who has or has suffered heart failure. In some embodiments, the subject is a subject who has or has suffered myocardial infarction. In some embodiments, the subject is a subject who has or has suffered acute myocardial infarction. In some embodiments, the subject is at risk of having heart failure and / or myocardial infarction (e.g., acute myocardial infarction). In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject prevents reduction in ejection fraction due to heart failure. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject prevents reduction in ejection fraction after myocardial infarction (e.g., acute myocardial infarction). In some embodiments, the subject’s ejection fraction does not substantively decrease due to heart failure or myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject. In some embodiments, the subject’s ejection fraction does not substantively decrease due to acute myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject. In some embodiments, the subject’s ejection fraction does not decrease, or decreases by, by about, or by at most 1, 2, 3, 4, 5%, or by a percentage in a range defined by any two of the preceding values (e.g., 0-5%, 0-3%, 1-4%, etc.) due to heart failure or myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject. In some embodiments, the subject’s ejection fraction does not decrease, or decreases by, by about, or by at most 1, 2, 3, 4, 5%, or by a percentage in a range defined by any two of the preceding values (e.g., 0-5%, 0-3%, 1-4%, etc.) due to acute myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject. In some embodiments, the subject’s ejection fraction increases after administering the therapeutically effective amount of the nucleic acid to the subject, where the subject hassuffered heart failure and / or myocardial infarction. Tn some embodiments, the subject’s ejection fraction increases after administering the therapeutically effective amount of the nucleic acid to the subject, where the subject has suffered acute myocardial infarction. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces myocardial fibrosis due to heart failure and / or myocardial infarction. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces myocardial fibrosis due to acute myocardial infarction.
[0064] In some embodiments, the subject has or is predisposed to having muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, the subject is genetically predisposed to having muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, the method includes identifying a subject who is predisposed to having muscular dystrophy, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject. In some embodiments, the subject has one or more mutations in a dystrophin gene that predisposes the subject to developing muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject prevents or attenuates the reduction in skeletal muscle function e.g., the force or torque exerted by a skeletal muscle group, due to muscular dystrophy. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject suffering from muscular dystrophy increases or restores skeletal muscle function e.g., the force or torque exerted by an affected skeletal muscle group. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject suffering from muscular dystrophy increases the force or torque exerted by an affected skeletal muscle group by, by about, or by at least 5, 7, 10, 12, 15, 17, 20%, or by a percentage defined by any two of the preceding values (e.g., 5-20%, 5-15%, 7- 17%, etc.), compared to before administering. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces skeletal muscle fibrosis due to muscular dystrophy. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces the percentage of skeletal muscle fibrosis due to muscular dystrophy by, by about, or by at least 2, 5, 7, 10, 12, or 15 percentage points, or by a percentage point in a range defined by any two of the preceding values (e.g., 2- 15%, 5-15%, 10-12%, 7-15%, etc.) compared to a suitable reference (e.g., an averagepercentage of skeletal muscle fibrosis due to muscular dystrophy in a subject who does not receive the therapeutically effective amount of the nucleic acid). In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases myofiber number in skeletal muscle. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases myofiber number in skeletal muscle by, by about, or by at least 5, 10, 12, 15, 18, 20, 25%, or by a percentage in a range defined by any two of the preceding values (e.g., 5-25%, 10-20%, 12018%, 10-15%, etc.) compared to before the administering. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases skeletal muscle mass or volume. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases skeletal muscle mass or volume by, by about, or by at least 5, 10, 12, 15, 18, 20, 25%, or by a percentage in a range defined by any two of the preceding values (e.g.. 5-25%, 10-20%. 12018%, 10-15%, etc.) compared to before the administering.
[0065] In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject alters the composition of macrophage subtypes in a muscle tissue, e.g., in skeletal muscle or cardiac muscle. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject increases the number and / or abundance of CD68+ / CD206+ cells in a muscle tissue, e.g., skeletal muscle, compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide, etc.). In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject increases the number and / or abundance of CD68+ / CD206+ cells in a muscle tissue, e.g., skeletal muscle, by, by about, or by at least 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4. 4.5, 5 fold, or by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-5 fold, 1.5-4.5 fold, 2-4 fold, 1.2-5 fold, etc.), compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide, etc.). In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject increases the number and / or abundance of CD68+ / CD206+ cells in a muscle tissue, e.g., skeletal muscle, compared to a suitable control. In some embodiments, the number and / or abundance of CD68+ / CD206+ cells in a muscletissue, e.g., in skeletal muscle or cardiac muscle, is determined relative to the number and / or abundance of CD68+ / CD206- cells in the same tissue. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces the number and / or abundance of CD68+ / CD206+ cells in a muscle tissue, e.g., cardiac muscle, compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide, etc.). In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces the number and / or abundance of CD68+ / CD206+ cells in a muscle tissue, e.g., cardiac muscle, by, by about, or by at least 0.1, 0.2, 0.3, 0.4 or 0.5 fold, or by a fold amount in a range defined by any two of the preceding values (e.g., 0.1-0.5 fold, 0.1-0.4 fold, 0.2-0.4 fold, 0.1-0.3 fold, etc.), compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide). In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces the number and / or abundance of CD68+ / CD206+ cells in a muscle tissue, e.g., cardiac muscle, compared to a suitable control. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject does not alter the number and / or abundance of CD68+ / C8O+ cells in a muscle tissue, e.g., in skeletal muscle or cardiac muscle. In some embodiments, the number and / or abundance of CD68+ / CD80+ cells in a muscle tissue, e.g., in skeletal muscle or cardiac muscle, is determined relative to the number and / or abundance of CD68+ / CD8O- cells in the same tissue.
[0066] The nucleic acid can be administered to the subject at any suitable amount. In some embodiments, the therapeutically effective amount of the nucleic acid includes about 0.01 pg, 0.02 pg, 0.05 pg, 0.1 pg, 0.2 pg. 0.5 pg, 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg. 7 pg, 8 pg, 9 pg, 10 pg, 15 pg, 20 pg, 25 pg, 30 pg, 40 pg, 50 pg, 75 pg, 100 pg, 125 pg, 150 pg, 175 pg, 200 pg, 250 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 30 mg, 40 mg, 50 mg, 75 mg, 100 mg or more, or an amount in a range defined by any two of the preceding values (e.g., 0.01 pg-0.1 pg, 0.1 pg-1 pg, 1 pg-10 pg, 10 pg-100 pg, 100 pg-1 mg, 1 mg-lOmg, lOmg-lOOmg). In some embodiments, the therapeutically effective amount of the nucleic acid includes about 0.001 pg / g, 0.002 pg / g, 0.005 pg / g, 0.01 pg / g, 0.02 pg / g, 0.05 pg / g, 0.1 pg / g, 0.15 pg / g, 0.2 pg / g, 0.5 pg / g, 1 pg / g, 2 pg / g, 3 pg / g. 4 pg / g, 5 pg / g, 6 pg / g, 7 pg / g, 8 pg / g. 9 pg / g, 10 pg / g, 15 pg / g, 20 pg / g, 25 pg / g, 30 pg / g, 35 pg / g, 40 pg / g, 45 pg / g, 50 pg / g, 60 pg / g, 70 pg / g, 80 pg / g,90 g / g, 100 pg / g of body weight, or more, or an amount in a range defined by any two of the preceding values (e.g., 0.001 pg / g-0.01 pg / g, 0.01 pg / g-0.1 pg / g, 0.1 pg / g-1 pg / g, 1 pg / g-10 pg / g, 10 pg / g-100 pg / g). In some embodiments, the therapeutically effective amount of the nucleic acid is about 0.001 pg / g, 0.002 pg / g, 0.005 pg / g, 0.01 pg / g, 0.02 pg / g, 0.05 pg / g, 0.1 pg / g, 0.2 pg / g, 0.5 pg / g, or about 1 pg / g of body weight, or more, or an amount in a range defined by any two of the preceding values (e.g., 0.001 pg / g-0.01 pg / g, 0.01 pg / g-0.05 pg / g, 0.05 pg / g-0.1 pg / g, 0.1 pg / g-0.2 pg / g, 0.2 pg / g-0.5 pg / g, or 0.5 pg / g-1 pg / g). In some embodiments, the therapeutically effective amount of the nucleic acid includes about 0.001 mg / kg, 0.002 mg / kg, 0.005 mg / kg, 0.01 mg / kg, 0.02 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg of body weight, or more, or an amount in a range defined by any two of the preceding values (e.g., 0.001 mg / kg- 0.01 mg / kg, 0.01 mg / kg-0.1 mg / kg, 0.1 mg / kg-1 mg / kg, 1 mg / kg-10 mg / kg, 10 mg / kg-100 mg / kg). In some embodiments, the therapeutically effective amount of the nucleic acid is about 0.001 mg / kg, 0.002 mg / kg, 0.005 mg / kg, 0.01 mg / kg, 0.02 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.5 mg / kg, or about 1 mg / kg of body weight, or more, or an amount in a range defined by any two of the preceding values (e.g., 0.001 mg / kg-0.01 mg / kg, 0.01 mg / kg- 0.05 mg / kg, 0.05 mg / kg-0.1 mg / kg, 0.1 mg / kg-0.2 mg / kg, 0.2 mg / kg-0.5 mg / kg, or 0.5 mg / kg- 1 mg / kg).
[0067] In any method of the present disclosure, in some embodiments, the therapeutically effective amount of the nucleic acid is sufficient on its own to bring about the desired outcome (e.g., without administering another therapeutic agent for the same condition or disease). In any method of the present disclosure, in some embodiments, the method does not include administering another nucleic acid that includes a nucleotide sequence about 25 to about 35 nt long that is part of a tRNA (e.g., does not include a nucleotide sequence that is the 5’ fragment of TRE-CTC1-7). In any method of the present disclosure, in some embodiments, the method does not include administering another nucleic acid that includes a nucleotide sequence about 30-32 nt long that is derived from at least one of: TRE-GCC1-2, TRE-GCC4- 1. In any method of the present disclosure, in some embodiments, the method does not include administering another nucleic acid that includes a nucleotide sequence about 30-32 nt long thatis the 5’ fragment of TRE-GCC1 -2 or TRE-GCC4-1 . In any method of the present disclosure, in some embodiments, the method includes administering a therapeutically effective amount of a composition that consists of, or consists essentially of the isolated nucleic acid and a pharmaceutically acceptable excipient. In some embodiments, the method includes administering a therapeutically effective amount of a cell-free composition (e.g., a composition substantially free of cells such as CDC) that includes the isolated nucleic acid. In some embodiments, the method includes administering a therapeutically effective amount of an extracellular' vesicle-free composition (e.g., a composition substantially free of extracellular vesicles such as exosomes) that includes the isolated nucleic acid.
[0068] The nucleic acid or composition can be administered to the subject at any suitable dosing schedule. In some embodiments, the therapeutically effective amount of the nucleic acid or the composition is administered to the subject no more frequently than three time a week, twice a week, once a week (QW), once every two weeks (Q2W), once every month (QM), once every two months (Q2M), once every three months (Q3M), once every four months (Q4M) or longer, or at a frequency in a range defined by any two of the preceding values (e.g., three times a week to once every four months (Q4M), twice a week to once every two months (Q2M), or twice a week to once a month (QM)). In some embodiments, the nucleic acid is administered to the subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more times, or a number of times in a range defined by any two of the preceding values (e.g., 1-30 times, 2-20 times, 5-15 times, 1-20 times, etc.). In some embodiments, the nucleic acid is administered to the subject at regular intervals. In some embodiments, the nucleic acid is administered to the subject chronically.
[0069] The nucleic acid or composition can be administered using any suitable route. Administration can be local or systemic. In some embodiments, administration is parenteral. Suitable option for administration include, without limitation, intravenous, intramuscular, subcutaneous, intra-arterial, intraperitoneal, or oral administration. In some embodiments, the nucleic acid or composition is administered orally. In some embodiments, the nucleic acid or composition is administered by oral gavage. In some embodiments, the nucleic acid or composition is administered intravenously. In some embodiments, the nucleic acid or composition is administered by infusion.
[0070] Also provided herein is a method of immunomodulation (“immunomodulation method”). The immunomodulation method can include contacting an effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein), with a population of macrophages, e.g., human macrophages. In some embodiments, the contacting comprises administering to a subject in need of treating a condition characterized by inflammation and / or fibrosis an effective amount of the nucleic acid or the composition. In some embodiments, contacting the effective amount of the nucleic acid of the present disclosure with a population of macrophages increases expression of one or more anti-inflammatory cytokines. In some embodiments, contacting the effective amount of the nucleic acid of the present disclosure with a population of macrophages increases expression of IL-10, IL-la, and / or ARG-1 in the population of macrophages. In some embodiments, contacting the effective amount of the nucleic acid of the present disclosure with a population of macrophages increases expression of IL- 10, IL-la, and / or ARG-1 in the population of macrophages by, by about, or by at least 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5. 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10 fold, or by a fold amount in a range defined by any two of the preceding values (e.g., 1.1- 10 fold, 1.5-9 fold, 2-8 fold, 1.2-5 fold, etc.). In some embodiments, expression of IL-10, IL-la, and / or ARG-1 is mRNA expression of IL-10, IL-la, and / or ARG- 1.
[0071] In some embodiments, the contacting is done in vitro, e.g., in culture. In some embodiments, after contacting the macrophages in vitro, the method includes administering the macrophages to a subject in need of treating a muscle disorder, a heart condition, fibrosis, an inflammatory condition, as described herein.KITS
[0072] Also provided herein are kits that include the nucleic acid or a composition of the present disclosure. The present kit in some embodiments finds use in treating a muscle disorder, a heart condition, fibrosis, an inflammatory condition (e.g., associated with a muscle disorder, or a viral infection), as provided herein. A kit can include the nucleic acid of the present disclosure and a transfection reagent. The transfections reagent can be any suitable transfection reagent, as provided herein. In some embodiments, the transfection reagent includes one or more of a lipid (e.g., a liposome-forming lipid), a PEGylated lipid, and anextracellular vesicle. In some embodiments, the kit includes a pharmaceutically acceptable excipient, as provided herein. In some embodiments, the kit includes casein and / or chitosan. In some embodiments, the kit includes an antisense oligonucleotide, such as, without limitation, an exon-skipping agent that targets a dystrophin transcript. Kits can include one or more containers (e.g., vials, ampoules, test tubes, flasks or bottles) for holding one or more components of the kits. The kits may further include instructions for using the kit to treat a condition (e.g., muscular dystrophy, heart failure, myocardial infarction, or an inflammatory condition associated therewith, or an inflammatory condition associated with a viral infection). The information and instructions may be in the form of words, pictures, or both, and the like.Additional Embodiments
[0073] Additional non-limiting embodiments of the present disclosure are provided below.
[0074] Cardiosphere-derived cells (CDCs) are cardiac progenitor / stromal cells with immunomodulatory, anti-fibrotic, and pro-regenerative properties. These therapeutic actions antagonize crucial pathways central to the pathology of Duchenne muscular dystrophy (DMD). Without being bound to theory, mechanistic studies in preclinical models demonstrate CDCs work indirectly by secreting extracellular vesicles (CDC-EVs), which are lipid nanoparticles laden with a rich repertoire of bioactive molecules. Inventories of CDC-EV contents, generated by RNA-sequencing, now serve as Rosetta stones to decipher and exploit the complex biology of EVs. In CDC-EVs, the largest percentage of mapped reads are transfer RNA (tRNA) fragments. These molecular entities were previously thought to be nonspecific degradation products, but they are increasingly recognized as comprising a novel class of small ncRNAs with potential therapeutic bioactivity. In CDC-EVs, a species comprising the 5’ half of one specific tRNA is particularly plentiful. This entity, tREX-1, was tested in mdx mice (see Examples below). When created synthetically and packaged in a transfection reagent, tREX-1 has disease-modifying bioactivity: key disease manifestations of DMD, including structural and functional abnormalities in the heart and skeletal muscle, are partially and significantly reversed by tREX-1 intravenous infusion twice weekly for 4 weeks. Thus, tREX-1 represents a new class of defined ncRNAs mined from CDC-EVs.
[0075] Non-limiting embodiments of the present disclosure are further provided in the following numbered arrangements.1. An isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long, or is at most 40 nt long.2. An isolated nucleic acid comprising a nucleotide sequence at least 95% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long, or is at most 40 nt long.3. An isolated nucleic acid comprising a nucleotide sequence of a 5’ fragment of a human tRNA, wherein the human tRNA is selected from: TRE-CTC1-7, TRE-CTC1-1, and TRE-CTC2-1, wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long, or is at most 40 nt long.4. The isolated nucleic acid of any one of the preceding arrangements, wherein the nucleic acid comprises at least one chemically-modified nucleotide.5. The isolated nucleic acid of arrangement 4, wherein the nucleic acid comprises 1-10 chemically-modified nucleotides.6. The isolated nucleic acid of arrangement 4, wherein the at least one chemically- modified nucleotide comprises a backbone modification.7. The isolated nucleic acid of arrangement 6, wherein the backbone modification comprises a backbone sugar modification.8. The isolated nucleic acid of arrangement 6 or 7, wherein the at least one chemically- modified nucleotide is a locked nucleic acid (LNA).9. The isolated nucleic acid of any one of arrangements 4-8, wherein the at least one chemically-modified nucleotide increases stability of the nucleic acid.10. The isolated nucleic acid of arrangement 9, wherein the at least one chemically- modified nucleotide increases in vivo stability of the nucleic acid.11. The isolated nucleic acid of any one of the preceding arrangements, wherein the nucleotide sequence is at the 5’ end of the nucleic acid.12. The isolated nucleic acid of any one of the preceding arrangements, wherein the nucleic acid is or is about 32 nt long.13. The isolated nucleic acid of any one of the preceding arrangements, wherein the nucleic acid consists of or consists essentially of the nucleotide sequence: UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).14. A therapeutic composition comprising: a therapeutically effective amount of the isolated nucleic acid of any one of the preceding arrangements; and a pharmaceutically acceptable excipient.15. The composition of arrangement 14, further comprising a transfection reagent.16. The composition of arrangement 15, wherein the transfection reagent comprises one or more of a liposome, an extracellular vesicle (EV), and a polyethylene glycol (PEG)- cationic lipid complex (PCLC).17. The composition of arrangement 15 or 16, wherein the transfection reagent comprises EV derived from cardiosphere-derived cells (CDC).18. The composition of any one of arrangements 14-17, further comprising a casein phosphoprotein.19. The composition of arrangement 18, comprising casein micelles.20. The composition of arrangement 18 or 19, comprising chitosan.21. The composition of claim 20, wherein the isolated nucleic acid is encapsulated in a casein-chitosan complex.22. The composition of arrangement 20 or 21, comprising casein-chitosan micelles.23. The composition of any one of arrangements 14-22, further comprising an antisense oligonucleotide.24. The composition of arrangement 23, wherein the antisense oligonucleotide comprises an exon-skipping agent that targets a dystrophin transcript.25. A kit comprising: the nucleic acid of any one of any one of arrangements 1-13; and a transfection reagent.26. The kit of arrangement 25, wherein the transfection reagent comprises one or more of a lipid, PEGylated lipid, and an extracellular vesicle (EV).27. The kit of arrangement 25 or 26, further comprising a pharmaceutically acceptable excipient.28. The kit of any one of arrangements 25-27, further comprising a casein phosphoprotein.29. The kit of any one of arrangements 25-28, further comprising chitosan.30. The kit of any one of arrangements 25-29, further comprising an antisense oligonucleotide.31. The kit of arrangement 30, wherein the antisense oligonucleotide comprises an exon-skipping agent that targets a dystrophin transcript.32. A method of treating a muscle disorder or symptom thereof, comprising administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of the nucleic acid of any one of arrangements 1-13, or of the composition of any one of arrangements 14-24, thereby treating the muscle disorder or symptom thereof.33. The method of arrangement 32, wherein the muscle disorder comprises a skeletal muscle disorder and / or a heart condition.34. The method of arrangement 32 or 33, wherein the muscle disorder comprises muscular dystrophy.35. The method of any one of arrangements 32-34, wherein the muscle disorder comprises Duchenne muscular dystrophy.36. The method of arrangement 34 or 35, further comprising administering a second therapy for the muscle disorder.37. The method of arrangement 36, wherein the second therapy comprises an exonskipping agent and / or gene therapy.38. A method of treating a heart condition or symptom thereof, comprising administering to a subject in need of treating a heart condition or symptom thereof a therapeutically effective amount of the nucleic acid of any one of arrangements 1-13, or of the composition of any one of arrangements 14-24, thereby treating the heart condition or symptom thereof.39. The method of arrangement 38, wherein the heart condition comprises a symptom and / or sequelae of heart failure or myocardial infarction.40. A method of treating a condition associated with inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and / or fibrosis a therapeutically effective amount of the nucleic acid of any oneof arrangements 1-1 , or of the composition of any one of arrangements 14-24, thereby treating the condition associated with inflammation and / or fibrosis.41. The method of arrangement 40. wherein the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart or skeletal muscle.42. The method of arrangement 40 or 41, wherein the condition associated with inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, myocardial infarction, or muscular dystrophy.43. The method of arrangement 40, wherein the condition associated with inflammation and / or fibrosis comprises a symptom or sequelae of an infectious disease or is associated with immunotherapy .44. The method of arrangement 43, wherein the infectious disease comprises a viral infection.45. The method of arrangement 40, wherein the condition associated with inflammation and / or fibrosis comprises a cytokine storm or an autoimmune disorder.46. The method of arrangement 40, wherein the condition associated with inflammation and / or fibrosis comprises a symptom or sequelae of an infectious disease, idiopathic pulmonary fibrosis or cirrhosis of the liver.47. The method of any one of arrangements 32-46, comprising orally administering the therapeutically effective amount of the nucleic acid or of the composition to the subject.48. The method of any one of arrangements 32-46, comprising parenterally administering the therapeutically effective amount of the nucleic acid or of the composition to the subject.49. The method of arrangement 48, comprising intravenously, intramuscularly, or intracardially administering the therapeutically effective amount of the nucleic acid or of the composition to the subject.50. The method of any one of arrangements 32-49, wherein the therapeutically effective amount comprises from about 0.001 pg / g to about 100 pg / g of the nucleic acid.51. The method of any one of arrangements 32-50, comprising administering the therapeutically effective amount of the nucleic acid or the composition no more frequently than twice a week.52. A method of immunomodulation, comprising contacting an effective amount of the nucleic acid of any one of arrangements 1- 13, or of the composition of any one of arrangements 14-24 with a population of macrophages.53. The method of arrangement 52, wherein the contacting comprises administering to a subject in need of treating a condition characterized by inflammation and / or fibrosis an effective amount of the nucleic acid or the composition.54. The method of arrangement 52 or 53, wherein the macrophage is a human macrophage.55. The method of any one of arrangements 52-54, wherein contacting the effective amount of the isolated nucleic acid increases expression of IL-10, IL-la, and / or ARG-1 in the population of macrophages.56. The method of any one of arrangements 52-55, wherein the contacting is done in vitro.57. The method of any one of the preceding arrangements, wherein the subject has suffered heart failure or myocardial infarction.58. The method of any one of the preceding arrangements, wherein the subject has or is predisposed to having muscular dystrophy (e.g. Duchenne muscular dystrophy).59. Use of the nucleic acid of any one of arrangements 1-13 or the composition of any one of arrangements 14-24 for treatment of a muscle disorder or symptom thereof in a subject in need thereof.60. Use of the nucleic acid of any one of arrangements 1-13 or the composition of any one of arrangements 14-24 for preparation of a medicament for treatment of a muscle disorder or symptom thereof in a subject in need thereof.61. The use of the nucleic acid or the composition of arrangements 59 or 60, wherein the muscle disorder comprises a skeletal muscle disorder and / or a heart condition.62. The use of the nucleic acid or the composition of arrangement 61, wherein the heart condition comprises a symptom and / or sequelae of heart failure or myocardial infarction.63. The use of the nucleic acid or the composition of any one of arrangement 59-61, wherein the muscle disorder comprises muscular dystrophy.64. Use of the nucleic acid of any one of arrangements 1 -13 or the composition of any one of arrangements 14-24 for treatment of a condition associated with inflammation and / or fibrosis in a subject in need thereof.65. Use of the nucleic acid of any one of arrangements 1-13 or the composition of any one of arrangements 14-24 for preparation of a medicament for treatment of a condition associated with inflammation and / or fibrosis a subject in need thereof.66. The use of the nucleic acid or the composition of arrangements 64 or 65, wherein the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart and / or skeletal muscle.67. The use of the nucleic acid or the composition of any one of arrangements 64-66, wherein the condition associated with inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, myocardial infarction, or muscular dystrophy.
[0076] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications arc provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0077] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodimentsdescribed herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein or nucleic acid structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.
[0078] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.
[0079] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLESExample 1
[0080] This non-limiting example shows discovery of a non-coding RNA (ncRNA), tREX-1, identified as payload in CDC-derived extracellular vesicles (CDC-EV), and initial in vitro characterization of its immunomodulatory effect.
[0081] A ncRNA species particularly abundant in CDC-EV was identified as having the sequence 5’-UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC-3’ (SEQ ID NO: 1) (FIG. 7D). Extracellular vesicles (EVs) secreted by cardio sphere-derived cells induced transcriptomic changes in cultured macrophages, sharing characteristics with alternatively - activated (M2) and classically-activated (Ml) macrophages (FIG. 7A). Sequencing of EV small RNAs revealed that tRNAs represented the largest percentage of mapped reads (FIG. 7B). The greatest tRNA reads mapped to tREX-1 (FIG. 7C).
[0082] This ncRNA species represents a 5’ fragment (specifically, the first 32 nucleotides from the 5’ end) of the tRNA, TRE-CTC1-7, and was named “tREX-1” (FIGs. 1A, 6, 7D). FIG. 1A shows a schematic of 5’ tRNA half and known bioactivity. The tREX-1 sequence also had 100% homology with a 5’ fragment (specifically, the first 32 nucleotidesfrom the 5’ end) of at least two other tRNA-Glu-CTC isodecoders, TRE-CTC1-1 and TRE- CTC2-1 (FIG. 6).
[0083] To determine potential bioactivity of tREX-1, bone marrow-derived macrophages (BMDM) from mdx mice were exposed to tREX-1 in vitro. RNA-seq analysis revealed broad (or major transcriptome-wide) changes in gene expression in cultured BMDM exposed to tREX-1, compared to control cells exposed to vehicle (Veh) or scrambled (Scr) RNA (FIG. 1C). The scrambled RNA had the sequence of SEQ ID NO: 5 shown in FIG. 6. FIG. 1C shows a transcriptomic heatmap of mdx mouse bone marrow-derived macrophages exposed to tREX-1 (20 nM), scrambled RNA, or vehicle. Changes in cultured macrophage gene expression were unique to tREX-1, as neither tREX-1 scramble (same RNA contents in a randomized order non-complementary to the mouse genome) nor the next most abundant non-glu tRNA half induced major changes in gene expression (FIG. 7D; *P<0.05, **P<0.01, ****p<0.0001, ns: not significant. Data are represented as mean ± SEM. A one-way ANOVA was used to determine statistical significance (a=0.05)). Gene ontology analysis of the RNA- seq data (shown in FIG. 1C) revealed enrichment of transcripts for genes involved in various immune processes, among others (FIG. ID). The analysis in FIG. ID is presented in different format in FIG. 7E. Gene ontology also showed that tREX-1 modulates the immune response, reactive oxygen species (ROS) metabolism, and may stimulate apoptosis of pro-fibrotic fibroblasts (FIG. ID, 7E). Kyoto Encyclopedia of Genes and Genomes showed that tREX-1 stimulated the insulin and hypoxia-inducible factor- 1 signaling pathways, and regulated endocytosis, spliceosome, phagosome, lysosome, proteolysis, and the cell cycle (FIG. 7F). These results demonstrate that tREX-1 has potential immunomodulatory effects by modulating macrophage function.
[0084] FIG. IB provides a schematic of the hypothetical mechanism of action of tREX-1, where tREX-1 enters target cells, binds gene expression response elements, and alters gene expression. The culmination is a change in cell behavior consistent with a regenerative response to tissue injury or disease.Example 2
[0085] This non-limiting example shows disease-modifying bioactivity of tREX-1 in a model of muscular dystrophy.
[0086] The disease modifying bioactivity of tREX-1 was tested with respect to heart pathophysiology in mdx mice, a model of Duchenne muscular dystrophy. FIG. 2A shows a schematic of the experimental protocol (see also FIG. 8A). 14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 pg / g body weight) twice-weekly by retro- orbital injection (i.e., intravenous) for 4 weeks. FIG. 2B shows that mice that received tREX- 1 had a greater left ventricular ejection fraction (EF) (or greater preservation of heart function) relative to mice that received scrambled control. FIG. 8B shows the EF data, including data in FIG. 2B, in a different format. Thus, mice that had received tREX-1 showed preserved heart function, whereas heart function decreased in control mice.
[0087] Heart tissue was obtained to quantify myocardial fibrosis in the animals. FIG. 2C shows representative Masson’s trichrome micrographs of cardiac tissue sections. The results of quantification of myocardial fibrosis of tissue sections, such as those shown in FIG 2C, are shown in FIG. 2D. FIG. 8D shows the cardiac tissue section staining data and quantification of myocardial fibrosis, including data in FIGs. 2C and 2D, in a different format. Animals treated with tREX-1 exhibited a significant reduction in myocardial fibrosis compared to animals treated with scrambled RNA (FIGs. 2D, 8D right panel). *P<0.05. **P<0.01, ***p<0.001, ns: not significant. Data are represented as mean ± SEM. A two-way ANOVA with repeated measures or an independent t-test was used to determine statistical significance (a=0.05). These results demonstrate the disease-modifying bioactivity of tREX-1 with respect to both cardiac function and fibrosis in muscular dystrophy.Example 3
[0088] This non-limiting example shows disease-modifying bioactivity of tREX-1 in a model of muscular dystrophy.
[0089] The disease modifying bioactivity of tREX-1 was tested with respect to skeletal muscle pathophysiology in mdx mice. FIG. 3A shows a schematic of the experimental protocol (see also FIG. 8 A). 14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 pg / g BW) twice-weekly by retro-orbital injection (i.e., intravenous) for 4 weeks. FIG. 3B shows that mice that received tREX-1 produced more muscle torque relative to mice that received scrambled control. FIG. 8C shows tetanic torque data, including data in FIG. 3B,in a different format. Thus, mice that had received tREX-1 had improved muscle function, whereas no change was observed in control mice (FIG. 8C).
[0090] Skeletal muscle tissue was obtained to quantify myocardial fibrosis in the animals. FIG. 3C shows representative Masson’s trichrome micrographs of cardiac tissue sections. Quantification of fibrosis and muscle fiber count of skeletal muscle tissue sections was carried out. Animals treated with tREX- 1 exhibited a significant reduction in myocardial fibrosis (FIG. 3D), and a significant increase in myofiber count (FIG. 3E) compared to animals treated with scrambled RNA. FIG. 8E shows the skeletal muscle tissue section staining data and quantification of myocardial fibrosis, including data in FIGs. 3C and 3D, in a different format, and FIG. 8F shows the myofiber count data, including data in FIG. 3E, in a different format. *P<0.05, **P<0.01, ***P<0.001, ns: not significant. Data are represented as mean ± SEM. A two-way ANOVA with repeated measures or an independent t-test was used to determine statistical significance (a=0.05). These results demonstrate the disease-modifying bioactivity of tREX-1 with respect to both skeletal muscle function and fibrosis in muscular dystrophy.
[0091] The results shown in Examples 2 and 3 show that tREX-1 given after disease is established can improve heart and skeletal muscle function, and reduce fibrosis, in some non-limiting embodiments.Example 4
[0092] This non-limiting example shows the effect of tREX-1 administration on serum inflammatory cytokine levels.
[0093] A serum inflammatory cytokine array was performed for 14-month-old mdx mice that were administered tREX-1 or scrambled RNA (0.15 ptg / g BW) twice-weekly by retro-orbital injection (i.e., intravenous) for 4 weeks. FIG. 4 shows the changes in serum inflammatory cytokines from mdx mice. At the 4-week study endpoint, mice that received tREX-1 showed robust changes in pro-inflammatory cytokines relative to scrambled control, demonstrating immunomodulatory properties in vivo.Example 5
[0094] This non-limiting example shows the effect of oral tREX-1 administration in a model of acute myocardial infarction (MI).
[0095] The bioactivity of orally administered tREX-1 was tested in a myocardial ischemia / reperfusion injury model acute MI. Mice underwent 45 min LAD ligation, followed by 20 min reperfusion. After reperfusion, mice were administered tREX-1 or scrambled RNA (0.15 pg / g body weight) by oral gavage. Two days following ischemia / reperfusion, hearts were extracted and processed for TTC staining to quantify infarct size (average of apical, mid- papillary, and basal infarcts) relative to the left ventricle (FIG. 5). Data are represented as mean ± SEM. *P<0.05. An independent t-test was used to determine statistical significance. Animals treated with tREX-1 exhibited a significant reduction in infarct size. These results show that oral tREX-1 has disease modifying activity in acute MI, in some embodiments.Example 6
[0096] This non-limiting example shows uptake of tREX-1 by cultured macrophages.
[0097] A fluorescent version of tREX-1 was created by substituting adenosine residues with 2-aminopurine (2-AP), a fluorescent adenosine analog maintaining Watson- Crick base pairing. Cultured macrophages were exposed to fluorescent (tREX-l2 AP) and non- fluorescent tREX-1 (25 nM) for 90 minutes. Cells were then processed for analysis by flow cytometry. As shown by FIG. 9, cultured macrophages demonstrated uptake of labeled tREX- 1.Example 7
[0098] This non-limiting example shows identification of tREX-1 protein binding partners.
[0099] Biotinylated tREX-1 or scrambled RNA (20 pM) was spiked into cultured macrophage lysates, and RNA pulldown was performed using streptavidin-coated beads. RNA binding proteins (RBP) eluted by pulldown were then identified by mass spectrometry (FIG. 10). In total, 5 predicted RBPs (based on sequence complementarity) were validated by mass spectrometry. Each of the RBPs identified have well-established roles in regulating geneexpression at the transcriptional, post-transcriptional, and translational levels. Mass spectrometry was unable to detect any RBPs in samples spiked with biotinylated scrambled RNA, further supporting the notion that the specificity of tREX-1 is unique to its sequence. These data suggest tREX-1 interacts with RBPs to regulate macrophage gene expression; and thus, altering their biological function.Example 8
[0100] This non-limiting example shows the effects of tREX-1 on cardiac macrophages.
[0101] 12-14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 |lg / g body weight) twice-weekly by intravenous injection for 4 weeks. Hearts were processed for immunohistochemistry and CD68+ / CD8O- and CD68+ / CD8O+ cells (FIG. 11, top panels), and CD68+ / CD206- and CD68+ / CD206+ cells (FIG. 11, bottom panels) were quantified. tREX-1 had no effect on CD68+ / CD80+ (classically-activated) cardiac macrophages, but dramatically reduced the numbers of CD68+ / CD206+ (alternatively- activated) macrophages (FIG. 11, top right and bottom right panels, respectively). These data indicate that tREX-1 alters the composition of cardiac macrophage subtypes. ****P<0.0001. Data are represented as mean ± SEM. An independent t-test was used to determine statistical significance (a=0.05).Example 9
[0102] This non-limiting example shows the effects of tREX-1 on skeletal muscle macrophages.
[0103] 12-14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 ptg / g body weight) twice-weekly by intravenous injection for 4 weeks. Hearts were processed for immunohistochemistry and CD68+ / CD8O- and CD68+ / CD8O+ cells (FIG. 12, top panels), and CD68+ / CD206- and CD68+ / CD206+ cells (FIG. 12, bottom panels) were quantified. tREX-1 had no effect on CD68+ / CD8O+ (classically-activated) skeletal muscle macrophages, but dramatically increased the numbers of CD68+ / CD206+ (alternatively - activated) macrophages (FIG. 12, top right and bottom right panels, respectively). These data indicate that tREX-1 alters the composition of skeletal muscle macrophage subtypes.****P<0.0001 . Data are represented as mean ± SEM. An independent t-test was used to determine statistical significance (a=0.05).Example 10
[0104] This non-limiting example shows that tREX-1 bioactivity is dependent on macrophages.
[0105] Macrophages were depleted (Mcp-) by clodronate liposomes or present (M<p+) in 12-14-month-old mdx mice prior to administration of tREX-1 or scrambled RNA (0.15 J-ig / g body weight) twice-weekly by intravenous injection for 4 weeks. Heart function was measured by echocardiography at baseline (after macrophage depletion, but prior to tREX- 1 administration) and at the 4-week study endpoint. When macrophages were present, tREX- 1 improved heart function (FIG. 13). In contrast, when macrophages were absent, tREX-1 was ineffective (FIG. 13). These data demonstrate macrophages are targets of tREX-1. ***P<0.001, ns: not significant. Data are represented as mean ± SEM. A two-way ANOVA was used to determine statistical significance (a=0.05).
Claims
WHAT TS CLAIMED TS:
1. A method of treating a condition associated with inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and / or fibrosis a therapeutically effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nucleotides (nt) long.
2. The method of claim 1, wherein the nucleic acid is at most 40 nt long.
3. The method of claim 1, wherein the nucleic acid is about 32 nt long.
4. The method of claim 1, wherein the nucleic acid consists of or consists essentially of the nucleotide sequence:UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
5. The method of claim 3, wherein the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart or skeletal muscle.
6. The method of claim 3, wherein the condition associated with inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, myocardial infarction, or muscular dystrophy.
7. The method of claim 6, wherein the subject has suffered heart failure or myocardial infarction.
8. The method of claim 6, wherein the subject has or is predisposed to having muscular dystrophy.
9. The method of claim 8, wherein the subject has or is predisposed to having Duchenne muscular dystrophy.
10. The method of claim 9, further comprising administering a second therapy for the muscle disorder.
11. The method of claim 10, wherein the second therapy comprises an exonskipping agent and / or gene therapy.
12. The method of claim 3, comprising orally administering the therapeutically effective amount of the nucleic acid or of the composition to the subject.
13. The method of claim 6, comprising parenterally administering the therapeutically effective amount of the nucleic acid or of the composition to the subject.
14. The method of claim 13, comprising intravenously, intramuscularly, or intracardially administering the therapeutically effective amount of the nucleic acid or of the composition to the subject.
15. A method of treating a muscle disorder or symptom thereof, comprising administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
16. The method of claim 15, is at most 40 nt long.
17. The method of claim 15, wherein the nucleic acid is about 32 nt long.
18. The method of claim 17, wherein the muscle disorder comprises a skeletal muscle disorder and / or a heart condition.
19. The method of claim 18, wherein the heart condition comprises a symptom and / or sequelae of heart failure or myocardial infarction.
20. The method of claim 18, wherein the muscle disorder comprises muscular dystrophy.
21. The method of claim 20, wherein the muscle disorder comprises Duchenne muscular dystrophy.
22. The method of claim 21, further comprising administering a second therapy for the muscle disorder.
23. The method of claim 22, wherein the second therapy comprises an exonskipping agent and / or gene therapy.
24. The method of any one of the preceding claims, wherein the therapeutically effective amount comprises from about 0.001 pg / g to about 100 pg / g of the nucleic acid.
25. The method of any one of the preceding claims, comprising administering the therapeutically effective amount of the nucleic acid or the composition no more frequently than twice a week.
26. A method of immunomodulation, comprising contacting an effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) with a population of macrophages, wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
27. The method of claim 26, wherein the nucleic acid is at most 40 nt long.
28. The method of claim 26, wherein the nucleic acid is about 32 nt long.
29. The method of claim 28, wherein the contacting comprises administering to a subject in need of treating a condition associated with inflammation and / or fibrosis the effective amount of the isolated nucleic acid.
30. The method of claim 28, wherein the macrophage is a human macrophage.
31. The method of claim 30, wherein contacting the effective amount of the isolated nucleic acid increases expression of IL- 10, IL- la, and / or ARG-1 in the population of macrophages.
32. The method of claim 28, wherein the contacting is done in vitro.
33. An isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
34. An isolated nucleic acid comprising a nucleotide sequence at least 95% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
35. An isolated nucleic acid comprising a nucleotide sequence of a 5’ fragment of a human tRNA, wherein the human tRNA is selected from: TRE-CTC1-7, TRE-CTC1-1, and TRE-CTC2-1, wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
36. The isolated nucleic acid of claim 33, wherein the nucleotide sequence is at the 5’ end of the nucleic acid.
37. The isolated nucleic acid of claim 33, wherein the nucleic acid is about 32 nt long.
38. The isolated nucleic acid of claim 33, wherein the nucleic acid consists of or consists essentially of the nucleotide sequence:UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
39. A therapeutic composition comprising: a therapeutically effective amount of the isolated nucleic acid of claim 37; and a pharmaceutically acceptable excipient.
40. The composition of claim 39, wherein the composition consists essentially of the therapeutically effective amount of the isolated nucleic acid and the pharmaceutically acceptable excipient.
41. The composition of claim 39, wherein the composition is a cell-free composition.
42. The composition of claim 39, wherein the composition is an extracellular vesicle-free composition.
43. The composition of claim 39, further comprising a transfection reagent.
44. The composition of claim 43, wherein the transfection reagent comprises one or more of a liposome, an extracellular vesicle (EV), and a polyethylene glycol (PEG)-cationic lipid complex (PCLC).
45. The composition of claim 43, wherein the transfection reagent comprises EV derived from cardiosphere-derived cells (CDC).
46. The composition of claim 43, further comprising a casein phosphoprotein.
47. The composition of claim 46, comprising casein micelles.
48. The composition of claim 47, comprising chitosan.
49. The composition of claim 48, wherein the isolated nucleic acid is encapsulated in a casein-chitosan complex.
50. The composition of claim 49, comprising casein-chitosan micelles.
51. The composition of claim 39, further comprising an antisense oligonucleotide.
52. The composition of claim 51, wherein the antisense oligonucleotide comprises an exon-skipping agent that targets a dystrophin transcript.
53. A kit comprising: the nucleic acid of any one of any one of claims 33-38; and a transfection reagent.
54. The kit of claim 53, wherein the transfection reagent comprises one or more of a lipid, PEGylated lipid, and an extracellular vesicle (EV).
55. The kit of claim 53 or 54, further comprising a pharmaceutically acceptable excipient.
56. The kit of any one of claims 53-55. further comprising a casein phosphoprotein.
57. The kit of any one of claims 53-56, further comprising chitosan.
58. The kit of any one of claims 53-57, further comprising an antisense oligonucleotide.
59. The kit of claim 58, wherein the antisense oligonucleotide comprises an exonskipping agent that targets a dystrophin transcript.
60. Use of the nucleic acid of any one of claims 33-38 or the composition of any one of claims 39-52 for treatment of a muscle disorder or symptom thereof in a subject in need thereof.
61. Use of the nucleic acid of any one of claims 33-38 or the composition of any one of claims 39-52 for preparation of a medicament for treatment of a muscle disorder or symptom thereof in a subject in need thereof.
62. The use of the nucleic acid or the composition of claims 60 or 61, wherein the muscle disorder comprises a skeletal muscle disorder and / or a heart condition.
63. The use of the nucleic acid or the composition of claim 62, wherein the heart condition comprises a symptom and / or sequelae of heart failure or myocardial infarction.
64. The use of the nucleic acid or the composition of any one of claims 60-62, wherein the muscle disorder comprises muscular dystrophy.
65. Use of the nucleic acid of any one of claims 33-38 or the composition of any one of claims 39-52 for treatment of a condition associated with inflammation and / or fibrosis in a subject in need thereof.
66. Use of the nucleic acid of any one of claims 33-38 or the composition of any one of claims 39-52 for preparation of a medicament for treatment of a condition associated with inflammation and / or fibrosis a subject in need thereof.
67. The use of the nucleic acid or the composition of claims 65 or 66, wherein the condition associated with inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart and / or skeletal muscle.
68. The use of the nucleic acid or the composition of any one of claims 65-67, wherein the condition associated with inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, myocardial infarction, or muscular dystrophy.