Compositions of dry powder formulations of messenger RNA and methods of use thereof

EP4622630A1Pending Publication Date: 2025-10-01TRANSLATE BIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023833925
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-21
Filing Date
2023-11-20
Publication Date
2025-10-01

AI Technical Summary

Technical Problem

Current mRNA therapy formulations, such as lipid nanoparticle compositions, are typically in liquid form and require invasive administration methods like injections or nebulizers, and lyophilized powders often suffer from particle uniformity issues and instability during storage and handling.

Method used

Development of a dry powder formulation of mRNA encapsulated in lipid nanoparticles, optimized through spray-drying with specific hydrophobic amino acids and sugar alcohols, achieving uniform particle sizes between 1-8 μm for efficient delivery via inhalation without compromising stability or yield.

Benefits of technology

The dry powder formulation enables efficient mRNA delivery with minimal inflammatory response and maintains mRNA integrity, allowing for stable storage and effective inhalation-based administration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000012_0001
    Figure IMGF000012_0001
  • Figure IMGF000024_0001
    Figure IMGF000024_0001
  • Figure IMGF000025_0001
    Figure IMGF000025_0001
Patent Text Reader

Abstract

The present disclosure provides stable, dry powder messenger RNA formulations for therapeutic use, and methods of making and using the same.
Need to check novelty before this filing date? Find Prior Art

Description

PATENT ATTORNEY DOCKET NO.0171.0103-PCT COMPOSITIONS OF DRY POWDER FORMULATIONS OF MESSENGER RNA AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 384,553 filed 21 November 2022, the entire contents of which are hereby incorporated by reference in their entirety. SUBMISSION OF SEQUENCE LISTING

[0002] The Sequence Listing associated with this application is filed in electronic format as a XML file and hereby incorporated by reference into the specification in its entirety. The name of the XML file containing the Sequence Listing is 0171_0103_PCT_SL.xml and the size of the XML file is 3,985 bytes. BACKGROUND

[0003] Messenger RNA therapy (MRT) is becoming an increasingly important approach for the treatment of a variety of diseases. Lipid encapsulated mRNA formulations, such as lipid nanoparticle (LNP) compositions, show high degree of cellular uptake and protein expression. However, presently these formulations are typically in liquid forms, and are required to be administered usually in the form of injections, or via nebulizers. These modes of administration are less desired by the patient than some less invasive routes, for example, metered dose inhalers. Lyophilized formulations sometimes do not offer reliable particle uniformity in dry state, or ease of handling and distribution. Lyophilized powder has to be dissolved in an appropriate solvent prior to dispensing to a patient and can undergo degradation within a few hours. Repeated freeze thawing of mRNA preparations is not recommended due to the potential for mRNA and / or LNP instability. SUMMARY

[0004] The present disclosure provides, among other things, a dry powder (e.g., spray-dried) formulation of mRNA encapsulated with lipid based nanoparticles for more efficient mRNA delivery and more efficacious mRNA therapy. The particle size of mRNA-LNP formulation can be important for dry-powder based delivery of mRNA drug products. mRNA-LNP drug productsPATENT ATTORNEY DOCKET NO.0171.0103-PCT generated by spray-drying often generate particles bigger than 10µm, are not conducive to delivery to several tissues, for example, lungs. Dry powder product of mRNA-LNPs with an ideal particle size range and desired surface characteristics can be manufactured using spray drying technique by optimizing the processing parameters and LNP composition and by using different solvents and excipient combinations. Provided herein are compositions comprising a hydrophobic amino acid and / or sugar alcohols at certain ratios in an mRNA-LNP formulation, which can provide fine dry- powder particles containing mRNA-loaded lipid nanoparticles. Such particles can be suitable for several delivery methods, for example, inhalation, without significantly affecting the yield, or stability of mRNA. Additionally, the present disclosure is directed to desired in-vitro and in-vivo potency of dry powder product with minimal inflammatory response.

[0005] In some aspects, the present disclosure is directed to a dry powder formulation comprising a messenger RNA encapsulated in lipid nanoparticles (LNPs), wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG- modified lipids, wherein the dry powder formulation comprises leucine and mannitol at a weight ratio of between 1:1 and 1:10, and wherein the dry powder formulation has a mean particle size of between 1-8 µm. In some embodiments, the mean particle size is 2 µm. In some embodiments, the mean particle size in 3 µm. In some embodiments, the mean particle size in 4 µm. In some embodiments, the mean particle size in 5 µm. In some embodiments, the mean particle size in 6 µm. In some embodiments, the mean particle size in 7 µm.

[0006] In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:2. In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:3. In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:4. In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:5. In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:6. In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:7. In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:8. In some embodiments, the dry powder formulation comprises leucine and mannitol at a weight ratio of 1:9.

[0007] In some embodiments, the weight ratio of leucine and mannitol is 1:8.

[0008] In some embodiments, the weight ratio of leucine and mannitol is 1:4.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0009] In some aspects, the present disclosure is directed to a messenger RNA encapsulated in lipid nanoparticles (LNPs), wherein the LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises a hydrophobic amino acid at a concentration of between 4 and 65%, and wherein the dry powder formulation has a mean particle size of between 1-8 µm. In some embodiments, the dry powder formulation comprises a hydrophobic amino acid at a concentration of between 10% and 50%. In some embodiments, the dry-powder formulation has a mean particle size of between 2-6 µm. In some embodiments, the mean particle size of the dry powder formulation is 2 µm. In some embodiments, the mean particle size of the dry powder formulation is 3 µm. In some embodiments, the mean particle size of the dry powder formulation is 4 µm. In some embodiments, the mean particle size of the dry powder formulation is 5 µm. In some embodiments, the mean particle size of the dry powder formulation is 6 µm.

[0010] In some embodiments, the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline, or tryptophan. In some embodiments, the hydrophobic amino acid is leucine.

[0011] In some embodiments, the dry powder formulation comprises the lipid nanoparticles encapsulating the mRNA have an N / P ratio of between 2 and 6. In some embodiments, the dry powder formulation comprises the lipid nanoparticles encapsulating the mRNA have an N / P ratio of between 3 and 4. In some embodiments, the dry powder formulation comprises the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 3.

[0012] In some embodiments, the dry powder formulation comprises one or more cholesterol- based lipids. In some embodiments, the dry powder formulation comprises cationic lipids constituting about 30-70% of the total lipids in LNPs by molar %. In some embodiments, the dry powder formulation comprises PEG-modified lipids constituting about 1-15% of the total lipids in LNP by molar %. In some embodiments, the dry powder formulation comprises non-cationic lipids constituting about 10-40% of the total lipids in LNP by molar %. In some embodiments, the dry powder formulation comprises one or more cholesterol-based lipids comprising about 5-40% of the total lipids in LNP by molar %.

[0013] In some embodiments, the dry powder formulation comprises molar ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles is approximately 60:25:10:5. In some embodiments, the molar ratio of cationicPATENT ATTORNEY DOCKET NO.0171.0103-PCT lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles is approximately 40:25:30:5.

[0014] In some embodiments, the dry powder formulation comprises a mean particle size of between 1-5 µm. In some embodiments, the dry powder formulation comprises a mean particle size between 1-3 µm.

[0015] In some embodiments, the dry powder formulation comprises mRNA constituting greater than 2% of the dry powder formulation by weight. In some embodiments, the dry powder formulation comprises mRNA constituting greater than 3% of the dry powder formulation by weight. In some embodiments, the dry powder formulation comprises mRNA constituting greater than 4% of the dry powder formulation by weight.

[0016] In some embodiments, the dry powder formulation comprises an encapsulation rate of the lipid nanoparticles is greater than 60%. In some embodiments, the dry powder formulation comprises an encapsulation rate of the lipid nanoparticles is greater than 70%. In some embodiments, the dry powder formulation comprises an encapsulation rate of the lipid nanoparticles is greater than 80%.

[0017] In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 80% or greater post spray drying. In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 90% or greater post spray drying. In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 95% or greater post spray drying.

[0018] In some embodiments, the dry powder formulation maintains the mRNA integrity of 80% or greater after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 90% or greater after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 80% or greater after storage at 4°C for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 90% or greater after storage at 4°C for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 80% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 90% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 95% or greater after storage at 25°C for 4 weeks or longer.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0019] In some embodiments, the dry powder formulation has a moisture content of less than 0.5%. In some embodiments, the dry powder formulation has a moisture content of less than 0.4%. In some embodiments, the dry powder formulation has a moisture content of less than 0.3%. In some embodiments, the dry powder formulation has a moisture content of less than 0.2%. In some embodiments, the dry powder formulation has a moisture content of less than 0.1%.

[0020] In some embodiments, the dry powder formulation comprises mRNA that encodes a therapeutic protein. In some embodiments, the mRNA encodes an antigen. In some embodiments, the mRNA encodes a vaccine. In some embodiments, the dry powder formulation is inhalable. In some embodiments, the dry powder formulation is nebulizable upon reconstitution.

[0021] In some aspects, the present disclosure comprises methods of delivering mRNA in vivo comprising administering to a subject in need thereof a dry powder formulation according to any of the embodiments disclosed herein. In some embodiments, the present disclosure comprises methods of administration of dry powder formulation by inhalation. In some embodiments, the present disclosure comprises methods of administration of any of the dry powder formulations disclosed herein by intranasal spray. In some embodiments, the present disclosure provides methods of administration of any of the dry powder formulations disclosed herein by an inhaler.

[0022] In some aspects, the present disclosure comprises methods of preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles encapsulating an mRNA, b) adding leucine and mannitol to the mixture at a weight ratio of between 1:1 and 1:10, c) spray-drying the mixture, and d) obtaining the dry powder formulation that has a mean particle size of between 1-8µm, and wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the weight ratio of leucine and mannitol is 1:8. In some embodiments, the weight ratio of leucine and mannitol is 1:7. In some embodiments, the weight ratio of leucine and mannitol is 1:6. In some embodiments, the weight ratio of leucine and mannitol is 1:5. In some embodiments, the weight ratio of leucine and mannitol is 1:4.

[0023] In some aspects, the present disclosure comprises methods of preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles encapsulating an mRNA, b) adding a hydrophobic amino acid to the mixture at a concentration of between 4.0-65%, c) spray-drying the mixture, and d) obtaining the dry powder formulation that has a mean particle size of between 1-8µm, and wherein the lipid nanoparticles comprise one orPATENT ATTORNEY DOCKET NO.0171.0103-PCT more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the hydrophobic amino acid is leucine, isoleucine, valine, phenylalanine, methionine, proline, or tryptophan. In some embodiments, the hydrophobic amino acid is leucine. In some embodiments, the method further comprises a step of adding 20% ethanol to the mixture.

[0024] In some embodiments, the spray-drying step occurs at a temperature of less than 90°C. In some embodiments, the spray-drying step occurs at a temperature of between 20-70°C.

[0025] In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of between 2 and 6. In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of between 3 and 4. In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 2. In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 3. In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 4. In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 5. In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 6.

[0026] In some embodiments, the lipid nanoparticles further comprise one or more cholesterol- based lipids. In some embodiments, the lipid nanoparticles further comprise one or more cationic lipids constitutes about 30-70% of the total lipids in LNPs by molar %. In some embodiments, the lipid nanoparticles further comprise one or more PEG-modified lipids constitutes about 1-15% of the total lipids in LNP by molar %. In some embodiments, the lipid nanoparticles further comprise one or more non-cationic lipids constitutes about 10-40% of the total lipids in LNP by molar %. In some embodiments, the lipid nanoparticles further comprise one or more cholesterol-based lipids comprise about 5-40% of the total lipids in LNP by molar %.

[0027] In some embodiments, the method comprises providing the molar ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles at approximately 60:25:10:5. In some embodiments, the method comprises providing the molar ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles at approximately 40:25:30:5.

[0028] In some embodiments, the mean particle size is between 1-5µm. In some embodiments, the mean particle size is between 1-3µm. In some embodiments, the mean particle size is 3µm. In some embodiments, the mean particle size is 2µm.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0029] In some embodiments, the mRNA constitutes greater than 2% of the dry powder formulation by weight. In some embodiments, the mRNA constitutes greater than 3% of the dry powder formulation by weight. In some embodiments, the mRNA constitutes greater than 4% of the dry powder formulation by weight.

[0030] In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 50%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 60%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 70%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 80%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 90%.

[0031] In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 80% or greater post spray drying. In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 90% or greater post spray drying. In some embodiments, the mRNA in the dry powder formulation maintains an integrity of 95% or greater post spray drying.

[0032] In some embodiments, the dry powder formulation maintains the mRNA integrity of 80% or greater after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 90% or greater after storage at room temperature for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 80% or greater after storage at 4°C for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 90% or greater after storage at 4°C for 6 months or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 80% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 90% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the dry powder formulation maintains the mRNA integrity of 95% or greater after storage at 25°C for 4 weeks or longer.

[0033] In some embodiments, the dry powder formulation has a moisture content of less than 0.5%. In some embodiments, the dry powder formulation has a moisture content of less than 0.4%. In some embodiments, the dry powder formulation has a moisture content of less than 0.3%. In some embodiments, the dry powder formulation has a moisture content of less than 0.2%. In some embodiments, the dry powder formulation has a moisture content of less than 0.1%.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0034] In some embodiments, the dry powder formulation comprises mRNA that encodes a therapeutic protein. In some embodiments, the mRNA encodes an antigen. In some embodiments, the mRNA encodes a vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] FIG. 1 is a diagrammatic representation of the spray drying process in a typical spray drying chamber.

[0036] FIGs. 2A-2D are bar graphs showing mRNA weight percentage (FIG. 2A); mRNA powder yield (FIG. 2B); mRNA post spray dry encapsulation efficiency (FIG. 2C) and powder size (FIG.2D) at different leucine and / or mannitol concentrations, with lipid 1.

[0037] FIGs. 3A-3D are bar graphs showing mRNA weight percentage (FIG. 3A); mRNA powder yield (FIG. 3B); mRNA post spray dry encapsulation efficiency (FIG. 3C) and powder size (FIG.3D) at different leucine and / or mannitol concentrations, with lipid 3.

[0038] FIGs.4A-4D show the effect of lipid amount on dry powder product characteristics: Yield in collection vessel (FIG. 4A), dry powder product mean particle size (FIG. 4B), mRNA encapsulation (FIG.4C), and mRNA weight percent in the dry powder product (FIG.4D).

[0039] FIGs. 5A-5G show SEM images for some of the representative dry powder products manufactured using Lipid 1 – mannitol only with regular LNP composition at N / P 4 (FIG. 5A), leucine only with regular LNP composition at N / P 4, (FIG. 5B) leucine only with regular LNP composition at N / P 3, (FIG.5C) leucine only with modified LNP composition at N / P 4, (FIG. 5D) mannitol / leucine combination with regular LNP composition at N / P 4, (FIG.5E) mannitol / leucine combination with regular LNP composition at N / P 4 exposed for longer duration, (FIG. 5F) cross section of the DPP containing mannitol / leucine combination with regular LNP composition at N / P 4 (FIG.5G).

[0040] FIGs. 6A-6D show the in vitro transfection properties of dry-powder products. FIG. 6A shows normalized relative luminescence units of HEK293 cells transfected with mRNA encapsulated in Lipids 1, 2 and 3 in the presence of leucine, mannitol or both at various N / P ratios. FIG. 6B shows normalized relative luminescence units of in-vitro FFL expression in HEK-293 cells for various dry powder product samples from an independent experiment. FIG. 6C shows dose dependent potency of number of cells expressing mCherry and FIG. 6D shows amount of mCherry expressed by the cells.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0041] FIGs.7A-7B are chromatograms assessing integrity of mRNA extracted from dry powder (FIG.7A) and mRNA standard (FIG.7B).

[0042] FIGs. 8A-8C show transfection of the respiratory system in mice with dry-powder products after 24 hours. FIG.8A shows the luminescence after IVIS images of trachea and lungs showing FFL bioluminescence. FIG.8B shows plot of average radiance of FFL bioluminescence measured from trachea and lungs. FIG.8C shows TNF-α levels.

[0043] FIG.9 shows the change of mRNA integrity of a dry powder formulation as compared to a liquid formulation at 25°C accelerated thermostability. DEFINITIONS

[0044] In order for the present disclosure to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification. The publications and other reference materials referenced herein to describe the background of the disclosure and to provide additional detail regarding its practice are hereby incorporated by reference.

[0045] Approximately or about: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0046] Delivery: As used herein, the term “delivery” encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and retained within the target tissue (also referred to as “local distribution” or “local delivery”), and situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and secreted into patient’s circulation system (e.g., serum) and systematically distributed and taken up by other tissues (also referred to as “systemic distribution” or “systemic delivery). In some embodiments, delivery is pulmonary delivery, e.g., comprising nebulization.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0047] Embodiments: As used herein, the term “in some embodiments,” “in certain embodiments,” “in other embodiments,” “in some other embodiments,” or the like, refers to embodiments of all aspects of the disclosure, unless the context clearly indicates otherwise.

[0048] Encapsulation: As used herein, the term “encapsulation,” or its grammatical equivalent, refers to the process of confining a nucleic acid molecule within a nanoparticle.

[0049] Expression: As used herein, “expression” of a nucleic acid sequence refers to translation of an mRNA into a polypeptide, assemble multiple polypeptides (e.g., heavy chain or light chain of antibody) into an intact protein (e.g., antibody) and / or post-translational modification of a polypeptide or fully assembled protein (e.g., antibody). In this disclosure, the terms “expression” and “production,” and their grammatical equivalents, are used interchangeably.

[0050] Functional: As used herein, a “functional” biological molecule is a biological molecule in a form in which it exhibits a property and / or activity by which it is characterized.

[0051] Half-life: As used herein, the term “half-life” is the time required for a quantity such as nucleic acid or protein concentration or activity to fall to half of its value as measured at the beginning of a time period.

[0052] Improve, increase, or reduce: As used herein, the terms “improve,” “increase” or “reduce,” or grammatical equivalents, indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control subject (or multiple control subject) in the absence of the treatment described herein. A “control subject” is a subject afflicted with the same form of disease as the subject being treated, who is about the same age as the subject being treated.

[0053] In Vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi- cellular organism.

[0054] In Vivo: As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).

[0055] Isolated: As used herein, the term “isolated” refers to a substance and / or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and / or in an experimental setting), and / or (2) produced,PATENT ATTORNEY DOCKET NO.0171.0103-PCT prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated. In some embodiments, isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is “pure” if it is substantially free of other components. As used herein, calculation of percent purity of isolated substances and / or entities should not include excipients (e.g., buffer, solvent, water, etc.).

[0056] Median mass aerodynamic diameter: As used herein, the term “Median mass aerodynamic diameter,” or “MMAD,” or "aerodynamic diameter," refers to half the total aerosol mass. In some embodiments, the MMAD of particles is between approximately 1 μm and approximately 5 μm or any sub-range between. In some embodiments, the MMAD of particles is approximately 2 μm. In some embodiments, the MMAD of particles is approximately 3 μm. In some embodiments, the MMAD of particles is approximately 4 μm. In some embodiments, the MMAD of particles is approximately 5 μm. Experimentally, the aerodynamic diameter can be determined using the gravitational sedimentation method, so that the time for a set of particles to settle at a certain distance is used to directly deduce the aerodynamic diameter of the particles. An indirect method to measure the median of the aerodynamic mass diameter (MMA) is the multi- stage liquid impactor (MSLI). The aerodynamic diameter, ^^^^, can be calculated from the equation: ^^^^ൌ ^^ൈ √^^^^;diameter, for example the MMGD and ρtap is the tapped bulk density. Particles which have a tap density less than about 0.4 g / cm3, median diameters of at least about 1 μm, for example, at least about 5 μm, and an aerodynamic diameter of between about 2 μm and about 4 μm, preferably less than about 5 μm, are more capable of escaping inertial and gravitational deposition in the oropharyngeal region, and are targeted to the airways, particularly the deep lung.

[0057] messenger RNA (mRNA): As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide. mRNA as used herein encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems andPATENT ATTORNEY DOCKET NO.0171.0103-PCT optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. An mRNA sequence is presented in the 5’ to 3’ direction unless otherwise indicated.

[0058] N / P Ratio: As used herein, the term “N / P ratio” refers to a molar ratio of positively charged molecular units in the cationic lipids in a lipid nanoparticle relative to negatively charged molecular units in the mRNA encapsulated within that lipid nanoparticle. As such, N / P ratio is typically calculated as the ratio of moles of amine groups in cationic lipids in a lipid nanoparticle relative to moles of phosphate groups in mRNA encapsulated within that lipid nanoparticle.

[0059] Nucleic acid: As used herein, the term “nucleic acid,” in its broadest sense, refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” encompasses RNA as well as single and / or double-stranded DNA and / or cDNA. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and / or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. For example, the so-called “peptide nucleic acids,” which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present disclosure. The term “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and / or encode the same amino acid sequence. Nucleotide sequences that encode proteins and / or RNA may include introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. A nucleic acid sequence is presented in the 5’ to 3’ direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-PATENT ATTORNEY DOCKET NO.0171.0103-PCT methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5- methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages). In some embodiments, the present disclosure is specifically directed to “unmodified nucleic acids,” meaning nucleic acids (e.g., polynucleotides and residues, including nucleotides and / or nucleosides) that have not been chemically modified in order to facilitate or achieve delivery. In some embodiments, the nucleotides T and U are used interchangeably in sequence descriptions.

[0060] Patient: As used herein, the term “patient” or “subject” refers to any organism to which a provided composition may be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In specific embodiments, a patient is a human. A human includes pre- and post-natal forms.

[0061] Pharmaceutically acceptable: The term “pharmaceutically acceptable” as used herein, refers to substances that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0062] Subject: As used herein, the term “subject” refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre- and post-natal forms. In some embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term “subject” is used herein interchangeably with “individual” or “patient.” A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.

[0063] Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result.PATENT ATTORNEY DOCKET NO.0171.0103-PCT The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0064] Treating: As used herein, the term “treat,” “treatment,” or “treating” refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and / or reduce incidence of one or more symptoms or features of a particular disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of a disease and / or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease. DETAILED DESCRIPTION

[0065] The present disclosure provides, among other things, a dry powder (e.g., spray- dried) formulation of mRNA encapsulated with lipid based nanoparticles. Dry powder formulations described herein can comprise certain quantities of hydrophobic amino acids (e.g., mannitol and / or leucine) and can be useful for improved mRNA delivery and mRNA therapy. For example, dry powder formulations described herein can have useful powder size, mRNA encapsulation efficiency, and powder yield. The present disclosure can also provide methods of using formulations described herein, as well as kits comprising formulations described herein.

[0066] Various exemplary aspects and embodiments of the disclosure are described in detail in the following sections. The use of sections is not meant to limit the disclosure. Each section can apply to any aspect of the disclosure. In this application, the use of “or” means “and / or” unless stated otherwise.

[0067] In some aspects, the disclosure features a dry powder formulation comprising a messenger RNA encapsulated in lipid nanoparticles (LNPs), where the lipid nanoparticles comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the formulation comprises a hydrophobic amino acid (e.g., leucine) at a concentration of 4-65% w / w. In some embodiments, the formulation comprises a hydrophobic amino acid (e.g., leucine) and a sugar (e.g., a sugar alcohol such as mannitol) at a weight ratio of between 1:1 and 1:10. In some embodiments, a dry powder formulation has a mean particle size of between 1-8µm.

[0068] In another aspect, the disclosure features a method of preparing a dry powder formulation as described herein. In some embodiments, the method comprises providing a mixture comprising lipid nanoparticles encapsulating an mRNA, adding a hydrophobic amino acid (e.g., leucine) toPATENT ATTORNEY DOCKET NO.0171.0103-PCT the mixture at a concentration of between 4 and 65% w / w, and spray drying the mixture. In some embodiments, a dry powder formulation is obtained that has a mean particle size of between 1- 8µm. In some embodiments, a lipid nanoparticle comprises one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. Dry powder Formulations Comprising Amino Acids and / or a Sugar.

[0069] The present disclosure provides stable dry powder formulations containing mRNA loaded lipid nanoparticles (mRNA-LNP) for therapeutic use. In some embodiments, the dry powder comprises excipients to enhance yield, optimal powder size, and / or optimal N / P ratio. In some embodiments, the dry powder formulation described herein comprises certain compounds, such as amino acids, for example, tryptophan, lysine, methionine, trileucine, proleucine, phenylalanine, threonine, valine, leucine, isoleucine, arginine, tyrosine, glycine, serine, glutamic acid, aspartic acid, taurine, cysteine, histidine, proline, alanine, and creatinine. In some embodiments, a dry powder formulation described herein comprises certain compounds such as amino acids (e.g., a hydrophobic amino acid such as leucine, trileucine, proleucine) and / or sugars (e.g., a sugar alcohol such as mannitol), which can be useful for increasing yield, decreasing powder size, and / or improving the N:P ratio of mRNA lipid nanoparticle product formulations. In certain embodiments, a dry powder formulation comprises a combination of an amino acid (e.g., leucine, trileucine, proleucine) and a sugar (e.g., mannitol).

[0070] In some embodiments, lipid nanoparticles described herein comprise one or more of cationic lipids, PEGylated lipids, non-cationic lipids, and cholesterol-based lipids. Exemplary non- limiting lipids are described herein.

[0071] In some embodiments, the dry powder formulation comprises lipid nanoparticles (LNPs), comprising leucine and mannitol at a specific weight ratio of 0.1 to 3.0.

[0072] In some embodiments, dry powder formulations described herein comprise one or more hydrophobic amino acids.

[0073] In some embodiments, dry powder formulations described herein comprise at least one sugar.

[0074] In some embodiments, the sugar is selected from the group consisting of monosaccharides, disaccharides, polysaccharides, sugar alcohols, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrins, inulin, xylitol, sorbitol, lactitol, and mannitol, and combinations thereof. In some embodiments,PATENT ATTORNEY DOCKET NO.0171.0103-PCT the sugar is mannitol. In some embodiments, a sugar is trehalose. In some embodiments, the sugar is sorbitol.

[0075] In some embodiments, the sugar constitutes less than 30%, 25%, 20%, 15%, 10%, or 5% of total weight, including any values and subranges therebetween.

[0076] In some embodiments, the hydrophobic amino acid is selected from the group consisting of leucine, trileucine, proleucine, isoleucine, valine, phenylalanine, methionine, proline, and tryptophan, and combinations thereof. In some embodiments, the hydrophobic amino acid is leucine. In some embodiments, the hydrophobic amino acid is isoleucine trileucine, or proleucine. In some embodiments, the hydrophobic amino acid is valine. In some embodiments, the hydrophobic amino acid is phenylalanine. In some embodiments, the hydrophobic amino acid is methionine. In some embodiments, the hydrophobic amino acid is proline.

[0077] In some embodiments, dry powder formulations described herein comprise (1) one or more hydrophobic amino acids and (2) at least one sugar.

[0078] In some embodiments, a dry powder formulation comprises an amino acid that is leucine and a sugar that is mannitol.

[0079] In some embodiments, a dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) at a weight ratio that ranges from 1:1 to 1:10. In some embodiments, a dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) at a weight ratio that ranges from 1:1 to 1:20. In some embodiments, a dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) at a weight ratio that ranges from 1:3 to 1:9. In some embodiments, a dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) at a weight ratio that ranges from 10:1 to 1:1. In some embodiments, a dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) at a weight ratio that ranges from 20:1 to 1:1.

[0080] In some embodiments, a dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) at a weight ratio that ranges from 1:3 to 1:9. In some embodiments, a dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) at a weight ratio that ranges from 1:4 to 1:8.

[0081] For example, in some embodiments, the weight ratio of an amino acid and sugar (e.g., leucine and mannitol) is 1:4. In some embodiments, the weight ratio of an amino acid and sugar (e.g., leucine and mannitol) is 1:8.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0082] In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:1. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:0.5. In some embodiments, a dry powder formulation comprises leucine and mannitol at a weight ratio of about 1:2. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:3. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:4. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:5. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:6. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:7. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:8. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:9. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of about 1:10. In some embodiments, a dry powder formulation comprises an amino acid and sugar (e.g., leucine and mannitol) at a weight ratio of greater than 1:10. In some embodiments, an amino acid is leucine, and a sugar is mannitol. N / P Ratios of Lipid Nanoparticles

[0083] In some embodiments, the preparation of LNPs entails encapsulating mRNA lipids are added to the aqueous buffer containing mRNA at a certain Nitrogen (lipid) to Phosphate (nucleic acid) ratio (N / P ratio).

[0084] In some embodiments, mRNA and lipids are combined with pump systems which maintain the lipid / mRNA (N / P) ratio constant throughout the process and which can also afford facile scale- up.

[0085] In some embodiments, the one or more LNPs encapsulating mRNA (also referred to as mRNA-loaded LNPs) have a lipid:mRNA (N / P) ratio ranging from 1 to 20, 1 to 15, 1 to 10, 2 to 8, 2 to 6, or 2 to 4. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 20. In some embodiments, the one or more mRNA- loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 18. In somePATENT ATTORNEY DOCKET NO.0171.0103-PCT embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 16. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 14. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 12. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 10. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 8. In some embodiments, the one or more mRNA- loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 6. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 20. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 16. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 12. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 8. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 6. In some embodiments, the one or more mRNA- loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 4. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 20. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 16. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 14. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 12. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 10. In some embodiments, the one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2 or 4. In some embodiments, the one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2. In some embodiments, the one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 4.

[0086] In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of between 2 and 6. In some embodiments, the N / P ratio is between 3 and 4. In some embodiments, the N / P ratio is 3.

[0087] In some embodiments, a dry powder formulation comprises lipid nanoparticles that are added to the mRNA at an N:P ratio of about 1. In some embodiments, a dry powder formulationPATENT ATTORNEY DOCKET NO.0171.0103-PCT comprises lipid nanoparticles are added to the mRNA at an N:P ratio of about 2. In some embodiments, a dry powder formulation comprises lipid nanoparticles are added to the mRNA at an N:P ratio of about 3. In some embodiments, a dry powder formulation comprises lipid nanoparticles are added to the mRNA at an N:P ratio of about 4. In some embodiments, a dry powder formulation comprises lipid nanoparticles are added to the mRNA at an N:P ratio of about 5. In some embodiments, a dry powder formulation comprises lipid nanoparticles are added to the mRNA at an N:P ratio of about 6. In some embodiments, a dry powder formulation comprises lipid nanoparticles are added to the mRNA at an N:P ratio of about 7. In some embodiments, a dry powder formulation comprises lipid nanoparticles are added to the mRNA at an N:P ratio of about 8. Median mass aerodynamic diameter of dry powder particles

[0088] In some embodiments, the median mass aerodynamic diameter is defined as particle diameter for which half of the aerosol mass is contained in smaller particles and half is contained in larger particle diameters. The respirable dry particles or dry powders can be delivered by inhalation to a desired area within the respiratory tract, as desired. It is known that particles with an aerodynamic diameter of about 1 micron to about 3 microns, can be delivered to the deep lung. Larger aerodynamic diameters, for example, from about 3 microns to about 5 microns can be delivered to the central and upper airways. If the MMAD of the individual particles is too large, e.g., above 5 um, then an increasing percentage of powder will deposit in the oral cavity.

[0089] In some embodiments, dry powder product particles in the range of 1 to 3 µm exhibit highest deposition in the central and peripheral airways leading to sedimentation and subsequent absorption, whereas particles below 1 and above 5 µm are exhaled out and swallowed, respectively. In some embodiments, characteristics such as bulk and tap density, moisture content, rate of water absorption, flowability, and surface area of the particles also play some role in dry powder product flow in the airways. Encapsulation Efficiencies

[0090] In some embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 98% or greater, including any values and subranges therebetween. In some embodiments, the one or more mRNA- loaded lipid nanoparticles have an encapsulation efficiency of 70% or greater. In somePATENT ATTORNEY DOCKET NO.0171.0103-PCT embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 75% or greater. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 80% or greater. In some embodiments, the one or more mRNA- loaded lipid nanoparticles have an encapsulation efficiency of 85% or greater. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 90% or greater. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 92% or greater. In some embodiments, the one or more mRNA- loaded lipid nanoparticles have an encapsulation efficiency of 94% or greater. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 96% or greater. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 95% or greater. In some embodiments, the one or more mRNA- loaded lipid nanoparticles have an encapsulation efficiency of 96% or greater. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 98% or greater. Pre-Spray Drying LNP Sizes and Sizing

[0091] Suitable mRNA loaded lipid nanoparticles may be made in various sizes. In some embodiments, the size of an mRNA loaded lipid nanoparticles pre-spray drying is determined by the length of the largest diameter of the lipid nanoparticle.

[0092] In some embodiments, an mRNA loaded lipid nanoparticle has a size pre-spray drying no greater than about 250 nm (e.g., no greater than about 250 nm, about 225 nm, about 200 nm, about 175 nm, about 150 nm, about 125 nm, about 100 nm, about 90 nm, about 80 nm, about 75 nm, about 70 nm, about 60 nm, about 50 nm, about 40 nm, about 30 nm, about 25 nm, about 20 nm, or about 10 nm, including any values and subranges therebetween). In some embodiments, a suitable liposome has a size ranging from about 10 nm to about 250 nm (e.g., ranging from about 10 nm to about 225 nm, about 10 nm to about 200 nm, about 10 nm to about 175 nm, about 10 nm to about 150 nm, about 10 nm to about 125 nm, about 10 nm to about 100 nm, about 10 nm to about 75 nm, or about 10 nm to about 50 nm). In some embodiments, an mRNA loaded lipid nanoparticle has a size pre-spray drying ranging from about 100 nm to about 250 nm (e.g., ranging from about 100 nm to about 225 nm, about 100 nm to about 200 nm, about 100 nm to about 175 nm, about 100 nm to about 150 nm). In some embodiments, an mRNA loaded lipid nanoparticle has a size pre- spray drying ranging from about 10 nm to about 100 nm (e.g., ranging from about 10 nm to aboutPATENT ATTORNEY DOCKET NO.0171.0103-PCT 90 nm, about 10 nm to about 80 nm, about 10 nm to about 70 nm, about 10 nm to about 60 nm, or about 10 nm to about 50 nm). In a particular embodiment, an mRNA loaded lipid nanoparticle has a size pre-spray drying less than about 100 nm.

[0093] A variety of alternative methods known in the art are available for sizing of a population of liposomes. One such sizing method is described in U.S. Pat. No.4,737,323, incorporated herein by reference. Sonicating a liposome suspension either by bath or probe sonication produces a progressive size reduction down to small ULV less than about 0.05 microns in diameter. Homogenization is another method that relies on shearing energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLV are recirculated through a standard emulsion homogenizer until selected liposome sizes, typically between about 0.1 and 0.5 microns, are observed. The size of the liposomes may be determined by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), incorporated herein by reference. Average liposome diameter may be reduced by sonication of formed liposomes. Intermittent sonication cycles may be alternated with QELS assessment to guide efficient liposome synthesis. Spray-Drying Process

[0094] Spray drying is a commonly used, economical, and established technique to manufacture the dry powder product for various modalities such as small molecules, peptides, and proteins. The technique is continuous, scalable, suitable for heat sensitive material, can produce consistent dry powder product, and can be automated. Various sugars such as lactose and mannitol are commonly used as carrier excipients to facilitate the spray drying process. For example, in the compositions and processes described herein, beneficial properties of mannitol as an excipient for spray drying of mRNA formulations include (i) altering effect on the viscoelastic properties associated to the phlegm (ii) increasing water content driven by osmotic gradient (iii) less hygroscopic compared to some other sugars like lactose (iv) non-reducing sugar with absence of aldehyde group etc. However, amino acids such as leucine, isoleucine, and trileucine have been utilized to increase the dispersibility and decrease the MMAD of dry powder product. Although spray drying is continuous, scalable, suitable for heat sensitive material and can produce consistent DPP, reports of excipient screening and optimization of formulation properties and aerosol performance of spray dried mRNA LNPs are minimal.

[0095] Various spray-drying processes may be used to practice the present disclosure.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0096] The process involves, in general, removal of moisture from a composition by passing a liquid form of the composition through an apparatus; a simplified diagrammatic depiction is provided as FIG.1. In brief, a liquid formulation comprising the composition of interest is passed through a narrow inlet spray “atomizer” nozzle into a first chamber, which is the drying chamber. Usually, the liquid formulation is passed in a steady stream. The liquid formulation is sprayed as tiny droplets into the drying chamber. A stream of heated air or gas is also led into the drying chamber to form an air current. Passage of the formulation through this heated current disperses the incoming droplets, dries them into the solid particulate form. This product is led into a second chamber by flow through a connector or pipe. The second chamber is the cyclone powder collector. Here, the air circulation generates a cyclone, and the powder particles are collected via a vortex stream into a collection vessel attached to the outlet end. The cyclone chamber is attached to an exhaust fan, which helps cool the components. The inlet and outlet temperatures are operator adjustable. The respective inlet and outlet temperatures, the chamber temperatures, the liquid feed flow rate (aspirator %), pressure, nature of the heated air current and most importantly, the composition of the liquid feed are suitably adjusted for optimal drying of any particulate matter.

[0097] In some embodiments, the inlet temperature is adjustable within a range of 40°C to 200°C. In some embodiments, the outlet temperature ranges between 20-70°C. The relative pressure of the pump and the aspirator is also operator adjustable. In some embodiments, the inlet temperature was adjusted to 55°C. In some embodiments, the inlet temperature was adjusted to 60°C. In some embodiments, the inter temperature was adjusted to 61°C. In some embodiments, the inter temperature was adjusted to 62°C. In some embodiments, the inter temperature was adjusted to 63°C. In some embodiments, the inter temperature was adjusted to 64°C. In some embodiments, the inter temperature was adjusted to 65°C. In some embodiments, the inter temperature was adjusted to 70°C. In some embodiments, for spray-drying mRNA-lipid nanoparticle, the inlet temperature is adjusted between 70°C and 200°C. In some embodiments, the inlet temperature is adjusted between 80°C and 200°C. In some embodiments, the inlet temperature is adjusted between 90°C and 200°C. In some embodiments, the inlet temperature is adjusted between 95°C and 180°C. In some embodiments, the inlet temperature is adjusted between 95°C and 160°C. In some embodiments, the inlet temperature is adjusted between 90°C and 150°C. In some embodiments, the inlet temperature is adjusted between 90°C and 120°C. In some embodiments the inlet temperature is adjusted between 90°C and 100°C. In some embodiments, the inletPATENT ATTORNEY DOCKET NO.0171.0103-PCT temperature is 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, or 100°C, including any values and subranges therebetween.

[0098] In some embodiments, the outlet temperature ranges between 20°C to 70°C. In some embodiments, the outlet temperature is between 30°C to 60°C. In some embodiments, the outlet temperature is between 20°C to 50°C. In some embodiments, the outlet temperature is between 30°C to 50°C. In some embodiments, the outlet temperature is between 40°C to 50°C. In some embodiments, the outlet temperature is between 45°C and 50°C.

[0099] Spray drying can be carried out using any suitable spray-drying device. As is known to a person of ordinary skill in the art, a variety of spray-drying instruments are commercially available and can be used to practice the present disclosure. Exemplary commercially available devices suitable for the present disclosure include, but are not limited to the following: Mini Spray Dryer B-290; Nano Spray Dryer B-90 (manufactured by Buchi); Anhydro MicraSpray Dryer GMP; Anhydro MicraSpray Dryer Aseptic series (manufactured by SPX FLOW); MDL-50 and MDL- 015 (manufactured by Fujisaki Electric); Versatile Mini Sprayer Dryer GAS410 (manufactured by Yamato Scientific America); LSD-1500 Mini spray dryer, MSD-8 Multi -functional laboratory spray dryer; PSD-12 Precision pharmacy spray dryer; (manufactured by Changzhou Xiandao Drying Equipment Co. Ltd); TALL FORM DRYER™; Multi-Stage Dryer; COMPACT DRYER™; FILTERMAT™ Spray Dryer; VERSATILE-SD™; Fluidized Spray Dryer; MOBILE MINOR™; SDMICRO™; PRODUCTION MINOR™ (manufactured by GEA Process Engineering) and many others. Convenient scale up from laboratory scale to industrial manufacturing scale is also available from several of these manufacturers. Dry Powders

[0100] Dry powders prepared according to the present disclosure contain a plurality of spray-dried particles. Residual moisture content, aerosol performance and physio-chemical stability are important parameters for spray-dried pharmaceutical products. It is determined by the sample weight loss after heating and drying, using the equation: Moisture content % =^ௌ^್ିௌ^ ^ൈ 100%, wherein, SWb is theheating and SWa is the sample weight after heating. Perkin Elmer TGA 7 (Perkin Elmer) is an example of commercially used instrument with associated software for the measurement of residual moisture in a nanoparticle.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0101] In general, an admissible range of particle size distribution is maintained for uniformity of dosing of an active pharmaceutical ingredient of the formulation. For example, therapeutic treatments for liver and lung diseases are being developed by delivering synthetic mRNA encoding a missing and / or a non-functional protein to the corresponding organ cells via intravenous and inhalable routes, respectively. For pulmonary delivery in particular, the particles of the dry powder formulation affect distribution and deposition of an aerosol within the respiratory system. In many cases, particle deposition to the large conducting airways is preferred for effective absorption and distribution of the therapeutic component. Aerosol of very fine particles, for instance, particles having less than 1 micrometer diameter may be deposited peripherally for effective absorption by specific cells of the lung, such as smooth muscles for an active pharmaceutical ingredient functioning as bronchodilator.

[0102] In some embodiments, the mean particle size of the dry powder formulation is between 0.5-10µm. In some embodiments, the mean particle size of the dry powder formulation is between 1-8 µm. In some embodiments, the mean particle size of the dry powder formulation is between 1-7 µm. In some embodiments, the mean particle size of the dry powder formulation is between 1-6 µm. In some embodiments, the mean particle size of the dry powder formulation is between 1-5 µm. In some embodiments, the mean particle size of the dry powder formulation is between 1-4 µm. In some embodiments, the mean particle size of the dry powder formulation is between 1-3 µm. In some embodiments, the mean particle size of the dry powder formulation is between 1-2 µm. In some embodiments, the mean particle size of the dry powder formulation is 2 µm. In some embodiments, the mean particle size of the dry powder formulation is 3 µm. In some embodiments, the mean particle size of the dry powder formulation is 5 µm. In some embodiments, the mean particle size of the dry powder formulation is 8 µm. In some embodiments, the mean particle size of the dry powder formulation is 9 µm. In some embodiments, the mean particle size of the dry powder formulation is 10 µm.

[0103] Primary particle size distributions of spray-dried particles are measured by dynamic light scattering, which is expressed in terms of Z-average. The Z-average is the mean, also known as the cumulant size, calculated from the intensity- weighted distribution of particle diameter and is given by the formula, ∑^ ^^^PATENT ATTORNEY DOCKET NO.0171.0103-PCT where, Si is the scattered intensity from the particle ‘i’, and Di is the particle’s diameter. In addition to these parameters, a fine and a course fraction of the particles is defined.

[0104] Polydispersity index (PDI), on the other hand is the measure of the distribution of molecular mass of a given particulate sample. In some embodiments, the polydispersity index of the glycerol and propylene glycol based LNP is less than 0.2. In some embodiments, the polydispersity index of the glycerol and propylene glycol based LNP is about 0.1. In some embodiments, the polydispersity index of the glycerol and propylene glycol based LNP is less than about 0.1. mRNA

[0105] In some embodiments, the mRNA constitutes greater than about 2% of the dry powder formulation by weight. In some embodiments, the mRNA constitutes greater than about 3% of the dry powder formulation by weight. In some embodiments, the mRNA constitutes greater than about 3% of the dry powder formulation by weight. In some embodiments, the mRNA constitutes greater than about 4% of the dry powder formulation by weight.

[0106] It was observed that the dry powder formulation of mRNA of the present disclosure had high stability even after the brief exposure of LNPs to heat and stress during spray drying. In some embodiments, the mRNA in the dry powder formulation maintains a greater than about 80% integrity post spray drying. In some embodiments, the mRNA in the dry powder formulation maintains a greater than about 85% integrity post spray drying. In some embodiments, the mRNA in the dry powder formulation maintains a greater than about 90% integrity post spray drying. In some embodiments, the mRNA in the dry powder formulation maintains a greater than about 95% integrity post spray drying.

[0107] It is desired that the integrity of the mRNA be maintained after multiple freeze-thaw cycles and / or for prolonged periods of time for maintaining therapeutic benefit. In some embodiments, the mRNA maintains integrity of 80% or greater after storage at room temperature for 6 months or longer. In some embodiments, the mRNA maintains integrity of 80% or greater after storage at room temperature for 3 months or longer. In some embodiments, the mRNA maintains integrity of 80% or greater after storage at room temperature for 1 year or longer. In some embodiments, the mRNA maintains integrity of 90% or greater after storage at room temperature for 6 months or longer. In some embodiments, the mRNA maintains integrity of 90% or greater after storage atPATENT ATTORNEY DOCKET NO.0171.0103-PCT room temperature for 3 months or longer. In some embodiments, the mRNA maintains integrity of 90% or greater after storage at room temperature for 1 year or longer.

[0108] In some embodiments, the mRNA maintains integrity of 80% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains integrity of 80% or greater after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains integrity of 80% or greater after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains integrity of 80% or greater after storage at 25°C for a year or longer. In some embodiments, the mRNA maintains integrity of 85% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains integrity of 85% or greater after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains integrity of 85% or greater after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains integrity of 85% or greater after storage at 25°C for a year or longer. In some embodiments, the mRNA maintains integrity of 90% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains integrity of 90% or greater after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains integrity of 90% or greater after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains integrity of 90% or greater after storage at 25°C for a year or longer. In some embodiments, the mRNA maintains integrity of 95% or greater after storage at 25°C for 4 weeks or longer. In some embodiments, the mRNA maintains integrity of 95% or greater after storage at 25°C for 3 months or longer. In some embodiments, the mRNA maintains integrity of 95% or greater after storage at 25°C for 6 months or longer. In some embodiments, the mRNA maintains integrity of 95% or greater after storage at 25°C for a year or longer.

[0109] In some embodiments, the mRNA maintains integrity of 80% or greater after storage at - 80°C after 3 freeze thaw cycles. In some embodiments, the mRNA maintains integrity of 90% or greater after storage at -80°C after 3 freeze thaw cycles.

[0110] As used herein, the phrase “the mRNA maintains integrity of x% or greater after storage” means that the mRNA integrity does not decrease more than (100-x)% after storage. mRNA Synthesis

[0111] mRNAs according to the present disclosure may be synthesized according to any of a variety of known methods. Various methods are described in published U.S. Application No. USPATENT ATTORNEY DOCKET NO.0171.0103-PCT 2018 / 0258423, and can be used to practice the present disclosure, all of which are incorporated herein by reference. For example, mRNAs according to the present disclosure may be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor. The exact conditions will vary according to the specific application.

[0112] In some embodiments, a suitable mRNA sequence is an mRNA sequence encoding a protein or a peptide. In some embodiments, a suitable mRNA sequence is codon optimized for efficient expression human cells. In some embodiments, a suitable mRNA sequence is naturally- occurring or a wild-type sequence. In some embodiments, a suitable mRNA sequence encodes a protein or a peptide that contains one or mutations in amino acid sequence. An exemplary mRNA coding sequence and the corresponding amino acid sequence are shown below: Exemplary Construct design for mRNAs X – mRNA coding region – Y 5’ and 3’ UTR Sequences X (5′ UTR Sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACC GGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCG UGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 1) Y (3′ UTR Sequence) = CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCC ACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2) OR GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCA CUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0113] The present disclosure may be used to deliver mRNAs of a variety of lengths. In some embodiments, the present disclosure may be used to deliver in vitro synthesized mRNA of or greater than about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb 6 kb, 7 kb, 8PATENT ATTORNEY DOCKET NO.0171.0103-PCT kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 20 kb, 30 kb, 40 kb, or 50 kb in length, , including any values and subranges therebetween. In some embodiments, the present disclosure may be used to deliver in vitro synthesized mRNA ranging from about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-50 kb in length.

[0114] In some embodiments, for the preparation of mRNA according to the disclosure, a DNA template is transcribed in vitro. A suitable DNA template typically has a promoter, for example a T3, T7 or SP6 promoter, for in vitro transcription, followed by desired nucleotide sequence for desired mRNA and a termination signal. Nucleotides

[0115] Various naturally-occurring or modified nucleosides may be used to produce mRNA according to the present disclosure. In some embodiments, an mRNA is or comprises naturally- occurring nucleosides (or unmodified nucleotides; e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3- methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2- aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5- propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine, (e.g., N-1-methyl- pseudouridine), 2-thiouridine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages).

[0116] In some embodiments, a suitable mRNA may contain backbone modifications, sugar modifications and / or base modifications. For example, modified nucleotides may include, but not be limited to, modified purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and as modified nucleotides analogues or derivatives of purines and pyrimidines, such as e.g. 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6- methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl- guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2- thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-PATENT ATTORNEY DOCKET NO.0171.0103-PCT (carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl- uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5- methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl- uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1- methyl-pseudouracil, queosine, .beta.-D-mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7- deazaguanosine, 5-methylcytosine and inosine. The preparation of such analogues is known to a person skilled in the art, for instance, from the U.S. Pat. No.4,373,071, U.S. Pat. No.4,401,796, U.S. Pat. No.4,415,732, U.S. Pat. No.4,458,066, U.S. Pat. No.4,500,707, U.S. Pat. No.4,668,777, U.S. Pat. No.4,973,679, U.S. Pat. No.5,047,524, U.S. Pat. No.5,132,418, U.S. Pat. No.5,153,319, U.S. Pat. Nos.5,262,530 and 5,700,642, the disclosures of which are incorporated by reference in their entirety.

[0117] In some embodiments, the mRNA comprises one or more nonstandard nucleotide residues. The nonstandard nucleotide residues may include, e.g., 5-methyl-cytidine (“5mC”), pseudouridine (“yU”), and / or 2-thio-uridine (“2sU”). See, e.g., U.S. Patent No.8,278,036 or WO 2011 / 012316 for a discussion of such residues and their incorporation into mRNA. The mRNA may be RNA, which is defined as RNA in which 25% of U residues are 2-thio-uridine and 25% of C residues are 5-methylcytidine. Teachings for the use of RNA are disclosed US Patent Publication US 2012 / 0195936 and international publication WO 2011 / 012316, both of which are hereby incorporated by reference in their entirety. The presence of nonstandard nucleotide residues may render an mRNA more stable and / or less immunogenic than a control mRNA with the same sequence but containing only standard residues. In further embodiments, the mRNA may comprise one or more nonstandard nucleotide residues chosen from isocytosine, pseudoisocytosine, 5- bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine and 2- chloro-6-aminopurine cytosine, as well as combinations of these modifications and other nucleobase modifications. Some embodiments may further include additional modifications to the furanose ring or nucleobase. Additional modifications may include, for example, sugar modifications or substitutions (e.g., one or more of a 2′-O-alkyl modification, a locked nucleic acid (LNA)). In some embodiments, the RNAs may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNA). In some embodiments where the sugar modification is a 2′-O-alkyl modification, such modification may include, but are not limited to aPATENT ATTORNEY DOCKET NO.0171.0103-PCT 2′-deoxy-2′-fluoro modification, a 2′-O-methyl modification, a 2′-O-methoxyethyl modification and a 2′-deoxy modification. In some embodiments, any of these modifications may be present in 0-100% of the nucleotides—for example, more than 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or 100% of the constituent nucleotides individually or in combination.

[0118] In some embodiments, mRNAs may contain RNA backbone modifications. Typically, a backbone modification is a modification in which the phosphates of the backbone of the nucleotides contained in the RNA are modified chemically. Exemplary backbone modifications typically include, but are not limited to, modifications from the group consisting of methylphosphonates, methylphosphoramidates, phosphoramidates, phosphorothioates (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphates, positively charged guanidinium groups etc., which means by replacing the phosphodiester linkage by other anionic, cationic or neutral groups.

[0119] In some embodiments, mRNAs may contain sugar modifications. A typical sugar modification is a chemical modification of the sugar of the nucleotides it contains including, but not limited to, sugar modifications chosen from the group consisting of 2'-deoxy-2'-fluoro- oligoribonucleotide (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'- triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotide (2'-amino-2'-deoxycytidine 5'- triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotide, 2'-deoxy- 2'-C-alkyloligoribonucleotide (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'- triphosphate), 2'-C-alkyloligoribonucleotide, and isomers thereof (2'-aracytidine 5'-triphosphate, 2'-arauridine 5'-triphosphate), or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'- azido-2'-deoxyuridine 5'-triphosphate). Post-synthesis processing

[0120] Typically, a 5′ cap and / or a 3′ tail may be added after the synthesis. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of a “tail” serves to protect the mRNA from exonuclease degradation.

[0121] A 5’ cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5’ nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5’5’5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp (5'(A,G(5')ppp(5')A and G(5')ppp(5')G. Additional cap structures are described in published U.S.PATENT ATTORNEY DOCKET NO.0171.0103-PCT Application No. US 2016 / 0032356 and published U.S. Application No. US 2018 / 0125989, which are incorporated herein by reference.

[0122] Typically, a tail structure includes a poly(A) and / or poly(C) tail. A poly-A or poly-C tail on the 3' terminus of mRNA typically includes at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb adenosine or cytosine nucleotides, respectively, including any values and subranges therebetween. In some embodiments, a poly A or poly C tail may be about 10 to 800 adenosine or cytosine nucleotides (e.g., about 10 to 200 adenosine or cytosine nucleotides, about 10 to 300 adenosine or cytosine nucleotides, about 10 to 400 adenosine or cytosine nucleotides, about 10 to 500 adenosine or cytosine nucleotides, about 10 to 550 adenosine or cytosine nucleotides, about 10 to 600 adenosine or cytosine nucleotides, about 50 to 600 adenosine or cytosine nucleotides, about 100 to 600 adenosine or cytosine nucleotides, about 150 to 600 adenosine or cytosine nucleotides, about 200 to 600 adenosine or cytosine nucleotides, about 250 to 600 adenosine or cytosine nucleotides, about 300 to 600 adenosine or cytosine nucleotides, about 350 to 600 adenosine or cytosine nucleotides, about 400 to 600 adenosine or cytosine nucleotides, about 450 to 600 adenosine or cytosine nucleotides, about 500 to 600 adenosine or cytosine nucleotides, about 10 to 150 adenosine or cytosine nucleotides, about 10 to 100 adenosine or cytosine nucleotides, about 20 to 70 adenosine or cytosine nucleotides, or about 20 to 60 adenosine or cytosine nucleotides) respectively. In some embodiments, a tail structure includes is a combination of poly (A) and poly (C) tails with various lengths described herein. In some embodiments, a tail structure includes at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides, including any values and subranges therebetween. In some embodiments, a tail structure includes at least 50%, 55%, 65%,PATENT ATTORNEY DOCKET NO.0171.0103-PCT 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides, including any values and subranges therebetween.

[0123] As described herein, the addition of the 5’ cap and / or the 3’ tail facilitates the detection of abortive transcripts generated during in vitro synthesis because without capping and / or tailing, the size of those prematurely aborted mRNA transcripts can be too small to be detected. Thus, in some embodiments, the 5’ cap and / or the 3’ tail are added to the synthesized mRNA before the mRNA is tested for purity (e.g., the level of abortive transcripts present in the mRNA). In some embodiments, the 5’ cap and / or the 3’ tail are added to the synthesized mRNA before the mRNA is purified as described herein. In other embodiments, the 5’ cap and / or the 3’ tail are added to the synthesized mRNA after the mRNA is purified as described herein.

[0124] mRNA synthesized according to the present disclosure may be used without further purification. In particular, mRNA synthesized according to the present disclosure may be used without a step of removing shortmers. In some embodiments, mRNA synthesized according to the present disclosure may be further purified. Various methods may be used to purify mRNA synthesized according to the present disclosure. For example, purification of mRNA can be performed using centrifugation, filtration and / or chromatographic methods. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification or any other suitable means. In some embodiments, the mRNA is purified by HPLC. In some embodiments, the mRNA is extracted in a standard phenol: chloroform : isoamyl alcohol solution, well known to one of skill in the art. In some embodiments, the mRNA is purified using Tangential Flow Filtration. Suitable purification methods include those described in published U.S. Application No. US 2016 / 0040154, published U.S. Application No. US 2015 / 0376220, published U.S. Application No. US 2018 / 0251755, published U.S. Application No. US 2018 / 0251754, U.S. Provisional Application No. 62 / 757,612 filed on November 8, 2018, and U.S. Provisional Application No. 62 / 891,781 filed on August 26, 2019, all of which are incorporated by reference herein and may be used to practice the present disclosure.

[0125] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified both before and after capping and tailing.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0126] In some embodiments, the mRNA is purified either before or after or both before and after capping and tailing, by centrifugation. In some embodiments, the mRNA is purified either before or after or both before and after capping and tailing, by filtration. In some embodiments, the mRNA is purified either before or after or both before and after capping and tailing, by Tangential Flow Filtration (TFF). In some embodiments, the mRNA is purified either before or after or both before and after capping and tailing by chromatography. Additional Lipids

[0127] In some embodiments, lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, lipid nanoparticles further comprise one or more cholesterol-based lipids. In some embodiments, the one or more cationic lipids constitutes about 30-70% of the total lipids in LNPs by molar %. In some embodiments, the one or more PEG-modified lipids constitutes about 1-15% of the total lipids in LNP by molar %. In some embodiments, the one or more non-cationic lipids constitutes about 10-40% of the total lipids in LNP by molar %. In some embodiments, the one or more cholesterol-based lipids comprise about 5-40% of the total lipids in LNP by molar %.

[0128] In some embodiments, the molar ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles is approximately 60:25:10:5. In some embodiments, the molar ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles is approximately 40:25:30:5.

[0129] Exemplary lipids are described herein. Cationic Lipids

[0130] As used herein, the phrase “cationic lipids” refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH.

[0131] Suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2010 / 144740, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid, (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19- yl 4-(dimethylamino) butanoate, having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCT and pharmaceutically acceptable salts thereof.

[0132] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include ionizable cationic lipids as described in International Patent Publication WO 2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of one of the following formulas: selectedfrom the group consisting of hydrogen, an optionally substituted, variably saturated or unsaturated C1-C20alkyl and an optionally substituted, variably saturated or unsaturated C6-C20acyl; wherein L1 and L2 are each independently selected from the group consisting of hydrogen, an optionally substituted C1-C30 alkyl, an optionally substituted variably unsaturated C1-C30 alkenyl, and an optionally substituted C1-C30alkynyl; wherein m and o are each independently selected from the group consisting of zero and any positive integer (e.g., where m is three); and wherein n is zero or any positive integer (e.g., where n is one). In certain embodiments, the compositions and methods of the present disclosure include the cationic lipid (15Z, 18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca- 9,12-dien-l-yl) tetracosa-15,18-dien-1-amine (“HGT5000”), having a compound structure of:and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include the cationic lipid (15Z, 18Z)-N,N-dimethyl-6-((9Z,12Z)- octadeca-9,12-dien-1-yl) tetracosa-4,15,18-trien-l -amine (“HGT5001”), having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCT and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include the cationic lipid and (15Z,18Z)-N,N-dimethyl-6- ((9Z,12Z)-octadeca-9,12-dien-1-yl) tetracosa-5,15,18-trien- 1 -amine (“HGT5002”), having a compound structure of:and pharmaceutically acceptable salts thereof.

[0133] Other suitable cationic lipids for use in the compositions and methods of the disclosure include cationic lipids described as aminoalcohol lipidoids in International Patent Publication WO 2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:and pharmaceutically acceptable salts thereof.

[0134] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0135] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:

[0136] Other suitable cationic lipids for use in the compositions and methods of the disclosure include a cationic lipid having the formula of 14,25-ditridecyl 15,18,21,24-tetraaza- octatriacontane, and pharmaceutically acceptable salts thereof.

[0137] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publications WO 2013 / 063468 and WO 2016 / 205691, each of which are incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: each instanceLof R is independently optionally substituted C6-C40 alkenyl. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCT andembodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCTthe compositions and methods of the present disclosure include a cationic lipid having a compound structure of:

[0138] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2015 / 184256,PATENT ATTORNEY DOCKET NO.0171.0103-PCT which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: salt thereof, wherein each X independently is O or S; each Yindependently is O or S; each m independently is 0 to 20; each n independently is 1 to 6; each RA is independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl or halogen; and each RB is independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl or halogen. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid, “Target 23”, having a compound structure of:and pharmaceutically acceptable salts thereof.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0139] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the compound structure:In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the compound structure:compositions and methods of the present disclosure include a cationic lipid having the compound structure:

[0140] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in United States Provisional Patent Application Serial Number 62 / 758,179, which is incorporated herein by reference. In some embodiments, thePATENT ATTORNEY DOCKET NO.0171.0103-PCT compositions and methods of the present disclosure include a cationic lipid of the following formula: ,or a pharmaceutically acceptable salt thereof, wherein each R1and R2is independently H or C1-C6 aliphatic; each m is independently an integer having a value of 1 to 4; each A is independently a covalent bond or arylene; each L1is independently an ester, thioester, disulfide, or anhydride group; each L2is independently C2-C10aliphatic; each X1is independently H or OH; and each R3is independently C6-C20 aliphatic. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula:or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: HO C H O OHor a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula:PATENT ATTORNEY DOCKET NO.0171.0103-PCTor a

[0141] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include the cationic lipids as described in J. McClellan, M. C. King, Cell 2010, 141, 210-217 and in Whitehead et al., Nature Communications (2014) 5:4277, which is incorporated herein by reference. In certain embodiments, the cationic lipids of the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:and pharmaceutically acceptable salts thereof.

[0142] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT the compositions andmethods of the present disclosure include a cationic lipid having the compound structure:compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:some the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT the compositions andmethods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0143] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT the compositions andpresent a the compound structure: the compositions andmethods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT the compositions andmethods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT the compositions andpresent a structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the compound structure: the compositions andmethods of the present disclosure include a cationic lipid having the compound structure:

[0144] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: orsalt thereof, wherein one of L1or L2is -O(C=O)-, -(C=O)O-, - C(=O)-, -O-, -S(O)x, -S-S-, -C(=O)S-, -SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, NRaC(=O)NRa-, - OC(=O)NRa-, or -NRaC(=O)O-; and the other of L1or L2is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, - S(O) x, -S-S-, -C(=O)S-, SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, ,NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O- or a direct bond; G1and G2are each independently unsubstituted C1-C12 alkylene or C1-C12alkenylene; G3is C1-C24alkylene, C1-C24alkenylene, C3-C8cycloalkylene, C3-C8PATENT ATTORNEY DOCKET NO.0171.0103-PCT cycloalkenylene; Rais H or C1-C12 alkyl; R1and R2are each independently C6-C24 alkyl or C6-C24 alkenyl; R3is H, OR5, CN, -C(=O)OR4, -OC(=O)R4or -NR5C(=O)R4; R4is C1-C12 alkyl; R5is H or C1-C6alkyl; and x is 0, 1 or 2.

[0145] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:the compositions and methods of the present disclosure include a cationic lipid having the compound structure:

[0146] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipids of thePATENT ATTORNEY DOCKET NO.0171.0103-PCT compositions and methods of the present disclosure include a compound of one of the following formulas:one of these four formulas, R4 is independently selected from -(CH2)nQ and -(CH2)nCHQR; Q is selected from the group consisting of -OR, -OH, -O(CH2)nN(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, - N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, - N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), and a heterocycle; and n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCT embodiments, the compositions andpresent a having a compound structure of: embodiments, the compositions andmethods of the present disclosure include a cationic lipid having a compound structure of:embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:

[0147] Other suitable cationic lipids for use in the compositions and methods of the disclosure include the cationic lipids as described in International Patent Publication WO 2017 / 173054 and WO 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCT the compositions andmethods of the present disclosure include a cationic lipid having a compound structure of:the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:embodiments, the compositions and methods of the present disclosure include a cationic lipid having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0148] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cleavable cationic lipids as described in International Patent Publication WO 2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: , from the group consisting of imidazole, guanidinium, amino, imine,enamine, an optionally-substituted alkyl amino (e.g., an alkyl amino such as dimethylamino) and pyridyl; wherein R2 is selected from the group consisting of one of the following two formulas:from the group consisting of an optionally substituted, variably saturated or unsaturated C6-C20 alkyl and an optionally substituted, variably saturated or unsaturated C6-C20 acyl; and wherein n is zero or any positive integer (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more). In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid, “HGT4001”, having a compound structure of:and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid, “HGT4002”, having a compound structure of:PATENT ATTORNEY DOCKET NO.0171.0103-PCTand pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid, “HGT4003”, having a compound structure of:and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid, “HGT4004”, having a compound structure of:and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid “HGT4005”, having a compound structure of:and pharmaceutically acceptable salts thereof.

[0149] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include HEPES-based disulfide cationic lipids with a piperazine core as described in International Patent Publication WO 2022 / 221688, which is incorporated herein by reference. InPATENT ATTORNEY DOCKET NO.0171.0103-PCT some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: yl)amino)propyl)disulfaneyl)ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydecyl)amino)butanoate)) and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula:butyl)disulfaneyl) ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydodecyl)amino)butanoate)) and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula:PATENT ATTORNEY DOCKET NO.0171.0103-PCT amino)propyl)disulfaneyl)ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydodecyl)amino)butanoate)) and pharmaceutically acceptable salts thereof.

[0150] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids as described in Dong et al., PNAS, 2014, 111(11):3955-3960 and U.S. Pat. No. 9,512,073, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula:and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula:PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0151]

[0152] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cleavable cationic lipids as described in U.S. Provisional Application No. 62 / 672,194, filed May 16, 2018, and incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid that is any of general formulas or any of structures (1a)-(21a) and (1b)-(21b) and (22)-(237) described in U.S. Provisional Application No.62 / 672,194. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid that has a structure according to Formula (I’), ,–L5A-L5B-B’; each of L1, L2, and L3is independently a covalent bond, -C(O)-, -C(O)O-, -C(O)S-, or - C(O)NRL-; each L4Aand L5Ais independently -C(O)-, -C(O)O-, or -C(O)NRL-; each L4Band L5Bis independently C1-C20 alkylene; C2-C20 alkenylene; or C2-C20 alkynylene; each B and B’ is NR4R5or a 5- to 10-membered nitrogen-containing heteroaryl; each R1, R2, and R3is independently C6-C30 alkyl, C6-C30 alkenyl, or C6-C30 alkynyl;PATENT ATTORNEY DOCKET NO.0171.0103-PCT each R4and R5is independently hydrogen, C1-C10 alkyl; C2-C10 alkenyl; or C2-C10 alkynyl; and each RLis independently hydrogen, C1-C20alkyl, C2-C20alkenyl, or C2-C20alkynyl.

[0153] In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid that is Compound (139) of 62 / 672,194, having a compound structure of:.

[0154] In some embodiments, the compositions and methods of the present disclosure include the cationic lipid, N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (“DOTMA”) (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355, which is incorporated herein by reference). Other cationic lipids suitable for the compositions and methods of the present disclosure include, for example, 5-carboxyspermylglycinedioctadecylamide (“DOGS”); 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium (“DOSPA”) (Behr et al. Proc. Nat.'l Acad. Sci.86, 6982 (1989), U.S. Pat. No.5,171,678; U.S. Pat. No. 5,334,761); l,2-Dioleoyl-3-Dimethylammonium-Propane (“DODAP”); l,2-Dioleoyl-3- Trimethylammonium-Propane (“DOTAP”).

[0155] Additional exemplary cationic lipids suitable for the compositions and methods of the present disclosure also include: l,2-distearyloxy-N,N-dimethyl-3-aminopropane ( “DSDMA”); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (“DODMA”); 1 ,2-dilinoleyloxy-N,N-dimethyl-3- aminopropane (“DLinDMA”); l,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane (“DLenDMA”); N-dioleyl-N,N-dimethylammonium chloride (“DODAC”); N,N-distearyl-N,N- dimethylammonium bromide (“DDAB”); N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N- hydroxyethyl ammonium bromide (“DMRIE”); 3-dimethylamino-2-(cholest-5-en-3-beta- oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane (“CLinDMA”); 2-[5'-(cholest-5-en-3- beta-oxy)-3'-oxapentoxy)-3-dimethy l-l-(cis,cis-9', l-2'-octadecadienoxy)propanePATENT ATTORNEY DOCKET NO.0171.0103-PCT (“CpLinDMA”); N,N-dimethyl-3,4-dioleyloxybenzylamine (“DMOBA”); 1 ,2-N,N'- dioleylcarbamyl-3-dimethylaminopropane (“DOcarbDAP”); 2,3-Dilinoleoyloxy-Ν,Ν- dimethylpropylamine (“DLinDAP”); l,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (“DLincarbDAP”); l ,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (“DLinCDAP”); 2,2- dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane (“DLin-K-DMA”); 2-((8-[(3P)-cholest-5-en- 3-yloxy]octyl)oxy)-N, N-dimethyl-3-[(9Z, 12Z)-octadeca-9, 12-dien-1 -yloxy]propane-1-amine (“Octyl-CLinDMA”); (2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N, N-dimethyl-3- [(9Z, 12Z)-octadeca-9, 12-dien-1-yloxy]propan-1 -amine (“Octyl-CLinDMA (2R)”); (2S)-2-((8- [(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N, fsl-dimethyh3-[(9Z, 12Z)-octadeca-9, 12-dien-1 - yloxy]propan-1 -amine (“Octyl-CLinDMA (2S)”); 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]- dioxolane (“DLin-K-XTC2-DMA”); and 2-(2,2-di((9Z,12Z)-octadeca-9,l 2-dien- 1-yl)-l ,3- dioxolan-4-yl)-N,N-dimethylethanamine (“DLin-KC2-DMA”) (see, WO 2010 / 042877, which is incorporated herein by reference; Semple et al., Nature Biotech.28: 172-176 (2010)). (Heyes, J., et al., J Controlled Release 107: 276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8): 1003-1007 (2005); International Patent Publication WO 2005 / 121348). In some embodiments, one or more of the cationic lipids comprise at least one of an imidazole, dialkylamino, or guanidinium moiety.

[0156] In some embodiments, one or more cationic lipids suitable for the compositions and methods of the present disclosure include 2,2-Dilinoley1-4-dimethylaminoethy1-[1,3]-dioxolane (“XTC”); (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH- cyclopenta[d] [1 ,3]dioxol-5-amine (“ALNY-100”) and / or 4,7,13-tris(3-oxo-3-(undecylamino) propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide (“NC98-5”).

[0001] In some embodiments, the compositions and methods of the present disclosure include the cationic lipid known as ALC-0315 ([(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl)bis(2- hexyldecanoate)), which is a synthetic lipid having the following chemical structure:PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0157] In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, including any values and subranges therebetween, measured by weight, of the total lipid content in the composition, e.g., a lipid nanoparticle. In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, including any values and subranges therebetween, measured as a mol %, of the total lipid content in the composition, e.g., a lipid nanoparticle. In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute about 30-70 % (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35- 40%, including any values and subranges therebetween), measured by weight, of the total lipid content in the composition, e.g., a lipid nanoparticle. In some embodiments, the compositions of the present disclosure include one or more cationic lipids that constitute about 30-70 % (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35- 50%, about 35-45%, or about 35-40%, including any values and subranges therebetween), measured as mol %, of the total lipid content in the composition, e.g., a lipid nanoparticle. Non-Cationic / Helper Lipids

[0158] In some embodiments, provided liposomes contain one or more non-cationic (“helper”) lipids. As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected H, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG),PATENT ATTORNEY DOCKET NO.0171.0103-PCT dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2- oleoyl-phosphatidyethanolamine (SOPE), or a mixture thereof.

[0159] In some embodiments, a non-cationic lipid is DPPC. In some embodiments, a non-cationic lipid is DOPE. In some embodiments, a non-cationic lipid is DEPE.

[0160] In some embodiments, such non-cationic lipids may be used alone, but are preferably used in combination with other lipids, for example, cationic lipids. In some embodiments, the non- cationic lipid may comprise a molar ratio of about 5% to about 90%, or about 10 % to about 70% of the total lipid present in a liposome. In some embodiments, a non-cationic lipid is a neutral lipid, i.e., a lipid that does not carry a net charge in the conditions under which the composition is formulated and / or administered. In some embodiments, the percentage of non-cationic lipid in a liposome may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. Cholesterol-Based Lipids

[0161] In some embodiments, provided liposomes comprise one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N- dimethyl-N-ethylcarboxamidocholesterol), l,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm.179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Pat. No.5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise a molar ration of about 2% to about 30%, or about 5% to about 20% of the total lipid present in a liposome. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. PEG-Modified Lipids

[0162] The use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids such as derivatized ceramides (PEG-CER), including N-Octanoyl-Sphingosine-1-[Succinyl(Methoxy Polyethylene Glycol)-2000] (C8 PEG-2000 ceramide) is also contemplated by the presentPATENT ATTORNEY DOCKET NO.0171.0103-PCT disclosure, either alone or preferably in combination with other lipid formulations together which comprise the transfer vehicle (e.g., a lipid nanoparticle). Contemplated PEG-modified lipids include, but are not limited to, a polyethylene glycol chain of up to S kDa in length covalently attached to a lipid with alkyl chain(s) of C6-C20 length. The addition of such components may prevent complex aggregation and may also provide a means for increasing circulation lifetime and increasing the delivery of the lipid-nucleic acid composition to the target tissues, (Klibanov et al. (1990) FEBS Letters, 268 (1): 235-237), or they may be selected to rapidly exchange out of the formulation in vivo (see U.S. Pat. No.5,885,613). Particularly useful exchangeable lipids are PEG- ceramides having shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipid and derivatized lipids of the present disclosure may comprise a molar ratio from about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipid present in the liposomal transfer vehicle. In some embodiments, one or more PEG- modified lipids constitute about 4% of the total lipids by molar ratio. In some embodiments, one or more PEG-modified lipids constitute about 5% of the total lipids by molar ratio. In some embodiments, one or more PEG-modified lipids constitute about 6% of the total lipids by molar ratio. Polymers

[0163] In some embodiments, a suitable delivery vehicle is formulated using a polymer as a carrier, alone or in combination with other carriers including various lipids described herein. Thus, in some embodiments, liposomal delivery vehicles, as used herein, also encompass nanoparticles comprising polymers. Suitable polymers may include, for example, polyacrylates, polyalkycyanoacrylates, polylactide, polylactide-polyglycolide copolymers, polycaprolactones, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrins, protamine, PEGylated protamine, PLL, PEGylated PLL and polyethylenimine (PEI). When PEI is present, it may be branched PEI of a molecular weight ranging from 10 to 40 kDa, e.g., 25 kDa branched PEI (Sigma #408727).

[0164] Exemplary combinations of cationic lipids, non-cationic lipids, cholesterol- based lipids, and PEG-modified lipids are described in the Examples section. For example, a suitable lipid solution may contain CKK-E10, DOPE, cholesterol, and DMG-PEG2K; CKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; OF-02,PATENT ATTORNEY DOCKET NO.0171.0103-PCT DOPE, cholesterol, and DMG-PEG2K; GL-HEPES-E3-E12-DS-4-E10, DOPE, cholesterol, and DMG-PEG2K; CKK-E10, DPPC, cholesterol, and DMG-PEG2K; CKK-E12, DPPC, cholesterol, and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, and DMG-PEG2K; HGT5001, DPPC, cholesterol, and DMG-PEG2K; OF-02, DPPC, cholesterol, and DMG-PEG2K; or GL-HEPES-E3-E12-DS-4-E10, cholesterol, and DMG- PEG2K. The selection of cationic lipids, non-cationic lipids and / or PEG-modified lipids which comprise the lipid mixture as well as the relative molar ratio of such lipids to each other, is based upon the characteristics of the selected lipid(s) and the nature of the and the characteristics of the mRNA to be encapsulated. Additional considerations include, for example, the saturation of the alkyl chain, as well as the size, charge, pH, pKa, fusogenicity and toxicity of the selected lipid(s). Thus, the molar ratios may be adjusted accordingly.

[0165] In some embodiments, the LNPs are manufactured with a particular molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids. In some embodiments, lipid nanoparticle comprises a molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids of 60:25:10:5. In some embodiments, lipid nanoparticle comprises a molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids of 40:25:30:5. Therapeutic Uses

[0166] In some embodiments, a dry powder formulation described herein comprises any full- length mRNA. In some embodiments, a dry powder formulation described herein comprises mRNA encoding for a drug or a peptide or protein therapeutic suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any peptide or polypeptide suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any antibody suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any therapeutic protein suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any naturally occurring peptide suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any modified or non-naturally occurring peptide suitable for the present disclosure. In some embodiments, a dry powder formulationPATENT ATTORNEY DOCKET NO.0171.0103-PCT described herein comprises a full length mRNA that encodes for any peptide drug suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any peptide or polypeptide for use in the delivery to or treatment of the lung of a subject or a lung cell suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any peptide or polypeptide for use in the delivery to or treatment of the liver of a subject or a liver cell suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a protein associated with a urea cycle disorder suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a protein associated with a lysosomal storage disorder suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a protein associated with a glycogen storage disorder suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a protein associated with amino acid metabolism suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a protein associated with a lipid metabolism or fibrotic disorder suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a protein associated with methylmalonic acidemia suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a peptide or polypeptide for use in the delivery to or treatment of the cardio-vasculature of a subject or a cardiovascular cell suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any peptide or polypeptide for use in the delivery to or treatment of the muscle of a subject or a muscle cell suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for a peptide or polypeptide for use in the delivery to or treatment of the nervous system of a subject or a nervous system cell suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for any peptide or polypeptide for use in the delivery to or treatment of the eye of a subject or an eye cell suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a fullPATENT ATTORNEY DOCKET NO.0171.0103-PCT length mRNA that encodes for a peptide or polypeptide for use in the delivery of or treatment with a vaccine for a subject or a cell of a subject suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for an antigen from an infectious agent (e.g., a virus) suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for an immunomodulator suitable for the present disclosure. In some embodiments, a dry powder formulation described herein comprises a full length mRNA that encodes for an endonuclease suitable for the present disclosure.

[0167] The pharmaceutical formulations of the disclosure may be administered in a local rather than systemic manner, for example, via injection of the pharmaceutical formulation directly into a targeted tissue, preferably in a sustained release formulation.

[0168] Local delivery can be affected in various ways, depending on the tissue to be targeted. Exemplary tissues in which delivered mRNA may be delivered and / or expressed include, but are not limited to the lungs, liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid. In some embodiments, the tissue to be targeted in the liver. For example, aerosols containing compositions of the present disclosure can be inhaled (for nasal, tracheal, or bronchial delivery). In some embodiments, compositions of the present disclosure can be delivered using a metered dose inhaler. In some embodiments, compositions of the present disclosure can be reconstituted and nebulized for delivery. In some embodiments, compositions of the present disclosure can be injected into the site of injury, disease manifestation, or pain. In some embodiments, compositions of the present disclosure can be provided in lozenges for oral, tracheal, or esophageal applications. In some embodiments, compositions of the present disclosure can be supplied in liquid, tablet or capsule form for administration to the stomach or intestines. In some embodiments, compositions of the present disclosure can be supplied in suppository form for rectal or vaginal application. In some embodiments, compositions of the present disclosure can be delivered to the eye by use of creams, drops, or even injection.

[0169] In some embodiments, a dry powder formulation of the present disclosure is reconstituted into a liquid solution and nebulized for delivery. Nebulization can be achieved by any nebulizer known in the art. A nebulizer transforms a liquid to a mist so that it can be inhaled more easily into the lungs. Nebulizers are effective for infants, children and adults. Nebulizers are able toPATENT ATTORNEY DOCKET NO.0171.0103-PCT nebulize large doses of inhaled medications. Typically, a nebulizer for use with the disclosure comprises a mouthpiece that is detachable.

[0170] In some embodiments, dry powder formulations as described herein may be used to deliver a therapeutically effective amount of mRNA for the treatment of various diseases or disorders. In some embodiments, an mRNA encodes a therapeutic protein. For example, the dry powder formulation prepared by spray-drying according to the present disclosure can be administered for treatment of a lung-related disorder, such as cystic fibrosis, via oral, nasal, tracheal, or pulmonary or routes. In some embodiments, the dry powder formulation is administered by inhalation. In some embodiments, the formulation is administered by a metered-dose inhaler. In some embodiments, the dry powder formulation is administered by intranasal spray. In some embodiments, the dry powder formulation is rehydrated and administered as intravenous infusions, injections, oral drops, nasal drops and any other applications as easily conceivable by one of ordinary skill in the art. The present disclosure may be used to treat various other lung-related diseases, disorders and conditions. In some embodiments, the present disclosure of stable dry powder formulation is useful in treating one or more of asthma; COPD; emphysema; primary ciliary dyskinesia (CILD1) with or without situs inversus, or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dube syndrome; hereditary hemorrhagic telangiectasia; alpha- 1 antitrypsin deficiency; Cytochrome b positive granulomatous diseases (CGD, X-lined); Cytochrome b positive granulomatous diseases, autosomal recessive; surfactant deficiency diseases, Pulmonary Surfactant Metabolism Dysfunction 1, Pulmonary Surfactant Metabolism Dysfunction 2, Pulmonary Surfactant Metabolism Dysfunction 3; Respiratory distress syndrome of prematurity; tuberculous tuberculosis, lung viral diseases, including influenza, and Respiratory Syncytial Virus (RSV).

[0171] In some embodiments, the present disclosure of stable dry powder formulation is useful in treating one or more of Acute Respiratory Distress Syndrome (ARDS), Cystic Fibrosis (CF), Lung Cancer, Pulmonary Alveolar Proteinosis (PAP), Pulmonary Arterial Hypertension (PAH), and Primary Ciliary Dyskinesia (PCD).

[0172] In some embodiments, the present disclosure provides a dry powder composition comprising full-length mRNA that encodes a therapeutic protein In some embodiments, a therapeutic protein is CFTR. In some embodiments, a therapeutic protein is DNAI1. In some embodiments, the present disclosure provides a dry powder composition comprising full-lengthPATENT ATTORNEY DOCKET NO.0171.0103-PCT mRNA that encodes a secreted protein. In some embodiments, the present disclosure provides a dry powder composition comprising full-length mRNA that encodes a nuclear protein. In some embodiments, the present disclosure provides a dry powder composition comprising full-length mRNA that encodes a metabolic protein. In some embodiments, the present disclosure provides a dry powder composition comprising full-length mRNA that encodes a cytoplasmic protein. In some embodiments, the present disclosure provides a dry powder composition comprising full- length mRNA that encodes a membrane protein. In some embodiments, the present disclosure provides a dry powder composition comprising full-length mRNA that encodes a mitochondrial protein. In some embodiments, the present disclosure provides a dry powder composition comprising full-length mRNA that encodes a lysosomal protein. In some embodiments, an mRNA encodes a cytosolic protein. In some embodiments, an mRNA encodes a protein associated with the actin cytoskeleton. In some embodiments, an mRNA encodes a protein associated with the plasma membrane.

[0173] In some embodiments, an mRNA encodes one or more naturally occurring peptides. In some embodiments, an mRNA encodes one or more modified or non-natural peptides.

[0174] In some embodiments, the peptide drug includes glucose-dependent insulinotropic polypeptide. A further example of the peptide drug is elamipretide. Further examples of the peptide drug are cyclotides (which are peptides characterized by their head-to-tail cyclized peptide backbone and the interlocking arrangement of their disulfide bonds), including, e.g., a cyclotide having at least two disulfide bonds (and preferably a cyclotide having three disulfide bonds).

[0175] In some embodiments, the peptide drug is selected from GLP-1, amylin, an amylin analog, pramlintide, a somatostatin analog (e.g., octreotide, lanreotide, or pasireotide), goserelin (e.g., goserelin acetate), buserelin, peptide YY (PYY), a PYY analog, glatiramer (e.g., glatiramer acetate), leuprolide (e.g., leuprolide acetate), desmopressin (e.g., desmopressin acetate, particularly desmopressin monoacetate trihydrate), teicoplanin, telavancin, bleomycin, ramoplanin, decaplanin, bortezomib, cosyntropin, sermorelin, luteinizing-hormone-releasing hormone (LHRH), calcitonin (e.g., calcitonin-salmon), pentagastrin, neseritide, enfuvirtide, eptifibatide, cyclosporine, glucagon, viomycin, thyrotropin-releasing hormone (TRH), leucine- enkephalin, methionine-enkephalin, substance P, a parathyroid hormone (PTH) fragment (e.g., teriparatide (PTH(1-34)), PTH(1-31), or PTH(2-34)), carfilzomib, icatibant, cilengitide, a prostaglandin F2α receptor modulator (e.g., PDC31), and pharmaceutically acceptable saltsPATENT ATTORNEY DOCKET NO.0171.0103-PCT thereof. It is particularly preferred that the peptide drug is selected from semaglutide, liraglutide, teriparatide (PTH(1-34)), octreotide, leuprolide, and pharmaceutically acceptable salts thereof.

[0176] Accordingly, in certain embodiments, the present disclosure provides a method for producing a dry powder composition comprising full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the lung of a subject or a lung cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for cystic fibrosis transmembrane conductance regulator (CFTR) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for ATP-binding cassette sub- family A member 3 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for dynein axonemal intermediate chain 1 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for dynein axonemal heavy chain 5 (DNAH5) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for alpha-1- antitrypsin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for forkhead box P3 (FOXP3) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes one or more surfactant protein, e.g., one or more of surfactant A protein, surfactant B protein, surfactant C protein, and surfactant D protein.

[0177] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the liver of a subject or a liver cell. Such peptides and polypeptides can include those associated with a urea cycle disorder, associated with a lysosomal storage disorder, with a glycogen storage disorder, associated with an amino acid metabolism disorder, associated with a lipid metabolism or fibrotic disorder, associated with methylmalonic acidemia, or associated with any other metabolic disorder for which delivery to or treatment of the liver or a liver cell with enriched full-length mRNA provides dry powder benefit.

[0178] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein associated with a ureaPATENT ATTORNEY DOCKET NO.0171.0103-PCT cycle disorder. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for ornithine transcarbamylase (OTC) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for arginosuccinate synthetase 1 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for carbamoyl phosphate synthetase 1 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for arginosuccinate lyase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for arginase protein.

[0179] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein associated with a lysosomal storage disorder. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for alpha galactosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for glucocerebrosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for iduronate-2- sulfatase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for iduronidase protein. In certain embodiments, the present disclosure provides a method for producing a therapeutic composition having full-length mRNA that encodes for N-acetyl-alpha-D-glucosaminidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for heparan N-sulfatase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for galactosamine-6 sulfatase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for beta-galactosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for lysosomal lipase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-lengthPATENT ATTORNEY DOCKET NO.0171.0103-PCT mRNA that encodes for arylsulfatase B (N-acetylgalactosamine-4-sulfatase) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for transcription factor EB (TFEB).

[0180] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein associated with a glycogen storage disorder. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for acid alpha- glucosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for glucose-6- phosphatase (G6PC) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for liver glycogen phosphorylase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for muscle phosphoglycerate mutase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for glycogen debranching enzyme.

[0181] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein associated with amino acid metabolism. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for phenylalanine hydroxylase enzyme. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for glutaryl-CoA dehydrogenase enzyme. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for propionyl-CoA carboxylase enzyme. In certain embodiments the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for oxalase alanine-glyoxylate aminotransferase enzyme.

[0182] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein associated with a lipid metabolism or fibrotic disorder. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an mTORPATENT ATTORNEY DOCKET NO.0171.0103-PCT inhibitor. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for ATPase phospholipid transporting 8B1 (ATP8B1) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for one or more NF- kappa B inhibitors, such as one or more of I-kappa B alpha, interferon-related development regulator 1 (IFRD1), and Sirtuin 1 (SIRT1). In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for PPAR-gamma protein or an active variant.

[0183] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein associated with methylmalonic acidemia. For example, in certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for methylmalonyl CoA mutase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for methylmalonyl CoA epimerase protein.

[0184] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA. In some embodiments, the present disclosure provides a method for which delivery to liver or a method for treatment of liver-associated condition. In certain embodiments the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for ATP7B protein, also known as Wilson disease protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for porphobilinogen deaminase enzyme. In certain embodiments the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for one or clotting enzymes, such as Factor VIII, Factor IX, Factor VII, and Factor X. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for human hemochromatosis (HFE) protein.

[0185] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the cardiovasculature of a subject or a cardiovascular cell. In certain embodiments, the present disclosure provides a method for producing a dry powder compositionPATENT ATTORNEY DOCKET NO.0171.0103-PCT having full-length mRNA that encodes for vascular endothelial growth factor A protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for relaxin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for bone morphogenetic protein-9 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for bone morphogenetic protein-2 receptor protein.

[0186] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the muscle of a subject or a muscle cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for dystrophin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for frataxin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the cardiac muscle of a subject or a cardiac muscle cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein that modulates one or both of a potassium channel and a sodium channel in muscle tissue or in a muscle cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein that modulates a Kv7.1 channel in muscle tissue or in a muscle cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a protein that modulates a Nav1.5 channel in muscle tissue or in a muscle cell.

[0187] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the nervous system of a subject or a nervous system cell. For example, in certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for survival motor neuron 1 protein. For example, in certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for survival motor neuron 2 protein.PATENT ATTORNEY DOCKET NO.0171.0103-PCT In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for frataxin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full- length mRNA that encodes for ATP binding cassette subfamily D member 1 (ABCD1) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for CLN3 protein.

[0188] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the blood or bone marrow of a subject or a blood or bone marrow cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for beta globin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for Bruton's tyrosine kinase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for one or clotting enzymes, such as Factor VIII, Factor IX, Factor VII, and Factor X.

[0189] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the kidney of a subject or a kidney cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for collagen type IV alpha 5 chain (COL4A5) protein.

[0190] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery to or treatment of the eye of a subject or an eye cell. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for ATP-binding cassette sub-family A member 4 (ABCA4) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for retinoschisin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for retinal pigment epithelium-specific 65 kDa (RPE65) protein. In certainPATENT ATTORNEY DOCKET NO.0171.0103-PCT embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for centrosomal protein of 290 kDa (CEP290).

[0191] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes a peptide or polypeptide for use in the delivery of or treatment with a vaccine for a subject or a cell of a subject. For example, in certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from an infectious agent, such as a virus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from influenza virus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from respiratory syncytial virus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from rabies virus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full- length mRNA that encodes for an antigen from cytomegalovirus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from rotavirus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from a hepatitis virus, such as hepatitis A virus, hepatitis B virus, or hepatitis C virus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from human papillomavirus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from a herpes simplex virus, such as herpes simplex virus 1 or herpes simplex virus 2. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full- length mRNA that encodes for an antigen from a human immunodeficiency virus, such as human immunodeficiency virus type 1 or human immunodeficiency virus type 2. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full- length mRNA that encodes for an antigen from a human metapneumovirus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from a human parainfluenza virus, such asPATENT ATTORNEY DOCKET NO.0171.0103-PCT human parainfluenza virus type 1, human parainfluenza virus type 2, or human parainfluenza virus type 3. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from malaria virus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from zika virus. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen from chikungunya virus.

[0192] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen associated with a cancer of a subject or identified from a cancer cell of a subject. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen determined from a subject's own cancer cell, i.e., to provide a personalized cancer vaccine. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antigen expressed from a mutant KRAS gene.

[0193] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antibody. In certain embodiments, the antibody can be a bi-specific antibody. In certain embodiments, the antibody can be part of a fusion protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antibody to OX40. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antibody to VEGF. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antibody to tissue necrosis factor alpha. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antibody to CD3. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an antibody to CD19.

[0194] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an immunomodulator. In certain embodiments, the present disclosure provides a method for producing a dry powder compositionPATENT ATTORNEY DOCKET NO.0171.0103-PCT having full-length mRNA that encodes for Interleukin 12. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for Interleukin 23. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for Interleukin 36 gamma. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a constitutively active variant of one or more stimulator of interferon genes (STING) proteins.

[0195] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an endonuclease. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for an RNA-guided DNA endonuclease protein, such as Cas 9 protein. In certain embodiments the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a meganuclease protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a transcription activator-like effector nuclease protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having full-length mRNA that encodes for a zinc finger nuclease protein.

[0196] The present disclosure may be used to treat various other diseases, disorders and conditions in which sustained release of the mRNA formulation is required. These examples include diseases where the mRNA delivery in the digestive tract is useful. Such diseases include but are not limited to, Apolipoprotein E deficiency disease; Inflammatory Bowel Disease, or Crohn's disease; Adhesion G Protein-coupled Receptor VI deficiency disease; Type 2 Von Willebrand Disease; Nephrolithiasis, calcium oxalate CAON related; Maturity Onset Diabetes of the Young, Type 8. Messenger RNA (mRNA) Vaccines

[0197] mRNA vaccines are novel and offer many advantages over present cell-based vaccines using live, attenuated or killed pathogen or toxoid vaccines. In addition to the safety, mRNA vaccines are cost-effective and provide flexible design platform. mRNA encoding an antigen could be directed to induce specific immune response, and therefore can be applied in developing a wide range of therapeutic and prophylactic mRNA vaccines for a wide variety of diseases, including infections and cancers.PATENT ATTORNEY DOCKET NO.0171.0103-PCT Vaccines against infections

[0198] Vaccine candidates are well established for a large number of infectious pathogens. Typically, vaccines are agents that mimic at least in part a disease causing agent and thereby elicit an immune response by the mammalian host. In general vaccines are biological agents, such as heat killed, irradiated or otherwise attenuated pathogenic organisms, live attenuated microbes, protein or peptide antigens, conjugated antigens, toxins or microbial surface proteins or fragments thereof. However, an mRNA encoding a protein or a peptide antigen, is a safe and effective way to induce an immune response against the disease. As discussed above, mRNA can be effectively delivered to express in vivo by encapsulated in a liposome comprising suitable lipids discussed in a later section. This mRNA encoding the antigenic peptide or protein could therefore be used to generate the vaccine in vivo. An immune response generated by the mammalian host against the vaccine component is intended in turn to protect the host from a subsequent attack by the pathogen, since the immune system of the host is primed for the attack by the pathogen. In other words, the host system has immunological memory (a component of the adaptive immune response) of the pathogen. This process is known as prophylactic vaccination. Additionally, a vaccine may boost the host’s immune system in an existing infection, for example by redirect an immune response against new and less recognized microbial antigen(s) (subdominant antigens) which then induce a strong immune response leading to pathogen elimination. This type of vaccine response may be categorized as therapeutic vaccination.

[0199] An immune response against a pathogen can be broken down into a few stages. First, an encounter of the human body (or a mammalian system) with a new pathogen, especially by contact through exposed surfaces such as skin or the internal mucosal surfaces of the respiratory, gastro- intestinal, and urogenital tracts, lead to a non-specific innate immune response through activation of pattern recognition molecules. Pattern recognition molecules include a variety of germline- encoded receptors specialized in discriminating between microbial and host cell surfaces, or infected and normal cells. Phagocytes (monocytes, macrophages and dendritic cells), express pattern recognition molecules on their surface and are primarily responsible for recognizing, killing and elimination of the pathogens in an innate immune response. In doing so, phagocytes also process and present antigens to the circulating lymphocytes for generating a more specific antigen-targeted immune response, also known as the adaptive immune response. At this stage activated lymphocytes mature in the lymph nodes into antigen-specific T-cells expressingPATENT ATTORNEY DOCKET NO.0171.0103-PCT receptors for recognition of the antigen such that effector cytotoxic T cells recognize and kill a cell expressing the antigen when present in association with a second set of cell-surface molecules, the Major Histocompatibility Complex molecules or MHC; and helper T cells activate the system to generate the T cell memory and the humoral immune response. The humoral immune response comprises antibody-secreting B cells generated by clonal expression and differentiation over the course of several days, during which time that innate immunity continues to function. Clonal expansion of cytotoxic T cells also occur rapidly in lymphoid organs, such as lymph nodes and is augmented by exposure to antigens. Activated T cells generate a number of cytokines, such as Interferon Gamma (IFN-γ) and Tumor Necrosis Factor alpha (TNF-α) which are considered the hallmarks of T cell activation. Eventually, antigen-specific T cells and then antibodies are released into the blood and recruited to the site of infection. A successful vaccine generates a rapid and robust cytotoxic T cell response, a strong antibody response and a lasting immunological memory. Cancer Vaccines

[0200] Cancer is considered an immunological disease, and cancer immunotherapy has become the center-stage of research and development of the present day. In cancer immunotherapy, vaccines are developed to boost the immune system to turn against cancer antigens and eliminate a tumor by activated cytotoxic T cells directed against the antigens. One class of cancer antigens are viral antigens relating to the cancer-causing viruses, for example, Epstein Barr Virus (EBV) antigens such as EBV1 and EBV2 associated with lymphoma and nasopharyngeal carcinoma, Human Papilloma Virus (HPV) antigens such as HPV16 associated with cervical cancer (CC), Hepatitis B Virus (HBV) antigens and Hepatitis C Virus (HCV) antigens associated with hepatocellular carcinoma (HCC), human T lymphotropic virus type 1 (HTLV-1) associated with adult T-cell leukemia / lymphoma, and human herpes virus 8 (HHV-8) with Kaposi sarcoma, to name a few.

[0201] On the other hand, cancerous cells express antigens that are not commonly expressed by non-cancerous cells or tissues. Such antigens include but are not limited to epithelial tumor antigen (ETA) found in breast cancer, RAS family member p-53 and other activated RAS antigens, ovarian cancer antigens BRCA1 and BRCA2, melanoma associated antigen (MAGE) found in malignant melanoma cells, BCR-ABL fusion gene product found in myeloid leukemia, acute lymphoblastic leukemia, acute myelogenic leukemia, BRAF antigens found in cutaneous melanoma and colorectal cancer, epithelial growth factor receptor (EGFR) for non-small cell lung cancer, KRASPATENT ATTORNEY DOCKET NO.0171.0103-PCT found in colorectal and non-small cell lung cancer, Neuron specific enolase, found in neuroblastoma and non-small cell lung cancer, NY-ESO 1 found in neuroblastoma, Melanoma- associated antigen recognized by T cells (MART-1) found in melanoma, programmed death ligand 1 (PD-L1) found in non-small cell lung cancer, Prostate-specific antigen (PSA) found in prostate cancer, urokinase plasminogen activator (UPA), plasminogen activator inhibitor (PAI-1) found in breast cancer, and many others, almost all of which are mutated endogenous proteins. These cancer antigens, being endogenous are not presented by antigen presenting cells (APCs) in a manner similar to viral antigens, i.e., in association with the MHC-1 molecule categorizing the antigen as foreign, but cytotoxic T cells are able to differentiate and identify mutated self-antigens and possess an inherent property to seek and destroy cells that bear the mutated antigens. Therefore, the current objective of cancer immunotherapy is to achieve optimum activation of cytotoxic T cells directed against the mutated antigens. A patient’s specific mutations associated with her / his cancer can be mapped and used to generate vaccines, inducing the patient’s own cytotoxic T cells to generate the necessary immune response to destroy tumor cells. mRNA vaccines could be the safe and cost-effective alternative to peptide vaccines for enabling such personalized medicine. Pan-genomic scanning and analysis of mutations present in a cancer patient could be used to specifically design mRNA encoding an antigen or epitope containing the mutation, which when administered in vivo will produce the translated product on a cell surface. This would direct an immune response against the mutated antigen. In the process, cytotoxic T cells attack the tumor cells, which inherently express the mutated antigen. Methods and protocols involved in executing pan genomic sequencing analysis, mutation analysis, epitope mapping and analysis and designing suitable peptides for vaccination are known to one of skill in the art.

[0202] This approach could also be leveraged to find dominant and subdominant antigens in a patient. It has been observed that both in chronic infection and cancer, certain antigens play a dominant role in producing an initial immune response. But soon afterwards, tolerance against such dominant antigens sets in, thereby the immune response is dampened. Genomic analysis and identification of antigens which did not show an initial dominant antigenic response (often termed subdominant antigens) could now be used to generate new and revived immune response.

[0203] One advantage of mRNA vaccines over peptide vaccines is that mRNA vaccines bypass the HLA-matching for the receiving host.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0204] In a synthetic approach to mRNA vaccine design, a pathogen proteome can be scanned for antigenic signatures with vaccine potential. (Proteome database can be accessed using Uniprot Consortium, http: / / www.uniprot.org / ). This could be effective in new pathogens, such as Zika virus. This type of reverse vaccinology has been employed in identifying a number of novel peptide vaccine candidates. New peptide vaccines were also identified from Helicobacter pylori and Mycobacterium tuberculosis by combining genomics and proteomics (See, for example, Etz et al., PNAS.2002, 99 (10) 6573-6578). Whether the potential antigenic candidate can generate successful immune response can be verified by suitably expressing a library of potential antigens by various forms of cell surface display and subjecting to testing opsonization and antibody binding. Exemplary useful databases for vaccine antigen development include: ImMunoGeneTics information system (URL: imgt.org); Epitome Database, (URL: rostlab.org / services / epitome), Immune Epitope Database and Analysis Resource, iedb.org; Immunet database, immunet.cn / ced / index.php; HIV database: hiv.lanl.gov / content / immunology for immunogenetics and immunoinformatics.

[0205] Therefore, from the above discussion, it is clear that enrichment of mRNA vaccine delivery to lymph nodes can lead to access of the vaccines to both activated and naïve lymphocytes for lymphoproliferation and antigen-specific T cell and B cell generation. This localization of antigen activation is also less toxic as opposed to widespread immune activation. EXAMPLES

[0206] While certain compounds, compositions and methods of the present disclosure have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the disclosure and are not intended to limit the same.

[0207] Lipids studied in the present examples include: (1) Lipid 1 (also referred to as Lipid A); (2) Lipid 2 (also referred to as Lipid B); and (3) Lipid 3. Example 1: Effect of Mannitol and Solvent on Processing Temperature and Powder Size.

[0208] This Example describes the effect of temperature on dry powder product and the effect of solvent on temperature. Although it was feasible to manufacture the DPP at the inlet temperaturePATENT ATTORNEY DOCKET NO.0171.0103-PCT of 90°C using water as a solvent, the process temperature was reduced to prevent any potential mRNA degradation and to increase the yield by minimizing the sticking to the cyclone separator. Dry-powder formulations of LNP-encapsulated mRNA prepared in the presence of mannitol were evaluated for efficiency of spray drying and powder size. Using hydroalcoholic solution also helped in reducing the particle size of the DPP. It was observed that use of 5% mannitol in 20% ethanol decreased the processing temperature and powder size.

[0209] Two LNP-encapsulated mRNA formulations were prepared, one with 5% mannitol in water and the second with 4% mannitol in 20% ethanol. To prepare the LNP formulations, for spray-drying, the mRNA was first mixed with LNPs using a gear pump. This process encapsulated the mRNA within the LNPs. Different solutions of mannitol were added to the mRNA LNP formulations. These mixtures were then subjected to spray-drying. The inlet temperature and subsequent outlet temperatures were optimized for each formulation of mannitol. Table 1 summarizes the different formulations of mannitol and the powder size of the LNP-mRNA.

[0210] Results: It was observed that use of 5% mannitol in 20% ethanol solution yielded a powder size of 12 micrometer. This was a stark contrast from a formulation of 5% mannitol in water, in which case the powder size were much larger. Furthermore, the inlet and outlet temperatures used for spray drying were much lower for the solutions comprising 4% mannitol in 20% ethanol. Table 1 – Effect of mannitol formulations in mRNA lyophilization Feed Pre SD Pre Powder Post Solvent Inlet / Outlet Li id H l V l Si SD Si SDExample 2: Effect of Different Helper Lipids on Encapsulation Efficiency.

[0211] This Example describes determination of the lipid(s) yielding most desirable values for pre-encapsulation efficiency and powder size. It was observed that, Lipid 2 with, DEPE or DPPC helper lipids provided the least efficient encapsulation efficiency.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0212] LNP-encapsulated mRNA formulations were prepared with 2 different ionizable lipids and 3 different helper lipids in the presence of mannitol. To prepare the LNP formulations, for spray- drying, acidic aqueous buffered solution of mRNA was first mixed with lipid solution in ethanol using a gear pump. This process encapsulated the mRNA within the LNPs. The LNPs were then buffer exchanged in 4% w / v mannitol in 20% ethanol solution and subjected to spray-drying. The pre-spray drying encapsulation efficiency and reconstituted encapsulation efficiency was calculated. The results are summarized in Table 2.

[0213] Results: It was observed that no significant change in size, encapsulation efficiency, and powder size using different helper lipids for Lipid 1. There was no significant difference in yield, LNP size, encapsulation, and DP size using DPPC and DEPE as compared to DOPE for Lipid 1. Lower encapsulation with DPPC and DEPE for Lipid 2 was observed. Thus, it can be estimated that helper lipids DPPC and DEPE were not compatible with ionizable lipid 2 in forming LNPs. The feed volume did not have any significant impact on the process or product characteristics.

[0214] Table 2 – Encapsulation efficiency and powder size of LNPs with different helper lipids Feed Pre Powder Reconstitution Lipid Helper VolumePre EE%PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0215] Similar analysis was repeated with different lipid:mRNA ratios with Lipid 1. FIGs. 2A- 2D summarize mRNA loading efficiency, yield, encapsulation efficiency, and powder sizes. It was observed that increased mRNA loading was achieved by reducing the N / P ratio or changing the LNP composition. The LNP composition could be changed, while keeping the yield same. No change in post spray drying encapsulation was seen. All combinations yielded desirable powder size. The best composition was 375 mg leucine with N / P =3 (5:60:25:10 LNP composition). Example 3: Determination of Leucine and Mannitol Concentrations for Yield, Powder Size and Encapsulation Efficiency.

[0216] This Example describes determination of mannitol and leucine concentrations for determining the most desirable yield, encapsulation efficiency and powder size. Amino acid excipients such as leucine and Trileucine had shown improvement in powder characteristics and can enhance the yield by minimizing sticking to the cyclone separator. In order to include amino acid excipients, a higher feed volume was required due to their lower solubility in 20% ethanol. Hence, the impact of increasing feed volume was first evaluated on formulations without amino acids. There was no significant difference in yield, LNP size, encapsulation, and mean particle size for Lipid 1 based dry powder at the feeding volumes of 50, 100, 150, and 250 ml manufactured using 2 g mannitol, 50 mg mRNA, and equivalent lipid amounts.

[0217] LNP-encapsulated mRNA formulations were prepared, one with different masses of leucine, or mannitol, or combination of leucine and mannitol in different ratios. To prepare the LNP formulations, for spray-drying, acidic aqueous buffered solution of mRNA was first mixed with lipid solution in ethanol using a gear pump. This process encapsulated the mRNA within the LNPs. The final LNP formulations were then buffer exchanged in 20% ethanol solution. Different solutions of mannitol, leucine, or combination of leucine and mannitol were prepared in 20% ethanol and then added to the final mRNA LNP formulations. These mixtures were then subjected to spray-drying. The inlet temperature and outlet temperatures were optimized for each formulation of mannitol. FIGs. 2A-2D summarize the different parameters analyzed. The dry powder was manufactured using LNPs at a constant lipid content at an N / P of 4 and lipid molar ratio of DMG-PEG-2000 : Lipid 1 : Cholesterol : DOPE (5:40:25:30) for this screening. The size of LNP product used for spray drying was between 60 and 80 nm. There was significant improvement in yield by using leucine. For example, majority of the dry powder was stuck to thePATENT ATTORNEY DOCKET NO.0171.0103-PCT cyclone separator and only 10% yield was obtained for the dry powder without leucine despite of using 2000 mg of mannitol. Whereas, up to 50% of the product was obtained in the collection vessel using only 1500 mg of leucine alone. Also, a significant increase in yield was detected with the increasing amount of leucine. The highest yield of up to 60% was obtained using 4:1 mixture of mannitol and leucine (500 mg leucine in combination with 2000 mg mannitol). Further, leucine alone and in combination with mannitol exhibited significant reduction in dry powder mean particle size (FIG.2D) The dry powder manufactured using only mannitol showed much higher mean particle size.

[0218] In some embodiments, the increase in yield and the decrease in DPP mean particle size can be attributed to the lower solubility of leucine in hydroalcoholic solvent and its higher surface activity. The lower solubility of leucine promotes rapid coating of the newly forming DPPs that may have prevented adhesion and resulted in higher yield. In addition, higher surface activity reduces cohesiveness that may have led to formation of DPP with smaller mean particle size.

[0219] It was observed that, Lipid 1 with 750 mg of leucine or 500 mg leucine + 200 mg mannitol provided the best mRNA loading efficiency and yield. Other characteristics such as encapsulation efficiency and powder yield were also desirable (FIG.2B and FIG.2C). The experimental mRNA weight percent decreased with the increase in excipient amount as expected. (FIG.2A)

[0220] Results: It was observed that introducing leucine decreased powder size, increased yield and mRNA loading. No significant change was observed in post spray drying encapsulation and powder size with leucine or leucine / mannitol concentration. Therefore, the best composition was observed to be 750 mg leucine or 2500 mg leucine / mannitol (1:2.3) combination. It was observed in independent experiments that a combination of mannitol / leucine (1000mg / 500) mg was also optimal for yield, powder size, encapsulation efficiency and mRNA weight percent.

[0221] Similar analysis was repeated using Lipid 3 with combination of leucine, mannitol or a combination of leucine and mannitol. FIGs.3A-3D summarize the different parameters analyzed. It was observed that there was no change in composition or lipid to mRNA (N / P) ratio needed. It was observed that 250 mg leucine provided reasonable dry powder yield and yielded 5% mRNA loading. Example 4: Effect of Decreasing Lipid Concentration on Dry Powder Characteristics.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0222] After evaluating the impact of excipient amount at a constant lipid content, the effect of lowering lipid amount was assessed. In order to reduce the total lipid content of the LNPs, either the N / P ratio (ratio of ionizable lipid to mRNA) was decreased and / or the LNP composition was modified by increasing the mole percent of the ionizable lipid.

[0223] The effect of lowering lipid content on the DPP manufactured using leucine alone or in combination with mannitol are shown in FIG.4. The yield for dry powder was improved due to lower lipid content of the LNPs (FIG. 4A). For example, 15 mg of leucine per mg of mRNA resulted in more than 30% yield for dry powder manufactured using LNPs at an N / P of 7 and a modified lipid composition of DMG-PEG-2000 : Lipid 1 : Cholesterol : DOPE (5:50:30:15). Whereas, less than 20% yield was obtained using same amount of leucine for dry powder manufactured using LNPs at an N / P of 7 and regular lipid composition of DMG-PEG-2000 : Lipid A : Cholesterol : DOPE (5:40:25:30). Similarly, 50% yield was obtained for DPP manufactured using a combination of 1000 / 500 mg mannitol / leucine for LNPs at an N / P of 7 and a modified lipid composition of DMG-PEG-2000 : Lipid 1 : Cholesterol : DOPE (5:50:30:15). On the other hand, about 30% yield was detected for LNPs at an N / P of 10 and regular lipid composition of DMG-PEG-2000 : Lipid 1 : Cholesterol : DOPE (5:40:25:30) using the same amount of mannitol / leucine. The reduction in lipid amount by reducing the N / P and modifying the composition may have resulted in lower degree of melting and hence less adhesion tendency that led to increase in the yield. For majority of formulations made with lower lipid amounts, there was no significant difference in encapsulation efficiency (FIG.4C). The DP mean particle size was below 3 µm for all the DP formulations (FIG.4D). The experimental mRNA weight % increased slightly with the decrease in lipid amounts (FIG.4D).

[0224] Although not shown here, similar results were obtained for Lipid 2 based dry powder as those for Lipid 1, where leucine alone or in combination with mannitol increased the yield and reduced the dry powder mean particle size. Further, the mRNA weight percent and yield were increased by reducing the lipid amount with no significant difference in encapsulation and dry powder product mean particle size.

[0225] Scanning electron microscopy (SEM) was used to visualize the DPP. Powder samples were sprinkled onto carbon adhesive tape that was mounted on SEM stubs. Excess powder was removed by blowing with clean compressed air. Prior to imaging, the powder samples were sputter coated with approximately 11 nm gold-palladium alloy in two cycles to avoid overheating.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0226] The scanning electron microscopy (SEM) images for some of the representative dry powder products manufactured using Lipid 1 are depicted in FIG. 5A-5G. Although not shown here, similar surface characteristics were observed for Lipid 2 dry powder. The dry powder manufactured using mannitol alone showed large globular aggregates (FIG.5A), whereas small raisin like particles were obtained using leucine alone (FIG. 5B). These leucine-only particles exhibited wrinkled, collapsed appearance, with a significant porosity. There was no significant change in surface characteristics due to lowering the lipid content of the LNPs for these particles. As shown in FIG. 5C and FIG. 5D, raisin like particles were obtained for both N / P 3 and a modified LNP composition, respectively. The dry powder particles obtained using leucine- mannitol combination appeared smoother and more spherical (FIG. 5E). The surface of these particles started showing slight indentations, wrinkles, and dimples because of the beam damage due to longer exposure to the electron beam as shown in FIG.5F. Further, these particles appeared to be solid on the inside (FIG.5G) when cross-sections of the particles were taken. The spherical morphology of the mannitol / leucine combination DPP can be attributed to the higher excipient content as well as to the presence of mannitol that may have provided higher amount of material to form a matrix. Example 5: In Vitro Potency of Dry Powders Formed with Leucine and / or Mannitol.

[0227] This Example describes the in vitro potency of different mRNA encapsulations. It was observed that all formulations showed reasonable potency.

[0228] HEK cells were plated in 12 well plate 24 hours prior to transfecting using the dry powders at 0.5 x 106cells / well. Cells were transfected with mRNA encapsulated in Lipids 1, 2 and 3 in the presence of leucine, mannitol, or both at various N / P ratios and were observed for expression of fire-fly luciferase (FFL). The dry powder samples were reconstituted in OPTIMEM medium at 0.5 mg / ml mRNA concentration to generate the stock solutions. The reconstituted dry powder was then diluted to the required mRNA concentrations and used to transfect the HEK cells. The protein expression was measured after 24 hours using ELISA. The cell expressing mCherry mRNA were counted using FACS analysis. FIG.6A summarizes the normalized relative luminescence units of all formulations. It was observed that all categories showed potency. However, mRNA encapsulated in Lipid 3 showed lower potency when compared to other lipids.PATENT ATTORNEY DOCKET NO.0171.0103-PCT

[0229] In an independent experiment, all the DPPs formulated using FFL mRNA showed successful in vitro transfection. As shown in FIG.6B, DPPs formulated with various combinations of excipients and varying lipid content showed luminescence in the transfected HEK293 cells with a good correlation between the dose and the expression of mCherry. FIG.6C and FIG.6D show dose response activity wherein both the number of cells showing mCherry signal and the amount of mCherry protein expressed using this DPP increased with the increasing mRNA amount. These initial experiments showing no significant loss in mRNA integrity due to spray drying process and successful in-vitro transfection suggested feasibility of the DPP for in vivo evaluation. Based on these promising results, some of the lead DPPs formulated with various combinations of excipients and lipids were selected for in-vivo evaluations.

[0230] These experiments showing no drop in mRNA integrity due to spray drying process and transfection efficiency in-vitro suggested initial feasibility for the DPP. Example 6: Evaluation of mRNA Integrity.

[0231] This Example describes evaluation of the integrity of spray dried mRNA formulations. It was observed that the mRNA integrity was maintained.

[0232] Given the brief exposure of LNPs to heat and stress during spray drying, the mRNA integrity post spray drying was assessed for the DPP. As shown in FIGs.7A-7B, mRNA extracted from the DPP (FIG.7A) show superimposable peak as compared to the control mRNA standard (FIG. 7B) with no significant difference in the mRNA integrity as measured using capillary electrophoresis (CE). The mRNA encapsulated in Lipid 1 and Lipid 3 were subject to gel filtration and the peak shape and elution volume were used to determine the integrity of the mRNA. FIG. 7A and FIG.7B summarizes the mRNA elution profile.

[0233] It was observed that there was no change in mRNA integrity after spray drying. Similar results were obtained for all the FFL mRNA DPPs as well as mCherry DPP used in Example 5. Example 7: In Vivo Potency of Dry Powders Formed with Leucine and / or Mannitol.

[0234] This Example describes evaluation of the in vivo potency of dry powder formulations.

[0235] The dry powders (2 mg each) were administered intratracheally using dry powder insufflators in 6 to 8 weeks old CD-1 male mice. Saline was used as a negative control for potency and inflammatory response, whereas LPS dissolved in saline was used as a positive control forPATENT ATTORNEY DOCKET NO.0171.0103-PCT TNF-α measurement. Saline and LPS solutions were administered intratracheally using catheters. After 24 hours of intratracheal administration all animals were dosed with 15 mg / mL D-Luciferin at 3 mg / animal via subcutaneous (SC) injection at 0.2 mL / animal. After euthanizing the animals BALF was collected for inflammatory response and lungs and trachea were harvested in a petri dish for IVIS imaging.

[0236] As shown in FIG. 8A, all the FFL dry powder products using both Lipid 1 or Lipid 2 showed bioluminescence in the trachea and lungs of the mice, suggesting successful delivery with sufficient deposition, sedimentation, and subsequent absorption of the functional DPP with desired mean particle size (< 4 µm) in the lung parenchyma. The saline and lipopolysaccharide (LPS) controls did not show any bioluminescence. Overall, all the dry powder products showed a good distribution of bioluminescence in trachea as well as both lungs entirely suggesting sufficient deposition, sedimentation, and subsequent absorption of the dry powder product in the lung parenchyma. Overall, protein expression for Lipid 1 DPPs was significantly increased by using mannitol and leucine in combination rather than using leucine alone or by reducing the lipid content.

[0237] Further, the lower solubility of leucine in hydroalcoholic solvent and its higher surface activity may have led to formation of low density corrugated dry powder product particles with an improved aerosol performance. The comparison of average radiance for the dry powder products of both Lipid 1 and Lipid 2 is shown in FIG. 8B. In general, all the dry powder products of ionizable Lipid 2 exhibited higher average radiance as compared to that of Lipid 1, possibly due to the inherent higher potency of ionizable lipid 2. The potency of dry powder product of Lipid 1 was found to be governed by the LNP composition rather than the excipients, lipid content, and mRNA weight percent. As an example, no significant difference in average radiance was detected at two different lipid A to mRNA weight higher ratios manufactured using leucine alone. Similarly, changes in LNP composition did not show any significant difference in average radiance for mannitol-leucine combination. On the other hand, cumulative average radiance of both mannitol- leucine DPPs was higher as compared to that of both leucine based DPPs (p value 0.0224). This higher expression with mannitol-leucine combination for lipid A DPP can be attributed to its spherical morphology, better aerosolization, dispersibility, and deposition in the lung tissue. Cumulatively, the DPPs made using ionizable Lipid 2 LNPs exhibited significantly higher average radiance as compared to that of Lipid 1 (p value 0.0082), possibly due to the inherently higherPATENT ATTORNEY DOCKET NO.0171.0103-PCT activity of ionizable lipid 2 as compared to that of lipid 1 (FIG.8B and FIG.8C). No statistically significant difference in average radiance was detected by changing excipients or lipid amounts for lipid B DPPs, possibly due to higher inherent activity (potency) of Lipid 2. To summarize, beneficial conditions for the mRNA LNP-DPP have been achieved, resulting in significant improvement in formulation characteristics and delivery efficiency. Example 8: Evaluation of mRNA Integrity at 25°C Accelerated Thermostability

[0238] This Example evaluates if there is a thermostability advantage associated with changing the formulation type by comparing the degradation profile of mRNA between dry powder formulation and liquid formulation under accelerated thermostability conditions. It was observed that the dry powder formulation had better mRNA integrity after storage at 25°C for 4 weeks as compared to the liquid formulation.

[0239] Briefly, a dry powder formulation containing LNP-encapsulated mRNA was prepared using mannitol and leucine as excipients as described previously. This dry powder formulation was stored at -80°C for about a year before being used in this accelerated study. The liquid control formulation was prepared with the same mRNA using a composition similar to that of the dry powder formulation, but it was not spray dried. This liquid LNP formulation was stored in final buffer of 10% trehalose. Both formulations were then stored in an incubator at 25°C and the change in % mRNA integrity was analyzed each week over a period of 4 weeks.

[0240] As shown in FIG.9, the % mRNA integrity in the dry powder formulation decreased less than 10% after storage at 25°C for 4 weeks, whereas the % mRNA integrity in the liquid control formulation decreased more than 30% after storage at 25°C for 4 weeks. The results demonstrate that the dry powder formulation maintains improved mRNA integrity as compared to a liquid formulation under 25°C accelerated thermostability conditions.

Claims

PATENT ATTORNEY DOCKET NO.0171.0103-PCT CLAIMS 1. A dry powder formulation comprising a messenger RNA (mRNA) encapsulated in lipid nanoparticles (LNPs), wherein the LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises leucine and mannitol at a weight ratio of between 1:1 and 1:10, and wherein the dry powder formulation has a mean particle size of between 1-8 µm.

2. The dry powder formulation of claim 1, wherein the weight ratio of leucine and mannitol is 1:

8.

3. The dry powder formulation of claim 1, wherein the weight ratio of leucine and mannitol is 1:

4.

4. A dry powder formulation comprising a messenger RNA (mRNA) encapsulated in lipid nanoparticles (LNPs), wherein the LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises a hydrophobic amino acid at a concentration of between 4 and 65%, and wherein the dry powder formulation has a mean particle size of between 1-8 µm.

5. The dry powder formulation of claim 4, wherein the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline, or tryptophan.

6. The dry powder formulation of claim 5, wherein the hydrophobic amino acid is leucine.

7. The dry powder formulation of any one of claims 1-6, wherein the lipid nanoparticles encapsulating the mRNA have a N / P ratio of between 2 and 6.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 8. The dry powder formulation of claim 7, wherein the N / P ratio is between 3 and 4.

9. The dry powder formulation of claim 8, wherein the N / P ratio is 3.

10. The dry powder formulation of any one of claims 1-9, wherein the LNPs further comprise one or more cholesterol-based lipids.

11. The dry powder formulation of any one of claims 1-10, wherein the one or more cationic lipids constitutes about 30-70% of the total lipids in the LNPs by molar %.

12. The dry powder formulation of any one of claims 1-11, wherein the one or more PEG- modified lipids constitutes about 1-15% of the total lipids in the LNPs by molar %.

13. The dry powder formulation of any one of claims 1-12, wherein the one or more non- cationic lipids constitutes about 10-40% of the total lipids in the LNPs by molar %.

14. The dry powder formulation of any one of claims 10-13, wherein the one or more cholesterol-based lipids comprise about 5-40% of the total lipids in the LNPs by molar %.

15. The dry powder formulation of any one of claims 10-14, wherein the molar ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the LNPs is approximately 60:25:10:

5.

16. The dry powder formulation of any one of claims 10-14, wherein the molar ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the LNPs is approximately 40:25:30:

5.

17. The dry powder formulation of any one of claims 1-16, wherein the mean particle size is between 1-5 µm.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 18. The dry powder formulation of any one of claims 1-17, wherein the mean particle size is between 1-3 µm.

19. The dry powder formulation of any one of claims 1-18, wherein the mRNA constitutes greater than 2% of the dry powder formulation by weight.

20. The dry powder formulation of any one of claims 1-19, wherein the mRNA constitutes greater than 3% of the dry powder formulation by weight.

21. The dry powder formulation of any one of claims 1-20, wherein the mRNA constitutes greater than 4% of the dry powder formulation by weight.

22. The dry powder formulation of any one of claims 1-21, wherein the encapsulation rate of the LNPs is greater than 60%.

23. The dry powder formulation of any one of claims 1-22, wherein the encapsulation rate of the LNPs is greater than 70%.

24. The dry powder formulation of any one of claims 1-23, wherein the encapsulation rate of the LNPs is greater than 80%.

25. The dry powder formulation of any one of claims 1-24, wherein the mRNA maintains an integrity of 80% or greater post spray drying.

26. The dry powder formulation of any one of claims 1-25, wherein the mRNA maintains an integrity of 90% or greater post spray drying.

27. The dry powder formulation of any one of claims 1-26, wherein the mRNA maintains an integrity of 95% or greater post spray drying.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 28. The dry powder formulation of any one of claims 1-27, wherein the mRNA maintains the integrity of 80% or greater after storage at room temperature for 6 months or longer.

29. The dry powder formulation of any one of claims 1-28, wherein the mRNA maintains the integrity of 90% or greater after storage at room temperature for 6 months or longer.

30. The dry powder formulation of any one of claims 1-29, wherein the mRNA maintains the integrity of 80% or greater after storage at 4°C for 6 months or longer.

31. The dry powder formulation of any one of claims 1-30, wherein the mRNA maintains the integrity of 90% or greater after storage at 4°C for 6 months or longer.

32. The dry powder formulation of any one of claims 1-31, wherein the mRNA maintains the integrity of 80% or greater after storage at 25°C for 4 weeks or longer.

33. The dry powder formulation of any one of claims 1-32, wherein the mRNA maintains the integrity of 90% or greater after storage at 25°C for 4 weeks or longer.

34. The dry powder formulation of any one of claims 1-33, wherein the mRNA maintains the integrity of 95% or greater after storage at 25°C for 4 weeks or longer.

35. The dry powder formulation of any one of claims 1-34, wherein the dry powder formulation has a moisture content of less than 0.5%.

36. The dry powder formulation of any one of claims 1-35, wherein the dry powder formulation has a moisture content of less than 0.1%.

37. The dry powder formulation of any one of claims 1-36, wherein the mRNA encodes a therapeutic protein.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 38. The dry powder formulation of any one of claims 1-37, wherein the mRNA encodes an antigen.

39. The dry powder formulation of any one of claims 1-38, wherein the mRNA encodes a vaccine.

40. The dry powder formulation of any one of claims 1-39, wherein the dry powder formulation is inhalable.

41. The dry powder formulation of any one of claims 1-40, wherein the dry powder formulation is nebulizable upon reconstitution.

42. A method of delivering mRNA in vivo comprising administering to a subject in need thereof the dry powder formulation of any one of claims 1-41.

43. A method of treating a disease or disorder in a patient by administering to the patient the dry powder formulation of any one of claims 1-41.

44. The method of claim 42 or 43, wherein the dry powder formulation is administered by inhalation.

45. The method of claim 42 or 43, wherein the dry powder formulation is administered by intranasal spray.

46. The method of claim 42 or 43, wherein the dry powder formulation is administered by inhaler.

47. A method of preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles encapsulating an mRNA, b) adding leucine and mannitol to the mixture at a weight ratio of between 1:1 and 1:10,PATENT ATTORNEY DOCKET NO.0171.0103-PCT c) spray-drying the mixture, and d) obtaining the dry powder formulation that has a mean particle size of between 1- 8µm, and wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non- cationic lipids, and one or more PEG-modified lipids.

48. The method of claim 47, wherein the weight ratio of leucine and mannitol is 1:

8.

49. The method of claim 47, wherein the weight ratio of leucine and mannitol is 1:

4.

50. A method of preparing a dry powder formulation, the method comprising: a) providing a mixture comprising lipid nanoparticles (LNPs) encapsulating an mRNA, b) adding a hydrophobic amino acid to the mixture at a concentration of between 4.0- 65%, c) spray-drying the mixture, and d) obtaining the dry powder formulation that has a mean particle size of between 1- 8µm, and wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non- cationic lipids, and one or more PEG-modified lipids.

51. The method of claim 50, wherein the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline, or tryptophan.

52. The method of claim 51, wherein the hydrophobic amino acid is leucine.

53. The method of any one of claims 47-52, wherein the method further comprises a step of adding 20% ethanol to the mixture.

54. The method of any one of claims 47-53, wherein the spray-drying step occurs at a temperature of less than 90°C.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 55. The method of any one of claims 47-54, wherein the spray-drying step occurs at a temperature of between 20-70°C.

56. The method of any one of claims 47-55, wherein the LNPs encapsulating the mRNA have a N / P ratio of between 2 and 6.

57. The method of any one of claims 47-56, wherein the N / P ratio is between 3 and 4.

58. The method of any one of claims 47-57, wherein the N / P ratio is 3.

59. The method of any one of claims 47-58, wherein the LNPs further comprise one or more cholesterol-based lipids.

60. The method of any one of claims 47-59, wherein the one or more cationic lipids constitutes about 30-70% of the total lipids in LNPs by molar %.

61. The method of any one of claims 47-60, wherein the one or more PEG-modified lipids constitutes about 1-15% of the total lipids in LNP by molar %.

62. The method of any one of claims 47-61, wherein the one or more non-cationic lipids constitutes about 10-40% of the total lipids in LNP by molar %.

63. The method of any one of claims 59-62, wherein the one or more cholesterol-based lipids comprise about 5-40% of the total lipids in LNP by molar %.

64. The method of any one of claims 59-63, wherein the molar ratio of cationic lipid(s) to non- cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles is approximately 60:25:10:5.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 65. The method of any one of claims 59-63, wherein the molar ratio of cationic lipid(s) to non- cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) in the lipid nanoparticles is approximately 40:25:30:

5.

66. The method of any one of claims 47-65, wherein the mean particle size is between 1-5 µm.

67. The method of any one of claims 47-66, wherein the mean particle size is between 1-3 µm.

68. The method of any one of claims 47-67, wherein the mRNA constitutes greater than 2% of the dry powder formulation by weight.

69. The method of any one of claims 47-68, wherein the mRNA constitutes greater than 3% of the dry powder formulation by weight.

70. The method of any one of claims 47-69, wherein the mRNA constitutes greater than 4% of the dry powder formulation by weight.

71. The method of any one of claims 47-70, wherein the encapsulation rate of the LNPs is greater than 60%.

72. The method of any one of claims 47-71, wherein the encapsulation rate of the LNPs is greater than 70%.

73. The method of any one of claims 47-72, wherein the encapsulation rate of the LNPs is greater than 80%.

74. The method of any one of claims 47-73, wherein the mRNA maintains an integrity of 80% or greater post spray drying.

75. The method of any one of claims 47-74, wherein the mRNA maintains an integrity of 90% or greater post spray drying.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 76. The method of any one of claims 47-75, wherein the mRNA maintains an integrity of 95% or greater post spray drying.

77. The method of any one of claims47-76, wherein the mRNA maintains the integrity of 80% or greater after storage at room temperature for 6 months or longer.

78. The method of any one of claims 47-77, wherein the mRNA maintains the integrity of 90% or greater after storage at room temperature for 6 months or longer.

79. The method of any one of claims 47-78, wherein the mRNA maintains the integrity of 80% or greater after storage at 4°C for 6 months or longer.

80. The method of any one of claims 47-79, wherein the mRNA maintains the integrity of 90% or greater after storage at 4°C for 6 months or longer.

81. The method of any one of claims 47-80, wherein the mRNA maintains the integrity of 80% or greater after storage at 25°C for 4 weeks or longer.

82. The method of any one of claims 47-81, wherein the mRNA maintains the integrity of 90% or greater after storage at 25°C for 4 weeks or longer.

83. The method of any one of claims 47-82, wherein the mRNA maintains the integrity of 95% or greater after storage at 25°C for 4 weeks or longer.

84. The method of any one of claims 47-83, wherein the dry powder formulation has a moisture content of less than 0.5%.

85. The method of any one of claims 47-84, wherein the dry powder formulation has a moisture content of less than 0.1%.PATENT ATTORNEY DOCKET NO.0171.0103-PCT 86. The method of any one of claims 47-85, wherein the mRNA encodes a therapeutic protein.

87. The method of any one of claims 47-86, wherein the mRNA encodes an antigen.

88. The method of any one of claims 47-87, wherein the mRNA encodes a vaccine.

89. The method of any one of claims 47-88, where in the dry powder formulation is inhalable.

90. The method of any one of claims 47-89, wherein the dry powder formulation is nebulizable upon reconstitution.