Methods and agents for treating neurotrophic keratitis

EP4622634A1Pending Publication Date: 2025-10-01MICROCURES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023889603
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-08
Filing Date
2023-11-07
Publication Date
2025-10-01

AI Technical Summary

Technical Problem

Current therapies for neurotrophic keratitis (NK) are inadequate, and there is a need for effective methods to treat the degenerative disease of the cornea caused by trigeminal nerve damage, which leads to corneal sensitivity impairment, epithelial breakdown, and ulceration.

Method used

Administering an RNA interference agent, such as siRNA or shRNA, that inhibits fidgetin-like 2 (FL2) activity for ocular administration to promote corneal healing and improve sensitivity, with specific sequences and delivery methods like nanoparticles, electroporation, or drug-eluting contact lenses.

Benefits of technology

The treatment leads to complete corneal healing, reduction in persistent epithelial defects, improved visual acuity, and enhanced corneal sensitivity, addressing the progression of corneal damage and promoting epithelial healing in NK patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000003_0001
    Figure IMGF000003_0001
  • Figure IMGF000006_0001
    Figure IMGF000006_0001
  • Figure IMGF000026_0001
    Figure IMGF000026_0001
Patent Text Reader

Abstract

Methods are described for treating neurotrophic keratitis in a subject by administering an agent that inhibits fidgetin-like 2 activity, such as by using an RNA interference agent, e.g., siRNA.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND AGENTS FOR TREATING NEUROTROPHIC KERATITIS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 423,745, filed November 8, 2022, which is incorporated here by reference in its entirety. BACKGROUND

[0002] Neurotrophic keratitis (NK; also called neurotrophic keratopathy) is a degenerative disease of the cornea caused by damage of the trigeminal nerve, which results in impairment of corneal sensitivity, spontaneous corneal epithelium breakdown, poor corneal healing and development of corneal ulceration, melting and perforation. In addition to its primary sensory role, the nerve also plays a role maintaining the integrity of the cornea by supplying it with trophic factors and regulating tissue metabolism.

[0003] Neurotrophic keratitis is classified as a rare disease, with an estimated prevalence of less than 50 / 100,000 individuals. It has been reported that on average, 6% of herpetic keratitis cases may evolve to this disease, with a peak of 12.8% of cases of keratitis due to varicella zoster virus. Although there are many causes of NK, herpetic keratitis due to herpes simplex virus (HSV) and herpes zoster virus (HZV) infections is the most common cause and accounts for up to 27% of NK cases.

[0004] NK is poorly addressed by current therapies; new methods for effectively treating NK are needed. SUMMARY

[0005] The methods and agents for uses disclosed herein for use in patients with neurotrophic keratitis (NK) are directed to treating the degenerative disease of the cornea caused by damage to the trigeminal nerve, which may be triggered by any number of induction events (such as but not limited to those described herein below) but do not typically develop into NK. Thus, the methods disclosed herein for such uses are distinct from uses for treatment of the causes of NK, and suchtreatment of NK typically would be initiated at diagnosis of NK as described herein, and not contiguous with any treatment of its causes.

[0006] Thus, in one aspect, a method is provided for treating neurotrophic keratitis comprising administering to a subject in need thereof an effective amount of an agent that inhibits or reduces the activity of fidgetin-like 2 (FL2) formulated for ocular administration. In certain embodiments, the neurotrophic keratitis is Stage 1 or Stage 2 or Stage 3. In certain embodiments, the inhibitor of fidgetin-like 2 is an RNA interference agent. In certain embodiments, the RNA interference agent is siRNA. In certain embodiments, the RNA interference agent is shRNA. In certain embodiments, treating comprises an improvement in one or more from among: complete corneal healing, reduction in area of the persistent epithelial defect, no residual fluorescein staining in the area of the corneal lesion, no persistent fluorescein staining, complete corneal clearing, improved visual acuity and improved corneal sensitivity.

[0007] In certain embodiments, the siRNA comprises a sequence selected from:fUfUmA fCmAfC AGU AUU AAA GCG ATT (SEQ ID NO:17); (Phos) U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO:18); 5’-UUACACAGUAUUAAAGCGATT-3’ (SEQ ID NO:34); (Phos) 5’ – mUmCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:35); (Phos) 5’ – mU(s)mC(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:36); (Phos) 5’ – fUfCGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:37); (Phos) 5’ –fU(s)fC(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:38); (Phos) 5’ – mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3’ (SEQ ID NO:39); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:40); (Phos) 5’ – mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO:41); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3’ (SEQ ID NO:42); (Phos) 5’ – mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3’ (SEQ ID NO:43); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3’ (SEQ ID NO:44); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3’ (SEQ ID NO:45); 5' UUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:46); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:47); (Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:48); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:49); 5'-mUmUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:50); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUmAmATT-3’ (SEQ ID NO:51); (Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:52); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3’ (SEQ ID NO:53); 5' lUlUlAlClACAGUAUUAAAGCGATT-3’ (SEQ ID NO:54); (Phos) 5’ – UCGCUUUAAUACUGlUlGlUlAlA TT -3’ SEQ ID NO:55);5' fUfUlAfClACAGUAUUAAAGCGA-3’ (SEQ ID NO:56); or (Phos) 5’ – mU(s)mCmGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:57), wherein d(nucleotide) = deoxy-(nucleotide), m(nucleotide) = 2 ^-O-methyl nucleotide, T = thymidine, f(nucleotide) = 2 ^-fluorodeoxy nucleotide, (Phos) = phosphodiester cap; capital letter nucleotide = RNA nucleotide, l(nucleotide) = a locked nucleotide, and (s) = phosphorothioate.

[0008] In some embodiments, the siRNA has at least one modification selected from a 3’ overhang, a 5’ overhang, a 5’ phosphorylation, a 2’ sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing. In some embodiments, a siRNA or shRNA sequence disclosed herein with at least one modification has at least one additional modification selected from a 3' overhang, a 5' overhang, a 5' phosphorylation, a 2' sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing.

[0009] In certain embodiments, the fidgetin-like 2 is human fidgetin-like 2. In certain embodiments, the siRNA or shRNA is encapsulated in a nanoparticle. In certain embodiments, the siRNA or shRNA is delivered by nanoparticles, electroporation / nucleofection, Accel siRNA, a viral vector, peptide, protein or aptamer. In certain embodiments, the siRNA or shRNA is delivered by eyedrop. In certain embodiments, the siRNA or shRNA is delivered in an ocular wafer. In certain embodiments, the siRNA or shRNA is delivered in a drug-eluting contact lens.

[0010] In certain embodiments, the siRNA comprises a duplex of SEQ ID NO:17 and SEQ ID NO:18.

[0011] In certain embodiments, the shRNA comprises SEQ ID NO:23.

[0012] In one aspect, an ophthalmic composition is provided for treating neurotrophic keratitis comprising an effective amount of an agent that inhibits or reduces the activity of fidgetin-like 2 (FL2). In certain embodiments, the neurotrophic keratitis is Stage 1 or Stage 2 or Stage 3. In certain embodiments, the inhibitor of fidgetin-like 2 is an RNA interference agent. In certain embodiments, the RNA interference agent is siRNA. In certain embodiments, the RNA interference agent is shRNA. In certain embodiments, the treating comprises an improvement in one or more from among: completecorneal healing, reduction in area of the persistent epithelial defect, no residual fluorescein staining in the area of the corneal lesion, no persistent fluorescein staining, complete corneal clearing, improved visual acuity and improved corneal sensitivity.

[0013] In certain embodiments, the ophthalmic composition siRNA comprises a sequence selected from:(Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:40); (Phos) 5’ – mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO:41); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3’ (SEQ ID NO:42); (Phos) 5’ – mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3’ (SEQ ID NO:43); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3’ (SEQ ID NO:44); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3’ (SEQ ID NO:45); 5' UUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:46); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:47); (Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:48); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:49); 5'-mUmUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:50); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUmAmATT-3’ (SEQ ID NO:51); (Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:52); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3’ (SEQ ID NO:53); 5' lUlUlAlClACAGUAUUAAAGCGATT-3’ (SEQ ID NO:54); (Phos) 5’ – UCGCUUUAAUACUGlUlGlUlAlA TT -3’ SEQ ID NO:55); 5' fUfUlAfClACAGUAUUAAAGCGA-3’ (SEQ ID NO:56); or (Phos) 5’ – mU(s)mCmGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:57), wherein d(nucleotide) = deoxy-(nucleotide), m(nucleotide) = 2 ^-O-methyl nucleotide, T = thymidine, f(nucleotide) = 2 ^-fluorodeoxy nucleotide, (Phos) = phosphodiester cap; capital letter nucleotide = RNA nucleotide, l(nucleotide) = a locked nucleotide, and (s) = phosphorothioate.

[0014] In certain embodiments, the siRNA has at least one modification selected from a 3’ overhang, a 5’ overhang, a 5’ phosphorylation, a 2’ sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing. Any such one ormore modifications may be in addition to any such modification in any of the foregoing sequences. In certain embodiments, the fidgetin-like 2 is human fidgetin-like 2. In certain embodiments, the siRNA or shRNA is encapsulated in a nanoparticle. In certain embodiments, the siRNA or shRNA is provided in nanoparticles, electroporation / nucleofection, Accel siRNA, a viral vector, peptide, protein or aptamer. In certain embodiments, the siRNA or shRNA ophthalmic formulation is provided in eyedrop. In certain embodiments, the siRNA or shRNA ophthalmic formulation is provided in an ocular wafer. In certain embodiments, the siRNA or shRNA ophthalmic formulation is provided in a drug-eluting contact lens. In certain embodiments, the ophthalmic shRNA composition comprises SEQ ID NO:23. DETAILED DESCRIPTION

[0015] The present subject matter may be understood more readily by reference to the following detailed description which forms a part of this disclosure. It is to be understood that this invention is not limited to the specific products, methods, conditions or parameters described and / or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed invention.

[0016] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0017] As employed above and throughout the disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings.

[0018] In the present disclosure, the singular forms "a," "an," and "the" include the plural reference, and reference to a particular numerical value includes at least that particular value, unless the context clearly indicates otherwise. Thus, for example, a reference to "a compound" is a reference to one or more of such compounds and equivalents thereof known to those skilled in the art, and so forth. The term "plurality", as used herein, means more than one. When a range ofvalues is expressed, another embodiment includes from the one particular and / or to the other particular value.

[0019] Similarly, when values are expressed as approximations, by use of the antecedent "about," it is understood that the particular value forms another embodiment. All ranges are inclusive and combinable. In the context of the present disclosure, by "about" a certain amount it is meant that the amount is within ± 20% of the stated amount, or preferably within ± 10% of the stated amount, or more preferably within ± 5% of the stated amount.

[0020] As used herein, the terms “treat”, “treatment”, or “therapy” (as well as different forms thereof) refer to therapeutic treatment, including prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change associated with a disease or condition. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of the extent of a disease or condition, stabilization of a disease or condition (i.e., where the disease or condition does not worsen), delay or slowing of the progression of a disease or condition, amelioration or palliation of the disease or condition, and remission (whether partial or total) of the disease or condition, whether detectable or undetectable. Those in need of treatment include those already with the disease or condition as well as those prone to having the disease or condition or those in which the disease or condition is to be prevented.

[0021] As used herein, the terms "component," "composition," “formulation”, "composition of compounds," "compound," "drug," "pharmacologically active agent," "active agent," "therapeutic," "therapy," "treatment," or "medicament," are used interchangeably herein, as context dictates, to refer to a compound or compounds or composition of matter which, when administered to a subject (human or animal) induces a desired pharmacological and / or physiologic effect by local and / or systemic action. A personalized composition or method refers to a product or use of the product in a regimen tailored or individualized to meet specific needs identified or contemplated in the subject.

[0022] The terms "subject," "individual," and "patient" are used interchangeably herein, and refer to an animal, for example a human, to whom treatment with a composition or formulation in accordance with the present invention, is provided. The term "subject" as used herein refers tohuman and non-human animals. The terms "non-human animals" and "non-human mammals" are used interchangeably herein and include all vertebrates, e.g., mammals, such as non-human primates, (particularly higher primates), sheep, dog, rodent, (e.g. mouse or rat), guinea pig, goat, pig, cat, rabbits, cows, horses and non-mammals such as reptiles, amphibians, chickens, and turkeys. The compositions described herein can be used to treat any suitable mammal, including primates, such as monkeys and humans, horses, cows, cats, dogs, rabbits, and rodents such as rats and mice. In one embodiment, the mammal to be treated is human. The human can be any human of any age. In an embodiment, the human is an adult. In another embodiment, the human is a child. The human can be male, female, pregnant, middle-aged, adolescent, or elderly. According to any of the methods of the present invention and in one embodiment, the subject is human. In another embodiment, the subject is a non-human primate. In another embodiment, the subject is murine, which in one embodiment is a mouse, and, in another embodiment is a rat. In another embodiment, the subject is canine, feline, bovine, equine, laprine or porcine. In another embodiment, the subject is mammalian.

[0023] Conditions and disorders in a subject for which a particular drug, compound, composition, formulation (or combination thereof) is said herein to be "indicated" are not restricted to conditions and disorders for which that drug or compound or composition or formulation has been expressly approved by a regulatory authority, but also include other conditions and disorders known or reasonably believed by a physician or other health or nutritional practitioner to be amenable to treatment with that drug or compound or composition or formulation or combination thereof.

[0024] Other abbreviations used herein include Fi2, Fidgetin-like 2; FL2, Fidgetin-like 2; FL2- NPsi, rRat analog of SiFi2, silencing FL2 with siRNA; HSV, Herpes simplex virus; HZV, Herpes zoster virus; HZO, Herpes zoster ophthalmicus; MT, Microtubule; NK, Neurotrophic keratitis; SiFi2, Small interfering ribonucleic acid targeting fidgetin-like 2; siRNA, Small interfering ribonucleic acid.

[0025] The present disclosure is directed to the treatment of neurotrophic keratitis (NK) by administration to a subject an RNA interfering agent targeting fidgetin-like 2 (FL2). Neurotrophic Keratitis

[0026] Neurotrophic keratitis (NK), also known as neurotrophic keratopathy, is a rare degenerative disease of the cornea characterized by decreased or absent corneal sensitivity with consequent breakdown of the corneal epithelium, which is caused by damage to the trigeminal nerve. Epithelial breakdown can lead to ulceration, infection, melting, and perforation secondary to poor corneal healing, which could ultimately result in a serious loss of visual acuity or blindness.

[0027] NK is caused by any persistent disruption of the corneal sensory innervation interfering with the function of the post-ganglionic fibers. There are numerous etiologies which share the common pathway of altering corneal sensory innervation, as shown in Table 1. The methods disclosed herein are directed to any cause of NK such as but not limited to those in Table 1. The most common causes include herpetic keratitis due to herpes simplex virus (HSV) and herpes zoster virus (HZV) infections, which account for up to 27% of NK cases (Bonini et al. 2003, Sacchetti et al. 2014, Versura et al. 2018). Chemical burns, corneal surgeries, and other corneal traumatic injuries are other common ocular causes. Genetic and systemic conditions may also lead to the development of NK.

[0028] Table 1. Common Causes of Neurotrophic Keratitis

[0029] The cornea is innervated by the ophthalmic branch of the trigeminal nerve and autonomic nerves. Corneal nerves are essential for maintaining a healthy corneal epithelium by activating protective reflexes post injury and providing trophic factors (e.g., calcitonin gene-related peptide, acetylcholine, serotonin, substance P, neuropeptide Y) that promote corneal epithelial cell proliferation, migration, adhesion, and differentiation. Moreover, corneal epithelial cells play an important role in corneal homeostasis by secreting various neurotrophic growth factors such as ciliary neurotrophic factor, glial-cell-derived neurotrophic factor, and nerve growth factor. The epithelial cells act in a mutually supportive relationship with the corneal nerves to promote neuronal development and survival. Thus, the disruption of sensory innervation hinders the corneal nerve-epithelial cell cross-talk and results in NK, consequently leading to epithelial breakdown, poor wound healing, and persistent corneal defects.

[0030] Diagnosis of NK is based on review of clinical history, eye examination, and testing to assess decreased corneal sensitivity and nerve damage (Sacchetti et al.2014, Feroze et al.2022). NK clinical presentation is predominantly unilateral and characterized by progressive ocular surface changes. Corneal damage severity in NK is classified into three stages using the Mackie system: the relatively mild Stage 1 (corneal epithelial changes), moderate Stage 2 (current or persistent corneal epithelial defects), and the more severe Stage 3 (corneal ulcer, perforation, stromal melting) (Sacchetti et al.2014).

[0031] Table 2. Clinical Presentation of Neurotrophic Keratitis

[0032] Patients also commonly present with redness, dry eye, reduced visual acuity, and blurred vision due to persistent epithelial defects (Sacchetti et al. 2014, Versura et al. 2018, Feroze et al. 2022). The prognosis of NK is dependent on the severity of the disease and stage of disease at time of diagnosis. Due to the natural history of NK, it is imperative to treat progression of corneal damage and promote epithelial healing. The present disclosure provides methods and agents for treating NK including but not limited to the progression of corneal damage and promote epithelial healing.

[0033] The methods and agents disclosed herein for treatment of NK may be combined with any one or more other treatments for NK. In one embodiment, the other treatment is using cenegermin (Oxervate™), a recombinant human nerve growth factor (Oxervate 2019). In one embodiment, the other treatment is use of topical antibiotics to prevent infections. In one embodiment, the other treatment is use of therapeutic contact lenses to promote corneal healing. In one embodiment, the other treatment is use of a surgical procedure to treat corneal ulcers that are refractory to medication.

[0034] The methods and agents for uses disclosed herein for use in patients with NK are directed to treating the degenerative disease of the cornea caused by damage to the trigeminal nerve, which may be triggered by any number of induction events (such as but not limited to those listed in Table 1) but do not typically develop into NK. Thus, the methods and agents for such uses disclosed herein are distinct from treatment of the causes of NK such as those listed in Table 1, and such treatment of NK typically would be initiated at diagnosis of NK as described herein, and not contiguous with any treatment of the causes listed in Table 1.

[0035] In some embodiments, treatment is initiated at the time of diagnosis of NK. In some embodiments, treatment is initiated if the corneal defect does not resolve or heal. In some embodiments, treatment is initiated of the corneal defect does not heal after, in some embodiments, one month, two month, three months, four months, or longer than 4 months from the time ofdiagnosis. In some embodiments, treatment is initiated of the corneal defect does not heal after one month, two month, three months, four months, or longer than 4 months from the time of onset. In some embodiments, onset may be earlier than diagnosis. Clinical Evaluation of a RNAi Agent in NK

[0036] In one embodiment, the activity and efficacy of a RNAi targeting FL2 for treatment of NK may be conducted in a 8-week Phase I / II, multicenter, randomized, double-masked, vehicle-controlled parallel-group study with a 48- or 56-week follow-up period to evaluate the safety and efficacy of two dose frequencies of 20 micrograms of a liposomal formulated siRNA against Fidgetin-like 2) eye drops solution versus vehicle in patients with Stage 2 and 3 of neurotrophic keratitis.

[0037] In some embodiments, the siRNA is 20 micrograms if SIRNA 9 e.g., a duplex of SEQ ID NO:17 and SEQ ID NO:18 in liposomal formulation). One 35 μl drop equals to 9.37 micrograms of siRNA duplex. In some embodiments, the vehicle control is an ophthalmic solution of the same composition as the test product but excluding siRNA. In some embodiments, the test product and vehicle are formulated as single-use preparation (frozen-solution packaged in a glass vial) and administered through a sterile polyethylene dropper provided in a kit. In some embodiments the siRNA is stored frozen. In some embodiments (at home) the study medication is stored in the fridge at 2 - 8 °C for a maximum of 7 days. In some embodiments, one drop (35 μl) of study medication is administered 6 times a day in the affected eye(s), during the 8-week, randomized, double- masked, controlled treatment period and during the 8-week, uncontrolled treatment period for qualifying study subjects (see study design below).

[0038] In some embodiments, diagnosis of NK is based on review of clinical history, eye examination, and testing to assess decreased corneal sensitivity and nerve damage (Sacchetti, M. and A. Lambiase, Diagnosis and management of neurotrophic keratitis. Clinical ophthalmology (Auckland, N.Z.), 2014. 8: p. 571-579, Feroze KB, Patel BC,; Neurotrophic keratitis, StatPearls 2022 May 24). In some embodiments, NK clinical presentation is predominantly unilateral and characterized by progressive ocular surface changes. In some embodiments, as shown in Table 1 herein, corneal damage severity inNK is classified into three stages using the Mackie system: the relatively mild Stage 1 (corneal epithelial changes), moderate Stage 2 (current or persistent corneal epithelial defects), and the more severe Stage 3 (corneal ulcer, perforation, stromal melting) (Sacchetti et al. 2014). In some embodiments, patients also commonly present with redness, dry eye, reduced visual acuity, and blurred vision due to persistent epithelial defects (Sacchetti et al.2014, Versura, P., et al., Neurotrophic keratitis: current challenges and future prospects. Eye and brain, 2018. 10: p. 37-45. Feroze et al. 2022). In some embodiments, the prognosis of NK is dependent on the severity of the disease and stage of disease at time of diagnosis. Due to the natural history of NK, it is imperative to treat progression of corneal damage and promote epithelial healing.

[0039] In some embodiments, Phase I and Phase II will begin with an 8-week randomized, controlled, double-masked treatment period. In some embodiments, after the 8-week controlled treatment period, patients will be assessed as completely healed (CH) or non-completely healed (NCH), and then enter the 48-week or 56-week follow-up period. In some embodiments, the follow-up period will be 48 weeks in length for the following patients: 1. Those initially randomized to siRNA treatment regardless of whether the patient was completely healed or non-completely healed at Week 8. 2. Those initially randomized to vehicle and who were completely healed at Week 8.

[0040] In some embodiments, the follow-up period will be 56 weeks in length for the following patients: 1.Those initially randomized to vehicle and who are non-completely healed at Week 8. These patients will be treated with siRNA during the 8-week uncontrolled treatment period (Week 8 to Week 16). Patients will be randomized to one of the 2 regimens. Following the uncontrolled treatment period, these patients will be followed for 48 weeks, and therefore their total follow-up period will be 56 weeks in length (i.e., 8 weeks of siRNA treatment plus 48 weeks of follow-up).

[0041] In some embodiments, 20 micrograms siRNA will be administered once every 48 hours for 8 weeks (Regimen 1), and once a day for 8 weeks (Regimen 2).

[0042] Primary Objectives and Endpoints: In some embodiments, the objective of the Phase 1 study is to assess the safety and pharmacokinetic profile of the siRNA eye drops solution, administered at the proposed clinical dose to the intended patient population (20 micrograms, single drop administered once every two days or once a day to Stage 2 and Stage 3 NK patients). In some embodiments, incidences of ophthalmic adverse events (AEs) will be assessed via routine ophthalmic examinations conducted on all subjects throughout the treatment and follow-up period. In some embodiments, these include: visual acuity assessments, corneal photography, manifest refractions, confocal microscopy (on a subset of subjects), corneal sensitivity testing, slit lamp examination, and dilated fundus examinations. In some embodiments, ophthalmic examinations will be conducted weekly during the treatment period, one month into the follow-up period (12 weeks + / -3 days), then every 3 months for the remainder of the follow-up period. Any systemic AEs in patients during the treatment or 48-week follow-up period will be documented.

[0043] In some embodiments, primary endpoints of Phase 1 and / or Phase 2 include any one or more of the following: -Incidence of ophthalmic adverse events during the course of treatment or the follow-up period in treatment and vehicle groups. Ophthalmic AEs include corneal epithelium defects, corneal neovascularization, corneal thinning, eye inflammation, eye pain, hyphemia, keratitis, reduced visual acuity, corneal deposits, eye inflammation, eye pain, lacrimation increased, ocular hyperemia, and intraocular pressure increased. -Incidence of systemic adverse events in treatment and vehicle groups during the course of treatment or the follow-up period.-Determination of the pharmacokinetic profile of siRNA and collection of data concerning possible systemic exposure of siRNA in Stage 2 and Stage 3 NK patients treated with siRNA via local application to the eye.

[0044] In some embodiments, secondary endpoints of Phase 1 and / or Phase 2 include any one or more of the following: -Clinical laboratory tests (hematology and serum chemistry parameters) will be performed at the beginning and end of the trial. -Heart rate and blood pressure will be checked at Baseline, Week 4 and Week 8, and electrocardiograms performed at Baseline, Week 4 and Week 8.

[0045] In some embodiments, the primary objective of Phase 2 is assessing the efficacy of siRNA eye drops solution (20 micrograms, single drop administered once every two days or once a day) compared to vehicle in inducing complete healing of Stage 2 (PED) and Stage 3 (corneal ulcer) NK, as measured by the central reading center evaluating the clinical pictures of corneal fluorescein staining. In some embodiments, secondary objectives of the Phase 2 study will be one or more of: to assess for complete healing as measured by the investigator, the duration of complete healing, improvement in visual acuity and improvement in corneal sensitivity, and percentage of patients achieving complete corneal clearing defined as complete absence of staining on the modified Oxford Scale.

[0046] In some embodiments, a key secondary objective is incomplete corneal healing (<0.5 mm lesion size) as measured by the central reading center evaluating the clinical pictures of corneal fluorescein staining.

[0047] In some embodiments, additional secondary objectives include any one or more of the following: - Improvement in visual acuity via ETDRS chart - Improvement in corneal sensitivity via Cochet-Bonnet esthesiometry

[0048] In some embodiments, a primary efficacy endpoint is the percentage of patients experiencing complete healing (0 mm lesion size and no residual staining) of Stage 2 (PED) and Stage 3 (corneal ulcer) NK, as measured by the central reading center evaluating the clinical pictures of corneal fluorescein staining at 8 weeks. In some embodiments, corneal fluorescein staining using the modified Oxford scale will be assessed at the slit lamp using a yellow barrier filter and cobalt blue illumination.

[0049] In some embodiments, secondary efficacy endpoints include one or more of: - Percentage of patients experiencing complete healing of the PED or corneal ulcer determined by corneal fluorescein staining at 4, 6, 8, 12, 20, 32, 44, and 56 weeks, as defined by the Investigator. - Percentage of patients experiencing complete corneal clearing (Grade 0 on the modified Oxford scale) at 4, 68, 12, 20, 32, 44 and 56 weeks. - Mean change in best corrected distance visual acuity (BCDVA) from baseline to Week 8. - Percentage of patients that achieved a ≥15 letter gain in BCDVA at 4, 6, and 8 weeks. - Percentage of patients that achieved an improvement in corneal sensitivity as measured by the Cochet-Bonnet esthesiometer at 4, 6 and 8 weeks (binary goal attainment variable: Week 4 / 6 / 8 corneal sensitivity – Baseline corneal sensitivity > 0 [Yes / No]). - Percentage of patients experiencing deterioration (increase in lesion size ≥ 1mm, decrease in BCDVA by >5 ETDRS letters, progression in lesion depth to corneal melting or perforation, onset of infection) in Stage 2 or 3 NK from baseline to Weeks 4, 6 and 8. - Time to onset of deterioration from baseline to Week 8.

[0050] In some embodiments, one or more exploratory efficacy variables are evaluated, including one or more of time to complete corneal clearing and to onset of healing (defined as a >20% reduction in the greatest diameter of the lesion), change in Schirmer’s without anesthesia score, change in tear film osmolarity and change in National Eye Institute Visual Functioning Questionnaire 25 (NEI-VFQ) and / or EuroQol 5D (EQ-5D) scores.

[0051] In some embodiments, the sample size for the study is calculated based on an estimated 60% of patients achieving complete healing of the PED or corneal ulcer with siRNA eye drops at 4 weeks as compared to 30% in patients treated with the vehicle. Best In some embodiments the Phase II segment of study will need 141 evaluable patients to have 80% power to detect such a difference. In some embodiments, assuming a drop-out rate of 10-20%, a minimum of 156 patients were to be randomized in the Phase II segment. In some embodiments, this sample size was considered adequate to evaluate safety for progression to continue into Phase II of the study. In some embodiments, a minimum of 174 patients in total (including 18 patients for the Phase I segment) are planned to be randomized.

[0052] In some embodiments, the Phase II segment of the study will be included in the baseline randomization scheme for all patients assigned to vehicle a randomized secondary treatment assignment to active study medication. This randomized secondary treatment assignment is defined as the regimen of the active study medication that the patients in the vehicle control arm would receive during the 56-week follow-up period if not completely healed at Week 8, or in the event of a recurrence of their PED or corneal ulcer.

[0053] In some embodiments, key inclusion criteria include any one or more of the following: - Patients 18 years of age or older. - Patients with Stage 2 PED or Stage 3 (corneal ulcer) NK. Patients with NK stage 2 or 3 involving only 1 eye were permissible- PED or corneal ulceration of at least 2 weeks duration, refractory to one or more conventional non-surgical treatments for NK (eg, preservative-free artificial tears, gels or ointments; discontinuation of preserved topical drops and medications that can decrease corneal sensitivity; therapeutic contact lenses). - Evidence of decreased corneal sensitivity (≤ 4 cm using the Cochet-Bonnet aesthesiometer) within the area of the PED or corneal ulcer and outside of the area of the defect in at least 1 corneal quadrant. - Best corrected distance visual acuity (BCDVA) score ≤ 75 Early Treatment Diabetic Retinopathy Study (ETDRS) letters (equivalent to ≥ + 0.2 LogMAR, ≤ 20 / 32 Snellen or ≤ 0.625 decimal fraction) in the affected eye. - No objective clinical evidence of improvement in the PED or corneal ulceration within the 2 weeks prior to study enrolment.

[0054] In some embodiments, key Exclusion Criteria include any one or more of the following: - Any active ocular infection (bacterial, viral, fungal or protozoal) or active ocular inflammation not related to NK in the affected eye. - Any other ocular disease requiring topical ocular treatment in the affected eye during the course of the study treatment period. No topical treatments other than the study medications provided by the study sponsor or allowed by the study protocol could be administered in the affected eye during the course of the study treatment periods. - Patients with severe vision loss in the affected eye with no potential for visual improvement in the opinion of the Investigator as a result of the study treatment. - Schirmer test without anesthesia ≤ 3 mm / 5 minutes in the affected eye. - Patients with severe blepharitis and / or severe meibomian gland disease in the affected eye.- History of any ocular surgery (including laser or refractive surgical procedures) in the affected eye within the three months before study enrolment. - Prior surgical procedure(s) for the treatment of NK (eg, complete tarsorraphy, conjunctival flap, etc) in the affected eye with the exception of amniotic membrane transplantation. Patients previously treated with Botox (botulinum toxin) injections were eligible for enrolment only if the last injection was given at least 90 days prior to enrolment in the study. - Use of therapeutic contact lenses or contact lens wear for refractive correction during the study treatment periods in the eye with NK. - Anticipated need for punctual occlusion during the study treatment period. Patients with punctual occlusion or punctual plugs inserted prior to the study were eligible for enrolment provided that the punctual occlusion was maintained during the study. - Evidence of corneal ulceration involving the posterior third of the corneal stroma, corneal melting or perforation in the affected eye. - Presence or history of any ocular or systemic disorder or condition that might have hindered the efficacy of the study treatment or its evaluation, could possibly have interfered with the interpretation of study results, or could have been judged by the Investigator to be incompatible with the study visit schedule or conduct (eg, progressive or degenerative corneal or retinal conditions, uveitis, optic neuritis, poorly controlled diabetes, autoimmune disease, systemic infection, neoplastic diseases). - Any need for or anticipated change in the dose of systemic medications known to impair the function of the trigeminal nerve (eg, neuroleptics, antipsychotic and antihistamine drugs), unless initiated prior to 30 days before study enrolment and they remained stable throughout the course of the study treatment periods. - Any known sensitivity to RNA-based therapeutics.

[0055] In some embodiments ‘Completely Healed’ comprises Dompe’s original definition: The greatest diameter of corneal fluorescein staining in the area of the persistent epithelial defect (PED) or corneal ulcer (as measured at the baseline visit) was < 0.5 mm at the moment of assessment. In some embodiments, ‘Completely Staining Free’ means any one or more or all of the following: - no residual fluorescein staining in the area of the corneal lesion at the moment of assessment and - No persistent staining (i.e., not changing in shape and / or location at different time points) elsewhere in the cornea as seen in pictures taken at different time points during the study.

[0056] In some embodiments, the corneal images that are needed to be reassessed by the central reading center which remained masked to the patient and visit to which each image corresponded. In some embodiments, all images are reassessed for patients who were judged to have been completely healed (Dompé definition) or have a lesion size of 0 mm at any time point, and is determined or each patient: - Is any residual staining present? (i.e., is there any staining outside of the lesion area?) (Yes / No) - If residual staining is present, is the staining persistent? (where persistent indicated the staining was persistent in a specific zone of the cornea and had not cleared or changed in shape and / or location between images) (Yes / No)

[0057] There are 3 possible scenarios per patient. The table below describes the possible responses and the resultant healing status for each patient.* Result from main analysis unchanged. ** Completely Healed status from main analysis is revised to be Not Completely Healed for all time points.

[0058] In some embodiments, all post-hoc efficacy analyses are performed using the ITT population. The analysis of the post-hoc efficacy endpoints for the Phase II segment of the study used the data for the 8-week controlled treatment period. In some embodiments, for the chi-square analyses of achievement of complete healing at Week 4 and Week 8, missing data are imputed using the last observation carried forward (LOCF) methodology. In some embodiments, these analyses are also presented by imputing missing data as failures (worst case scenario), where data are considered to be missing at a given visit regardless of the reason for the missing data. In some embodiments, all other post-hoc analyses were conducted on an observed case basis, that is, no further imputation of missing data was carried out unless expressly stated otherwise.

[0059] Test product: 20 micrograms SiFi2 in liposomal formulation. One 35 μl drop equals to 9.37 microgram of siRNA duplex.

[0060] Vehicle Control: Ophthalmic solution of the same composition as the test product but excluding SiFi2. Test product and vehicle control preparation:

[0061] The test product and vehicle were formulated as single-use preparation (frozen- solution packaged in a glass vial) and administered through a sterile polyethylene dropper (in the kit box there was a dropper per each vial). The study treatments were supplied in identical boxes. Each treatment kit included 7 boxes, each containing 6 frozen single-use vials of the randomized / assigned medication for daily treatment, i.e., a total number of 42 vials in each kit. At home, the study medication was to be stored in the fridge at 2 - 8 °C for a maximum of 7 days. When the patient started to use the study medication he / shewas to remove from the fridge only 1 daily box including 6 single-use vials to be used over the course of the day.

[0062] One drop (35 μl) of study medication is to be administered 6 times a day in the affected eye(s), during the 8-week, randomized, double-masked, controlled treatment period and during the 8-week, uncontrolled treatment period for qualifying study subjects (see study design above). Estimated Time to Complete Enrollment: Three months. FL2 inhibitors

[0063] In some embodiments, treatment of NK comprises administering to a patient in need thereof an agent that reduces fidgetin-like 2 (FL2) expression or activity in the cornea.

[0064] Non-limiting examples of inhibitors of FL2 expression or its activity include aptamers, nucleic acids, oligonucleotides, and small molecules (of 2000 Daltons or less). In one embodiment, agents that inhibit FL2 expression or activity include nucleic acids such as but not limited to RNA interference agents. Non-limiting examples of RNA interference agents include shRNA and siRNA. siRNA

[0065] In one embodiment, the RNA interference agent is an siRNA (small interfering RNA). In an embodiment, the siRNA as used in the methods or compositions described herein comprises a portion which is complementary to an mRNA sequence encoding a fidgetin-like 2 protein. In an embodiment, the fidgetin-like 2 protein is a human fidgetin-like 2 protein. In an embodiment, the mRNA is encoded by the DNA sequence NCBI Reference Sequence: NM—001013690.4 (SEQ ID NO:19), and the siRNA is effective to inhibit expression of fidgetin-like 2 protein. In an embodiment, the fidgetin-like 2 protein comprises consecutive amino acid residues having the sequence set forth in SEQ ID NO:20 shown below.

[0066] In one embodiment, the siRNA comprises a double-stranded portion (duplex). In an embodiment, the siRNA is 20-25 nucleotides in length. In an embodiment the siRNA comprises a 19-21 core RNA duplex with a one or two nucleotide 3′ overhang on, independently, either one or both strands.

[0067] siRNA oligonucleotides may be modified to enhance their activity and reduce degradation, such as described in Chakraborty et al., 2017, Mol Ther Nucleic Acids 8:132-143, incorporated herein by reference, among other teachings in the art. In one embodiment, the siRNA can be 5′ phosphorylated, or not, and may be modified with any of the known modifications in the art to improve efficacy and / or resistance to nuclease degradation. In an embodiment the siRNA can be administered such that it is transfected into one or more cells. In an embodiment, the siRNA is 5′ phosphorylated.

[0068] In an embodiment, the 5′ terminal residue of a strand of the siRNA is phosphorylated. In an embodiment the 5′ terminal residue of the antisense strand of the siRNA is phosphorylated. In one embodiment, a siRNA of the invention comprises a double-stranded RNA wherein one strand of the double-stranded RNA is 80, 85, 90, 95 or 100% complementary to a portion of an RNA transcript of a gene encoding fidgetin-like 2 protein. In an embodiment, the RNA transcript of a gene encoding fidgetin-like 2 protein is an mRNA. In an embodiment, the fidgetin-like 2 protein is a human fidgetin-like 2 protein. In an embodiment, a siRNA of the invention comprises a double-stranded RNA wherein one strand of the RNA comprises a portion having a sequence the same as a portion of 18-25 consecutive nucleotides of an RNA transcript of a gene encoding fidgetin-like 2 protein. In an embodiment, the fidgetin-like 2 protein is a human fidgetin-like 2 protein. In yet another embodiment, a siRNA of the invention comprises a double-stranded RNA wherein both strands of RNA are connected by a non-nucleotide linker. Alternately, a siRNA of the invention comprises a double-stranded RNA wherein both strands of RNA are connected by a nucleotide linker, such as a loop or stem loop structure.

[0069] In one embodiment, a single strand component of a siRNA of the invention is from 14 to 50 nucleotides in length. In another embodiment, a single strand component of a siRNA of the invention is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length. In yet another embodiment, a single strand component of a siRNA of the invention is 21 nucleotides in length. In yet another embodiment, a single strand component of a siRNA of the invention is 22 nucleotides in length. In yet another embodiment, a single strand component of a siRNA of the invention is 23 nucleotides in length. In one embodiment, a siRNA of the invention is from 28 to 56 nucleotides in length. In another embodiment, a siRNA of the invention is 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52 nucleotides in length.

[0070] In one embodiment, the siRNA has at least one modification selected from a 3’ overhang, a 5’ overhang, a 5’ phosphorylation, a 2’ sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing. Any such one or more modifications may be in addition to any such modification in any of the sequences disclosed herein.

[0071] In another embodiment, an siRNA of the invention comprises a 3’ overhang. In another embodiment, an siRNA of the invention comprises a 5’ overhang. In another embodiment, an siRNA of the invention comprises at least one 2′-sugar modification, such as but not limited to 2’azido-2’deoxycytidine ribonucleic acid, 2’-azido-2’deoxyuridine ribonucleic acid, 2’-azido- 2’deoxyadenosine ribonucleic acid, 2’-azido-2’-deoxyguanosine ribonucleic acid, 2’-fluoro-2’- deoxyadenosine ribonucleic acid, 2’-fluoro-2’-deoxycytidine ribonucleic acid, 2’-fluoro-2’- deoxyuridine ribonucleic acid, 2-fluorothymidine ribonucleic acid, 2'-O-methyladenosine ribonucleic acid, 2'-O-methylcytidine ribonucleic acid, 2'-O-methylguanosine ribonucleic acid, 2'- O-methyluridine ribonucleic acid, In another embodiment, an siRNA of the invention comprises at least one nucleic acid base modification, such as but not limited. to 2’-fluorodeoxy cytidine ribonucleic acid, 2’-fluorodeoxy uracil ribonucleic acid, 2’-O-methyl adenosine ribonucleic acid. Other nucleotide modifications are described in Chiu et al., 2003, RNA 9(9):1034-1048, and Peacock et al., 2011, J Org Chem 76(18):7295-7300, incorporated herein by reference.

[0072] In another embodiment, an siRNA of the invention comprises at least one phosphate backbone modification. In another embodiment, an siRNA of the invention comprises at least one 5′ phosphorylation. As used herein, “at least one” means one or more.

[0073] Any such one or more modifications may be in addition to any such modification in any of the sequences disclosed herein.

[0074] The NCBI Reference Sequence: NM—001013690.4 (nucleic acid encoding human fidgetin-like 2) is:

[0075] In one embodiment, the siRNA that inhibits FL2 comprises a sense or antisense sequence selected from the table below.wherein d(nucleotide) = deoxy-(nucleotide), m(nucleotide) = 2 ^-O-methyl nucleotide, T = thymidine, f(nucleotide) = 2 ^-fluorodeoxy nucleotide, (Phos) = phosphodiester cap; capital letter nucleotide = RNA nucleotide, l(nucleotide) = a locked nucleotide, and (s) = phosphorothioate. Thus, for example dT represents deoxythymidine, dC represents deoxycytidine, fC represents 2’- fluorodeoxy cytidine ribonucleic acid, fU represents 2’-fluorodeoxy uracil ribonucleic acid, mA represents 2’-O-methyl adenosine ribonucleic acid, mU represents 2’-O-methyl uracil ribonucleicacid, mC represents 2’-O-methyl cytosine ribonucleic acid, and mG represents 2’-O-methyl guanosine ribonucleic acid.

[0076] In some embodiments, the siRNA may have a 5’-phosphodiester cap, as abbreviated “(Phos)” in the aforementioned sequences. In some embodiments, the siRNA does not have a 5’- phosphodiester cap. siRNA sequences without a 5’-phosphodiester cap are fully embraced herein.

[0077] A phosphorothioate linkage between nucleotides is represented in the sequences by “(s)”.

[0078] Locked nucleotides in one embodiment comprise a ribose with a 2’-O, 4’-C methylene bridge, for example, 2'-O, 4'-C methylene adenosine (lA); 2'-O, 4'-C methylene guanosine (lG); 2'-O, 4'-C methylene cytidine (lC); 2'-O, 4'-C methylene uridine (lU); and 2'-O, 4'-C methylene thymine (lT) ribonucleosides. In other embodiments, the locked nucleic acid comprises a methyl group attached to the methylene group. Other types of locked nucleic acids are embraced herein.

[0079] In one embodiment, the FL2 siRNA is double-stranded and comprises any complementary sense sequence and antisense sequence from the foregoing table.

[0080] Non-limiting examples of such double-stranded sequences include SEQ ID NO:1 and SEQ ID NO: 2, SEQ ID NO:3 and SEQ ID NO: 4, SEQ ID NO:5 and SEQ ID NO: 6, SEQ ID NO:7 and SEQ ID NO: 8, SEQ ID NO:9 and SEQ ID NO: 10, SEQ ID NO:11 and SEQ ID NO: 12, SEQ ID NO:13 and SEQ ID NO: 14, SEQ ID NO:15 and SEQ ID NO: 16, and SEQ ID NO:17 and SEQ ID NO: 18. In some embodiments, the siRNA is single-stranded, selected from among SEQ ID NO:1-18 above.

[0081] In one embodiment, a double stranded nucleic acid is provided consisting of complementary nucleic acid molecules selected from among SEQ ID NOs: 34-57 or from among SEQ ID NOS: 1-18 or 34-57. In one embodiment, the double stranded nucleic acid comprises a sense strand and an antisense strand. In one embodiment, the double stranded nucleic acid consists of a sense strand and an antisense strand.

[0082] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 or 17; and an antisense strand selected from SEQ ID NOs: 2, 4, 6, 8, 10, 1,2, 14, 16 or 18.

[0083] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50 and 54; and an antisense strand selected from SEQ ID NOs: 2, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55 and 57.

[0084] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50, 54 and 56; and an antisense strand selected from SEQ ID NOs: 2, 4, 6, and 8.

[0085] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 3, 5 and 7; and an antisense strand selected from SEQ ID NOs: 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55 and 57.

[0086] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 34, 42, 44, 45, 46, 50 and 54; and an antisense strand selected from SEQ ID NOs: 2, 4, 6, 8, 10, 1,2, 14, 16, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55 and 57.

[0087] In one embodiment, a double stranded nucleic acid is provided comprising a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 34, 42, 44, 45, 46, 50 and 54; and an antisense strand selected from SEQ ID NOs: 2, 4, 6, 8, 10, 1,2, 14, 16, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55 and 57.

[0088] In one embodiment, a double-stranded nucleic acid is provided consisting of SEQ ID NO:17 and SEQ ID NO:18; SEQ ID NO:34 and SEQ ID NO:35; SEQ ID NO:34 and SEQ ID NO:36; SEQ ID NO:34 and SEQ ID NO:37; SEQ ID NO:34 and SEQ ID NO:38; SEQ ID NO:34 and SEQ ID NO:39; SEQ ID NO:17 and SEQ ID NO:40; SEQ ID NO:34 and SEQ ID NO:41; SEQ ID NO:42 and SEQ ID NO:43; SEQ ID NO:44 and SEQ ID NO:43; SEQ ID NO:45 and SEQ ID NO:43; SEQ ID NO:46 and SEQ ID NO:47; SEQ ID NO:46 and SEQ ID NO:48; SEQ ID NO:46 and SEQ ID NO:49; SEQ ID NO:50 and SEQ ID NO:51; SEQ ID NO:46 and SEQ ID NO:53; SEQ ID NO:54 and SEQ ID NO:55; or SEQ ID NO:56 and SEQ ID NO:57.

[0089] In one embodiment, a double stranded nucleic acid is provided comprising at least one nucleic acid molecule selected from among SEQ ID NOs: 1-18 or 34-57.

[0090] In one embodiment, a double stranded nucleic acid is provided comprising two nucleic acid molecules selected from among SEQ ID NOs: 1-18 or 34-57. In one embodiment, the double stranded nucleic acid comprises a sense strand and an antisense strand.

[0091] In one embodiment, each strand of the double stranded nucleic acid has no more than 52 nucleotides.

[0092] In one embodiment, a double stranded nucleic acid is provided comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50, 54 and 56; and an antisense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 2, 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55 and 57.

[0093] In one embodiment, a double stranded nucleic acid is provided comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50, 54 and 56; and an antisense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 4, 6, 8, and 10.

[0094] In one embodiment, a double stranded nucleic acid is provided comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 3, 5, 7 and 9; and an antisense strand comprising a nucleic acid molecule selected from SEQ ID NO: 18, 35, 36, 37, 38, 39, 40, 41, 43, 47, 48, 49, 51, 52, 53, 55 and 57.

[0095] In one embodiment, the double-stranded nucleic acid comprises nucleic acid molecules comprising SEQ ID NO:17 and SEQ ID NO:18; SEQ ID NO:34 and SEQ ID NO:35; SEQ ID NO:34 and SEQ ID NO:36; SEQ ID NO:34 and SEQ ID NO:37; SEQ ID NO:34 and SEQ ID NO:38; SEQ ID NO:34 and SEQ ID NO:39; SEQ ID NO:17 and SEQ ID NO:40; SEQ ID NO:34 and SEQ ID NO:41; SEQ ID NO:42 and SEQ ID NO:43; SEQ ID NO:44 and SEQ ID NO:43; SEQ ID NO:45 and SEQ ID NO:43; SEQ ID NO:46 and SEQ ID NO:47; SEQ ID NO:46 and SEQ ID NO:48; SEQ ID NO:46 and SEQ ID NO:49; SEQ ID NO:50 and SEQ ID NO:51; SEQ ID NO:46 and SEQ ID NO:53; SEQ ID NO:54 and SEQ ID NO:55; or SEQ ID NO:56 and SEQ ID NO:57.

[0096] In one embodiment, each strand of the double stranded nucleic acid has no more than 52 nucleotides.

[0097] In one embodiment, any one of the foregoing nucleic acids has at least one nucleotide that is modified or further modified. In one embodiment, the modified nucleotide is selected from 2’-O-methyl-adenosine, 2’-O-methyl-uridine, 2’-O-methyl-cytosine, 2’-O-methyl-guanosine, 2’- O-methyl-thymidine, 2’-fluoro-adenosine, 2’-fluoro-cytidine, 2’-fluoro-guanosine, 2’-fluoro- uracil, 2’-fluoro-thymidine, deoxycytosine, deoxyguanosine, deoxyadenosine, deoxythymidine, deoxyuridine, a locked adenosine, a locked uridine, a locked guanosine, a locked cytidine, a phosphorothioate, and a phosphodiester cap. In one embodiment, at least one additional nucleotide or modified nucleotide is added to an end of the nucleic acid.

[0098] As noted above, locked nucleotides in one embodiment comprise a ribose with a 2’-O, 4’-C methylene bridge, for example, 2'-O, 4'-C methylene adenosine (lA); 2'-O, 4'-C methylene guanosine (lG); 2'-O, 4'-C methylene cytidine (lC); 2'-O, 4'-C methylene uridine (lU); and 2'-O, 4'-C methylene thymine (lT) ribonucleosides. In other embodiments, the locked nucleic acid comprises a methyl group attached to the methylene group. Other types of locked nucleic acids are embraced herein.

[0099] In other examples, a siRNA directed to FL2 may be selected from among:wherein the abbreviations are the same as described above. [000100] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50 and 54; and an antisense strand selected from any one of SEQ ID NOs: 58-72. [000101] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 3, 5 and 7; and an antisense strand selected from any one of SEQ ID NOs: 58-72. [000102] In one embodiment, a double stranded nucleic acid is provided consisting of a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 34, 42, 44, 45, 46, 50 and 54; and an antisense strand selected from any one of SEQ ID NOs: 58-72. [000103] In one embodiment, a double stranded nucleic acid is provided comprising a sense strand selected from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 34, 42, 44, 45, 46, 50 and 54; and an antisense strand selected from any one of SEQ ID NOs: 58-72. [000104] In one embodiment, a double-stranded nucleic acid is provided consisting of SEQ ID NO:34 and SEQ ID NO:58; SEQ ID NO:34 and SEQ ID NO:59; SEQ ID NO:34 and SEQ ID NO:60; SEQ ID NO:17 and SEQ ID NO:61; SEQ ID NO:34 and SEQ ID NO:62; SEQ ID NO:42 and SEQ ID NO:63; SEQ ID NO:44 and SEQ ID NO:63; SEQ ID NO:45 and SEQ ID NO:63; SEQ ID NO:46 and SEQ ID NO:64; SEQ ID NO:46 and SEQ ID NO:65; SEQ ID NO:46 and SEQ ID NO:66; SEQ ID NO:50 and SEQ ID NO:67; SEQ ID NO:46 and SEQ ID NO:69; SEQ ID NO:54 and SEQ ID NO:70; SEQ ID NO:17 and SEQ ID NO:72, or SEQ ID NO:56 and SEQ ID NO:71.[000105] In one embodiment, a double stranded nucleic acid is provided comprising at least one nucleic acid molecule selected from among SEQ ID NOs: 58-72. [000106] In one embodiment, a double stranded nucleic acid is provided comprising two nucleic acid molecules selected from among SEQ ID NOs: 1-18 or 34-72. In one embodiment, the double stranded nucleic acid comprises a sense strand and an antisense strand. [000107] In one embodiment, each strand of the double stranded nucleic acid has no more than 52 nucleotides. [000108] In one embodiment, a double stranded nucleic acid is provided comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 17, 34, 42, 44, 45, 46, 50, 54 and 56; and an antisense strand comprising a nucleic acid molecule selected from any one of SEQ ID NOs: 58-72. [000109] In one embodiment, a double stranded nucleic acid is provided comprising a sense strand comprising a nucleic acid molecule selected from SEQ ID NOs: 1, 3, 5, 7 and 9; and an antisense strand comprising a nucleic acid molecule selected from any one of SEQ ID NOs:58-72. [000110] In one embodiment, the double-stranded nucleic acid comprises nucleic acid molecules comprising SEQ ID NO:34 and SEQ ID NO:58; SEQ ID NO:34 and SEQ ID NO:59; SEQ ID NO:34 and SEQ ID NO:60; SEQ ID NO:17 and SEQ ID NO:61; SEQ ID NO:34 and SEQ ID NO:62; SEQ ID NO:42 and SEQ ID NO:63; SEQ ID NO:44 and SEQ ID NO:63; SEQ ID NO:45 and SEQ ID NO:63; SEQ ID NO:46 and SEQ ID NO:64; SEQ ID NO:46 and SEQ ID NO:65; SEQ ID NO:46 and SEQ ID NO:66; SEQ ID NO:50 and SEQ ID NO:67; SEQ ID NO:46 and SEQ ID NO:69; SEQ ID NO:54 and SEQ ID NO:70; SEQ ID NO:17 and SEQ ID NO:72, or SEQ ID NO:56 and SEQ ID NO:71. [000111] Any of the compositions and uses of siRNA directed to FL2 as described elsewhere herein may utilize any of the foregoing single stranded nucleic acid sequences SEQ ID NOs:58- 72, or a double stranded nucleic acids comprising or consisting of any of SEQ ID NOs:58-72. [000112] In one embodiment, RNAi inhibition of fidgetin-like 2 protein is effected by a short hairpin RNA (“shRNA”). The shRNA is introduced into the appropriate cell by transduction witha vector. In an embodiment, the vector is a lentiviral vector. In an embodiment, the vector comprises a promoter. In an embodiment, the promoter is a U6 or H1 promoter. In an embodiment the shRNA encoded by the vector is a first nucleotide sequence ranging from 19-29 nucleotides complementary to the target gene / mRNA, in the present case the mRNA encodes fidgetin-like 2 protein. In an embodiment the fidgetin-like 2 protein is a human fidgetin-like 2 protein. In an embodiment the shRNA encoded by the vector also comprises a short spacer of 4-15 nucleotides (a loop, which does not hybridize) and a 19-29 nucleotide sequence that is a reverse complement of the first nucleotide sequence. In an embodiment the siRNA resulting from intracellular processing of the shRNA has overhangs of 1 or 2 nucleotides. In an embodiment the siRNA resulting from intracellular processing of the shRNA overhangs has two 3′ overhangs. In an embodiment the overhangs are UU. shRNA [000113] In one non-limiting example, a shRNA useful for the purposes herein comprises CACCGCTGGAGCCCTTTGACAAGTTCTCGAGAACTTGTCAAAGGGCTCCAGCTTTT (SEQ ID NO:23). In one embodiment, the shRNA sequence consists of CACCGCTGGAGCCCTTTGACAAGTTCTCGAGAACTTGTCAAAGGGCTCCAGCTTTT (SEQ ID NO:23). Preparation [000114] Any of the nucleic acid sequences described herein may be prepared by any method known in the art, and purified by HPLC or any other method to provide inhibitors suitable for use for the in vitro, ex vivo or in vivo purposes described herein. In some embodiments, the purity of the inhibitor is equal to or greater than 85%. In some embodiment the purity is equal to or greater than 90%. In some embodiments the purity is equal to or greater than 95%. In some embodiment the purity is equal to or greater than 98%. In some embodiments the purity is equal to or greater than 99%. In some embodiments wherein the inhibitor is or comprises a duplex, the purity of the duplex is equal to or greater than 85%. In some embodiments wherein the inhibitor is or comprises a duplex, the purity of the duplex is equal to or greater than 90%. In some embodiments wherein the inhibitor is or comprises a duplex, the purity of the duplex is equal to or greater than 95%. In some embodiments wherein the inhibitor is or comprises a duplex, the purity of the duplex is equalto or greater than 98%. In some embodiments wherein the inhibitor is or comprises a duplex, the purity of the duplex is equal to or greater than 99%. In some embodiments the inhibitor is prepared under current Good Manufacturing Practices. In some embodiments the inhibitor is prepared for human use. In some embodiments the inhibitor is prepared for in vitro or ex vivo use for subsequent administration to humans. In some embodiments the inhibitor is prepared for human administration. Pharmaceutical Compositions and Methods for Ocular Delivery [000115] In one aspect, a composition is provided comprising any of the foregoing nucleic acid molecules or double-stranded nucleic acids, and a pharmaceutically acceptable carrier, vehicle, excipient or diluent. In one embodiment, a siRNA as described herein is formulated in a preservative-free, sterile liquid for ocular administration. [000116] As described herein, the one or more agents that inhibit FL2 in one embodiment is delivered to the eye for the treatment of NK. [000117] In one embodiment, the FL2 inhibitor such as a siRNA as described herein is formulated in an ophthalmic solution for application into the eye. In some embodiments, the FL2 inhibitor is encapsulated in nanoparticles or liposomes in the formulation. [000118] In some embodiments, the agent that inhibits activity or expression of FL2 is provided in an ophthalmic delivery format. Non-limiting examples of such formats include eyedrops, drug- releasing contact lenses and implants. As noted herein, the formulation of the agent may comprise nanoparticles, liposomes, or other carriers. The disclosure is not limited by any particular delivery method to address NK. [000119] Eyedrops. In one embodiment, the agent is provided in an eyedrop formulation. Guidance for such formulations are well known in the art. For example, Li et al., 2014, Current Molecular Medicine 14(9):1215-1225 describe cationic complexing agents such as polyethyleneimine (PEI) that increase delivery of siRNA into the cornea. Baran-Rachwalska et al., 2020, J Controlled Release 326:192-202 describe a silicon-based hybrid nanoparticle formulation in accordance with US Patent No. 9132083B2, providing siRNA in porous silicon nanoparticles and lipids that penetrate the cornea. Schiroli et al., 2019, Mol Ther Nucleic Acids 17:891-906describe derivatives of a cell penetrating peptide to aid in the penetration of siRNA into corneal layers, one modification being trifluoromethylquinoline-palmitoyl of CGGG[ARKKAAKA]4. Nie et al., 2009, Bioscience Hypotheses 2(4):223-225 suggested various topical means for siRNA delivery without injection. The foregoing examples, and citations incorporated here by reference, are merely exemplary. [000120] Drug-releasing contact lenses. Drug delivery by contact lenses is generally described by Barnett in Review of Optometry, August 15, 2021, and described methods such as the soaking method, molecular imprinting, colloidal nanoparticle-laden lenses, among other current and future means for delivery to the eye. Choi et al., 2018, Materials (Basel) 11(7):1125 review therapeutic contact lenses with polymeric vehicles for ocular drug delivery. [000121] Wafers. In one embodiment a wafer comprising the FL2 inhibitor agent such as siRNA is implanted at a site such as under the eyelid. In one embodiment, a composition of the FL2- siRNA-wafer is 2.5% collagen, 7.5% chondroitin sulfate, 82.5% polyvinylpyrrolidone (PVP) and 7.5% PEG400. siRNA will be incorporated into the wafer, and the siRNA will be measured and optimized, for example for size (by scanning electron microscopy, light scattering and atomic force microscopy), pH, charge, rate of delivery, amount of polyplex delivered, minimum fill and leakage, in order to obtain a suitable formulation to achieve good delivery and efficacy of siRNA knockdown. Formulations to be tested will be applied to the site. The FL2-siRNA-wafers (or controls containing nonsense-siRNA) are a gel-like matrix that will be cut to the appropriate size and applied with forceps to the site of insertion. [000122] In one non-limiting example, a sustained release, biodegradable, bioengineered product such as the NanoM Wafer™ which is a tissue-adherent product that can be placed under the upper eyelid or lower eyelid to release an agent described herein. See Barman et al., 2017, Invest Ophthal. Vis Sci 58(8):4103. [000123] In one non-limiting example, a nanowafer as described by Yuan et al., 2015, ACS Nano, 9(2):1749-1758 is used.[000124] In another embodiment, the siRNA may be delivered by an implantable delivery device, such as described in Zhang et al., 2019, Sci Adv 5:eaaw5296, incorporated herein by reference. [000125] Other means for ocular delivery of an agent disclosed herein is described in Gote et al., 2019, J Pharmacol Exp. Ther. 370(3):602-624. Non-limiting additional examples include Surodex™ Epi-scleral implant and DSP-Visulex cul-de-sac implant. [000126] Nanoparticles. In one embodiment, a nanoparticle is used to deliver the agent to the eye. Preparation of siRNA delivering nanoparticles is known in the art, such as described in Kim et al., 2019, Adv Mater (49)e1903637, epub; Ickenstein et al., 2019, Expert Opin Drug Deliv 16(11): 1205-1226 (Sept 17 epub). Various methods may be employed to prepare nanoparticles for effective delivery of their payload siRNA or shRNA into the eye. [000127] In one embodiment, nanoparticles comprising tetramethyl orthosilicate (TMOS) are used, wherein the TMOS nanoparticles comprise FL2 siRNA. For example, five hundred μl of tetramethyl orthosilicate (TMOS) can be hydrolyzed in the presence of 100 μl of 1 mM HCl by sonication on ice for about 15 min, until a single phase forms. The hydrolyzed TMOS (100 μl) can then be added to 900 μl of 20 μM of siRNA (mouse FL2 (Sigma-Aldrich, SASI_Mm02_00354635) or a negative control) solution containing 10 mM phosphate, pH 7.4. A gel is formed within 10 minutes. The gel may be frozen at −80°C for 15 minutes and lyophilized. [000128] The fidgetin, fidgetin-like 1 or FL2 inhibitor agent may be used in a composition with additives. Examples of suitable additives are sodium alginate, as a gelatinizing agent for preparing a suitable base, or cellulose derivatives, such as guar or xanthan gum, inorganic gelatinizing agents, such as aluminum hydroxide or bentonites (termed thixotropic gel-formers), polyacrylic acid derivatives, such as Carbopol®, polyvinylpyrrolidone, microcrystalline cellulose and carboxymethylcellulose. Amphiphilic low molecular weight and higher molecular weight compounds, and also phospholipids, are also suitable. The gels can be present either as water- based hydrogels or as hydrophobic organogels, for example based on mixtures of low and high molecular weight paraffin hydrocarbons and vaseline. The hydrophilic organogels can be prepared, for example, on the basis of high molecular weight polyethylene glycols. These gelatinous forms are washable. Hydrophobic organogels are also suitable. Hydrophobic additives, such as petroleumjelly, wax, oleyl alcohol, propylene glycol monostearate and / or propylene glycol monopalmitostearate, in particular isopropyl myristate can be included. Compositions may be in any suitable form. Emulsifiers which can be employed in compositions comprising the inhibitor of fidgetin-like 2 include anionic, cationic or neutral surfactants, for example alkali metal soaps, metal soaps, amine soaps, sulphonated and sulphonated compounds, invert soaps, higher fatty alcohols, partial fatty acid esters of sorbitan and polyoxyethylene sorbitan, e.g. lanette types, wool wax, lanolin or other synthetic products for preparing the oil / water and / or water / oil emulsions. [000129] Compositions comprising the agent that inhibits fidgetin-like 2 can also comprise vaseline, natural or synthetic waxes, fatty acids, fatty alcohols, fatty acid esters, for example as monoglycerides, diglycerides or triglycerides, paraffin oil or vegetable oils, hydrogenated castor oil or coconut oil, hog fat, synthetic fats (for example based on caprylic acid, capric acid, lauric acid or stearic acid, such as Softisan®), or triglyceride mixtures, such as Miglyol®, can be used as lipids, in the form of fatty and / or oleaginous and / or waxy components for preparing the ointments, creams or emulsions of the compositions comprising the inhibitor of fidgetin-like 2 used in the methods described herein. [000130] Osmotically active acids and alkaline solutions, for example hydrochloric acid, citric acid, sodium hydroxide solution, potassium hydroxide solution, sodium hydrogen carbonate, may also be ingredients of the compositions and, in addition, buffer systems, such as citrate, phosphate, tris buffer or triethanolamine, for adjusting the pH. It is possible to add preservatives as well, such as methyl benzoate or propyl benzoate (parabens) or sorbic acid, for increasing the stability. [000131] Pastes, powders and solutions are additional forms of compositions comprising the agent that inhibits of fidgetin, fidgetin-like 1 or fidgetin-like 2. As consistency-imparting bases, the pastes frequently contain hydrophobic and hydrophilic auxiliary substances, preferably, however, hydrophobic auxiliary substances containing a very high proportion of solids. In order to increase dispersity, and also flowability and slipperiness, and also to prevent agglomerates, the powders or topically applicable powders can, for example, contain starch species, such as wheat or rice starch, flame-dispersed silicon dioxide or siliceous earth, which also serve as diluent.[000132] In an embodiment, the compositions comprise further active ingredients, for example one or more antibiotics, antiseptics, vitamins, anesthetics, antihistamines, anti-inflammatory agents, moisturizers, penetration-enhancing agents and / or anti-irritants. Dosing Regimen [000133] The agent that suppresses expression of FL2 or its activity as described herein, is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression “dosage unit form” as used herein refers to a physically discrete unit of therapeutic agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. [000134] In one embodiment, a formulation comprises siRNA such as a duplex of SEQ ID NO:17 and SEQ ID NO:18. In some embodiments the siRNA is in a liposomal formulation. In some embodiments, a formulation for ocular delivery comprises the siRNA in a sterile solution wherein one 35 μl drop equals to 9.37 micrograms of siRNA duplex. [000135] In an embodiment of the methods and compositions described herein the subject is a mammal. In an embodiment the subject is human. [000136] In one embodiment, nanoparticles comprising the RNA interference agent are used for delivery for either the in vitro, ex vivo or in vivo applications of the methods described herein. [000137] The following examples are presented in order to more fully illustrate the preferred embodiments of the invention. It should in no way be construed, however, as limiting the broad scope of the invention.EXAMPLES Example 1. Eyedrop ophthalmic formulation for treating NK [000138] An eyedrop ophthalmic formulation is prepared comprising nanoparticles containing a siRNA comprising sense and antisense SEQ ID NOs: 17 and 18.[000139] The siRNA is formulated as a preservative-free, sterile liquid for topical ocular administration. The formulation is administered to a NK patient once every other day for 8 weeks. Improvement of NK is observed, including corneal healing and increase in corneal sensitivity. Example 2. Eyedrop ophthalmic formulation for treating NK [000140] An ophthalmic formulation is prepared comprising siRNA comprising sense and antisense SEQ ID NOs: 17 and 18 and polyethyleneimine. The formulation is instilled into the eye, one drop every other day. The subject’s NK improves. Example 3. siRNA-eluting contact lens formulation for treating NK [000141] An ophthalmic formulation is prepared comprising a soft contact lens into which sense and antisense SEQ ID NOs: 17 and 18 is incorporated. The contact lens is placed in the eyes and replaced daily. The subject’s NK improves. Example 4. Wafer ophthalmic formulation for treating NK [000142] An ophthalmic formulation is prepared comprising sense and antisense SEQ ID NOs: 17 and 18 in a wafer formulation. The wafer is placed under the lower eyelid. The subject’s NK improves.Example 5. Efficacy of siRNA targeting FL2 in Stage 2 and 3 NK [000143] The efficacy of an ophthalmic formulation of siRNA SEQ ID NO:17 and SEQ ID NO:18 is evaluated in patients based on review of clinical history, eye examination, and testing to assess decreased corneal sensitivity and nerve damage. NK clinical presentation is predominantly unilateral and characterized by progressive ocular surface changes. Patients with Stage 2 or 3 NK as described herein above are selected. Two dosing regimens are evaluated. The frequency of dosing is 20 micrograms of siRNA administered once every 48 hours for 8 weeks (Regimen 1), and once a day for 8 weeks (Regimen 2). After the 8-week controlled treatment period, patients are assessed as completely healed (CH) or non-completely healed (NCH), and then enter a 48- week or 56-week follow-up period. [000144] Efficacy is assessed by evaluating the clinical pictures of corneal fluorescein staining. Secondary objectives are to assess for complete healing as measured by the investigator, the duration of complete healing, improvement in visual acuity and improvement in corneal sensitivity, and percentage of patients achieving complete corneal clearing defined as complete absence of staining on the modified Oxford Scale. A key secondary objective is incomplete corneal healing (<0.5 mm lesion size) as measured by the central reading center evaluating the clinical pictures of corneal fluorescein staining. Additional Secondary Objectives are: Improvement in visual acuity via ETDRS chart and Improvement in corneal sensitivity via Cochet-Bonnet esthesiometry [000145] The primary efficacy endpoint is the percentage of patients experiencing complete healing (0 mm lesion size and no residual staining) of Stage 2 (PED) and Stage 3 (corneal ulcer) NK, as measured by the central reading center evaluating the clinical pictures of corneal fluorescein staining at 8 weeks. Corneal Fluorescein Staining using the modified Oxford scale will be assessed at the slit lamp using a yellow barrier filter and cobalt blue illumination. [000146] Efficacy: ‘Completely Healed’ is modified from Dompe’s original definition (the greatest diameter of corneal fluorescein staining in the area of the persistent epithelial defect (PED) or corneal ulcer [as measured at the baseline visit] was < 0.5 mm at the moment of assessment) to ‘Completely Staining Free’ meaning no residual fluorescein staining in the area of the corneal lesion at the moment of assessment and no persistent staining (i.e., not changing in shape and / orlocation at different time points) elsewhere in the cornea as seen in pictures taken at different time points during the study. [000147] The secondary efficacy endpoints are: Percentage of patients experiencing complete healing of the PED or corneal ulcer determined by corneal fluorescein staining at 4, 6, 8, 12, 20, 32, 44, and 56 weeks, as defined by the Investigator. Percentage of patients experiencing complete corneal clearing (Grade 0 on the modified Oxford scale) at 4, 68, 12, 20, 32, 44 and 56 weeks. Mean change in BCDVA from baseline to Week 8. Percentage of patients that achieved a ≥15 letter gain in BCDVA at 4, 6, and 8 weeks. Percentage of patients that achieved an improvement in corneal sensitivity as measured by the Cochet-Bonnet esthesiometer at 4, 6 and 8 weeks (binary goal attainment variable: Week 4 / 6 / 8 corneal sensitivity – Baseline corneal sensitivity > 0 [Yes / No]). Percentage of patients experiencing deterioration (increase in lesion size ≥ 1mm, decrease in BCDVA by >5 ETDRS letters, progression in lesion depth to corneal melting or perforation, onset of infection) in Stage 2 or 3 NK from baseline to Weeks 4, 6 and 8. Time to onset of deterioration from baseline to Week 8. [000148] Exploratory efficacy variables may be assessed, including time to complete corneal clearing and to onset of healing (defined as a >20% reduction in the greatest diameter of the lesion), change in Schirmer’s without anesthesia score, change in tear film osmolarity and change in National Eye Institute Visual Functioning Questionnaire 25 (NEI-VFQ) and EuroQol 5D (EQ-5D) scores. [000149] Key Inclusion Criteria are: Patients 18 years of age or older.Patients with Stage 2 PED or Stage 3 (corneal ulcer) NK. Patients with NK stage 2 or 3 involving only 1 eye were permissible PED or corneal ulceration of at least 2 weeks duration, refractory to one or more conventional non-surgical treatments for NK (eg, preservative-free artificial tears, gels or ointments; discontinuation of preserved topical drops and medications that can decrease corneal sensitivity; therapeutic contact lenses). Evidence of decreased corneal sensitivity (≤ 4 cm using the Cochet-Bonnet aesthesiometer) within the area of the PED or corneal ulcer and outside of the area of the defect in at least 1 corneal quadrant. Best corrected distance visual acuity (BCDVA) score ≤ 75 Early Treatment Diabetic Retinopathy Study (ETDRS) letters (equivalent to ≥ + 0.2 LogMAR, ≤ 20 / 32 Snellen or ≤ 0.625 decimal fraction) in the affected eye. No objective clinical evidence of improvement in the PED or corneal ulceration within the 2 weeks prior to study enrolment. [000150] Key Exclusion Criteria are: Any active ocular infection (bacterial, viral, fungal or protozoal) or active ocular inflammation not related to NK in the affected eye. Any other ocular disease requiring topical ocular treatment in the affected eye during the course of the study treatment period. No topical treatments other than the study medications provided by the study sponsor or allowed by the study protocol could be administered in the affected eye during the course of the study treatment periods. Patients with severe vision loss in the affected eye with no potential for visual improvement in the opinion of the Investigator as a result of the study treatment. Schirmer test without anesthesia ≤ 3 mm / 5 minutes in the affected eye. Patients with severe blepharitis and / or severe meibomian gland disease in the affected eye.History of any ocular surgery (including laser or refractive surgical procedures) in the affected eye within the three months before study enrolment. Prior surgical procedure(s) for the treatment of NK (eg, complete tarsorraphy, conjunctival flap, etc) in the affected eye with the exception of amniotic membrane transplantation. Patients previously treated with Botox (botulinum toxin) injections were eligible for enrolment only if the last injection was given at least 90 days prior to enrolment in the study. Use of therapeutic contact lenses or contact lens wear for refractive correction during the study treatment periods in the eye with NK. Anticipated need for punctual occlusion during the study treatment period. Patients with punctual occlusion or punctual plugs inserted prior to the study were eligible for enrolment provided that the punctual occlusion was maintained during the study. Evidence of corneal ulceration involving the posterior third of the corneal stroma, corneal melting or perforation in the affected eye. Presence or history of any ocular or systemic disorder or condition that might have hindered the efficacy of the study treatment or its evaluation, could possibly have interfered with the interpretation of study results, or could have been judged by the Investigator to be incompatible with the study visit schedule or conduct (eg, progressive or degenerative corneal or retinal conditions, uveitis, optic neuritis, poorly controlled diabetes, autoimmune disease, systemic infection, neoplastic diseases). Any need for or anticipated change in the dose of systemic medications known to impair the function of the trigeminal nerve (eg, neuroleptics, antipsychotic and antihistamine drugs), unless initiated prior to 30 days before study enrolment and they remained stable throughout the course of the study treatment periods. Any known sensitivity to RNA-based therapeutics.[000151] One drop (35 μl) of study medication is administered 6 times a day in the affected eye(s), during the 8-week, randomized, double-masked, controlled treatment period and during the 8-week, uncontrolled treatment period for qualifying study subjects. [000152] Subjects enrolled in the study in accordance with the inclusion and exclusion criteria described herein, and receive siRNA eye drops, show an improvement in one or more outcome of any from among the efficacy endpoint, secondary objectives, primary efficacy endpoint, secondary efficacy endpoints and exploratory efficacy variables. Treatment of NK is observed.

Claims

What is claimed is:

1. A method for treating neurotrophic keratitis comprising administering to a subject in need thereof an effective amount of an agent that inhibits or reduces the activity of fidgetin-like 2 (FL2) formulated for ocular administration.

2. The method of claim 1 wherein the neurotrophic keratitis is Stage 1 or Stage 2 or Stage 3.

3. The method of claim 1 wherein the inhibitor of fidgetin-like 2 is an RNA interference agent.

4. The method of claim 3 wherein the RNA interference agent is siRNA.

5. The method of claim 3 wherein the RNA interference agent is shRNA.

6. The method of claim 1 wherein the treating comprises an improvement in one or more from among: complete corneal healing, reduction in area of the persistent epithelial defect, no residual fluorescein staining in the area of the corneal lesion, no persistent fluorescein staining, complete corneal clearing, improved visual acuity and improved corneal sensitivity.

7. The method of claim 4 wherein the siRNA comprises a sequence selected from: UUACACAGUAUUAAAGCGAUU (SEQ ID NO:1); UCGCUUUAAUACUGUGUAAUU (SEQ ID NO:2); CAUCUGAAACCUAGGGUCUUU (SEQ ID NO:3; AGACCCUAGGUUUCAGAUGUU (SEQ ID NO:4); GUGACUUAUGCUAGGAGGAUU (SEQ ID NO:5); UCCUCCUAGCAUAAGUCACUU (SEQ ID NO:6); GGUCAGAAGCAGAAUGUAUUU (SEQ ID NO:7); AUACAUUCUGCUUCUGACCUU (SEQ ID NO:8); CGCCGGCCCACAAGUUGGAdTdT (SEQ ID NO:9); UCCAACUUGUGGGCCGGCGdTdT (SEQ ID NO:10); CAGCUCGAGCCCUUUGACAdTdT (SEQ ID NO:11); UGUCAAAGGGCUCGAGCUGdTdT (SEQ ID NO:12);CCUCCAACCUCCUCAAGAGdTdT (SEQ ID NO:13); CUCUUGAGGAGGUUGGAGGdTdT (SEQ ID NO:14); CGUUGCUGCUCAUCAGCGAdTdT (SEQ ID NO:15); UCGCUGAUGAGCAGCAACGdTdT (SEQ ID NO:16); fUfUmA fCmAfC AGU AUU AAA GCG ATT (SEQ ID NO:17); (Phos) U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO:18); 5’-UUACACAGUAUUAAAGCGATT-3’ (SEQ ID NO:34); (Phos) 5’ – mUmCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:35); (Phos) 5’ – mU(s)mC(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:36); (Phos) 5’ – fUfCGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:37); (Phos) 5’ –fU(s)fC(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:38); (Phos) 5’ – mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3’ (SEQ ID NO:39); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:40); (Phos) 5’ – mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO:41); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3’ (SEQ ID NO:42); (Phos) 5’ – mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3’ (SEQ ID NO:43); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3’ SEQ ID NO:44); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3’ (SEQ ID NO:45); 5' UUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:46); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:47); (Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:48); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:49); 5'-mUmUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:50); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUmAmATT-3’ (SEQ ID NO:51);(Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:52); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3’ (SEQ ID NO:53); 5' lUlUlAlClACAGUAUUAAAGCGATT-3’ (SEQ ID NO:54); (Phos) 5’ – UCGCUUUAAUACUGlUlGlUlAlA TT -3’ (SEQ ID NO:55); 5' fUfUlAfClACAGUAUUAAAGCGA-3’ (SEQ ID NO:56); (Phos) 5’ –mU(s)mCmGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:57), 5’ – fUfCGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:58; 5’ –fU(s)fC(s)GCUUUAAUACUGUGUAATT-3’(SEQ ID NO:59); 5’ – mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3’ (SEQ ID NO:60); 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:61); 5’ – mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO:62); 5’ – mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3’ (SEQ ID NO:63); 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:64); 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:65); 5’ – U(s)C(s)GCUUUAAUACUGUGUAATT-3’(SEQ ID NO:66); 5’ – U(s)CGCUUUAAUACUGUGUmAmATT-3’ (SEQ ID NO:67); 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:68); 5’ – U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3’ (SEQ ID NO:69); 5’ – UCGCUUUAAUACUGlUlGlUlAlA TT -3’ (SEQ ID NO:70); 5’ – mU(s)mCmGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:71); or 5’ -U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO:72); wherein d(nucleotide) = deoxy-(nucleotide), m(nucleotide) = 2 ^-O-methyl nucleotide, T = thymidine, f(nucleotide) = 2 ^-fluorodeoxy nucleotide, (Phos) = phosphodiester cap; capital letter nucleotide = RNA nucleotide, l(nucleotide) = a locked nucleotide, and (s) = phosphorothioate.

8. The method of claim 4 wherein the siRNA has at least one modification selected from a 3’ overhang, a 5’ overhang, a 5’ phosphorylation, a 2’ sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing.

9. The method of claim 7 wherein the siRNA has at least one additional modification selected from a 3’ overhang, a 5’ overhang, a 5’ phosphorylation, a 2’ sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing.

10. The method of claim 1 wherein the fidgetin-like 2 is human fidgetin-like 2.

11. The method of claim 4 or 5 wherein the siRNA or shRNA is encapsulated in a nanoparticle.

12. The method of claim 4 or 5 wherein the siRNA or shRNA is delivered by nanoparticles, electroporation / nucleofection, Accel siRNA, a viral vector, peptide, protein or aptamer.

13. The method of claim 4 or 5 wherein the siRNA or shRNA is delivered by eyedrop.

14. The method of claim 4 of 5 wherein the siRNA or shRNA is delivered in an ocular wafer.

15. The method of claim 4 or 5 wherein the siRNA or shRNA is delivered in a drug-eluting contact lens.

16. The method of claim 4 wherein the siRNA comprises a duplex of SEQ ID NO:17 and SEQ ID NO:

18.

17. The method of claim 5 wherein the shRNA comprises SEQ ID NO:

23.

18. The method of claim 6 wherein the defect is treated starting at the time of diagnosis.

19. The method of claim 6 wherein the defect is treated starting about one month, two months or three months from onset.

20. The method of claim 6 wherein the defect is treated starting about one month, two months or three month from diagnosis.

21. An ophthalmic composition for treating neurotrophic keratitis comprising an effective amount of an agent that inhibits or reduces the activity of fidgetin-like 2 (FL2).

22. The ophthalmic composition of claim 21 wherein the neurotrophic keratitis is Stage 1 or Stage 2 or Stage 3.

23. The ophthalmic composition of claim 21 wherein the inhibitor of fidgetin-like 2 is an RNA interference agent.

24. The ophthalmic composition of claim 23 wherein the RNA interference agent is siRNA.

25. The ophthalmic composition of claim 23 wherein the RNA interference agent is shRNA.

26. The ophthalmic composition of claim 21 wherein the treating comprises an improvement in one or more from among: complete corneal healing, reduction in area of the persistent epithelial defect, no residual fluorescein staining in the area of the corneal lesion, no persistent fluorescein staining, complete corneal clearing, improved visual acuity and improved corneal sensitivity.

27. The ophthalmic composition of claim 24 wherein the siRNA comprises a sequence selected from: UUACACAGUAUUAAAGCGAUU (SEQ ID NO:1); UCGCUUUAAUACUGUGUAAUU (SEQ ID NO:2); CAUCUGAAACCUAGGGUCUUU (SEQ ID NO:3; AGACCCUAGGUUUCAGAUGUU (SEQ ID NO:4); GUGACUUAUGCUAGGAGGAUU (SEQ ID NO:5); UCCUCCUAGCAUAAGUCACUU (SEQ ID NO:6); GGUCAGAAGCAGAAUGUAUUU (SEQ ID NO:7); AUACAUUCUGCUUCUGACCUU (SEQ ID NO:8); CGCCGGCCCACAAGUUGGAdTdT (SEQ ID NO:9); UCCAACUUGUGGGCCGGCGdTdT (SEQ ID NO:10); CAGCUCGAGCCCUUUGACAdTdT (SEQ ID NO:11); UGUCAAAGGGCUCGAGCUGdTdT (SEQ ID NO:12); CCUCCAACCUCCUCAAGAGdTdT (SEQ ID NO:13); CUCUUGAGGAGGUUGGAGGdTdT (SEQ ID NO:14); CGUUGCUGCUCAUCAGCGAdTdT (SEQ ID NO:15); UCGCUGAUGAGCAGCAACGdTdT (SEQ ID NO:16); fUfUmA fCmAfC AGU AUU AAA GCG ATT (SEQ ID NO:17);(Phos) U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO:18); 5’-UUACACAGUAUUAAAGCGATT-3’ (SEQ ID NO:34); (Phos) 5’ – mUmCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:35); (Phos) 5’ – mU(s)mC(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:36); (Phos) 5’ – fUfCGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:37); (Phos) 5’ –fU(s)fC(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:38); (Phos) 5’ – mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3’ (SEQ ID NO:39); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:40); (Phos) 5’ – mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO:41); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGmCmGmAmUmU-3’(SEQ ID NO:42); (Phos) 5’ – mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3’ (SEQ ID NO:43); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCdGdATT-3’ (SEQ ID NO:44); 5' mUmUmAmCmAmCmAmGmUmAmUmUmAmAmAmGdCmGmATT-3’ (SEQ ID NO:45); 5' UUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:46); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:47); (Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:48); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:49); 5'-mUmUACACAGUAUUAAAGCGA-3’ (SEQ ID NO:50); (Phos) 5’ – U(s)CGCUUUAAUACUGUGUmAmATT-3’ (SEQ ID NO:51); (Phos) 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:52); (Phos) 5’ – U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3’ (SEQ ID NO:53); 5' lUlUlAlClACAGUAUUAAAGCGATT-3’ (SEQ ID NO:54); (Phos) 5’ – UCGCUUUAAUACUGlUlGlUlAlA TT -3’ (SEQ ID NO:55); 5' fUfUlAfClACAGUAUUAAAGCGA-3’ (SEQ ID NO:56); or(Phos) 5’ –mU(s)mCmGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:57), 5’ – fUfCGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:58; 5’ –fU(s)fC(s)GCUUUAAUACUGUGUAATT-3’(SEQ ID NO:59); 5’ – mU(s)mC(s)GCUUUAAUAmCfUmGfUmGfUmAmATT-3’ (SEQ ID NO:60); 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:61); 5’ – mUfCmGfCmUfUmUAAfUmAfCmUGmUmGfUmAmATT (SEQ ID NO:62); 5’ – mUmCmGmCmUmUmUmAmAmUmAmCmUmGmUmGmUmAmAmUmU-3’ (SEQ ID NO:63); 5’ – U(s)CGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:64); 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:65); 5’ – U(s)C(s)GCUUUAAUACUGUGUAATT-3’(SEQ ID NO:66); 5’ – U(s)CGCUUUAAUACUGUGUmAmATT-3’ (SEQ ID NO:67); 5’ – UCGCUUUAAUACUGUGUAATT-3’ (SEQ ID NO:68); 5’ – U(s)C(s)GCUUUAAUACUGUGUAA T(s)T-3’ (SEQ ID NO:69); 5’ – UCGCUUUAAUACUGlUlGlUlAlA TT -3’ (SEQ ID NO:70); 5’ – mU(s)mCmGCUUUAAUACUGUGUAATT -3’ (SEQ ID NO:71); or 5’ -U CGC UUU AAU ACU G UG UAA TT (SEQ ID NO:72); wherein d(nucleotide) = deoxy-(nucleotide), m(nucleotide) = 2 ^-O-methyl nucleotide, T = thymidine, f(nucleotide) = 2 ^-fluorodeoxy nucleotide, (Phos) = phosphodiester cap; capital letter nucleotide = RNA nucleotide, l(nucleotide) = a locked nucleotide, and (s) = phosphorothioate.

28. The ophthalmic composition of claim 24 wherein the siRNA has at least one modification selected from a 3’ overhang, a 5’ overhang, a 5’ phosphorylation, a 2’ sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing.

29. The ophthalmic composition of claim 24 wherein the siRNA has at least one additional modification selected from a 3’ overhang, a 5’ overhang, a 5’ phosphorylation, a 2’ sugar modification, a nucleic acid base modification, a phosphate backbone modification, and any combination of any of the foregoing.

30. The ophthalmic composition of claim 21 wherein the fidgetin-like 2 is human fidgetin-like 2.

31. The ophthalmic composition of claim 24 or 25 wherein the siRNA or shRNA is encapsulated in a nanoparticle.

32. The ophthalmic composition of claim 24 or 25 wherein the siRNA or shRNA is provided in nanoparticles, electroporation / nucleofection, Accel siRNA, a viral vector, peptide, protein or aptamer.

33. The ophthalmic composition of claim 24 or 25 wherein the siRNA or shRNA is provided in eyedrop.

34. The ophthalmic composition of claim 24 or 25 wherein the siRNA or shRNA is provided in an ocular wafer.

35. The ophthalmic composition of claim 24 or 25 wherein the siRNA or shRNA is provided in a drug-eluting contact lens.

36. The ophthalmic composition of claim 25 wherein the shRNA comprises SEQ ID NO:23.