Improved casein secretion by non-mammalian host cells

Abstract

The present invention relates to improvements in the production of caseins in non- mammalian host cells, such as yeasts or filamentous fungi. In particular, the invention provides for non-mammalian host cells wherein at least one casein is co-expressed with at least one kinase that is capable of phosphorylating the casein. The kinase can be a kinase from the FAM20 family of kinases, preferably a Fam20C and / or a Fam20A kinase. Co-expression of the kinase with the casein not only increases the degree of phosphorylation of the casein but surprisingly also drastically improves secretion of the phosphorylated casein for the host cell, thus facilitating its recovery. The invention further provides for processes for producing a casein using the non- mammalian host cells of the invention, as well as a phosphorylated caseins having a non-native glycosylation pattern, and compositions comprising such phosphorylated caseins, e.g. food products such as animal-free dairy substitute products.

Description

[0001] Improved casein secretion by non-mammalian host cells

[0002] Field of the invention

[0003] The present invention relates to the field of molecular microbiology, food technology and fermentation technology. In particular, the invention relates to a non-mammalian host cell expressing a mammalian casein, wherein the expression of the casein is improved by coexpression of a kinase.

[0004] Background of the invention

[0005] In 2050 the global population will be around 10 billion people. It is generally recognized that the production of food and its ingredients needs to change significantly to keep within the agreed sustainability development goals (SDGs) for the environment and climate.

[0006] Milk, and especially cow milk, is an important source of protein and is produced all around the world (total production in 2018: 843 million tons). However, dairy production has an enormous impact on the environment. Currently over two-thirds of the world's agricultural land is used for maintaining livestock, including beef and dairy cows. Dairy cows and their manure generate significant amounts of greenhouse gas (including methane, which is a much more harmful greenhouse gas than CO2) emissions which contribute to climate change. Water demand is very high as dairy operations consume large volumes of water to grow feed, water cows, manage manure and process products. Additionally, nitrogen emissions (from e.g., manure and fertilizer) cause worldwide major issues. Consequently, the carbon footprint and land-use factor of milk and cheese are high, even higher than that of pigs, fish and chicken. Next to these environmental and climatological aspects, also animal welfare is quite often compromised. Concerns about sustainability and animal-welfare of milk production are two important motivations for an increasing percentage of consumers to replace animal-based proteins by (vegan) plant-based protein sources such as soy, almond, pea and coconut.

[0007] Bovine milk contains around 35 g / L of caseins (i.e., 80% of the milk protein fraction) divided over alphaSI-, alphaS2-, beta- and kappa-casein within an approximate ratio of 40, 10, 40 and 10 % respectively. The four caseins are well studied in terms of amino acid composition, molecular weight, post-translational modifications (PTMs) and general physico-chemical properties. Due to the high content of prolyl residues, each casein molecule has an open and flexible conformation. Furthermore, hydrophobic and hydrophilic regions show a block distribution within the protein chain, giving each casein an amphiphilic character. Because of their nature and physico-chemical properties, caseins are unique proteins that, for many applications, cannot easily be replaced by plant-based alternatives.

[0008] The ability of fungi (e.g., yeast and filamentous fungi) to grow on rather inexpensive substrates, as well as their capacity to produce a wide range of commercially interesting compounds ranging from simple organic acids to complex secondary metabolites, has attracted considerable interest to exploit them as production organisms in biotechnology. Furthermore, due to their exceptional high capacity to express and secrete certain hydrolytic proteins, filamentous fungi have nowadays become indispensable to produce enzymes (native or recombinant) with applications in paper and textile industry, feed production and food processing. The most commonly used fungal expression hosts for protein production are Aspergillus species and Trichoderma reesei. Via a combination of strain engineering and fermentation technology development, product titers exceeding 100 g / L are no longer an exception (Cherry & Fidantsef, 2003, Current opinion in biotechnology, 14(4), pp.438-443).

[0009] Expression of recombinant mammalian caseins has previously been described in nonmammalian organisms such as the yeasts P. pastoris and S. cerevisiae (Chung, Kun-Sub, et al. Journal of Microbiology and Biotechnology 1.1 (1991): 31-36; Choi, Byung-Kwon, and Rafael Jimenez-Flores. Journal of agricultural and food chemistry 44.1 (1996): 358-364) but the levels of secreted product are very low. It is thus an object of the present invention to provide for nonmammalian host cells, e.g., fungal host cells, expressing a mammalian casein, wherein the expression of the casein is quantitatively and / or qualitatively improved, to obviate the farm animals to produce these proteins. It is in particular an object of the present invention to provide for such improved expression of caseins wherein the amount of secreted casein is improved and / or wherein the post-translational modifications of the secreted casein are more in line with the corresponding natural milk casein.

[0010] Summary of the invention

[0011] In a first aspect, the invention relates to a non-mammalian host cell comprising i) an expression construct comprising a nucleotide sequence encoding at least one casein and ii) an expression construct comprising a nucleotide sequence encoding at least one kinase. Preferably, the at least one kinase is a kinase that is capable of phosphorylating the at least one casein.

[0012] In one embodiment, there is provided a host cell wherein co-expression of the at least one casein and the at least one kinase in the host cell, causes the casein to be phosphorylated, wherein co-expression of the at least one casein and the at least one kinase in the host cell increases the degree of phosphorylation of the at least one casein by at least 10%, as compared to the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase, wherein preferably, the degree of phosphorylation of the at least one casein, is at least 1 % of the degree of phosphorylation of the same casein produced and post-translationally modified in a mammalian cell, more preferably as determined by mass spectrometry.

[0013] In one embodiment, there is provided a host cell as described herein, wherein the nucleotide sequence encoding the at least one casein encodes a signal sequence operably linked to the at least one casein and the nucleotide sequence encoding the at least one kinase encodes a signal sequence operably linked to the at least one kinase, wherein co-expression of the at least one kinase and the at least one casein in the host cell increases the extracellular level of the at least one casein, as compared to the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase, and wherein preferably, the host cell is a non-mammalian eukaryotic host cell, wherein preferably, the extracellular level of the at least one casein is increased by at least a factor 1.1 , as compared to the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase.

[0014] In one embodiment, there is provided a host cell, wherein the nucleotide sequence encoding the at least one kinase encodes a kinase from the FAM20 family of kinases, preferably at least one of a Fam20C kinase and a Fam20A kinase, or, wherein the nucleotide sequence encoding the at least one kinase encodes at least one of: i) a protein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO.’s: 1 and 3, and having casein kinase activity: and, ii) a protein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO.’s: 2 and 4, and having at least one of casein kinase activity and casein kinase stimulating activity.

[0015] In one embodiment, there is provided a host cell, wherein the nucleotide sequence encodes at least one casein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to the amino acid sequence of a casein from a mammal selected from the group consisting of: Bos taurus (domestic cattle), Bos grunniens (yak), Bubalus bubalis (water buffalo), Capra hircus (goat), Ovis aries (sheep), Camelus spp. (camel, dromedaris), Rangifer tarandus (reindeer), Equus caballus (horse), Sus spp. including Sus domesticus (pig) and Homo sapiens. Preferably, the nucleotide sequence encodes at least one casein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to the amino acid sequence of at least one of SEQ ID NO’s: 5 - 43, of which the bovine SEQ ID NO’s: 5, 15, 25 and 34 are most preferred.

[0016] In one embodiment, there is provided a host cell, wherein the host cell is non-mammalian eukaryotic host cell, preferably a eukaryotic microbial host cell, more preferably a yeast or a filamentous fungus host cell. Preferably, the host cell is a cell selected from a genus from the group consisting of Saccharomyces, Kiuyveromyces, Candida, Komagataella, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, Yarrowia, Kazachstania Debaryomyces, Naumovia, Alternaria, Apophysomyces, Aspergillus, Cladosphialophora, Fonsecaea, Fusarium, Lichtheimia, Mucor, Myceliophthora, Neurospora, Penicillium, Rhizopus, Rhizomucor, Trichoderma and Trichophyton, wherein preferably, the cell selected from a species from the group consisting of K. phaffii, K. pastoris, K. pseudopastoris, S. cerevisiae, S. exiguus, S. bayanus, Kiuyveromyces lactis, Kiuyveromyces marxianus Y. lipolytica, S. pombe, Alternaria alternata, Apophysomyces variabilis, Aspergillus spp., Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus flavus, Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus sojae, Aspergillus terreus, Cladosphialophora spp., Fonsecaea pedrosoi, Fusarium spp., Fusarium oxysporum, Fusarium solani, Lichtheimia spp., Lichtheimia corymbifera, Lichtheimia ramosa, Myceliophthora spp., Myceliophthora thermophila, Neurospora crassa, Penicillium chrysogenum, Penicillium simplicissimum, Penicillium brasilianum, Rhizopus spp., Rhizopus microsporus, Rhizomucor spp., Rhizomucor pusillus, Rhizomucor miehei, Trichoderma spp., Trichoderma reesei Trichophyton spp., Trichophyton interdigitale, and Trichophyton rubru, of which Komagataella phaffii is most preferred. In one embodiment, there is provided a host cell, wherein the cell comprises at least one genetic modification selected from the group consisting of: a) the genetic modification reduces or eliminates the expression or activity of at least one of: i) a transcriptional activator regulating the expression of an array of protease genes, preferably, a transcriptional activator encoded by a prfT gene, or an orthologue thereof; ii) a vacuolar acid aspartyl protease, preferably a vacuolar acid aspartyl protease encoded by a PEP4 gene, or an orthologue thereof; iii) a cell-wall associated aspartic acid protease, preferably a cell-wall associated aspartic acid protease of the yapsin family, more preferably, encoded by a YPS1 gene and / or by a YPS’ gene or orthologues thereof; iv) a vacuolar serine-type protease, preferably a vacuolar serine-type protease encoded by a PRB1 gene, or an orthologue thereof; v) a secreted subtilisin-type protease, preferably a secreted subtilisin-type protease encoded by a SUB2 gene, or an orthologue thereof; and vi) a subtilisin-like Ser-type proteases, preferably a subtilisin-like Ser-type proteases encoded by a SBT100 gene or an orthologue thereof; b) the genetic modification reduces or eliminates the expression or activity of an extracellular phosphatase, preferably an extracellular phosphatase encoded by a PHO1 gene; and, c) the genetic modification reduces or eliminates the enzymatic activity of a protein-O- mannosyl transferase, preferably a protein-O-mannosyl transferase encoded by a PMT gene, more preferably at least one of a PMT1 - PMT7 gene, most preferably at least one of a PMT1, PMT2 and PMT4 gene, of which PMT1 is preferred

[0017] In one embodiment, reduction of O-linked glycosylation is achieved by co-expression of a alpha mannosidase such as an alpha-1 ,2-mannosidase.

[0018] In one embodiment, the host cell is a cell, wherein at least one of the genetic modification reduces or eliminates the expression or activity of at least one of: i) a vacuolar acid aspartyl protease, preferably a vacuolar acid aspartyl protease encoded by a PEP4 gene, or an orthologue thereof; and ii) at least one cell-wall associated aspartic acid protease, preferably a cell-wall associated aspartic acid protease of the yapsin family, more preferably, encoded by a YPS1 gene or YPS’ gene or orthologues thereof.

[0019] In one embodiment, the host cell comprises a genetic modification that reduces or eliminates the expression or activity of i) a vacuolar acid aspartyl protease encoded by a PEP4 gene, or an orthologue thereof; ii) a cell-wall associated aspartic acid protease encoded by a YPS1 gene and iii) a cell-wall associated aspartic acid protease encoded by a YPS’ gene.

[0020] In one embodiment, there is provided a host cell, wherein the cell comprises at least one genetic modification selected from the group consisting of: a) a genetic modification that reduces or eliminates the expression or activity of i) a vacuolar acid aspartyl protease encoded by a PEP4 gene, or an orthologue thereof; ii) a cell-wall associated aspartic acid protease encoded by a YPS1 gene, and iii) a cell-wall associated aspartic acid protease encoded by a YPS’ gene; b) a genetic modification that reduces the phosphatase activity of the cell, preferably the genetic modification reduces the extracellular phosphatase activity of the cell; and, c) a genetic modification that reduces O-linked glycosylation of proteins produced by the cell.

[0021] In a second aspect, the invention pertains to a process for producing a casein, the method comprising culturing a host cell as described in the first aspect, such that one or more of the nucleotide sequences are expressed and the casein is produced, the process optionally comprising the step of recovery of the casein.

[0022] In a third aspect, the invention relates to a casein having a non-native glycosylation pattern, wherein the casein is phosphorylated, wherein preferably the casein has a higher degree of phosphorylation as compared to a corresponding casein produced in a non-mammalian host cell that lacks expression of a heterologous kinase capable of phosphorylating the casein, wherein preferably, the degree of phosphorylation is determined by mass spectrometry. Preferably, the casein is a casein wherein the degree of phosphorylation of the casein is at least 1 % of the degree of phosphorylation of the same casein produced and post-translationally modified in a mammalian cell, preferably a mammary gland cell, more preferably as obtained from natural milk, wherein preferably, the degree of phosphorylation is determined by mass spectrometry. In one embodiment, the casein in this aspect is a casein that is obtained or obtainable in a process of the second aspect.

[0023] In a fourth aspect, the invention pertains to a composition comprising a casein according to the third aspect, wherein preferably the composition is a food product, wherein more preferably the composition is a dairy substitute product, wherein most preferably the composition is animal-free dairy substitute product.

[0024] Description of the invention

[0025] Definitions

[0026] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the method.

[0027] For purposes of the present invention, the following terms are defined below.

[0028] In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

[0029] As used herein, the term "and / or" indicates that one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases. As used herein, with "At least" a particular value means that particular value or more. For example, "at least 2" is understood to be the same as "2 or more" i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, ... ,etc.

[0030] The word “about” or “approximately” when used in association with a numerical value (e.g., about 10) preferably means that the value may be the given value (of 10) more or less 10% of the value.

[0031] The terms “homology”, “sequence identity” and the like are used interchangeably herein. Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods.

[0032] “Sequence identity” and “sequence similarity” can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithm (e.g., Needleman Wunsch) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith Waterman). Sequences may then be referred to as "substantially identical” or “essentially similar” when they (when optimally aligned by for example the programs GAP or BESTFIT using default parameters) share at least a certain minimal percentage of sequence identity (as defined below). GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps. A global alignment is suitably used to determine sequence identity when the two sequences have similar lengths. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (polynucleotides) I 8 (proteins) and gap extension penalty = 3 (nucleotides) 1 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or using open source software, such as the program “needle” (using the global Needleman Wunsch algorithm) or “water” (using the local Smith Waterman algorithm) in EmbossWIN version 2.10.0, using the same parameters as for GAP above, or using the default settings (both for ‘needle’ and for ‘water’ and both for protein and for DNA alignments, the default Gap opening penalty is 10.0 and the default gap extension penalty is 0.5; default scoring matrices are Blosum62 for proteins and DNAFull for DNA). When sequences have a substantially different overall lengths, local alignments, such as those using the Smith Waterman algorithm, are preferred. Alternatively, percentage similarity or identity may be determined by searching against public databases, using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the present invention can further be used as a “query sequence” to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTP programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403 — 10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the BLASTx program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information at http: / / www.ncbi.nlm.nih.gov / .

[0033] Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. Examples of classes of amino acid residues for conservative substitutions are given in the Tables below.

[0034] Alternative conservative amino acid residue substitution classes.

[0035] Alternative Physical and Functional Classifications of Amino Acid Residues.

[0036] The skilled artisan will know which conditions to apply for stringent and highly stringent hybridization conditions. Additional guidance regarding such conditions is readily available in the art, for example, in Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), Sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual (3rdedition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.).

[0037] Of course, a polynucleotide which hybridizes only to a poly A sequence (such as the 3' terminal poly(A) tract of mRNAs), or to a complementary stretch of T (or U) resides, would not be included in a polynucleotide of the invention used to specifically hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).

[0038] A "nucleic acid construct" or "nucleic acid vector" is herein understood to mean a man-made nucleic acid molecule resulting from the use of recombinant DNA technology. The term "nucleic acid construct" therefore does not include naturally occurring nucleic acid molecules although a nucleic acid construct may comprise (parts of) naturally occurring nucleic acid molecules. The terms "expression vector" or “expression construct" refer to nucleotide sequences that are capable of effecting expression of a gene in host cells or host organisms compatible with such sequences. These expression vectors typically include at least suitable transcription regulatory sequences and optionally, 3' transcription termination signals. Additional factors necessary or helpful in effecting expression may also be present, such as expression enhancer elements. The expression vector will be introduced into a suitable host cell and be able to effect expression of the coding sequence in an in vitro cell culture of the host cell. The expression vector will be suitable for replication in the host cell or organism of the invention.

[0039] As used herein, the term "promoter" or "transcription regulatory sequence" refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences, and is located upstream with respect to the direction of transcription of the transcription initiation site of the coding sequence, and is structurally identified by the presence of a binding site for DNA- dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, e.g., by the application of a chemical inducer. An inducible promoter may also be present but not induced.

[0040] As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein encoding regions, contiguous and in reading frame.

[0041] The terms "protein" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3- dimensional structure or origin.

[0042] The term "gene" means a DNA fragment comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g., an mRNA) in a cell, operably linked to suitable regulatory regions (e.g., a promoter). A gene will usually comprise several operably linked fragments, such as a promoter, a 5' leader sequence, a coding region, exons, introns and a 3'-nontranslated sequence (3'-end) e.g., comprising a polyadenylation- and / or transcription termination site.

[0043] "Expression of a gene" refers to the process wherein a DNA region which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e., which is capable of being translated into a biologically active protein or peptide.

[0044] The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain. If homologous to a host cell, a nucleic acid sequence encoding a polypeptide will typically (but not necessarily) be operably linked to another (heterologous) promoter sequence and, if applicable, another (heterologous) secretory signal sequence and / or terminator sequence than in its natural environment. It is understood that the regulatory sequences, signal sequences, terminator sequences, etc. may also be homologous to the host cell. In this context, the use of only "homologous" sequence elements allows the construction of "self-cloned" genetically modified organisms (GMO's) (self-cloning is defined herein as in European Directive 98 / 81 / EC Annex II). When used to indicate the relatedness of two nucleic acid sequences the term "homologous" means that one single-stranded nucleic acid sequence may hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentration as discussed earlier herein. The terms "heterologous" and "exogenous" when used with respect to a nucleic acid (DNA or RNA) or protein refers to a nucleic acid or protein that does not occur naturally as part of the organism, cell, genome or DNA or RNA sequence in which it is present, or that is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature. Heterologous and exogenous nucleic acids or proteins are not endogenous to the cell into which it is introduced but have been obtained from another cell or synthetically or recombinantly produced. Generally, though not necessarily, such nucleic acids encode proteins, i.e., exogenous proteins, that are not normally produced by the cell in which the DNA is transcribed or expressed. Similarly exogenous RNA encodes for proteins not normally expressed in the cell in which the exogenous RNA is present. Heterologous / exogenous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that one of skill in the art would recognize as foreign to the cell in which it is expressed is herein encompassed by the term heterologous or exogenous nucleic acid or protein. The terms heterologous and exogenous also apply to non-natural combinations of nucleic acid or amino acid sequences, i.e., combinations where at least two of the combined sequences are foreign with respect to each other. The terms heterologous and exogenous specifically also apply to non-naturally occurring modified versions of otherwise endogenous nucleic acids or proteins.

[0045] The "specific activity" of an enzyme is herein understood to mean the amount of activity of a particular enzyme per amount of total host cell protein, usually expressed in units of enzyme activity per mg total host cell protein. In the context of the present invention, the specific activity of a particular enzyme may be increased or decreased as compared to the specific activity of that enzyme in an (otherwise identical) wild type host cell.

[0046] Filamentous fungi are herein defined as eukaryotic microorganisms that include all filamentous forms of the subdivision Eumycotina and Oomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK). The filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.

[0047] Yeasts are herein defined as eukaryotic microorganisms and include all species of the subdivision Eumycotina (Yeasts: characteristics and identification, J.A. Barnett, R.W. Payne, D. Yarrow, 2000, 3rd ed., Cambridge University Press, Cambridge UK; and, The yeasts, a taxonomic study, C.P. Kurtzman and J.W. Fell (eds) 1998, 4thed., Elsevier Science Publ. B.V., Amsterdam, The Netherlands) that predominantly grow in unicellular form. Yeasts may either grow by budding of a unicellular thallus or may grow by fission of the organism.

[0048] The yeast genus Pichia has more recently been reassigned to the genus Komagataella (see e.g., Heistinger et al., Microbiology, 2020;166(7):614-616), which genus was split into the species K. phaffii, K. pastoris, and K. pseudopastoris. The Pichia species P. pastoris, that has been widely used in biotech industries and as used herein, has been reassigned to the Komagataella species K. phaffii (Heistinger et al., Microbiology, 2020, supra). Hence, when reference is made herein to the yeast species K. phaffii this is to be understood as equally referring to the yeast species formerly known as Pichia pastoris, and vice versa.

[0049] Detailed description of the invention

[0050] In-house experiments indicated that there are several problems associated with recombinant production of caseins using non-mammalian expression hosts, such as e.g. K. phaffi. One such problem is an insufficient degree of casein phosphorylation. Another problem is the intracellular accumulation of the caseins, resulting in a low degree of product secretion. We have now found that co-expression of kinases with caseins not only results in improved phosphorylation of the casein protein backbone, but surprisingly also enhances casein secretion by the non-mammalian host cell.

[0051] Therefore, in a first aspect, the invention relates to a non-mammalian host cell comprising i) an expression construct comprising a nucleotide sequence encoding at least one casein; and ii) an expression construct comprising a nucleotide sequence encoding at least one kinase.

[0052] The kinase can be any suitable kinase that is capable of phosphorylating at least one casein. The ability of a kinase to phosphorylate at least one casein, can be determined by co-expression of the kinase with a casein, e.g., in a non-mammalian host cell as described herein, detecting an increase in the level of phosphorylation of the casein compared to a casein expressed in a corresponding host cell that does not co-express the kinase. Methods for detecting the level of phosphorylation of caseins are known in the art and include mass spectrometric techniques such as the RPC-UV-MS method described in Example 8 herein, or an LC / ESI-MS-based method as described by Fang et al. (2016, J. Dairy Sci. 99:8168-8177). A protein with the ability to phosphorylate at least one casein, as may be determined as described above, is herein thus understood as a protein having casein kinase activity.

[0053] Thus, in one embodiment, a host as described herein, is a non-mammalian host cell comprising i) an expression construct comprising a nucleotide sequence encoding at least one casein and ii) an expression construct comprising a nucleotide sequence encoding at least one kinase, wherein co-expression of the at least one kinase and the at least one casein in the host cell causes the at least one casein to be phosphorylated. In one embodiment, co-expression of the at least one kinase and the at least one casein in the host cell increases the degree of phosphorylation of the at least one casein, as compared to the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase.

[0054] In one embodiment, the degree of phosphorylation of the at least one casein is at least 1 , 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% of the degree of phosphorylation of the same casein produced and post-translationally modified in a mammalian cell, preferably a mammary gland cell, more preferably as obtained from natural milk. The degree of phosphorylation can be determined in a method for detecting the level of phosphorylation of caseins as described above, e.g., by mass spectrometry. In one embodiment, the degree of phosphorylation of the at least one casein, as compared to the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase, is increased by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 200 or 500%, preferably as determined in a method for detecting the level of phosphorylation of caseins as described above. In one embodiment, the degree of phosphorylation of the at least one casein, as compared to the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase, is increased by at least a factor 1 .1 , 1 .2, 1 .5, 2.0, 5.0, 10, 20, 50, 100, 200, or 1000, preferably as determined in a method for detecting the level of phosphorylation of caseins as described above.

[0055] Co-expression of the at least one casein and the at least one kinase in the host is understood as that the at least one casein and the at least one kinase co-exist and can be into contact with each other for a sufficient amount of time to allow phosphorylation of the at least one casein to occur. Preferably, therefore, the at least one casein and the at least one kinase are co-expressed in the same subcellular compartment, e.g., the secretory pathway, including the Golgi apparatus. In one embodiment, the at least one casein and the at least one kinase can each be expressed without signal sequences (and without other topogenic signals) to be co-expressed in the cytosol of the host cell, e.g., in the case of a prokaryotic host cell.

[0056] In a preferred embodiment however, the at least one casein and the at least one kinase are both directed into the secretory pathway of the host cell, preferably, a non-mammalian eukaryotic host cell. Thus, a host as described herein, is a non-mammalian host cell wherein the nucleotide sequence encoding the at least one casein encodes a signal sequence operably linked to the at least one casein and the nucleotide sequence encoding the at least one kinase encodes a signal sequence operably linked to the at least one kinase, and wherein co-expression of the at least one kinase and the at least one casein in the host cell increases the extracellular level of the at least one casein, as compared to the extracellular level of at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase. Preferably, the host cell is a non-mammalian eukaryotic host cell.

[0057] In one embodiment, the extracellular level of the at least one casein, as compared to the extracellular level of the at least one casein produced in a corresponding host cell lacking coexpression of the at least one kinase degree, is increased by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 200 or 500%. In one embodiment, the extracellular level of the at least one casein, as compared to the extracellular level of the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase degree, is increased by at least a factor 1.1 , 1.2, 1.5, 2.0, 5.0, 10, 20, 50, 100, 200, 1 ,000, 2,000, 5,000, 10,000, 20,000, 50,000 or 100,000. Methods for determining the amount of extracellular or intracellular caseins are well-known in the art. Such methods usually include separating the host cells from the spent culture medium and quantifying the amounts of extracellular and / or intracellular caseins, in respectively the culture medium or cells, by known means, e.g., immunological assays such as ELISAs or Western blots using antibodies that are specific for the one or more caseins (see e.g. the methods used in the Examples herein). Alternatively, the (extracellular) caseins can first be purified and quantified by standard methods for protein quantification.

[0058] In one embodiment, wherein, a host as described herein, is a non-mammalian host cell wherein the nucleotide sequence encoding the at least one casein encodes a signal sequence operably linked to the at least one casein and the nucleotide sequence encoding the at least one kinase encodes a signal sequence operably linked to the at least one kinase, and wherein coexpression of the at least one kinase and the at least one casein in the host cell decrease the intracellular level of the at least one casein, as compared to the intracellular level of at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase. Preferably, the decrease of intracellular casein level coincides with and / or corresponds to the increases in extracellular casein level. Preferably, the host cell is a non-mammalian eukaryotic host cell. Thus, in one embodiment, the intracellular level of the at least one casein, as compared to the intracellular level of the at least one casein produced in a corresponding host cell lacking coexpression of the at least one kinase degree, is decreased by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 100%.

[0059] In one embodiment, the kinase is a protein kinase, preferably the kinase is a serine and / or threonine kinase (EC 2.7.11 .1), more preferably the kinase is at least a serine kinase.

[0060] In one embodiment, the kinase is a mammalian kinase. The kinase can e.g., be a human kinase or a ruminant kinase, e.g., a kinase from a ruminant selected from Bos taurus, Bos grunniens, Bubalus bubalis, Capra hircus, and Ovis aries.

[0061] In a one embodiment, the kinase is mammary gland casein kinase, such as e.g., a Fam20C kinase. Fam20C is a Golgi localized protein kinase, a serine kinase that phosphorylates both casein and other highly acidic proteins at the target motif SerXGlu or SerXphosphoSer. Fam20C, also known as DMP4, is a protein which in humans is encoded by the FAM20C gene.

[0062] In a preferred embodiment therefore, the kinase is a kinase from the FAM20 family of kinases, whereby more preferably, the kinase is at least one of a Fam20C kinase and a Fam20A kinase.

[0063] In one embodiment, the nucleotide sequence encoding the at least one kinase encodes a protein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO.’s: 1 and 3 and having casein kinase activity.

[0064] In one embodiment, the nucleotide sequence encoding the at least one kinase encodes a protein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO.’s: 2 and 4 and having at least one of casein kinase activity and casein kinase stimulating activity.

[0065] In one embodiment, a host as described herein, thus comprises an expression construct comprising a nucleotide sequence encoding at least one casein. The term "casein" is art-known and represents a family of proteins that is present in mammal-produced milk and is capable of selfassembling with other proteins in the family to form micelles and / or precipitate out of an aqueous solution at an acidic pH. Non-limiting examples of caseins include beta-casein, kappa-casein, alpha-S1 -casein, and alpha-S2-casein. As used herein, the term "alpha-S1 -casein" refers to not only the alpha-S1 -casein protein, but also fragments or variants thereof. Alpha-S1 -casein is found in the milk of numerous different mammalian species, including cow, yak, camel, dromedary, horse, water buffalo, goat, and sheep.

[0066] As used herein, the term "alpha-S2-casein" refers to not only the alpha-S2-casein protein, but also fragments or variants thereof. Alpha-S2-casein is known as epsilon-casein in mouse, gamma-casein in rat, and casein-A in guinea pig.

[0067] As used herein, the term "beta-casein" refers to not only the beta-casein protein, but also fragments or variants thereof. For example, A1 and A2 beta-casein are genetic variants of the betacasein milk protein that differ by one amino acid (at amino acid 67, A2 beta-casein has a proline, whereas A1 has a histidine). Other genetic variants of beta-casein include the A3, B, C, D, E, F, H1 , H2, I and G genetic variants.

[0068] As used herein, the term "kappa-casein" refers to not only the kappa-casein protein, but also fragments or variants thereof. Kappa-casein is cleaved by rennet, which releases the casein macropeptide from the C-terminal region. The remaining product with the N-terminus and two-thirds of the original peptide chain is referred to as para-kappa-casein.

[0069] Non-limiting examples of sequences for casein proteins from different mammals are provided in the sequence listing herewith (see Table 5). Additional sequences for other caseins are known in the art. In addition, the caseins for use in the invention can be defined by their amino acid sequences, e.g., by comprising an amino acid sequence with a minimal percentage sequence identity to a reference casein amino acid sequence as defined herein below.

[0070] In one embodiment, the at least one casein comprises or consists of an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100% identity to the amino acid sequence of casein from a mammal selected from the group consisting of Bos taurus (domestic cattle), Bos grunniens (yak), Bubalus bubalis (water buffalo), Capra hircus (goat), Ovis aries (sheep), Camelus spp. (camel, dromedary), Rangifer tarandus (reindeer), Equus caballus (horse), Sus spp. including Sus domesticus (pig) and Homo sapiens.

[0071] In one embodiment, a host cell as described herein comprises at least one expression construct comprising a nucleotide sequence encoding a beta-casein comprising or consisting of an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NOs 5 - 14.

[0072] In one embodiment, a host cell as described herein comprises at least one expression construct comprising a nucleotide sequence encoding an alphaSI -casein comprising or consisting of an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NOs: 15 - 24.

[0073] In one embodiment, a host cell as described herein comprises at least one expression construct comprising a nucleotide sequence encoding an alphaS2-casein comprising or consisting of an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NOs: 25 - 33.

[0074] In one embodiment, a host cell as described herein comprises at least one expression construct comprising a nucleotide sequence encoding a kappa-casein comprising or consisting of an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NOs: 34 - 43.

[0075] In a preferred embodiment, a host cell as described herein comprises at least one expression construct comprising a nucleotide sequence encoding a bovine casein comprising or consisting of an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO’s: 5, 15, 25 and 34.

[0076] In one embodiment, a host cell as described herein comprises more than one expression construct for expression of more than one type of casein in the host cell. Thus, in one embodiment, the host cell comprises expression constructs for expression in the host cell of a beta-casein and an alphaSI -casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of a beta-casein and an alphaS2-casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of a beta-casein and a kappacasein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of an alphaSI -casein and an alphaS2-casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of an alphaSI -casein and a kappa-casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of an alphaS2-casein and a kappa-casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of a beta-casein, an alphaSI -casein and an alphaS2- casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of a beta-casein, an alphaSI -casein and a kappa-casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of a beta-casein, an alphaS2-casein and a kappa-casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of an alphaSI-casein, an alphaS2-casein and a kappa-casein. In one embodiment, the host cell comprises expression constructs for expression in the host cell of a betacasein, an alphaSI -casein, an alphaS2-casein and a kappa-casein.

[0077] The non-mammalian host cell can be any suitable non-mammalian host cell, including both prokaryotic and eukaryotic host cells. A suitable prokaryotic host cell is usually a bacterial host cell and can be either a Gram-negative or a Gram-positive a bacterial host cell. Examples of suitable bacterial host cells include host cells from the genera Escherichia, Bacillus, Lactobacillus, Lactococcus and Streptococcus, or preferably bacterial host cells of the species Escherichia coll, Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus coagulans, Lactobacillus acidophilus, Lactobacillus fermentum, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus gasseri, Lactococcus lactis, Streptococcus salivarius and Streptococcus thermophilus. Preferably the bacterial host cell is a food-grade bacterium.

[0078] In a preferred embodiment, however, the non-mammalian host cell is a non-mammalian eukaryotic host cell, such as an insect cell, a plant cell, an algal cell or a eukaryotic microbial cell. In a more preferred embodiment, however, the non-mammalian host cell is a eukaryotic microbial cell, such as a yeast cell or a filamentous fungal host cell. Examples of suitable yeast host cells includes yeast from genera Saccharomyces, Kluyveromyces, Candida, Komagataella, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, Yarrowia, Kazachstania Debaryomyces and Naumovia, or preferably yeast host cells of the species K. phaffii, K. pastoris, K. pseudopastoris S. cerevisiae, S. exiguus, S. bayanus, K. lactis, K. marxianus Y. lipolytica and S. pombe, of which K. phaffii is most preferred. Examples of suitable filamentous fungal host cells includes fungi from genera Alternaria, Apophysomyces, Aspergillus, Cladosphialophora, Fonsecaea, Fusarium, Lichtheimia, Mucor, Myceliophthora, Neurospora, Penicillium, Rhizopus, Rhizomucor, Trichoderma and Trichophyton, or preferably filamentous fungi cells of the species Alternaria alternata, Apophysomyces variabilis, Aspergillus spp., Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus flavus, Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus sojae, Aspergillus terreus, Cladosphialophora spp., Fonsecaea pedrosoi, Fusarium spp., Fusarium oxysporum, Fusarium solani, Lichtheimia spp., Lichtheimia corymbifera, Lichtheimia ramosa, Myceliophthora spp., Myceliophthora thermophila, Neurospora crassa, Penicillium chrysogenum, Penicillium simplicissimum, Penicillium brasilianum, Rhizopus spp., Rhizopus microsporus, Rhizomucor spp., Rhizomucor pusillus, Rhizomucor miehei, Trichoderma spp., Trichoderma reesei Trichophyton spp., Trichophyton interdigitale, and Trichophyton rubru, and most preferably a species selected from Aspergillus oryzae and Aspergillus niger.

[0079] In one embodiment, the nucleotide sequence encoding the at least one casein encodes a signal sequence operably linked to the nucleotide sequence encoding the at least one casein, wherein the signal sequence effects extracellular expression of the at least one casein. Extracellular expression of the at least one casein can be detected as described above, preferably in a host cell that co-expresses at least one kinase as described above.

[0080] In one embodiment, the signal sequence that is operably linked to the at least one casein is a mammalian signal sequence. In one embodiment, the signal sequence that is operably linked to the at least one casein is a signal sequence from a mammary gland protein. In one embodiment, the signal sequence that is operably linked to the at least one casein is a signal sequence from a casein. In one embodiment, the signal sequence that is operably linked to the at least one casein is a signal sequence that is native to the at least one casein to which it is operably linked.

[0081] In one embodiment, the signal sequence that is operably linked to the at least one casein is a signal sequence that is heterologous to the at least one casein. In one embodiment, the signal sequence that is operably linked to the at least one casein is a signal sequence derived from a secreted protein that is endogenous to a cell of the same Kingdom, Division, Class, Order or Family as the non-mammalian host cell. In one embodiment, the signal sequence that is operably linked to the at least one casein is a signal sequence derived from a protein that is endogenous to a cell of the same genus or species as the non-mammalian host cell. For example, if non-mammalian host cell is a K. phaffii cell, the signal sequence can be derived from a K. phaffii protein such as the signal sequence of the K. phaffii Ost1 and Cwp1 proteins.

[0082] In one embodiment, the signal sequence that is operably linked to the at least one casein is operably linked to the casein through a pro-sequence. The pro-sequence preferably is a prosequence that natively associated with the signal sequence. The pro-sequence preferably comprises a furin-like proprotein convertase cleavage site, i.e., a paired basic amino acid processing site (also known as Kex2 cleavage site), for release of the pro-sequence from the at least one casein.

[0083] In one embodiment, the nucleotide sequence encoding the at least one kinase encodes a signal sequence operably linked to the at least one kinase, wherein the signal sequence effects entry of the at least one kinase into the secretory pathway, including the Golgi apparatus. Expression of the at least one kinase in the secretory pathway and / or Golgi apparatus can be detected by an increase in phosphorylation and / or extracellular expression of a co-expressed casein as described above.

[0084] In one embodiment, the signal sequence that is operably linked to the at least one kinase is a mammalian signal sequence. In one embodiment, the signal sequence that is operably linked to the at least one kinase is a signal sequence from a mammary gland protein. In one embodiment, the signal sequence that is operably linked to the at least one kinase is a signal sequence from a kinase. In one embodiment, the signal sequence that is operably linked to the at least one kinase is a signal sequence that is native to the at least one kinase to which it is operably linked.

[0085] In one embodiment, the signal sequence that is operably linked to the at least one kinase is a signal sequence that is heterologous to the at least one kinase. In one embodiment, the signal sequence that is operably linked to the at least one kinase is a signal sequence derived from a secreted protein that is endogenous to a cell of the same Kingdom, Division, Class, Order or Family as the non-mammalian host cell. In one embodiment, the signal sequence that is operably linked to the at least one kinase is a signal sequence derived from a protein that is endogenous to a cell of the same genus or species as the non-mammalian host cell. For example, if non-mammalian host cell is a K. phaffii cell, the signal sequence can be derived from a K. phaffii protein such as the signal sequence of the K. phaffii Ost1 and Cwp1 proteins.

[0086] In one embodiment, the signal sequence sequence that is operably linked to the at least one kinase is operably linked to the kinase through a pro-sequence. The pro-sequence preferably is a pro-sequence that natively associated with the signal sequence. The pro-sequence preferably comprises a furin-like proprotein convertase cleavage site, i.e., a paired basic amino acid processing site, for release of the pro-sequence from the at least one kinase.

[0087] Suitable signal sequences and combinations of signal- and pro-sequences (also known as pre-pro-sequences) for operable linkage to the caseins and kinases described herein are provide in Table 1 and in the Examples herein.

[0088] As will be understood, operable linkage of signal- and prepro-sequences to a casein or kinase as described herein preferably means that the signal- and prepro-sequence is linked to the N- terminus of the mature casein or kinase.

[0089] In one embodiment, a host cell as described herein comprises a genetic modification that reduces proteolytic activity of the cell, preferably the genetic modification reduces extracellular and / or vacuolar proteolytic activity of the cell. In one embodiment, the genetic modification reduces overall proteolytic activity of the cell, preferably the genetic modification reduces overall extracellular and / or vacuolar proteolytic activity of the cell. In one embodiment, the genetic modification reduces at least 30, 40, 50, 60, 70, 80, 90, 95, 100% of the overall proteolytic activity, preferably of its overall extracellular and / or vacuolar proteolytic activity. The reduction of proteolytic activity of the cell preferably is a reduction of proteolytic activity towards the at least one casein expressed in the host cell. The overall proteolytic activity against caseins within the cultivation broth of micro-organisms can be determined with substrates such as azocasein. The latter is prepared by dyeing casein with sulphanilic acid. The analytical procedure is based on the cleavage of azocasein by proteases, hereby generating the free azo-dye. Precipitation and centrifugation of the proteins and larger peptide fragments allow the free azo-dye to be measured under alkaline conditions, providing an indication of the proteolytic activity. The absorbance of this product is measured at OD 440 nm and this value is directly proportional to the level of the casein-specific protease activity. One unit of protease activity is described as the amount of enzyme that catalyzes the hydrolysis of 1 mg of azocasein per hour at 37 °C within the applied assay condition. In one embodiment, the host cell as described herein comprises a genetic modification that reduces at least 30, 40, 50, 60, 70, 80, 90, 95, 100% of the overall endoproteolytic activity of the cell, preferably of the overall extracellular and / or vacuolar endoproteolytic activity. Endoproteolytic activity can be measured by use of for example the azocasein assay which has been described in the art.

[0090] In one embodiment, the genetic modification comprised in the host cell that reduces proteolytic activity as described above, is a genetic modification that reduces or eliminates the expression or activity of an (endogenous) transcriptional activator gene regulating the expression of an array of protease genes. In one embodiment, the transcriptional activator regulating the expression of an array of protease genes, the activity or expression of which is to be reduced or eliminated in the host cell is encoded by a prfT gene, or an orthologue thereof. prfT is a transcriptional activator of proteases in eukaryotic cells. Several fungal transcriptional activators of proteases have been recently described in WO 00 / 20596, WO 01 / 68864, WO 2006 / 040312 and WO 2007 / 062936. These transcriptional activators were isolated from A niger, A fumigatus, P. chrysogenum and A oryzae. These transcriptional activators of protease genes can be used to improve a method for producing a polypeptide by a fungal cell, wherein the polypeptide is sensitive for protease degradation. When the prfT gene is partially or completely inactivated, the host cell will produce less or no proteases that are under transcriptional control of prfT. In one embodiment, the prtT gene encodes a transcriptional activator or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO’s: 44 or 45.

[0091] In one embodiment, the genetic modification comprised in the host cell that reduces proteolytic activity as described above, is a genetic modification that reduces or eliminates the expression or activity of a vacuolar acid aspartyl protease. In one embodiment, the vacuolar acid aspartyl protease, the activity or expression of which is to be reduced or eliminated in the host cell is a vacuolar acid aspartyl protease encoded by a PEP4 gene, or an orthologue thereof. In one embodiment, the PEP4 gene encodes a vacuolar acid aspartyl protease or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 46. In one embodiment, the genetic modification comprised in the host cell that reduces proteolytic activity as described above, is a genetic modification that reduces or eliminates the expression or activity of at least one aspartic-type endopeptidase, preferably at least one aspartic- -type endopeptidase of the yapsin family. In one embodiment, the at least one aspartic--type endopeptidase, the activity or expression of which is to be reduced or eliminated in the host cell is an aspartic-type endopeptidase encoded by a YPS gene, e.g., a YPS1, YPS2, YPS3, YPS7, MKC7, YPS’, YPS” gene or an orthologue thereof (see Wu et al., 2013, Journal of Industrial Microbiology and Biotechnology 40(6): 589-599), of which YPS1 and / or YPS’ are preferred. In one embodiment, the YPS1 gene encodes an aspartic--type endopeptidase or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 47.

[0092] In one embodiment, the YPS’ gene encodes an aspartic-type endopeptidase or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 89.

[0093] In one embodiment, the genetic modification comprised in the host cell that reduces proteolytic activity as described above, is a genetic modification that reduces or eliminates the expression or activity of at least one vacuolar serine-type protease. In one embodiment, the vacuolar serine-type protease, the activity or expression of which is to be reduced or eliminated in the host cell is a vacuolar serine-type protease encoded by a PRB1 gene, or an orthologue thereof (see e.g. Gleeson et al., 1998, Methods Mol Biol.; 103:81-94). In one embodiment, the PRB1 gene encodes a vacuolar serine-type protease or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 87.

[0094] In one embodiment, the genetic modification comprised in the host cell that reduces proteolytic activity as described above, is a genetic modification that reduces or eliminates the expression or activity of at least one secreted subtilisin-type protease. In one embodiment, the secreted subtilisin-type protease, the activity or expression of which is to be reduced or eliminated in the host cell is a secreted subtilisin-type protease encoded by a SUB2 gene, or an orthologue thereof (see e.g. Salamin et al., 2010, Appl Environ Microbiol.; 76(13): 4269-4276). In one embodiment, the SUB2 gene encodes a secreted subtilisin-type protease or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 88.

[0095] In one embodiment, the genetic modification comprised in the host cell that reduces proteolytic activity as described above, is a genetic modification that reduces or eliminates the expression or activity of at least one subtilisin-like Ser-type proteases. In one embodiment, the serine-type protease, the activity or expression of which is to be reduced or eliminated in the host cell is a subtilisin-like Ser-type proteases encoded by a SBT100 gene, or an orthologue thereof (see e.g. Mudassar, et al., Yeast 36.9 (2019): 557-570 - labelled kpx10 in this document). In one embodiment, the SBT100 gene encodes a subtilisin-like Ser-type proteases or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 90.

[0096] In one embodiment, a host cell as described herein comprises a genetic modification that reduces phosphatase activity of the cell, preferably, genetic modification reduces extracellular phosphatase activity of the cell or secreted by the cell. In one embodiment, the genetic modification comprised in the host cell that reduces phosphatase activity, is a genetic modification that reduces or eliminates the expression or activity of an extracellular phosphatase. In one embodiment, the extracellular phosphatase, the activity or expression of which is to be reduced or eliminated in the host cell is an extracellular phosphatase encoded by a PHO1 gene, or an orthologue thereof. In one embodiment, the PHO1 gene encodes an extracellular phosphatase or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 48.

[0097] In one embodiment, a host cell as described herein comprises a genetic modification that reduces the level of O-linked glycosylation of proteins produced by the cell. In one embodiment, the genetic modification comprised in the host cell that reduces O-linked protein glycosylation, is a genetic modification that reduces or eliminates the expression or activity of at least one proteinO- mannosyl transferase in the cell. The protein-O-mannosyl transferase is preferably a dolichyl- phosphate-mannose-protein mannosyltransferase (EC 2.4.1.109). In one embodiment, the at least one protein-O-mannosyl transferase, the activity or expression of which is to be reduced or eliminated in the host cell is an protein-O-mannosyl transferase encoded by a PMT gene, e.g., a PMT1 - PMT7 gene or an orthologue thereof (see Govindappa et al., 2013, Protein Expression and Purification 88(1): 164-171 ; Nett et al., 2013, PLoS One 8(7): e68325), of which PMT1, PMT2 and PMT4 are preferred, of which PMT1 is most preferred. In one embodiment, the PMT1 gene encodes a protein-O-mannosyl transferase or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 49. In one embodiment, the PMT2 gene encodes a protein-O-mannosyl transferase or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 50. In one embodiment, the PMT4 gene encodes a protein-O-mannosyl transferase or an orthologue thereof comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 91.

[0098] In one embodiment, reduction of O-linked glycosylation is achieved by co-expression of an alpha-mannosidase. In one embodiment the alpha-mannosidase is targeted to the secretion pathway and / or secreted by the host cell. In one embodiment the alpha-mannosidase is an alpha- 1 ,2-mannosidase, an alpha-1 ,6-mannosidase, an alpha-1 ,3-mannosidase or a mannosidase that is able to hydrolyse multiple types of alpha-mannose linkages. More preferably, the alpha- mannosidase is an alpha-1 ,2-mannosidase. Accordingly, in one embodiment, the host cell as described herein further comprises an expression construct comprising a nucleotide sequence encoding at least one alpha-1 ,2-mannosidase. In one embodiment, the nucleotide sequence encoding the at least one alpha-1 ,2-mannosidase encodes at least one a protein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to SEQ ID NO: 92. In other embodiments, the alpha-mannosidase may be separately produced and added to the cell culture.

[0099] Another aspect of the invention pertains to nucleic acid constructs, such as vectors, including cloning and expression vectors, comprising a polynucleotide of the invention, e.g. a nucleotide sequence encoding the at least one casein and of the at least one kinase and methods of growing, transforming or transfecting such vectors in a suitable host cell, for example under conditions in which expression of the polypeptide(s) occurs. As used herein, the terms “vector” and “construct” are used interchangeably and refers to a constructed nucleic acid molecule comprising and preferably capable of transporting a polynucleotide of the invention.

[0100] Polynucleotides of the invention can be incorporated into a recombinant replicable vector, for example a cloning or expression vector. The vector may be used to replicate the nucleic acid in a compatible host cell. Thus, in a further embodiment, the invention provides a method of making polynucleotides of the invention by introducing a polynucleotide of the invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector may be recovered from the host cell. Suitable host cells are described above.

[0101] The vector into which the expression cassette or polynucleotide of the invention is inserted may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of the vector will often depend on the host cell into which it is to be introduced.

[0102] A vector according to the invention may be an autonomously replicating vector, i.e., a vector which exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid. Such vectors can include an element which ensures that they are stably maintained at a single copy in each cell (e.g., a centromere-like sequence such as "CEN"). Alternatively, the autonomously replicating vector may optionally comprise an element which enables the vector to be replicated to higher than one copy per host cell (e.g., an autonomously replicating sequence or "ARS"), Methods in Enzymology, Vol. 350: Guide to yeast genetics and molecular and cell biology, Part B., Guthrie and Fink (eds.), Academic Press (2002).

[0103] In another embodiment, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated. In one embodiment, the integration vector comprises a heterologous nucleic acid fragment to be integrated in the host cell’s genome, flanked on the 5' end with a nucleic acid sequence from the 5' region of the locus from that genome and on the 3' end with a nucleic acid sequence from the 3' region of the locus. The integration vector is capable of integrating into the genome by double-crossover homologous recombination.

[0104] One type of vector is a “plasmid”, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “expression vectors”. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. The terms “plasmid” and “vector” can be used interchangeably herein as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as cosmid, viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses) and phage vectors which serve equivalent functions.

[0105] Vectors according to the invention may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

[0106] A vector of the invention may comprise two or more, for example three, four or five, polynucleotides of the invention, for example for overexpression.

[0107] The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. A regulatory sequence such as a promoter, enhancer or other expression regulation signal "operably linked" to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences or the sequences are arranged so that they function in concert for their intended purpose, for example transcription initiates at a promoter and proceeds through the DNA sequence encoding the polypeptide. The term “regulatory sequence” or “control sequence” is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signal). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). The term regulatory or control sequences includes those sequences which direct constitutive expression of a nucleotide sequence in many types of host cells and those which direct expression of the nucleotide sequence only in a certain host cell (e.g., tissue-specific regulatory sequences).

[0108] A vector or expression construct for a given host cell may thus comprise the following elements operably linked to each other in a consecutive order from the 5'-end to 3'-end relative to the coding strand of the sequence encoding the polypeptide of the first invention: (1) a promoter sequence capable of directing transcription of the nucleotide sequence encoding the polypeptide in the given host cell; (2) translation initiation sequences, such as the eukaryotic Kozak consensus sequence or the prokaryotic Ribosome Binding Site I Shine-Dalgarno sequence, (3) optionally, a signal sequence capable of directing secretion of the polypeptide from the given host cell into a culture medium; (4) a DNA sequence of the invention encoding a mature and preferably active form of a polypeptide of the invention; and preferably also (5) a transcription termination region (terminator) capable of terminating transcription downstream of the nucleotide sequence encoding the polypeptide. Downstream of the nucleotide sequence according to the invention there may be a 3' untranslated region containing one or more transcription termination sites (e. g. a terminator). The origin of the terminator is less critical. The terminator can, for example, be native to the DNA sequence encoding the polypeptide. However, preferably a yeast terminator is used in yeast host cells and a filamentous fungal terminator is used in filamentous fungal host cells. More preferably, the terminator is endogenous to the host cell (in which the nucleotide sequence encoding the polypeptide is to be expressed). In the transcribed region, a ribosome binding site for translation may be present. The coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated.

[0109] Enhanced expression of the polynucleotide of the invention may also be achieved by the selection of heterologous regulatory regions, e. g. promoter, secretion leader and / or terminator regions, which may serve to increase expression and, if desired, secretion levels of the protein of interest from the expression host and / or to provide for the inducible control of the expression of a polypeptide of the invention.

[0110] It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The vectors, such as expression vectors, of the invention can be introduced into host cells to thereby produce proteins or peptides, encoded by nucleic acids as described herein.

[0111] As set out above, the term "control sequences" or “regulatory sequences” is defined herein to include at least any component which may be necessary and / or advantageous for the expression of a polypeptide. Any control sequence may be native or foreign to the nucleic acid sequence of the invention encoding a polypeptide. Such control sequences may include, but are not limited to, a promoter, a leader, optimal translation initiation sequences (as described in Kozak, 1991 , J. Biol. Chem. 266:19867-19870) or the prokaryotic Shine-Dalgarno sequences, a secretion signal sequence, a pro-peptide sequence, a polyadenylation sequence, a transcription terminator. At a minimum, the control sequences typically include a promoter and translational initiation and stop signals.

[0112] A stably transformed microorganism is one that has had one or more DNA fragments introduced such that the introduced molecules are maintained, replicated and segregated in a growing culture. Stable transformation may be due to multiple or single chromosomal integration (s) or by (an) extrachromosomal element(s) such as (a) plasmid vector(s). A plasmid vector is capable of directing the expression of polypeptides encoded by particular DNA fragments.

[0113] Expression may be constitutive or regulated by inducible (or repressible) promoters that enable high levels of transcription of functionally associated DNA fragments encoding specific polypeptides. The promoters selected are those which would be expected to be operable in the particular host system selected. For example, yeast promoters are used when a yeast such as S. cerevisiae, Kluyveromyces lactis, or K. phaffii is the host cell whereas fungal promoters would be used in host cells such as A. niger, Neurospora crassa, or Trichoderma reesei. Examples of yeast promoters include but are not limited to the GAPDH / GAP, AOX1 , SEC4, HE I, PMA1 , OCH1 , GAL1 , PGK, GAP, TPI, CYC1 , ADH2, PHO5, CUP1 , MFa1 , FLD1 , PMA1 , PDI, TEF, RPL10, and GUT1 promoters. Romanos et at, Yeast 8: 423-488 (1992) provide a review of yeast promoters and expression vectors. Hartner et al., Nucl. Acid Res. 36: e76 (pub on-line 6 June 2008) describes a library of promoters for fine-tuned expression of heterologous proteins in K. phaffii.

[0114] In certain embodiments of the invention, the expression of the casein is placed under the control of an inducible promotor, preferably a methanol induced promotor such as for example an AOX1 promotor.

[0115] Regardless of the exact mechanism utilized for expression of polypeptides of the invention, it is contemplated that such expression is transferable by the introduction of genes encoding these polypeptides into another host cell by methods known in the art. Genetic elements as herein defined include nucleic acids (generally DNA or RNA) having expressible coding sequences for products such as proteins, including enzymes, apoproteins or antisense RNA, which express or regulate expression of relevant polypeptides. The expressed proteins can be structural proteins, can function as enzymes, repress or derepress enzyme activity or control expression of enzymes or function as transporter of compounds, e.g., metabolites. Recombinant DNA encoding these expressible sequences can be either chromosomal (integrated into the host cell chromosome by, for example, homologous recombination) or extra-chromosomal (for example, carried by one or more plasmids, cosmids and other vectors capable of self-replication). It is understood that the recombinant DNA utilized for transforming the host cell in accordance with this invention can include, in addition to structural genes and transcription factors, expression control sequences, including promoters, repressors and enhancers, that act to control expression or derepression of coding sequences for proteins, apoproteins or antisense RNA. For example, such control sequences can be inserted into wild-type host cells to promote overexpression of selected polypeptides already encoded in the host cell genome, or alternatively they can be used to control synthesis of extrachromosomally encoded polypeptides.

[0116] Recombinant DNA can be introduced into the host cell by any means, including, but not limited to, plasmids, cosmids, phages, yeast artificial chromosomes or other vectors that mediate transfer of genetic elements into a host cell. These vectors can include an origin of replication, along with cis-acting control elements that control replication of the vector and the genetic elements carried by the vector. Selectable markers can be present on the vector to aid in the identification of host cells into which genetic elements have been introduced.

[0117] Means for introducing genetic elements into a host cell (e.g., cloning) are well known to the skilled artisan. One can utilize an extrachromosomal multi-copy plasmid vector to insert the genetic elements in accordance with the present invention. Plasmid-borne introduction of the genetic element into host cells involves an initial cleaving of a plasmid vector with a restriction enzyme, followed by ligation of the plasmid and genetic elements encoding for the targeted enzyme species in accordance with the invention. Upon recircularization of the ligated recombinant plasmid, infection (e.g., packaging in phage lambda) or other mechanism for plasmid transfer (e.g., electroporation, microinjection, etc.) is utilized to transfer the plasmid into the host cell. Plasmids suitable for insertion of genetic elements into the host cell are well known to the skilled artisan.

[0118] Other gene cloning methods include, but are not limited to, direct integration of the genetic material into the chromosome. This can occur by a variety of means, including cloning the genetic elements described herein on non-replicating plasmids flanked by homologous DNA sequences of the host chromosome; upon transforming said recombinant plasmid into a host the genetic elements can be introduced into the chromosome by DNA recombination. Such recombinant strains can be recovered if the integrating DNA fragments contain a selectable marker, such as antibiotic resistance. Alternatively, the genetic elements can be directly introduced into the chromosome of a host cell without use of a non-replicating plasmid. This can be done by synthetically producing DNA fragments of the genetic elements in accordance to the present invention that also contain homologous DNA sequences of the host chromosome. Again, if these synthetic DNA fragments also contain a selectable marker, the genetic elements can be inserted into the host chromosome.

[0119] In one embodiment, the nucleotide sequence encoding the casein or kinase in the expression construct of the invention preferably is adapted to optimize its codon usage to that of the nonmammalian host cell in question. The adaptiveness of a nucleotide sequence encoding an enzyme to the general codon usage of a host cell may be expressed as codon adaptation index (CAI). The codon adaptation index is herein defined as a measurement of the relative adaptiveness of the codon usage of a gene towards the codon usage of highly expressed genes in a particular host cell or organism. The relative adaptiveness (w) of each codon is the ratio of the usage of each codon, to that of the most abundant codon for the same amino acid. The CAI index is defined as the geometric mean of these relative adaptiveness values. Non-synonymous codons and termination codons (dependent on genetic code) are excluded. CAI values range from 0 to 1 , with higher values indicating a higher proportion of the most abundant codons (see Sharp and Li, 1987, Nucleic Acids Research 15: 1281-1295; also see: Jansen et al, 2003, Nucleic Acids Res. 3J (8):2242-51). An adapted nucleotide sequence preferably has a CAI of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or 0.9.

[0120] In a second aspect, the invention provides for a process for producing a casein, the process comprising culturing a non-mammalian host cell as described herein in a medium in a fermenter or bioreactor under conditions conducive to the expression of casein. Thus, in one embodiment, the invention provides for a process for producing a casein, the process comprising culturing the nonmammalian host cell comprising i) an expression construct comprising a nucleotide sequence encoding at least one casein and ii) an expression construct comprising a nucleotide sequence encoding at least one kinase, such that one or more of the nucleotide sequences are expressed and the casein is produced, the method optionally comprising the step of recovery of the casein.

[0121] Media for growth of non-mammalian host cells, e.g., fungal host cells are generally known in the art. In a preferred embodiment, the medium for culturing a host cell of the invention is a chemically defined medium. Typical composition of the chemically defined media for growth of filamentous fungi and yeasts are e.g., described in US 20140342396 A1 , incorporated by reference herein. The pH in the fermenter or bioreactor may be controlled using ammonia as titrant. In certain embodiments, the host cell is cultured in a medium comprising glucose, glycerol, methanol or maltose as a carbon source. In preferred embodiments, glucose, glycerol, methanol or maltose is the sole carbon source.

[0122] Optionally, the process further comprises recovering the casein.

[0123] In one embodiment, the recovery is during fermentation. This may be carried out in a continuous mode to increase productivity. In one embodiment, the recovery is post fermentation. In one embodiment, the recovery is both during and post fermentation. The recovery of casein preferably at least includes separation of the host cell’s biomass from the medium comprising the (dissolved) casein. One of the possibilities to separate the microbial biomass is by centrifugation. Even more preferred the fermented broth may be set for release of the casein at the end of the fermentation, which may be following the separation of the released protein directly by centrifugation of the biomass. Therefore, in one embodiment, the recovery is by centrifugation. However, other recovery methods are suitable, such as e.g., acid or salt precipitation and solvent extraction, as known in the art.

[0124] In a third aspect, the invention relates to a casein, wherein casein has a non-native glycosylation pattern, and wherein the casein is phosphorylated. In one embodiment, the casein is at least one of a beta-casein, an alphaSI -casein, an alphaS2-casein and a kappa-casein as herein described. In one embodiment, the casein has an amino acid sequence that is comprised in an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO’s: 5 - 43. In one embodiment, the casein has an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to the mature amino acid sequence of at least one of SEQ ID NO’s: 5 - 43. In one embodiment, the casein has an amino acid sequence that is comprised in an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO’s: 5, 15, 25 and 34. In one embodiment, the casein has an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to the mature amino acid sequence of at least one of SEQ ID NO’s: 5, 15, 25 and 34.

[0125] As herein understood, the term "non-native glycosylation pattern” means that the protein is unglycosylated, or that the protein has a “non-mammalian glycosylation pattern", which means one of a difference in one or more location(s) of glycosylation in a protein, and / or a difference in the amount of and / or type of glycosylation at one or more location(s) in a casein produced and post- translationally modified in a non-mammalian host cell as compared to a corresponding reference casein, i.e. the same casein produced and post-translationally modified in a mammalian cell, preferably a mammary gland cell, more preferably as obtained from natural milk.

[0126] In one embodiment, the degree of phosphorylation of the casein having a non-native glycosylation pattern, is higher than the degree of phosphorylation of a corresponding casein produced in a non-mammalian host cell that lacks expression of a kinase capable of phosphorylating the casein, preferably a non-mammalian host cell that lacks expression of a heterologous kinase capable of phosphorylating the casein, such as e.g. mammary gland kinases, kinases from the FAM20 family of kinases or Fam20C kinase and Fam20A kinases. A “heterologous kinase” is herein understood as a kinase that is heterologous or foreign to the non-mammalian host cell. In one embodiment, the degree of phosphorylation of the casein having a non-native glycosylation pattern, is higher than the degree of phosphorylation of a corresponding casein produced in a K. phaffii host cell that lacks expression of a heterologous kinase capable of phosphorylating the casein, such as e.g., mammary gland kinases, kinases from the FAM20 family of kinases or Fam20C kinase and Fam20A kinases. The degree of phosphorylation can be determined in a method for detecting the level of phosphorylation of caseins as described above, e.g., by mass spectrometry.

[0127] In one embodiment, the degree of phosphorylation of the casein having a non-native glycosylation pattern, is at least 1 , 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% of the degree of phosphorylation of the same casein produced and post-translationally modified in a mammalian cell, preferably a mammary gland cell, more preferably as obtained from natural milk. The degree of phosphorylation can be determined in a method for detecting the level of phosphorylation of caseins as described above, e.g., by mass spectrometry.

[0128] In one embodiment, the casein having a non-native glycosylation pattern, is a casein that is obtained or obtainable by a process for producing a casein as herein described.

[0129] In a fourth aspect, the invention relates to compositions comprising a casein having a non- native glycosylation pattern and that is phosphorylated, as described herein, or a casein that is obtained or obtainable by a process for producing a casein as herein described. In one embodiment, the composition is a dairy substitute product comprising at least one casein having a non-native glycosylation pattern and that is phosphorylated, as described herein, or a casein that is obtained or obtainable by a process for producing a casein as herein described. In one embodiment, the composition is a dairy substitute product that is animal-free. Such an animal-free dairy substitute product is e.g., a composition comprising animal-free milk fats and proteins. A wide variety of dairy substitute products can be made using the methods and compositions of the present invention. Methods for producing animal-free dairy substitute products are inter alia described in WO2016 / 029193, which is herein incorporated by reference. Such products include without limitation, milk, whole milk, buttermilk, skim milk, infant formula, condensed milk, dried milk, evaporated milk, butter, clarified butter, cream, cottage cheese, cream cheese, creme fraiche, skyr, yogurt and various types of cheese. The dairy substitute products can also be incorporated into various food applications as a replacement for dairy products, which include ice cream, frozen custard, frozen yogurt, cookies, chocolate and cakes.

[0130] In one embodiment, the composition is a composition as described above, wherein at least one casein selected from the group consisting of alpha-S1 casein, alpha-S2 casein, beta casein and kappa casein is not present. As will be understood a composition wherein at least one of the caseins is not present will usually be a composition during the manufacture of which the particular casein has not been added. In one embodiment, the composition is a composition as described above, wherein at least two caseins selected from the group consisting of alpha-S1 casein, alpha- 82 casein, beta casein and kappa casein are not present. In one embodiment, the composition is a composition as described above, wherein at least three caseins selected from the group consisting of alpha-S1 casein, alpha-S2 casein, beta casein and kappa casein are not present. Advantageously, a composition wherein at least one of the caseins is not present is comparably simple to produce. The absence of the particular casein can e.g., be established by immunological means (see above) using antibodies specific for the particular casein.

[0131] In a further aspect, the invention pertains to a method for producing a composition comprising a casein having a non-native glycosylation pattern and that is phosphorylated, as described herein, or a casein that is obtained or obtainable by a process for producing a casein as herein described, the method comprising the step of combining the casein with further ingredients, preferably animal- free ingredients, to obtain the composition, e.g. a food product or a dairy substitute product, preferably an animal-free dairy substitute product.

[0132] A highly desirable advantage of the present invention is that co-expression of the kinase with the casein in a non-mammalian host cell not only increases the degree of phosphorylation of the casein but surprisingly also drastically improves secretion of the phosphorylated casein for the host cell, thus facilitating its recovery.

[0133] Further advantages of the invention are environmental in nature such as 8 times more energy efficient, 260 times more water efficient than conventional milk product. Other environmental advantages include less water usage than conventional milk production, which is estimated to be about 1000 L / L, reduced land usage compared to conventional milk production which typically requires grazing and crop land, and ability to reduce the 600 billion kg of carbon dioxide per year that is emitted from conventional milk production. The present invention also provides reduction or elimination of costs of feed, operations, labour, animals and marketing. Preferably, substantially reduce feed cost by a factor of 8.

[0134] Advantages in food safety include reduction or removal of antibiotic residues, heavy metals, bacteria, adulterations. Accordingly, certain aspects of the present invention provide animal-free dairy substitute products that are bacteria-free, require no pasteurization or cold shipping yet have an increased shelf-life and exhibit a number of characteristics such as taste, appearance, handling and mouth feel properties which are identical or at least closely similar to their traditional dairy counterparts. Preferably, the dairy substitute products are essentially free of bacteria such as Brucella, Campylobacter, Listeria, Mycobacterium, Salmonella, Shigella, Yersinia, Giardia and noro viruses, and thus are safer for consumption. Further advantages include minimal or no pasteurization and / or homogenization. More preferably, the dairy substitute is shelf stable for relatively long periods (e.g., at least three weeks and preferably longer) for production and distribution. Even more preferably, the dairy substitute product has a lower environmental impact.

[0135] The present invention has been described above with reference to a number of exemplary embodiments as shown in the drawings. Modifications and alternative implementations of some parts or elements are possible and are included in the scope of protection as defined in the appended claims. Description of the figures

[0136] Figure 1 : Detection of intracellularly accumulated His-tagged bovine Beta-casein variant A2, upon expression by K. phaffi using the beta-casein signal peptide. 115: K. phaffi GS115 parental strain; P09: Pp0009 = GS115 transformed with pHIL-D2_Beta-casein-H6 (1 copy strain); 2, 4, 6, 10, 5A, 6A: different clones of Pp0009 transformed with pPICZA_Beta-casein-H6 (different copy numbers integrated - clone 10 = Pp0020); Bo: reference beta-casein from bovine milk. Left panel: western blot followed by anti-His immunodetection (Genscript - THE™ His Tag antibody); middle panel: western blot followed by anti-casein detection (Abeam ab166596); right panel: SDS-PAGE followed by Coomassie staining.

[0137] Figure 2: Immunodetection (western blot) of intracellularly accumulated His-tagged bovine Betacasein variant A2, upon expression by K. phaffi using a collection of yeast-specific signal peptides. The identity of the different signal peptides (indicated by the numbers on top of the blot) is represented in Table 1 . P20: intracellular analysis on strain Pp0020 (multicopy Beta-casein strain; pAOX1 ; beta-casein signal peptide); 115: K. phaffi GS115 strain; Bo: reference beta-casein from bovine milk.

[0138] Figure 3: Immunodetection (western blot) of extracellular (left panel) or intracellular (right panel) His-tagged bovine Beta-casein variant A2, upon expression by K. phaffi in combination with different kinase expression constructs under the control of the pGPM1 promotor. PP-Cx: Pp0020 transformants expressing HuFam20C with own prepro-seguence; O-Cx: Pp0020 transformants expressing HuFam20C with the ost1 pre-seguence; O-(C+A)x: Pp0020 transformants expressing HuFam20C and A with the ost1 pre-seguence; P20: parental strain Pp0020; 115: K. phaffi GS115 strain; Bo: reference beta-casein from bovine milk. Intracellular analysis shows that also the parental Pp0020 strain was effectively producing (but not secreting) beta-casein.

[0139] Figure 4: Immunodetection (western blot) of extracellular (left panel) or intracellular (right panel) His-tagged bovine Beta-casein variant A2, upon expression by K. phaffi in combination with different kinase expression constructs under the control of the pGAP promotor. PP-Cx: Pp0020 transformants expressing HuFam20C with own prepro-seguence; (C+A)x: Pp0020 transformants expressing HuFam20C (own prepro) and HuFam20A (ost1 pre). P44 / 45: Pp0044 / 45 = Pp0020 coexpressing human Fam20C (own prepro) using the pGPM1 promotor; PP46 / 47: Pp0046 / 47 = Pp0020 co-expressing human Fam20C (Ost1 pre) and Fam20A (Ost1 pre) using the pGPM1 promotor; P20: parental strain Pp0020; 115: K. phaffi GS115 strain; Bo: reference beta-casein from bovine milk.

[0140] Figure 5: Immunodetection (western blot) of intracellular (left panel) or extracellular (right panel) His-tagged bovine Beta-casein variant A2, upon expression by further engineered K. phaffi strain lines (within the Pp0020 background). P70: Pp0070 = Pp0020 co-expressing human Fam20C (own prepro) and Fam20A (Ost1 pre) using the pGAP promotor; P57: Pp0057 = Pp0020 knocked-out for pmt1 ; P20: parental strain Pp0020; 115: K. phaffi GS115 strain; C1.1-C1.3: individual cultivations of a pep4 KO clone derived from Pp0070; Bo: reference beta-casein from bovine milk.

[0141] Figure 6: Immunodetection (western blot) of extracellular (left panel) or intracellular (right panel) His-tagged bovine Beta-casein variant A2, upon expression by K. phaff / Pp0130 (= Pp0020 + knockout of pho1 , pmt1 and pep4) transformants for pGAP-driven expression of human Fam20C or human Fam20C + Fam20A. PP-Cx: Pp0130 transformants expressing HuFam20C with own prepro- sequence; (C+A)x: Pp0130 transformants expressing HuFam20C (own prepro) and HuFam20A (ost1 pre); P70: Pp0070 = Pp0020 co-expressing human Fam20C (own prepro) and Fam20A (Ost1 pre) using the pGAP promotor; P20: parental strain Pp0020; P130: Pp0130; Bo: reference betacasein from bovine milk.

[0142] Figure 7: Immunodetection (western blot) of extracellular (left panel) or intracellular (right panel) His-tagged bovine Beta-casein variant A2, upon expression by K. phaff / Pp0130 (= Pp0020 + knockout of pho1 , pmt1 and pep4) transformants for pGAP-driven expression of bovine Fam20C. Cx: Pp0130 transformants expressing BoFam20C (own prepro); P168 / 169: Pp0168 / 169 = Pp0130 coexpressing human Fam20C (own prepro) and Fam20A (Ost1 pre) using the pGAP promotor; Bo: reference beta-casein from bovine milk.

[0143] Figure 8: Immunodetection (western blot) of extracellular (left panel) or intracellular (right panel) His-tagged bovine AlphaSI -casein variant B, upon pAOX1 -driven expression by K. phaffi using a collection of yeast-specific signal peptides. The identity of the different signal peptides (indicated by the numbers on top of the blot) is represented in Table 1 . P: K. phaffi parental strain PPS-9010; Bo: reference alphaSI -casein from bovine milk.

[0144] Figure 9: Immunodetection (western blot) of extracellular (left panel) or intracellular (right panel) His-tagged bovine AlphaSI -casein variant B, upon expression by K. phaffi in combination with human Fam20C and human Fam20A. P121 : Pp0121 = multicopy His-tagged AlphaSI -casein expression strain; Cx: Pp0121 transformants for pGAP-driven expression of HuFam20C (own prepro-sequence) and HuFam20A (Ost1 pre-sequence); P: K. phaffi parental strain PPS-9010; Bo: reference alphaSI -casein from bovine milk.

[0145] Figure 10: Immunodetection (western blot) of extracellular (left panel) or intracellular (right panel) bovine AlphaSI -casein variant B without C-terminal His-tag, upon expression by K. phaffi in combination with human Fam20C with or without human Fam20A. P196: Pp0196 = multicopy AlphaSI -casein (no tag) expression strain; PP-Cx: Pp0196 transformants expressing HuFam20C with own prepro-sequence; (C+A)x: Pp0196 transformants expressing HuFam20C (own prepro) and HuFam20A (ost1 pre); Bo: reference alphaSI -casein from bovine milk. Figure 11 : SDS-PAGE analysis (coomassie staining) of extracellular bovine AlphaSI -casein variant B without C-terminal His-tag, upon expression by K. phaffi 'm combination with human Fam20C with or without human Fam20A. P196: Pp0196 = multicopy AlphaSI -casein (no tag) expression strain; PP-Cx: Pp0196 transformants expressing HuFam20C with own prepro-sequence; (C+A)x: Pp0196 transformants expressing HuFam20C (own prepro) and HuFam20A (ost1 pre); P163: Pp0163 = Pp0121 transformant expressing HuFam20C (own prepro) and HuFam20A (ost1 pre); Bo: reference alphaSI -casein from bovine milk; #1 , #2: two independent cultivations of the same strain.

[0146] Figure 12: Immunodetection (western blot) of extracellular bovine AlphaSI -casein variant B upon expression by K. phaffi with or without human Fam20C in Pp0196 (the parental strain comprising a deletion of PEP4 and YPS1), strain Pp0211 (a strain with pGAP-driven HuFam20c and HuFam20a co-expression but without a deletion of the YPS’ gene) and strain Pp0213 (a strain with pGAP-driven HuFam20c co-expression but without a deletion of the YPS’ gene). Strains Pp0587 / 588 contain the pGAP-driven HuFam20c expression cassette and a deletion of the YPS’ gene.

[0147] Examples

[0148] Example 1 - Expression of beta-casein by Komagataella phaffi

[0149] K. phaffi strain GS1 15 (Invitrogen) was selected for the expression of bovine beta-casein variant A2. A gene fragment containing the full-length bovine beta-casein A2 coding sequence (including the native N-terminal signal sequence) and in-frame C-terminal His6-tag was generated synthetically and codon-optimized for efficient expression in K. phaffi. The presence of a unique 5’ EcoRI and 3’ Agel site allows cloning within the EcoRI / Agel digested pHIL-D2 plasmid (Invitrogen), thus placing the beta-casein sequence under the transcriptional control of the K. phaffi AOX1 promotor (pAOX1) and terminator (AOX1 TT). The resulting plasmid, pHIL-D2_Beta-casein-H6, was transformed to K. phaffi GS115 and transformants were selected based on their ability to grown on minimal medium plates without histidine. Integration of the expression cassette was confirmed via colony PCR. Several PCR-positive clones were selected for 24 deep-well cultivation and grown using the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.0; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol) pH 6.0 followed by cultivation for 48 hours or more; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed for the presence of beta-casein via western blot, using a commercial anti-casein (Abeam - ab166596) or anti-His antibody (Genscript - THE™ His Tag antibody). Faint expression of the beta-casein was observed intracellularly, but no product was detected within the cell-free broth. One of the analyzed clones showing limited intracellular expression was designated Pp0009 and used for further work. The observed beta-casein runs as a double band upon standard reducing SDS-PAGE analysis followed by western blotting or Coomassie staining, where the upper band runs slightly above and the lower band slightly below the reference beta-casein, derived from bovine milk (not shown).

[0150] To improve beta-casein expression, a second pAOX1-driven expression plasmid was constructed by introducing the same codon-optimized synthetic beta-casein sequence into the EcoRI / Agel digested pPICZA plasmid (Invitrogen). The resulting plasmid, pPICZA_Beta-casein-H6, was transformed to Pp0009 and transformants were selected based on their ability to grown on YPD plates containing either 100 or 500 pg / mL zeocin. A selection of clones growing on both plate types was transferred to YPD plates containing 1000 pg / mL of zeocin to increase the chances of identifying transformants in which multiple copies of the expression cassette have been integrated. Integration of the expression cassette was confirmed via colony PCR. PCR-positive clones showing good to very good ability of growing onto such high concentrations of zeocin were selected for 24 deep-well cultivation according to the above protocol. qPCR analysis confirmed multi-copy integration events (from 8 to close to 30 copies) for most of the selected clones. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via gel electrophoresis and / or western blot for the presence of beta-casein (Figure 1). A limited amount of extracellular beta-casein was detected for most analyzed multi-copy clones, while no product was observed for the parental strain Pp0009, which presumably contains only one copy of the beta- casein expression cassette. Intracellular analysis of the cell pellet indicated a low degree of betacasein expression for strain Pp0009, but high intensity signals for the multi-copy expression clones. One of the multi-copy clones (Pp0020 - up to 30 copies) was selected for future use and / or as reference strain. The observed beta-casein runs as a double band and can be distinguished from total intracellular protein upon Coomassie staining of a standard reducing SDS-PAGE gel. The high intracellular signals indicate product accumulation within the cell.

[0151] The observed intracellular accumulation of the beta-casein was observed previously (Choi and Jimenez-Flores, 1996, Journal of Agricultural and Food Chemistry 44(1): 358-364; Choi and Jimenez-Flores, 2001 , Journal of Agricultural and Food Chemistry 49(4):1761-6) and might be related to the use of the native secretion signal. To evaluate this, the coding sequence ofthe mature codon-optimized bovine beta-casein A2 variant was fused in-frame to a library of 15 yeast-specific signal peptides. Construction of these new expression plasmids was performed via a Golden Gate based modular cloning strategy using the commercially available OPENPichia plasmid system, distributed by GeneCorner (BCCM, https: / / www.qenecorner.uqent.be). 4 out of the 15 tested signal peptides (ScMF, ScMF-noEAEA, Ost1 and Kar2(v1)) were already available within the commercial OPENPichia system, while the others were designed in-house based on data in the literature or general knowledge. In essence, most of the applied secretion signals are derived from well-known sequences used for the expression of proteins by K. phaffi or from endogenous proteins that are known to be trafficking through the yeast secretion pathway. Detailed information on the sequences and origins of the secretion signal library is presented within Table 1. All in-house designed secretion signals were ordered as double strand codon-optimized DNA fragments (gBIocks - Integrated DNA Technologies) and separately subcloned via BsmBI assembly into the pPTK081_0_Empty entry vector of the OPENPichia system. A PCR fragment was generated using Fw primer: GCATCGTCTCATCGGTCTCATTCTAAGAGGCGAGAGTTAGAGGAATTGAATGTTCCAGG (SEQ ID NO: 66) and Rv primer:

[0152] ATGCCGTCTCAGGTCTCAGGATCCCACGATTATGGGAAACGGTCCCC (SEQ ID NO: 67).

[0153] This PCR fragment encodes a non-tagged bovine beta-casein A2 without its native signal peptide and flanked by the required BsmBI and Bsal cloning sites, was also separately subcloned within the entry vector via BsmBI assembly. Sequence analysis was performed to confirm the correctness of all cloned DNA fragments. The generated plasmids containing the secretion signals and the mature beta-casein sequence were used to assemble the different (15 in total) beta-casein expression constructs containing, amongst others, the AOX1 promotor, an in-frame cloned C- terminal poly-His tag (His8), the AOX1 transcription terminator and the zeocin selection marker. Golden gate-based vector construction was performed via Bsal-mediated fragment assembly. As a result, a 6-nucleotide sequence encoding Gly-Ser is introduced between the signal peptide and the N-terminus of the mature beta-casein and between the C-terminus of the beta-casein and the C- terminal in-frame introduced His8-tag. All 15 expression plasmids, each containing a different N- terminal signal peptide upfront of the beta-casein sequence, were transformed to a commercial K. phaffi strain PPS-9010 (ATUM). Transformants were selected based on their ability to grow on YPD with 100 pg / mL of zeocin. To select for transformants with potential high-copy integration of the expression cassette, 10 transformants of each were transferred to YPD containing 500 pg / mL of zeocin. 3 of the better growing transformants (presumed to be high-copy strains) per construct were selected for 24 deep-well cultivation, in combination with the parental strain PPS-9010 and the high- copy reference strain Pp0020. Cultivations were performed similar as above, with the exception that the pre-cultivation in 2 mL BMGY was performed for 48 hrs at 28°C / 200 rpm and in the presence of a final zeocin concentration of 500 pg / mL (except for PPS-9010). At the end of the cultivation, part of the cell suspension from the 3 clones per expression construct was pooled after which the cells were separated via centrifugation. The pooled mixtures of cells and cell-free broth were evaluated via standard SDS-PAGE electrophoresis, followed by western blot (Figure 2). Once more, little to no extracellular beta-casein was observed. In contrast, several combinations (but not all) of yeast-specific signal peptides and mature His-tagged beta-casein were resulting in significant intracellular accumulation, similar to what was observed for the high-copy reference strain Pp0020 expressing the full-length His-tagged beta-casein. Moreover, recultivation experiments showed that the extracellular presence of beta-casein was not reproducible for the individually tested clones (and thus could rather be the result of minor cell lysis at the end of the cultivation). Surprisingly, the more commonly used signal peptides such as the S. cerevisiae mating factor prepro region (ScMF, or variants thereof) or Ost1 and Kar2 pre-regions all resulted in the lower intensity intracellular signals, while some of the less frequently used leader peptides gave rise to the high intracellular accumulation. Moreover, in several of the latter cases the accumulated casein had a similar running behavior (double band, similar running position) as the one observed in Pp0020. This could indicate correct processing of those different signal peptides, including the native beta-casein secretion signal, within the K. phaffi secretion apparatus. It also indicates that lack of secretion is rather an intrinsic feature for the K. phaffi-expressed beta-casein, irrespective of the N-terminal signal peptide used to drive its secretion.

[0154] To get more details about the product characteristics upon intracellular accumulation, strain Pp0020 was grown via standard bioreactor cultivation conditions and the harvested cells were lysed for IMAC-based purification of the beta-casein. Protein characteristics were analyzed via RPC-UV- MS and peptide mapping under reducing conditions (see example 8).

[0155] Example 2 - Co-expression of beta-casein and a kinase in K. phaffi

[0156] Strain Pp0020, a multi-copy expression clone for His-tagged full-length bovine beta-casein A2 (including its own signal peptide), was selected for co-expression experiments with different kinase constructs. The main reason to initiate these co-expression studies was to explore potential strategies to produce bovine casein variants in non-mammalian organisms, such as yeast or filamentous fungi, with increased phosphorylation. The selected kinase constructs were generated using the OPENPichia vector system. Two different options were investigated: 1) expression of Fam20C only and 2) co-expression of Fam20C and Fam20A. For the Fam20C and Fam20A expression studies, initial tests were performed using the human kinase (UniProt Q8IXL6; SEQ ID NO: 1) resp. pseudo-kinase (UniProt Q96MK3; SEQ ID NO: 2) since these proteins were best characterized, both sequence- and functionality-wise. While Fam20A only contains a typical presequence, the mature Fam20C is preceded by its own prepro-sequence (but the function or importance of this pro-region is thus far uncharacterized). It was therefore decided to generate permutations for the Fam20C kinase, in which a codon-optimized sequence for the mature protein (starting from amino acid 93) was fused in-frame to either a pre-sequence or a prepro-sequence via Bsal assembly (Modular cloning using the OPENPichia system, each time resulting into an additional Gly-Ser linker between the C-terminal end of the pre- / prepro-region and the first amino acid of mature Fam20C). The following two sequences were selected: 1) Ost1 pre (a yeast signal peptide) and 2) native Fam20C prepro. While the first sequence was already available within the in-house signal peptide library, the latter one was newly designed as a double strand codon- optimized DNA fragment (gBIocks - Integrated DNA Technologies) and separately subcloned via BsmBI assembly into the pPTK081_0_Empty entry vector of the OPENPichia system. For the expression of the mature Fam20A (i.e. without its own pre-sequence), an in-frame fusion with the Ost1 signal sequence was generated via the modular cloning strategy. The coding sequences for the mature human Fam20C and Fam20A were synthesized and codon-optimized for expression in K. phaffi. A stop codon was not included to allow in-frame modular cloning with and read-through of a C-terminal tag (in this case the c-myc tag). The necessary BsmBI and Bsal restriction sites were included at the 5’ and 3’ end to allow correct integration within the OPENPichia entry plasmid as well as follow-on modular cloning steps.

[0157] A list of generated kinase co-expression plasmids is shown in Table 2. Initially, expression plasmids were generated via modular cloning in which the kinase constructs (with the corresponding pre- or prepro-regions and / or C-terminal myc-tag) were placed under the transcriptional control of the moderate constitutive GPM1 promotor (Stadlmayr et al., 2010, Journal of Biotechnology 150(4): 519-529). Each kinase expression construct also contained a nourseothricin selection marker (NourR). In a second stage, an additional plasmid was generated for the co-expression of Human Fam20C and Fam20A (both preceded by the Ost1 leader sequence). The two individual human Fam20C expression constructs and the plasmid for the simultaneous expression of Human Fam20C and Fam20A were transformed to strain Pp0020 and transformants were selected based on their ability to grown on YPD plates with 100 pg / mL nourseothricin and zeocin. Integration of the expression cassettes was confirmed via colony PCR. Several PCR-positive clones were selected for 24 deep-well cultivation and grown using the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.5; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol) pH 6.5 (containing pepstatin A at a concentration of 4 pg / mL) followed by cultivation for 48 hours; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of beta-casein (using a rabbit polyclonal antibody against beta-casein - custom-made at CERGroupe (Belgium) upon immunization of rabbits with in-house beta-casein purified from bovine milk). To our surprise, PCR-positive transformants for the generated kinase cassettes (Fam20C preceded by its own prepro-region or by the Ost-pre region and the simultaneous expression of Fam20C and Fam20A using the Ost1 pre-region) showed a different profile in extracellular beta-casein compared to the parental Pp0020 strain, indicating a phenotypical change in product secretion upon co-expression of these kinase constructs (Figure 3, left panel). While the Pp0020 cultivation did not result in secretion of beta-casein, secreted recombinant beta-casein (including putative degradation products) appeared to be present in the medium from the above-mentioned kinase transformants. The presumed full-size secreted betacasein shows a slower migration profile compared to the intracellularly accumulated product from e.g. strain Pp0020 (double casein band). Furthermore, despite improved secretion of the recombinant bovine beta-casein by the kinase co-expression strains, still some of the product remains trapped within the cell (Figure 3, right panel).

[0158] The above results indicate that kinase co-expression can stimulate the secretion of the expressed beta-casein. Hence, increased kinase expression might further boost the secretion potential. Therefore, the following kinase expression constructs were generated via modular cloning, in which the moderate constitutive GPM1 promotor was exchanged for the stronger constitutive pGAP promotor (Table 2): human Fam20C with its own prepro-sequence, human Fam20A with the Ost1 pre-region and a combination plasmid containing both of these expression cassettes onto the same backbone. The expression plasmid for pGAP-driven Fam20C (own prepro- sequence) and the combination plasmid for simultaneous pGAP-driven expression of Fam20C (own prepro-sequence) and Fam20A (Ost1 pre-sequence) were transformed to strain Pp0020 and transformants were selected based on their ability to grown on YPD plates with 100 pg / mL nourseothricin and zeocin. Integration of the expression cassettes was confirmed via colony PCR. Several PCR-positive and negative clones were selected for 24 deep-well cultivation and grown using the same protocol as described above for the initial kinase co-expression clones. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of beta-casein (using the custom-made rabbit polyclonal antibody against beta-casein). The results confirm that co-expression of Human Fam20C using its own prepro- sequence (alone or in combination with Fam20A) results in active secretion by K. phaffi cells of a heterogenous beta-casein protein population (Figure 4, left panel). The amount (but also degree of heterogeneity) of extracellular casein is increased when the kinase co-expression is driven by the stronger pGAP promotor. Intracellular analysis of the presented cultivation also showed a discrete difference in gel migration between intracellular beta-casein of the secreting kinase co-expression clones versus the parental strain or clones that do not secrete part of the beta-casein (no expression of active kinase) (Figure 4, right panel). The slight reduction in gel mobility for the intracellular betacasein of the kinase co-expression strains can be the result of protein phosphorylation, as has been shown by others for beta-casein derived from bovine milk. Example 3 - Extra strain engineering steps to improve K. phaffi-de rived beta-casein product quality

[0159] The extracellular analysis on cultivation broth of certain kinase co-expression strains showed the presence of a heterogenous beta-casein protein population. Product-related protein bands with a faster gel mobility are most probably the result of proteolytic events. To avoid too extensive degradation, we found that the addition of pepstatin A upon initiation of methanol induction helps to partially stabilize the secreted beta-casein. Next, a CRISPR-based knock-out strategy was designed to eliminate the major yeast vacuolar acid aspartyl protease gene (PEP4) from strain Pp0070, a Pp0020 transformants co-expressing the human Fam20C and Fam20A under the control of the GAP promotor (see Example 2). Apart from product-related bands with faster gel mobility, the main part of the extracellular beta-casein showed a reduced mobility compared to the intracellularly accumulated protein, most probably related to post-translational modifications such as extended O-glycosylation (see e.g. Figure 4).

[0160] Next, a similar knock-out strategy was designed to eliminate the K. phaffi PMT 1 gene, coding for the protein-O-mannosyltransferase that has been described as major factor in protein O- glycosylation by K. phaffi cells (Govindappa et al., 2013, Protein Expression and Purification 88(1): 164-171 ; Nett et al., 2013, PLoS One 8(7): e68325). Finally, to diminish the potential of protein dephosphorylation by K. phaffi extracellular phosphatases upon protein secretion, new strain lines were generated in which the PHO1 gene was deleted as well (Payne et al., 1995, Gene 163(1): 19- 26).

[0161] The applied CRISPR KO strategy was based on the Cas12a system, first described for mammalian cells and adapted in-house for use in K. phaffi. To this end, the human codon-optimized Cas12a coding sequence from Lachnospiraceae bacterium (hLbCas12a), the nuclear localization signal from SV40 (NLS-2xSV40) as well as a guideRNA (gRNA) cloning site with GFP dropout cassette (pGAP-gRNA-FBP1tt) were generated via gene synthesis (gBIock - IDT) or oligonucleotide annealing and each subcloned via BsmBI assembly into the pPTK081_0_Empty entry vector of the OPENPichia system. Next, an ‘empty’ destination CRISPR / Cas12a expression vector was constructed through Bsal-mediated Golden Gate Assembly of the required entry vectors belonging to or compatible with the OPENPichia toolkit (VIB / GeneCorner). The resulting plasmid expresses the Cas12a with in-frame C-terminal nuclear localization signal under the transcriptional control of the constitutive pGPM1 promotor and AOX1 transcription terminator and further contains the empty expression cassette (GFP dropout) for the required gRNA sequences as well as the hygromycin resistance marker (HygR) and an autonomous replicating sequence (ARS) for transient propagation of the plasmid within the K. phaffi cells. Then, to construct target-specific CRISPR / Cas12a vectors, the gRNA (or an array of gRNAs) for the genes of interest were designed as annealed oligonucleotides according to Zetsche et al. (2017, Nature Biotechnology 35(1): 31- 34) and subsequently cloned into the destination vector through Bbsl-mediated Golden Gate Assembly. Due to the corresponding loss of the GFP dropout cassette, a green-white screen allowed for easy identification of correctly assembled clones. The CRISPR construct to knock-out K. phaffi PMT1 was generated by introducing into the

[0162] ‘empty’ CRISPR / Cas12a destination vector an array forthe simultaneous expression of a first gRNA (5’-TGGCACCTCTTGAGGACTTG-3’ SEQ ID NO: 68) and a second gRNA sequence (5’- ACTGTAACACCTTCCCCAGT-3’ SEQ ID NO: 69) targeting resp. a 5’ and 3’ sequence of the PMT1 open reading frame. The plasmid was initially transformed towards strain Pp0020, the high-copy expression strain for His-tagged bovine beta-casein variant A2. Transformants were selected on YPD plates containing zeocin (100 pg / mL) and hygromycin (200 pg / mL). Deletion of the PMT1 gene was confirmed via colony PCR, after which the pmt1 deletion clones were further purified on YPD plates containing zeocin (100 pg / mL) to lose the episomal Crispr plasmid containing the hygromycin resistance marker. Purified pmt1 KO clones, obtained upon confirmed plasmid curing, were cultivated for expression analysis according to the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.0; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol) pH 6.5, followed by cultivation for 48 hours; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of beta-casein (using the custom-made rabbit polyclonal antibody against beta-casein). While little to no beta-casein secretion was observed within the cell-free broth (not shown), the gel mobility of the intracellularly accumulated beta-casein had changed upon deleting the PMT1 gene. Particularly, the upper beta-casein band was reduced in size and in concentration (relative to the lower beta-casein band) (Figure 5, left panel). This substantial effect on gel mobility indicates that the upper band contains O-glycans and that the O-glycosylation site occupancy is reduced because of the pmt1 KO. The CRISPR construct to knock-out K. phaffi PEP4 was generated by introducing into the ‘empty’ CRISPR / Cas12a destination vector an array for the simultaneous expression of a first gRNA (5’-GCTTCAGCACCAATACCTAG-3’ SEQ ID NO: 70) and a second gRNA sequence (5’-GACCTAGGCAAAGATGCAG-3’ SEQ ID NO: 71) targeting resp. a 5’ and 3’ sequence of the PEP4 open reading frame. The plasmid was transformed towards strain Pp0070, co-expressing the His-tagged bovine beta-casein variant A2 and human Fam20C / Fam20A. Transformants were selected on YPD plates containing zeocin (100 pg / mL), nourseothricin (100 pg / mL) and hygromycin (200 pg / mL). Deletion of the PEP4 gene was confirmed via colony PCR, after which the pep4 deletion clones were further purified on YPD plates containing zeocin (100 pg / mL) and nourseothricin (100 pg / mL) to lose the episomal Crispr plasmid containing the hygromycin resistance marker. Purified pep4 KO clones, obtained upon confirmed plasmid curing, were cultivated for expression analysis according to the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.5; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol) pH 6.5 (containing pepstatin A at a concentration of 4 pg / mL) followed by cultivation for 48 hours; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of beta-casein (using the custom-made rabbit polyclonal antibody against beta-casein). While little difference in casein expression was observed intracellularly (not shown), the heterogeneity caused by extracellular beta-casein degradation was significantly reduced in the pep4 KO clones compared to the parental Pp0070 strain (Figure 5, right panel).

[0163] One of the obtained pep4 KO clones within the Pp0070 cell line, called Pp0155, was further engineered to delete the YPS1 gene, responsible for the expression of the major yapsin activity (a family of cell-wall associated aspartic acid proteases). Knock-out of the YPS1 gene is described to benefit the secreted production of heterologous proteins by K. phaffi (Werten and de Wolf, 2005, Applied and Environmental Microbiology 71 (5): 2310-2317; Yao et al., 2009, Journal of Biotechnology 139(2): 131-136; Wu et al., 2013, Journal of Industrial Microbiology and Biotechnology 40(6): 589-599). The CRISPR construct to knock-out K. phaffi YPS was generated by introducing into the ‘empty’ CRISPR / Cas12a destination vector an array for the simultaneous expression of a first gRNA (5’-AACCGTGTTATGCCCGGACT-3’ SEQ ID NO: 72) and a second gRNA sequence (5’-GTAGTTATTCTCGGCGTGTG-3’ SEQ ID NO: 73) targeting resp. a 5’ and 3’ sequence of the YPS1 open reading frame. Upon its transformation to Pp0155, clones were selected on YPD plates containing zeocin (100 pg / mL), nourseothricin (100 pg / mL) and hygromycin (200 pg / mL). Deletion of the YPS1 gene was confirmed via colony PCR, after which the yps1 deletion clones were further purified on YPD plates containing zeocin (100 pg / mL) and nourseothricin (100 pg / mL) to lose the episomal Crispr plasmid containing the hygromycin resistance marker. Purified yps1 KO clones, obtained upon confirmed plasmid curing, were cultivated for expression analysis according to the above protocol (for pep4 KO clones). However, the additional knock-out of the YPS1 gene showed little beneficial effect on the stability of secreted beta-casein (not shown). One of the selected yps1 KO clones, strain Pp0132, was however selected to additionally delete the PMT1 gene. Gene knock-out and analysis of transformants were performed as described previously. A successful pmt1 KO clone with reduced beta-casein O- glycosylation, called Pp0178, was selected for more extensive beta-casein product characterization.

[0164] Finally, some of the above strategies to improve beta-casein product quality were combined within a single strain background. Initially, a CRISPR construct to knock out the PHO1 gene encoding for the major secreted K. phaffi phosphatase was introduced in strain Pp0020, expressing the bovine beta-casein variant A2. The plasmid to knock-out the K. phaffi PHO1 was generated by introducing into the ‘empty’ CRISPR / Cas12a destination vector an array for the simultaneous expression of a first gRNA (5’- CAGACTTAGAATAGGAGAAA-3’ SEQ ID NO: 74) and a second gRNA sequence (5’-CGGAAAACTGTGGAGTTCCT-3’ SEQ ID NO: 75) targeting resp. a 5’ and 3’ sequence of the PHO1 open reading frame. Transformants were selected on YPD plates containing zeocin (100 pg / mL) and hygromycin (200 pg / mL). Initial screening via colony PCR did not identify any pho1 KO clones, as each time an amplicon with an expected length for the WT PHO1 locus was obtained. However, sequencing of the obtained amplicon of two selected transformants indicated a frame-shift mutation (deletion of 2 nucleotides) in the PHO1 gene for one of the clones, at the position where the designed 5’ guideRNA was supposed to anneal to direct a cas12-mediated double strand nick. This clone was therefore considered as pho1 gene-inactivated. Upon curing of the Crispr plasmid, the resulting strain Pp0063 was transformed with the Crispr plasmid to delete the PMT1 gene and analyzed as described previously. A successful pmt1 KO clone, called Pp0127, was afterwards transformed with the Crispr plasmid to delete the PEP4 gene and analyzed as described previously. This resulted in the generation of strain Pp0130, inactivated or deleted for the PHO1 , PMT1 and PEP4 gene and containing multiple copies of the pAOX1 -driven expression cassette for bovine beta-casein variant A2.

[0165] To get more details about the product characteristics upon co-expression of the human Fam20C and Fam20A, strains Pp0132 and Pp0178 (additional pmt1 KO) were grown via standard bioreactor cultivation conditions and the harvested cells were lysed for IMAC-based purification of the beta-casein. Protein characteristics were analyzed via RPC-UV-MS and peptide mapping under reducing conditions (see Example 8).

[0166] Example 4 - Evaluation of human or bovine Fam20 kinase genes for the secreted expression of beta-casein

[0167] The newly generated strain Pp0130 was selected to test the functionality of bovine homologues of the human Fam20C and Fam20A kinase sequences. Since this background is different from the Pp0020 in which the original kinase constructs were tested, strain Pp0130 was initially transformed with the pGAP driven expression construct for human Fam20C (own prepro- sequence) or the combination construct for pGAP-driven expression of both the human Fam20C (own prepro-sequene) and the human Fam20A (Ost1 pre-sequence) to serve as positive controls when evaluating the co-expression of the bovine Fam20 kinase sequences. Transformants were selected based on their ability to grown on YPD plates with 100 pg / mL nourseothricin and zeocin. Integration of the expression cassettes was confirmed via colony PCR. Several PCR-positive (and negative) clones were selected for 24 deep-well cultivation and grown using the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.5; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol) pH 6.5, followed by cultivation for 48 hours; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of beta-casein (using the custom-made rabbit polyclonal antibody against beta-casein). The results reconfirmed that co-expression of Human Fam20C using its own prepro-sequence (alone or in combination with Fam20A) results in active secretion of betacasein by K. phaffi cells (Figure 6, left panel), while no product secretion was observed in the parental Pp0130 strain. However, due to the pmt1 KO background, the running position of the secreted upper beta-casein protein band was considerably lower compared to the running position of a more heterogenous extracellular beta-casein produced by human Fam20 kinase co-expression strains in which the PMT1 gene has not been inactivated (e.g. Pp0070). Cell pellet analysis of a selection of cultivated clones showed that co-expression of an active kinase slowed down the gel mobility of most of the intracellularly accumulated beta-casein (when compared to negative clones or the parental control Pp0130) (Figure 6, right panel). On top of that, the analysis once more shows the effect on beta-casein gel mobility (in the absence of kinase co-expression) when reducing overall protein O-glycosylation by deleting the PMT1 gene (comparing Pp0130 with Pp0020).

[0168] In a next phase we evaluated whether it could be more beneficial to co-express the bovine rather than the human versions of the Fam20 kinase proteins. The functional human Fam20C protein sequence was blasted against bovine protein databases and recovered a first sequence with high identity. This sequence (NCBI Reference Sequence: XP_002698221 .2; UniProt sequence F1 MXQ3; SEQ ID NO: 3) is almost identical in size to the human homologue and was ordered synthetically (full-length thus including the prepro-sequence) and codon-optimized for expression by K. phaffi (gBIocks - Integrated DNA Technologies). The sequence was flanked with the required BsmBI and Bsal restriction sites and separately subcloned via BsmBI assembly into the pPTK081_0_Empty entry vector of the OPENPichia system. The generated plasmid was used to assemble a bovine Fam20C expression construct via Golden gate based Bsal assembly. This vector contains, amongst others, the GAP promotor, the AOX1 transcription terminator and the geneticin (G418) selection marker. Strain Pp0130 was transformed with the bovine Fam20C expression construct and transformants were selected based on their ability to grown on YPD plates with 200 pg / mL zeocin and either 1 or 4 mg / mL G418. Integration of the expression cassette was confirmed via colony PCR. Several colonies were selected for 24 deep-well cultivation and grown using the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.5; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol; addition of pepstatin A at 4 pg / mL) pH 6.5, followed by cultivation for 48 hours; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of beta-casein (using the custom-made rabbit polyclonal antibody against beta-casein). The results showed that co-expression of Bovine Fam20C resulted in active secretion of beta-casein by K. phaffi cells when evaluated next to the parental strain Pp0130. Secreted levels were comparable with Pp0130 transformants Pp0168 and Pp0169, expressing the human Fam20C (and Fam20A). (Figure 7, left panel). The running position of the secreted beta-casein protein (and associated product-related fragments) was identical to the extracellular beta-casein produced by the corresponding human Fam20 kinase co-expression strains (Pp0168 and Pp0169). Cell pellet analysis of the cultivated clones showed that co-expression of BoFam20C slowed down the gel mobility of most of the intracellularly accumulated beta-casein (Figure 7, right panel). Overall, the results indicated that co-expression of Fam20C, whether human or bovine, results in increased secretion of accumulated bovine beta-casein by K. phaffi.

[0169] Example 5 - Expression of alphaSI -casein by K. phaffi

[0170] The nucleotide sequence of the mature bovine alphaSI -casein variant B was ordered synthetically (gBIock - IDT) and codon-optimized for expression by K. phaffi. The sequence was flanked with the required BsmBI and Bsal sites to allow Golden Gate based modular cloning strategies using the commercially available OPENPichia plasmid system (distributed by GeneCorner - BCCM) and was initially subcloned via BsmBI assembly into the pPTK081_0_Empty entry vector. In a next stage, the subcloned alphaSI -casein fragment was fused in-frame to a library of 15 yeast-specific signal peptides (see above; Table 1). Construction of these new plasmids was performed via the Bsal-based modular cloning strategy, combining the AOX1 promotor, the alphaSI -casein with in-frame fused N-terminal signal peptide and C-terminal His8-tag, the AOX1 transcription terminator and the zeocin resistance marker into individual (per signal peptide) expression cassettes. As a result, a 6-nucleotide sequence encoding Gly-Ser was introduced between the signal peptide and the N-terminus of the mature alphaSI -casein and between the C- terminus of the casein and the introduced His8-tag. All 15 expression plasmids were transformed to a commercial K. phaffi strain PPS-9010 (ATUM). Transformants were selected based on their ability to grow on YPD with 500 pg / mL of zeocin, which could induce the isolation of clones with high-copy integration of the expression cassette. Integration of the expression cassettes was confirmed via colony PCR. Three transformants per construct were selected for 24 deep-well cultivation and grown using the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.5; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol; addition of pepstatin A at 4 pg / mL) pH 6.5, followed by cultivation for 48 hours; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, part of the cell suspension from the 3 clones per expression construct was pooled after which the cells were separated via centrifugation. The pooled mixtures of cells and cell-free broth were evaluated via standard SDS-PAGE electrophoresis, followed by western blot using a rabbit polyclonal antibody against alphaSI -casein - custom-made at CERGroupe (Belgium) upon immunization of rabbits with in-house alphaSI -casein purified from bovine milk (Figure 8, left panel). Depending on the signal peptide, little to no extracellular alphaSI -casein was observed. In contrast, several combinations of yeast-specific signal peptides and mature His- tagged alpha-S1 casein resulted in significant intracellular accumulation (Figure 8, right panel). Moreover, recultivation experiments showed that the extracellular presence of alphaSI -casein was not reproducible for all individually tested clones and thus could be the result of uncontrolled cell lysis at the end of the cultivation. Surprisingly, some of the less conventional leader peptides again gave rise to the high intracellular accumulation, while little expression was observed for others. It indicates that lack of secretion is, similar to our earlier observations for beta-casein (variant A2), an intrinsic feature for the K. phaffi-expressed His-tagged bovine alphaSI -casein (variant B).

[0171] Example 6 - Co-expression of alphaSI -casein and the human Fam20C / A kinase in K. phaffi

[0172] The alphaSI -casein expression strain Pp0121 was selected for co-expression studies with the combination construct of the pGAP-driven human Fam20C (own prepro-region) and human Fam20A (Ost1 pre-sequence). Strain Pp0121 contains approximately 15 copies of the pAOX1- driven expression cassette for the bovine alphaSI variant A, fused in-frame to a C-terminal His8- tag and an N-terminal signal peptide (SP13, see Table 1) derived from the K. phaffi protein Cwp1. The plasmid for the simultaneous expression of Human Fam20C and Fam20A was transformed to strain Pp0121 and transformants were selected based on their ability to grown on YPD plates with 100 pg / mL nourseothricin and zeocin. Integration of the expression cassettes was confirmed via colony PCR. Several PCR-positive clones were selected for 24 deep-well cultivation and grown using the following protocol: 1) inoculation from single colony into 2 mL BMGY pH 6.5; 2) cultivation for 24 hours at 200 rpm and 28°C; 3) collection of cells via centrifugation and removal of the BMGY medium; 4) resuspension of cells in 2 mL BMMY (1 % methanol) pH 6.5 (containing pepstatin A at a concentration of 4 pg / mL) followed by cultivation for 48 hours; 5) at regular time intervals additional methanol is spiked into the cultivation to avoid longer periods of C-source starvation. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of beta-casein (using the custom-made rabbit polyclonal antibody against alphaSI -casein). Again, to our surprise several PCR-positive transformants showed a different profile in extracellular alphaSI -casein compared to the parental Pp0121 strain, indicating a phenotypical change on product secretion upon co-expression of these kinase constructs. While the Pp0121 shows at most the alphaSI-casein band representative of intracellularly accumulating product, more of the recombinant casein appeared to be present in the medium from the above- mentioned kinase transformants. On top of that, part of the presumed full-size secreted alphaSI- casein showed a slower migration profile compared to the product that is mainly accumulating within the cell. This could indicate effective migration through the later stages of the secretion pathway, where additional post-translational modification events can result in a protein of higher molecular weight (Figure 9, left panel). Despite improved secretion of the recombinant bovine alphaSI-casein by the kinase co-expression strains, some of the product remained trapped within the cell. Intracellular analysis of the presented cultivation also showed a discrete difference in gel migration between intracellular alphaSI-casein of the secreting kinase co-expression clones versus the parental strain or a clone that does not secrete part of the alphaSI-casein (no expression of active kinase) (Figure 9, right panel). The slight reduction in gel mobility for the intracellular alphaSI- casein of kinase co-expression strains can be the result of protein phosphorylation. Overall, the above results indicate that kinase co-expression can stimulate the secretion of the expressed alphaSI-casein.

[0173] Example 7 - Co-expression of alphaSI-casein (without C-terminal His-tag) and the human Fam20C / A kinase in K. phaffi

[0174] To reduce the chances for extracellular protein degradation, new alphaSI-casein expression strains were generated using a background strain in which both the YPS1 and PEP4 gene were knocked out. The gene knock-outs were generated in the commercial K. phaffi strain PPS-9010 (ATUM) according to the same principles and work methods as described above (CRISPR- mediated deletion) and the resulting strain was designated Pp0096. Since the custom-made inhouse antibody proved to be sufficient to evaluate expression of alphaSI-casein, a C-terminal His- tag was no longer deemed to be required the expression cassette. For this purpose, a new codon- optimized nucleotide sequence was ordered (gBIock - IDT) for the expression of the mature bovine alphaSI -casein variant B in direct fusion to the SP13 signal peptide, hence avoiding the introduction of a GS-linker between the signal peptide and mature casein via Bsal-mediated modular cloning. The ordered sequence was flanked with the required BsmBI and Bsal sites to allow Golden Gate based modular cloning strategies using the commercially available OPENPichia plasmid system (distributed by GeneCorner - BOOM) and was initially subcloned via BsmBI assembly into the pPTK081_0_Empty entry vector. The Bsal-based modular cloning strategy was used to combine the AOX1 promotor, the subcloned alphaSI -casein with direct in-frame fusion to the N-terminal signal peptide, the AOX1 transcription terminator and the zeocin resistance marker into a new expression cassette. The generated plasmid for tagless alphaSI -casein was transformed to strain Pp0096. Transformants were selected based on their ability to grow on YPD with 1000 pg / mL of zeocin, which could induce the isolation of clones with high-copy integration of the expression cassette. Integration of the expression cassettes was confirmed via colony PCR and number of integrated copies by qPCR analysis. PCR-positive multicopy strains were cultivated as described in example 6 and intracellular expression evaluated (not shown). A well expressing 9-copy clone (Pp0196) was selected for further engineering work.

[0175] Strain Pp0196 was transformed with the pGAP-driven expression construct for human Fam20C (own prepro-sequence) or the combination construct for pGAP-driven expression of both the human Fam20C (own prepro-sequene) and the human Fam20A (Ost1 pre-sequence). Transformants were selected based on their ability to grown on YPD plates with 100 pg / mL nourseothricin and zeocin. Integration of the expression cassettes was confirmed via colony PCR. Several PCR-positive (and negative) clones were selected for 24 deep-well cultivation and grown as described above, with the exception that an extra shot of pepstatin A (final concentration of 4 pg / mL) was added at the second day of methanol induction. The parental strain Pp0196 and strain Pp0163 (co-expression of His-tagged alphaSI -casein and human Fam20C / A kinase) were grown as well. At the end of the cultivation, cells were separated from the broth and both fractions were analyzed via western blot for the presence of alphaSI -casein (using the custom-made rabbit polyclonal antibody against beta-casein). The results reconfirmed that co-expression of Human Fam20C using its own prepro-sequence (alone or in combination with Fam20A) results in active secretion of alphaSI -casein by K. phaffi cells (Figure 10, left panel), while no product secretion was observed in the parental Pp0196 strain. Moreover, the degree of secretion seemed to substantially outperform that of Pp0163. Despite significant improved secretion of the recombinant bovine alphaSI -casein by kinase co-expression strains, still some product remains trapped within the cell. Intracellular analysis (Figure 10, right panel) of the presented cultivation also showed a difference in gel migration between intracellular alphaSI -casein of the secreting kinase co-expression clones versus the parental strain Pp0196, PCR-negative transformants (no secretion of the alphaSI- casein due to lack of active kinase co-expression). Extracellular cell-free samples of Pp0196, Pp0163 and kinase co-expression clones of Pp0196 (human Fam20C or human Fam20C+A) were loaded for standard SDS-PAGE analysis, followed by Coomassie staining. Only clear AlphaSI protein bands were observed for the kinase co-expression clones within the Pp0196 background (pAOX1 -driven expression of AlphaSI -casein without C-terminal His-tag; pep4yps1 double KO strain). In agreement with the extracellular western blot data, the secreted alphaSI -casein runs as a double protein band (Figure 11). The upper band was also easily detected using the periodic acid- Schiff staining method (not shown), which could indicate increased protein glycosylation. Similar results were obtained when co-expressing Bovine Fam20C or the combination of bovine Fam20C and bovine Fam20A (not shown). Overall, the above results reconfirmed that kinase co-expression stimulated the secretion of the expressed alphaSI -casein.

[0176] Example 8 - Characterization of beta- and alphaSI -casein produced by K. phaffi

[0177] Strains Pp0020, expressing the His-tagged Beta-casein variant B, and Pp0132, coexpressing the Beta-casein and the human Fam20(A+C) in a pep4 / yps1 deletion strain, were cultivated in 15 L bioreactors (Biostat C-DCU - Sartorius). Shake flask precultures were grown overnight at 28 °C using BMGY (1 % glycerol). The total preculture inoculum consisted of 5% of the bioreactor starting volume. Fermentations were performed at 24°C and pH 6.8 while the dissolved oxygen was maintained at 30%. The medium for the batch phase consisted of BMGY with 0.5% glycerol. Upon glycerol depletion, a biomass generation phase of 20 hours was initiated using a feed solution of 60% glycerol + 1 .2% PTMi (Cupric sulfate-5H2O, 6.0 g / L; Sodium iodide, 0.08 g / L; Manganese sulfate-H2O, 3.0 g / L; Sodium molybdate-2H2G, 0.2 g / L; Boric Acid, 0.02 g / L, Cobalt chloride, 0.5 g / L; Zinc chloride, 20.0 g / L; Ferrous sulfate-7H2O, 65.0 g / L; Biotin, 0.2 g / L; 85% Sulfuric Acid, 5.0 mL / L) (Invitrogen Corporation, 2002. K. phaffi Fermentation Process Guidelines) at a rate of 0.3*t + 13.4 g.L-1.h-1. Pressure was placed at 600 mbar from this phase onwards. After feed phase I, the culture was eased into methanol metabolism over a six hour period while feeding 100% methanol with a linear increase at a rate of 0.44*t + 0.8 g.L-1.h-1. After this six hour transition period, methanol induction continued with a constant feeding of 3.4 g.L-1.h-1.

[0178] Strain Pp0178, co-expressing the Beta-casein and the human Fam20(A+C) in a pep4 / yps1 / pmt1 deletion strain, was cultivated in two 1 L bioreactor vessels (Dasgip). Shake flask precultivations and bioreactor inoculation were done as described above. Fermentations were initiated at 28°C and pH 6.8 while the dissolved oxygen was maintained at 30%. The medium for the batch phase consisted of BMGY with 2.5% glycerol. Upon glycerol depletion, a biomass generation phase of 12 hours was initiated using a feed solution of 60% glycerol + 1 .2% PTM1 at a constant rate of 12.5 g.L-1.h-1. After feed phase I, the culture was eased into methanol metabolism over a six hour period while feeding 50% methanol at a rate of 0.67*t + 2.03 g.L-1.h-1. After this six hour transition period, methanol induction continued with a constant feeding of 6.09 g.L-1.h-1.

[0179] Strains Pp0121 , expressing the His-tagged AlphaSI -casein variant B, and Pp0163, coexpressing the AlphaSI -casein and the human Fam20(A+C) were cultivated in 1.5 L bioreactor vessels (Dasgip). Shake flask precultivations and bioreactor inoculation were done as described above. Fermentations were performed at 24°C and pH 6.8 while the dissolved oxygen was maintained at 30%. The medium for the batch phase consisted of BMGY with 1 % glycerol. Upon glycerol depletion, a biomass generation phase of 24 hours was initiated using a feed solution of 60% glycerol + 1.2% PTM1 at a linear feed rate of was 0.173*t + 1.73 g.L-1.h-1. After feed phase I, the culture was eased into methanol metabolism over a six hour period while feeding 50% methanol at a rate of 0.23*t + 0.70 g.L’1.h’1. After this six hour transition period, methanol induction continued with a constant feeding of 2.01 g.L-1.h-1.

[0180] At harvest time, K. phaffi cells were centrifuged to remove the supernatant and the wet cell pellet was then washed in 50 mM Tris-HCI pH 8 (1 .1 mL per g cells). Lysis buffer (50 mM Tris-HCI pH 8 + 4 pg / ml PepstatinA + 1 mM PMSF + 0.1 % Empigen BB + 5 U / mL nuclease) was added at 5 mL per gram wet cell weight. The resuspended cells were lysed via four consecutive passages through an Agitator bead mill DynoMill (Multi Lab) in which the lysis chamber was filled with 250 mL glass beads (425-600 pm). Cell debris was removed by centrifugation for 1 h at 4870 g, after which ammonium sulphate was added to the cleared supernatant over 30 min at 4°C to reach a final concentration of 1.4 M. After another 30 min of stirring at 4°C, a protein pellet was obtained via centrifugation for 45 min at 4870 g. The pellet was dissolved at 5 mL 50 mM Tris-HCI, 4 M urea, 200 mM NaCI, pH 8 per gram pellet followed by a sonication on ice (8 cycles of 30 sec at maximum amplitude). Next, a buffer exchange was performed to 50 mM Tris-HCI, 4 M urea, 200 mM NaCI, pH 8 (to remove remaining ammonium sulphate) via tangential flow filtration (TFF) using a 0.0264 m2Pellicon 3 RC membrane with 10 kDa cut-off (Merck Millipore). Following a 1 .2 pm filtration step, a chromatography separation by IMAC was performed on a 20 mL column with Chelating Sepharose FF (Cytiva), loaded with nickel chloride. After loading, the column was wash with 10 mM imidazole and the His-tagged caseins eluted with 200 mM imidazole. The product was concentrated and diafiltrated by TFF using a 0.0264 m2Pellicon 3 RC membrane with 10 kDa cut-off (Merck Millipore). Finally, the product was concentrated and diafiltered with at least 5 diavolumes 50 mM Tris-HCI pH 8, followed by 0.45 pm filtration. Protein concentration, purity and identity were determined using resp. OD280 measurement, SDS-PAGE + Coomassie staining and Western blot.

[0181] The purified casein samples were analyzed using reverse phase chromatography followed by mass spectrometric analysis (RPC-UV-MS) and using peptide mass analysis under reducing conditions. Prior to RPC-UV-MS analysis, samples were diluted 1 :3 (v:v) in 100 mM Tris-HCI, 8 M urea, 6 mM sodium acetate, 20 mM DTT, pH 7.5. Samples were analyzed using a C4 RP-HPLC column on a 1290 Infinity UHPLC system, coupled to a 6540 Q-TOF mass spectrometer (Agilent Technologies). Separation was performed at 45°C with H2O, acetonitrile and trifluoroacetic acid (TFA) as mobile phase constituents at a flow rate of 0.35 mL / min. Data acquisition and processing were performed with MassHunter 7.0 (Agilent Technologies). Peptide mapping was performed by reducing the purified casein samples with DTT, followed by alkylation using iodoacetamide. Upon trypsin ization samples were analyzed via RP-HPLC-MS using a C18 column. Separation was performed with H2O, acetonitrile and formic acid as mobile phase constituents. The analyses and data processing were performed as described above. During data processing the focus was on the evaluation of the sequence coverage and quantification and site determination of prominent post- translational modifications such as protein phosphorylation and O-mannosylation.

[0182] Based on the above analyses, the following conclusions could be made for the recombinant intracellular beta-casein produced from the different strain backgrounds (Table 3):

[0183] - For all strain backgrounds the main product is full-size (no N- or C-terminal truncations). Product from strain Pp0020: 1) no sign of product phosphorylation; 2) variable degree of O- mannosylation.

[0184] - Product from strain Pp0132: 1) some degree of protein phosphorylation observed; 2) phosphate addition occurs on the same peptide stretches that are also phosphorylated in the bovine betacasein; 3) similar degree of O-mannosylation as in strain Pp0020.

[0185] - Product from strain Pp0178: 1) O-mannosylation is significantly reduced (effect of pmt1 KO); 2) degree of phosphorylation appears to be increased compared to Pp0132.

[0186] Based on the above analyses, the following conclusions could be made for the recombinant intracellular alphaSI -casein produced from the two selected strain backgrounds (Table 4):

[0187] - For all strain backgrounds the main product is full-size (no N- or C-terminal truncations).

[0188] - Product from strain Pp0121 : 1) no sign of product phosphorylation; 2) limited degree of O- mannosylation (lower degree compared to beta-casein).

[0189] - Product from strain Pp0163: 1) prominent levels of protein phosphorylation; 2) phosphate addition occurs on the same peptide stretches that are also phosphorylated in the bovine betacasein; 3) limited degree of O-mannosylation (similar to that observed for Pp0121).

[0190] Example 9 - Further reduction of proteolysis of bovine aS1 -casein upon secretion by a Pichia pastoris strain which co-expresses the HuFam20c kinase

[0191] Direct gel analysis on cell-free medium samples, as well as LC-MS / MS analysis (data not shown) on bovine aS1 -casein variant B isolated from the cultivation broth of a Pichia strain that coexpresses the HuFam20c (and HuFam20a) kinase (e.g. strain Pp021 1 / PpO213), indicate the occurrence of one or more proteolytic events which result in aS1 -casein variant B molecules with a N-terminal truncation. This N-terminal truncation can be partially inhibited by cultivating the Pichia strains in the presence of pepstatin A, which suggests that acid aspartyl protease activity is responsible for the observed degradation of aS1 -casein variant B. Given that the described strains are already gene-deleted for PEP4 and YPS1 , the major vacuolar resp. cell-wall associated acid aspartyl proteases, an additional gene knock-out in the YPS’ gene (PP7435_Chr3-1068) was established in the strain Pp0196 by replacing the whole YPS’ ORF with a pGAP-driven HuFam20c kinase co-expression cassette through double homologous recombination. The Pp0196 contains up to nine genomically integrated copies of an expression cassette consisting of the AOX1 promoter, the coding sequence for the SP13 secretion signal in direct fusion to the N-terminus of the mature bovine AlphaSI -casein variant B, and the AOX1TT terminator.

[0192] For the purpose of the above-described knock-out / knock-in strategy, a plasmid was designed (P0626) in which the pGAP-driven HuFam20C (own prepro-sequence) expression cassette was flanked by a 581 bp and 659 bp sequence located 5’ resp. 3’ of the Pichia YPS’ coding sequence. To stimulate double homologous recombination at the endogenous YPS’ locus of strain Pp0196, the linearized knock-out / knock-in cassette from P0626 was co-transformed with a YPS’-specific CRISPR-based knock-out plasmid P0471. The latter plasmid was generated according to the methods as previously described for the PEP4 and YPS1 CRISPR-based knock-out plasmids. Pichia transformants were selected on hygromycin-containing medium to select for the presence of the CRISPR plasmid and single clones were then screened by cPCR to identify those in which the correct insertion of the HuFam20c kinase co-expression cassette resulted into the simultaneous deletion of the YPS’ ORF.

[0193] Colony PCR indicated that several correct knock-out / knock-in clones could be obtained within the Pp0196 strain background, and two pure single clones were then stored as strains Pp0587 and Pp0588. These two strains, as well as strain Pp0196 (the parental strain), strain Pp021 1 (a strain with pGAP-driven HuFam20c and HuFam20a co-expression but without a deletion of the YPS’ gene) and strain Pp0213 (a strain with pGAP-driven HuFam20c co-expression but without a deletion of the YPS’ gene) were selected for cultivation. The cultivation was performed in a 24 deepwell plate at 28°C and 200 rpm for 24 hours in standard BMGY medium pH 7. The cells were then transferred to standard BMMY medium (1 % methanol, pH 7) and cultivated for another 48 hours at 28°C and 200 rpm. During the methanol induction phase, PMSF was added at a final concentration of 2 mM. At the end of the cultivation, cells were separated from the broth and the cell-free medium was analyzed via western blot for the extracellular presence of (full-size) AlphaSI -casein variant B (Figure 12).

[0194] The results demonstrate that the knock-out of the YPS’ gene (SEQ ID 89) significantly reduced the proteolysis of bovine AlphaSI -casein variant B as secreted by Pichia strains in which the HuFam20c kinase is co-expressed (i.e. strain Pp0587 and Pp0588; more intense full-size AlphaSI casein variant B and absence of proteolytic fragments). In contrast, western blot analysis clearly shows that proteolysis is still ongoing in the medium of the Pp0211 and Pp0213 strains, which are both kinase co-expression strains that are not gene-deleted for YPS’.

[0195] References

[0196] Cherry JR & Fidantsef A, 2003. Directed evolution of industrial enzymes: an update. Current Opinion in Biotechnology, 14(4), pp.438-443.

[0197] Choi B-K and Jimenez-Flores R, 1996. Study of putative glycosylation sites in bovine beta-casein introduced by PCR-based site-directed mutagenesis. Journal of Agricultural and Food Chemistry 44(1): 358-364.

[0198] Choi B-K and Jimenez-Flores R, 2001 . Expression and purification of glycosylated bovine betacasein (L70S / P71 S) in Pichia pastoris. Journal of Agricultural and Food Chemistry 49(4):1761-6.

[0199] Chung K-S, Rafael FR, Sang Suk Oh, Richardson T, 1991 . Secretion of bovine b-casein by Saccharomyces cerevisiae. Journal of Microbiology and Biotechnology 1 .1 : 31-36.

[0200] Cui J, Xiao J, Tagliabracci VS, Wen J, Rahdar M, Dixon JE, 2015. A secretory kinase complex regulates extracellular protein phosphorylation. Elife (4): e06120.

[0201] Govindappa N, Hanumanthappa M, Venkatarangaiah K, Kanojia K, Venkatesan K, Chatterjee A, Kusumanchi M, Dave N, Hazra P, Tiwari S, Sastry K, 2013. PMT1 gene plays a major role in O-mannosylation of insulin precursor in Pichia pastoris. Protein Expression and Purification 88(1): 164-171. Jimenez-Flores R, Richardson T, Bisson LF, 1990. Expression of bovine beta-casein in Saccharomyces cerevisiae and characterization of the protein produced in vivo. Journal of Agricultural and Food Chemistry 38(4), 1 134-1141.

[0202] Nett JH, Cook WJ, Chen MT, Davidson RC, Bobrowicz P, Kett W, Brevnova E, Potgieter TI, Mellon MT, Prinz B, Choi BK, Zha D, Burnina I, Bukowski JT, Du M, Wildt S, Hamilton SR, 2013. Characterization of the Pichia pastoris protein O-mannosyltransferase gene family. PLoS One 8(7): e68325.

[0203] Payne WE, Gannon PM, Kaiser CA, 1995. An inducible acid phosphatase from the yeast Pichia pastoris: characterization of the gene and its product. Gene 16351): 19-26.

[0204] Stadlmayr G, Mecklenbrauker A, Rothmuller M, Maurer M, Sauer M, Mattanovich D, Gasser B, 2010. Identification and characterisation of novel Pichia pastoris promoters for heterologous protein production. Journal of Biotechnology 150(4): 519-529.

[0205] Tagliabracci VS, Engel JL, Wen J, Wiley SE, Worby CA, Kinch LN, Xiao J, Grishin NV, Dixon JE, 2012. Secreted kinase phosphorylates extracellular proteins that regulate biomineralization. Science 336(6085): 1 150-1153.

[0206] Tagliabracci VS, Wiley SE, Guo X, Kinch LN, Durrant E, Wen J, Xiao J, Cui J, Nguyen KB, Engel JL, Coon JJ, Grishin N, Pinna LA, Pagliarini DJ, Dixon JE, 2015. A Single Kinase Generates the Majority of the Secreted Phosphoproteome. Cell 161 (7): 1619-1632.

[0207] Venerando A, Ruzzene M, Pinna LA, 2014. Casein kinase: the triple meaning of a misnomer. Biochemistry Journal 460(2): 141-156.

[0208] Werten MWT and de Wolf FA, 2005. Reduced proteolysis of secreted gelatin and Yps1-mediated alpha-factor leader processing in a Pichia pastoris kex2 disruptant. Applied and Environmental Microbiology 71 (5): 2310-2317.

[0209] Wu M, Shen Q, Yang Y, Zhang S, Qu W, Chen J, Sun H, Chen S, 2013. Disruption of YPS1 and PEP4 genes reduces proteolytic degradation of secreted HSA / PTH in Pichia pastoris GS115. Journal of Industrial Microbiology and Biotechnology 40(6): 589-599.

[0210] Yao XQ, Zhao HL, Xue C, Zhang W, Xiong XH, Wang ZW, Li XY, Liu ZM, 2009. Degradation of HSA-AX15(R13K) when expressed in Pichia pastoris can be reduced via the disruption of YPS1 gene in this yeast. Journal of Biotechnology 139(2): 131-136.

[0211] Zetsche B, Heidenreich M, Mohanraju P, Fedorova I, Kneppers J, DeGennaro EM, Winblad N, Choudhury SR, Abudayyeh GO, Gootenberg JS, Wu WY, Scott DA, Severinov K, van der Oost J, Zhang F, 2017. Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nature Biotechnology 35(1): 31-34.

[0212] Zhang H, Zhu Q, Cui J, Wang Y, Chen MJ, Guo X, Tagliabracci VS, Dixon JE, Xiao J, 2018. Structure and evolution of the Fam20 kinases. Nature Communications 9(1): 1218. Table 1 . Overview of signal- and pre-pro-sequences used herein in expression constructs for expression of caseins and Fam20 kinases (see Examples and Figures).

[0213]

[0214] *Bold: potential N-glycosylation site; Bold and underlined: kex2 cleavage site.

[0215] Table 2. Overview of the constructs for expression of the FAM20 kinases.

[0216] Table 3. Analysis of post-translational modifications of tryptic fragments of beta-caseins produced from the different strain backgrounds as indicated, by reverse phase chromatography followed by mass spectrometric analysis.

[0217] Pp0020 Pp0132 Pp0178

[0218]

[0219] Pp0020 Pp0132 Pp0178

[0220] Table 4. Analysis of post-translational modifications of tryptic fragments of alphaSI -casein produced from the two selected strain backgrounds as indicated, by reverse phase chromatography followed by mass spectrometric analysis

[0221] Pp0121 Pp0163

[0222] Pp0121 Pp0163

[0223] Table 5. Sequences of caseins, FAM20 kinases and endogenous K. phaffii genes used herein.

Claims

Claims A non-mammalian host cell comprising i) an expression construct comprising a nucleotide sequence encoding at least one casein and ii) an expression construct comprising a nucleotide sequence encoding at least one kinase, wherein the at least one kinase is a kinase that is capable of phosphorylating the at least one casein. A host cell according to claim 1 , wherein co-expression of the at least one casein and the at least one kinase in the host cell, causes the casein to be phosphorylated, wherein coexpression of the at least one casein and the at least one kinase in the host cell increases the degree of phosphorylation of the at least one casein by at least 10%, as compared to the at least one casein produced in a corresponding host cell lacking co-expression of the at least one kinase, wherein preferably, the degree of phosphorylation of the at least one casein, is at least 1 % of the degree of phosphorylation of the same casein produced and post- translationally modified in a mammalian cell, preferably as determined by mass spectrometry. A host cell according to claim 1 or 2, wherein the nucleotide sequence encoding the at least one casein encodes a signal sequence operably linked to the at least one casein and the nucleotide sequence encoding the at least one kinase encodes a signal sequence operably linked to the at least one kinase, wherein co-expression of the at least one kinase and the at least one casein in the host cell increases the extracellular level of the at least one casein, as compared to the at least one casein produced in a corresponding host cell lacking coexpression of the at least one kinase, and wherein preferably, the host cell is a nonmammalian eukaryotic host cell, wherein preferably, the extracellular level of the at least one casein is increased by at least a factor 1.1 . A host cell according to any one of claims 1 - 3, wherein the nucleotide sequence encoding the at least one kinase encodes a kinase from the FAM20 family of kinases, preferably at least one of a Fam20C kinase and a Fam20A kinase, or, wherein the nucleotide sequence encoding the at least one kinase encodes at least one of: i) a protein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO.’s: 1 and 3, and having casein kinase activity: and, ii) a protein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to at least one of SEQ ID NO.’s: 2 and 4, and having at least one of casein kinase activity and casein kinase stimulating activity. A host cell according to any one of the preceding claims, wherein the nucleotide sequence encoding the at least one casein comprising an amino acid sequence with at least 50, 55,60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to the amino acid sequence of a casein from a mammal selected from the group consisting of: Bos taurus (domestic cattle), Bos grunniens (yak), Bubalus bubalis (water buffalo), Capra hircus (goat), Ovis aries (sheep), Camelus spp. (camel, dromedaris), Rangifer tarandus (reindeer), Equus caballus (horse), Sus spp. including Sus domesticus (pig) and Homo sapiens.

6. A host cell according to claim 5, wherein the nucleotide sequence encoding the at least one casein comprising an amino acid sequence with at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to the amino acid sequence of at least one of SEQ ID NO’s: 5 - 43, of which the bovine SEQ ID NO’s: 5, 15, 25 and 34 are preferred.

7. A host cell according to any one of the preceding claims, wherein the host cell is nonmammalian eukaryotic host cell, preferably a eukaryotic microbial host cell, more preferably a yeast or a filamentous fungus host cell.

8. A host cell according to claim 7, wherein the cell is selected from a genus from the group consisting of Saccharomyces, Kiuyveromyces, Candida, Komagataella, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, Yarrowia, Kazachstania Debaryomyces, Naumovia, Alternaria, Apophysomyces, Aspergillus, Cladosphialophora, Fonsecaea, Fusarium, Lichtheimia, Mucor, Myceliophthora, Neurospora, Penicillium, Rhizopus, Rhizomucor, Trichoderma and Trichophyton, wherein preferably, the cell selected from a species from the group consisting of K. phaffii, K. pastoris, K. pseudopastoris S. cerevisiae, S. exiguus, S. bayanus, Kiuyveromyces lactis, Kiuyveromyces marxianus Y. lipolytica, S. pombe, Alternaria alternata, Apophysomyces variabilis, Aspergillus spp., Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus flavus, Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus sojae, Aspergillus terreus, Cladosphialophora spp., Fonsecaea pedrosoi, Fusarium spp., Fusarium oxysporum, Fusarium solani, Lichtheimia spp., Lichtheimia corymbifera, Lichtheimia ramosa, Myceliophthora spp., Myceliophthora thermophila, Neurospora crassa, Penicillium chrysogenum, Penicillium simplicissimum, Penicillium brasilianum, Rhizopus spp., Rhizopus microsporus, Rhizomucor spp., Rhizomucor pusillus, Rhizomucor miehei, Trichoderma spp., Trichoderma reesei Trichophyton spp., Trichophyton interdigitale, and Trichophyton rubru, of which Komagataella phaffii is most preferred.

9. A host cell according to any one of the preceding claims, wherein the cell comprises at least one genetic modification selected from the group consisting of: a) a genetic modification that reduces proteolytic activity of the cell, preferably the genetic modification reduces at least one of extracellular and vacuolar proteolytic activity of the cell;b) a genetic modification that reduces the phosphatase activity of the cell, preferably the genetic modification reduces the extracellular phosphatase activity of the cell; and, c) a genetic modification that reduces O-linked glycosylation of proteins produced by the cell.

10. A host cell according to claim 9, wherein at least one of: a) the genetic modification reduces or eliminates the expression or activity of at least one of: i) a transcriptional activator regulating the expression of an array of protease genes, preferably, a transcriptional activator encoded by a prfT gene, or an orthologue thereof; ii) a vacuolar acid aspartyl protease, preferably a vacuolar acid aspartyl protease encoded by a PEP4 gene, or an orthologue thereof; iii) a cell-wall associated aspartic acid protease, preferably a cell-wall associated aspartic acid protease of the yapsin family, more preferably, encoded by a YPS1 gene and / or by a YPS’ gene or orthologues thereof; iv) a vacuolar serine-type protease, preferably a vacuolar serine-type protease encoded by a PRB1 gene, or an orthologue thereof; v) a secreted subtilisin-type protease, preferably a secreted subtilisin-type protease encoded by a SUB2 gene, or an orthologue thereof; and vi) a subtilisin-like Ser-type proteases, preferably a subtilisin-like Ser-type proteases encoded by a SBT100 gene or an orthologue thereof; b) the genetic modification reduces or eliminates the expression or activity of an extracellular phosphatase, preferably an extracellular phosphatase encoded by a PHO1 gene; and, c) the genetic modification reduces or eliminates the enzymatic activity of a protein-O- mannosyl transferase, preferably a protein-O-mannosyl transferase encoded by a PMT gene, more preferably at least one of a PMT1 - PMT7 gene, most preferably at least one of a PMT1, PMT2 and PMT4 gene, of which PMT1 is preferred.

11. A process for producing a casein, the process comprising culturing a host cell according to any one of claims 1-10 such that one or more of the nucleotide sequences are expressed and the casein is produced, the process optionally comprising the step of recovery of the casein.

12. A casein having a non-native glycosylation pattern, wherein the casein is phosphorylated, wherein preferably the casein has a higher degree of phosphorylation as compared to a corresponding casein produced in a non-mammalian host cell that lacks expression of a heterologous kinase capable of phosphorylating the casein, wherein preferably, the degree of phosphorylation is determined by mass spectrometry.

13. A casein according to claim 12, wherein the degree of phosphorylation of the casein is at least 1% of the degree of phosphorylation of the same casein produced and post- translationally modified in a mammalian cell, preferably a mammary gland cell, more preferably as obtained from natural milk, wherein preferably, the degree of phosphorylation is determined by mass spectrometry.

14. A casein according to claim 12 or 13, wherein the casein is obtainable in a process of claim 11.

15. A composition comprising a casein according to any one of claims 12 - 14, wherein preferably the composition is a food product, wherein more preferably the composition is a dairy substitute product, wherein most preferably the composition is animal-free dairy substitute product.

Images