Methods for identifying t cell receptors (TCRS) that bind antigens

EP4638712A2Pending Publication Date: 2025-10-29BLUESPHERE BIO INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023908493
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-22
Filing Date
2023-12-21
Publication Date
2025-10-29

AI Technical Summary

Technical Problem

Current adoptive cell therapy (ACT) treatments for diseases like cancer face challenges in identifying optimal T cell receptors (TCRs) for targeting tumor antigens, necessitating new and improved methods for TCR identification.

Method used

The method involves forming libraries of TCR-expressing reporter T cells and antigen-presenting cells (APCs) to rapidly screen TCRs that bind to specific antigens, including tumor neoantigens, by activating T cells upon contact with APCs expressing relevant antigens, and using HLA-matched APCs to ensure accurate antigen presentation.

Benefits of technology

This approach enables the rapid identification of TCRs that recognize tumor-specific antigens, facilitating personalized treatment by efficiently screening 1-100 TCRs against 1-20 candidate antigen expression vectors in a single sample, potentially leading to effective cancer treatment through adoptive cell therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

Provided herein are methods for identifying tumor neoantigens and T cell receptors (TCRs) that bind to tumor neoantigens, z.e., neoantigen-specific TCRs. In some embodiments, the present disclosure relates to the identified tumor neoantigens and tumor neoantigen-specific TCRs, and related methods and uses thereof. In some embodiments, the provided embodiments relate to the identification of the tumor neoantigen-specific TCRs from individuals to facilitate personalized treatment, such as adoptive cell therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Methods For Identifying T Cell Receptors (TCRs) that Bind Antigens CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No.63 / 476,717, filed December 22, 2022, which is incorporated herein by reference. SEQUENCE LISTING

[0002] The Sequence Listing written in file BSB-0005WO01_SeqListing_ST26.xml is 8.8 kilobytes in size, was created December 22, 2022, and is hereby incorporated by reference. FIELD

[0003] The present disclosure relates, in some embodiments, to methods for identifying antigens and T cell receptors (TCRs) that bind to the antigens, i.e., neoantigen-specific TCRs. In some embodiments, the present disclosure relates to the identified tumor neoantigens and tumor neoantigen-specific TCRs, and related methods and uses thereof. In some embodiments, the provided embodiments relate to the identification of the tumor neoantigen-specific TCRs from individuals to facilitate personalized treatment, such as adoptive cell therapy. BACKGROUND

[0004] The administration of T cells targeting a specific antigen, also known as adoptive cell therapy (ACT), is a promising approach for treating diseases such as cancer. However, current ACT treatments face challenges, including the identification of optimal T cell receptors for targeting antigens present in a tumor. Therefore, there is a need for new and improved methods to overcome these challenges. The present disclosure addresses these and other needs. SUMMARY

[0005] Described are methods for identifying T cell receptors (TCRs) or antigen-binding fragments thereof that bind to antigens. The antigen can be, but is not limited to, a tumor neoantigen, a shared tumor antigen, a pathogen antigen, (e.g., a viral or bacterial antigen), an allergen, or an autoimmune disorder-related antigen. The methods comprise: (a) forming a library of TCR-expressing reporter T cells, wherein each T cell in the library expresses a single TCR; (b) forming a library of antigen-presenting cells (APCs), wherein each APC expresses one or more antigens (e.g., tumor neoantigens); and (c) contacting the reporter T cells with the APCs, wherein activation of a T cell indicates the TCR expressed by the T cell binds to an antigen expressed by an APC. In some embodiments, the T cells are incubated with an immune effector cytokine prior to contacting the cells with the APCs. In some embodiments, the TCRsare cloned from a subject and the APCs are HLA matched to a subject. In some embodiments, the TCRs are cloned from a subject having a specific HLA allele or alleles and the APCs express the specific HLA allele or alleles. In some embodiments, the APCs are transfected or transduced with a vector encoding a one or more tumor neoantigens present in a tumor of the subject. In some embodiments, the APCs are transfected or transduced with a vector encoding a one or more pathogen proteins or fragments thereof. In some embodiments, the APCs are transfected or transduced with a vector encoding a one or more allergens or fragments thereof. In some embodiments, the APCs are transfected or transduced with a vector encoding a one or more proteins or fragments thereof associated with a cell of tissue that is a target of the autoimmune disorder. In some embodiments, 1-100 TCRs can be rapidly screened against 1- 20 candidate antigen expression vectors in a single sample.

[0006] In some embodiments, the described methods can be used to identify TCRs that recognize shared tumor antigens, wherein the shared tumor antigens are presented in the context of a specific HLA allele. Identification of a TCR that recognizes a shared tumor antigen in the context of a specific HLA allele can be used in the treatment of subjects having the shared tumor antigen and the specific HLA allele.

[0007] The described methods can also be used to identify antigens that are presented to the immune system in the context of HLA. Identification of a TCR that is activated by an APC expressing an antigen indicates the antigen is presented to the T cell in the context of HLA. In some embodiments, the described methods can be used to identify an antigen or neoantigen associated with a cancer. In some embodiments, the described methods can be used to identify shared tumor antigens. In some embodiments, the described methods can be used to identify shared tumor antigens that bind to a specific HLA allele. In some embodiments, the described methods can be used to identify a neoantigen specific to a subject. In some embodiments, the described methods are used to identify an antigen expressed by a pathogen, such as a bacterial antigen or a viral antigen. In some embodiments, the described methods are used to identify an antigen associate with an allergen or an autoimmune disease.

[0008] Described are methods of forming a neoantigen expression library comprising: (a) performing genomic DNA sequencing and RNA expression profile analysis on cells obtained from a tumor in a subject; (b) performing genomic DNA sequencing on non-cancerous cells obtained from the subject; (c) identifying expressed mutations in the genome of the tumor cells relative to the non-cancerous cells; and (d) forming a library of neoantigen expression vectors containing neoantigen minigenes encoding the mutations identified in step (c). The neoantigen expression vectors can be, but are not limited to, lentiviral vectors. In some embodiments, theneoantigen expression vectors contain tandem minigenes, wherein the tandem minigene comprises 2 or more neoantigen minigenes, wherein the neoantigen minigenes are expressed as a fusion polypeptide. In some embodiments, the neoantigen expression library can be used to prepare a library of neoantigen-presenting APCs by introducing the neoantigen expression vectors into APCs. In some embodiments, the APCs are HLA matched to the subject. HLA matched indicates that the APCs express the same HLA-A, HLA-B, and HLA-C alleles as the subject. In some embodiments, the neoantigen expression vectors are introduced into two antigen presenting cells, wherein the two APCs together are HLA matched to the subject. In some embodiments, the two APCs comprise a first APC expressing an HLA-A, HLA-B, and HLA-C of the subject, and a second APC expressing an HLA-A′, HLA-B′, and HLA-C′ of the subject, wherein HLA-A, HLA-B, HLA-C, HLA-A′, HLA-B′, and HLA-C′ represent the HLA alleles expressed by the subject. In some embodiments, the neoantigen expression vectors are introduced into three antigen presenting cells, wherein the three APCs together are HLA matched to the subject. In some embodiments, the three APCs comprise a first APC expressing an HLA-A allele and an HLA-A′ allele, a second APC expressing an HLA-B allele and an HLA-B′ allele, and a third APC expressing an HLA-C allele and an HLA-C′ allele, wherein HLA-A, HLA-B, HLA-C, HLA-A′, HLA-B′, and HLA-C′ represent the HLA alleles expressed by the subject. HLA-A and HLA-A′ may be the same or different. HLA-B and HLA-B′ may be the same or different. HLA-C and HLA-C′ may be the same or different.

[0009] Described are methods for identifying one or more T cell receptors (TCRs) or antigen- binding fragments thereof that bind to tumor neoantigens, the methods comprising: (a) generating a library of functional TCR-expressing reporter T cells by introducing a plurality of nucleic acid molecules, each comprising a nucleic acid encoding a functional TCR, or antigen- binding fragments thereof, from a plurality of T cells obtained from a biological sample from a subject having a tumor, into a plurality of reporter T cells, wherein the TCR-expressing reporter T cell is activated and provides a detectable signal if the TCR-expressing reporter T cell contacts an antigen presenting cell expressing an antigen to which the TCR binds; (b) identifying one or more candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from the subject to corresponding genomic DNA sequences of non-tumor cells from the subject and cloning the one or more candidate neoantigens or fragments thereof into one or more candidate neoantigen expression vectors to form a candidate neoantigen expression library, wherein each candidate neoantigen expression vector in the library encodes one or more candidate neoantigens or fragments thereof; (c) generating a library of neoantigen-expressing antigen-presenting cells (APCs) by introducingthe one or more candidate neoantigen expression vectors into a plurality of APCs capable of expressing the one or more candidate tumor neoantigens or fragments thereof complexed with a major histocompatibility complex (MHC) molecule; (d) contacting the library of functional TCR-expressing reporter T cells with one or more APCs of the library of neoantigen-expressing APCs; (e) detecting any activated TCR-expressing reporter T cells based on detection of the detectable signal; wherein the TCR expressed by an activated TCR-expressing reporter T cell binds the tumor neoantigen expressed by the APC. In some embodiments, the T cells are incubated with an immune effector cytokine prior to contacting the cells with the APCs. In some embodiments, a nucleic acid encoding the TCR can be isolated from the activated TCR- expressing reporter T cell. In some embodiments, a nucleic acid sequence encoding a TCR, or an antigen-binding fragment thereof, can be isolated or identified from the activated TCR- expressing reporter T cell. In some embodiments, a nucleic acid sequence encoding a neoantigen can be isolated or identified from the APC that activated the TCR-expressing reporter T cell.

[0010] Using the described methods, a library of TCRs can be screened against a full or partial mutanome. Using the described methods, 1-100 TCRs can be screened against 1-20 neoantigen expression vectors in a single sample. Steps (d) and (e) can be performed in as a little as one day. In some embodiments, steps (d) and (e) are performed in 1, 2, or 3 days.

[0011] Using the described methods, a library of TCRs can be screened against one or more proteins or fragments thereof that are associated with an infection (e.g., a viral infection or a bacterial infection), an allergy, or an autoimmune disorder.

[0012] A TCR-expressing reporter T cell (reporter T cell) comprises a T cell expressing a heterologous nucleic acid sequence encoding a functional TCR from a T cell isolated from the subject and a detectable marker. The T cell isolated from the subject can be, but is not limited to, a tumor infiltrating T cell (TIL), or a PBMC. The subject can be an autologous subject or an allogeneic subject. The TCR-expressing reporter T cell is activated if the expressed TCR binds to a cognate antigen complexed with an MHC (HLA) molecule presented on an APC. A reporter T cell line is a population of reporter T cells expressing the same functional TCR and the same detectable marker.

[0013] A reporter T cell is a T cell that provides a detectable signal when the T cell is activated by a TCR binding to a cognate antigen complexed with a major histocompatibility complex class 1 (MHC) molecule (e.g., a HLA complex) presented on an APC. In some embodiments, the reporter T cell is a T cell that expresses a detectable marker when the T cell is activated by a TCR binding to a cognate antigen in the context of a major histocompatibilitycomplex class 1 (MHC) molecule (e.g., a HLA complex). In some embodiments, a reporter T cell comprises a T cell that expresses CD69 when activated. In some embodiments, the reporter T cell contains a reporter gene that expresses a detectable marker when the T cell is activated. The detectable marker can be, but is not limited to, a fluorescent protein, a luciferase, or a cell surface marker. The fluorescent protein can be, but is not limited to, a green fluorescent protein, a blue fluorescent protein, a cyan fluorescent protein, a yellow fluorescent protein, an orange fluorescent protein, or a red fluorescent protein, or a derivative thereof. A TCR-expressing reporter T cell comprises a T cell expressing a heterologous nucleic acid sequence encoding a functional TCR from a T cell isolated from the subject and a detectable marker. The T cell isolated from the subject can be, but is not limited to, a tumor infiltrating T cell (TIL), or a PBMC. The subject can be an autologous subject or an allogeneic subject. The reporter T cell is activated if the expressed TCR binds to a cognate antigen complexed with an MHC molecule presented on an APC. In some embodiments, the TCR-expressing reporter T cell has been modified to knock out the endogenously expressed TCR.

[0014] The library of functional TCR-expressing reporter T cells can be generating using any method known in the art for generation of such libraries. In some embodiments, the library of functional TCR-expressing reporter T cells is generated using any of the methods described in US20150203886 or WO2018102473, each of which is incorporated herein by reference. In some embodiments, the TCR is an αβ TCR.

[0015] Identifying one or more candidate tumor neoantigens comprises identifying one or more neoantigens expressed by tumor cells of the subject, but not expressed by non-tumor cells of the subject. In some embodiments, an antigen is identified as a candidate tumor neoantigen if: (i) a single nucleotide variant (SNV) or an insertion-deletion (indel) is present in the genomic DNA sequence of the gene encoding the antigen from the tumor cells from the subject, compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the non-tumor cells from the subject; and / or (ii) an SNV or an indel is present in an mRNA sequence of the gene encoding the antigen from the tumor cells from the subject, compared to the corresponding mRNA sequence of the gene encoding the antigen from the non-tumor cells from the same subject. In some embodiments, an antigen is identified as a candidate tumor neoantigen if an SNV or an indel is present in the genomic DNA sequence of the gene encoding the antigen from the tumor cells from the subject, compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the non-tumor cells from the subject, and is expressed. In some embodiments, the SNV results in a non-synonymous mutation, a missense mutation, or a nonsense mutation, in the gene encoding the antigen. In someembodiments, the SNV or indel results in a non-synonymous mutation that is expressed as a peptide or protein. In some embodiments, the indel results in a frameshift mutation in the gene encoding the antigen. In some embodiments, the SNV or indel can be present in a coding region, such as an exon, of the gene encoding the antigen. In some embodiments, the SNV or indel is present in a regulatory region or an intron of the gene encoding the antigen and results in increased expression of the antigen in the tumor cell compared to the non-tumor cell.

[0016] In some embodiments, an antigen is identified as a candidate tumor neoantigen if: (i) an SNV or an indel is present in the genomic DNA sequence from the tumor cells from the subject, compared to the corresponding genomic DNA sequence from the non-tumor cells from the subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splicing variant RNA, a silenced retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF or a gene fusion; and / or (ii) an SNV or an indel is present in an expressed RNA sequence from the tumor cells from the subject, compared to the corresponding expressed RNA sequence from the non-tumor cells from the subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splicing variant RNA, a silenced retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF or a gene fusion. In some embodiments, the SNV or indel is present in an intergenic region, a non- coding region, a regulatory region, an intron, a silenced retroviral element, or a heterochromatic region of the genome. In some embodiments, the antigen is encoded by the non-coding RNA or the splicing variant RNA; and / or the antigen comprises the alternative ORF, the upstream ORF, the regulatory ORF or the small ORF.

[0017] In some embodiments, a candidate antigen (e.g., a candidate tumor neoantigen) is further analyzed for predicted complex formation with an MHC molecule. Predicted complex formation with an MHC molecule can be done using prediction models available in the art.

[0018] In some embodiments, a candidate antigen (e.g., a candidate tumor neoantigen) is further analyzed for predicted ability to generate an immune response. Predicted ability to generate an immune response can be done using prediction models available in the art.

[0019] Described are neoantigen minigenes comprising nucleic acid sequences encoding the identified candidate neoantigens. The neoantigen minigene encodes a polypeptide fragment comprising all or a portion of a gene in which a candidate neoantigen is identified. In some embodiments, a neoantigen minigene encodes a polypeptide comprising an identified mutation (e.g., a mutated amino acid resulting from a tumor-specific non-synonymous variation) and its surrounding amino acids. In some embodiments, the neoantigen minigene encodes an about 8 to about 30 amino acid peptide containing the mutated amino acid. In some embodiments, theneoantigen minigene encodes the identified mutated amino acid and about 4 to about 15 amino acids upstream and about 4 to about 15 amino acids downstream.

[0020] In some embodiments, a neoantigen minigene is cloned into an expression vector to form a neoantigen vector. The neoantigen minigene is cloned into an expression vector using methods known in the art. In some embodiments, the neoantigen minigene is cloned into an expression vector using seamless (e.g., Gibson) cloning. The neoantigen vector comprises a promoter operatively linked to the neoantigen minigene, wherein the promoter is active in an antigen presenting cell. The promoter can be, but is not limited to, a CMV promoter, a Igκ promoter, a PGK promoter, a SV40 promoter, a β-actin promoter, an α-actin promoter, a SRα promoter, a herpes thymidine kinase promoter, a herpes simplex virus (HSV) promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late promoter (Ad MLP), a rous sarcoma virus (RSV) promoter, an immunoglobulin promoter, EF1α promoter, ubiquitin promoter, MNDU3 promoter, metallothionein promoter, IFN gene promoter, or a GM-CSF gene promoter. In some embodiments, the expression vector further comprises one or more additional sequences that facilitate or enhance expression of the neoantigen minigene in an antigen presenting cell. The one or more additional sequences include, but are not limited to, a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) element, and a poly A tail. In some embodiments, a neoantigen vector further encodes a ubiquitin moiety. The ubiquitin moiety can be, but is not limited to, a modified ubiquitin moiety. The modified ubiquitin moiety can be, but is not limited to, a ubiquitin comprising a G76V amino acid substitution. In some embodiments, the encoded ubiquitin forms a fusion protein with the neoantigen or tandem neoepitope encoded by the neoantigen minigene or tandem minigene. The ubiquitin can be linked to the encoding neoantigen or tandem minigene via a spacer. In some embodiments, the neoantigen vector further encodes a selectable marker or cell surface reporter. The selectable marker or cell surface reporter can be, but is not limited to, truncated rat nerve growth factor receptor (tNGFR). The selectable marker or cell surface reporter can be expressed from the same promoter as the neoantigen minigene or tandem minigene or it can be expressed from a different promoter. If the selectable marker or cell surface reporter is expressed from the same promoter, the coding sequence of the selectable marker or cell surface reporter can be operably linked to the neoantigen minigene or tandem neoantigen minigene by a 2A or IRES element. The neoantigen vector or tandem minigene vector can be, but is not limited to, a viral vector or a vector for generating a viral particle. The viral vector can be, but is not limited to, a lentiviral vector. The viral particle can be, but is not limited to, a lentivirus.

[0021] In some embodiments, two or more neoantigen minigenes are cloned in tandem to form a tandem minigene. The tandem minigene encodes a fusion polypeptide comprising two or more neoantigens or neoepitopes (i.e., a tandem neoantigen). The tandem minigene can be cloned into an expression vector to from a tandem minigene vector. In some embodiments, the neoantigen minigenes in the tandem neoantigen minigene are be separated by a spacer. In some embodiments, the spacer encodes a short amino acid that promotes efficient epitope processing. In some embodiments, the spacer encodes the amino acid sequence AAY (alanine-alanine- tyrosine). In some embodiments, the spacer encodes the amino acid sequence GPGPG, EAAAK, or GGGSG. A tandem minigene vector can encode at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 candidate neoantigens or fragments thereof (including neoepitopes). In some embodiments, the tandem minigene vectors each encode about 2 to about 10 candidate neoantigens or fragments thereof. In some embodiments, the tandem minigene vectors each encodes about 5 to about 10 candidate neoantigens or fragments thereof. For tandem minigenes comprising two or more neoantigen minigenes, each neoantigen minigene can be separated by a spacer. The spacers can be the same or different.

[0022] In some embodiments, the neoantigen minigene vectors and / or tandem minigene vectors are assembled using parallel cloning. In some embodiments, the tandem minigene vectors are assembled without performing a restriction endonuclease cleavage reaction. In some embodiments, the tandem minigene vectors are assembled using seamless (e.g., Gibson) cloning.

[0023] Described are candidate neoantigen expression libraries. A candidate neoantigen expression library comprises a plurality of neoantigen minigene vectors and / or tandem minigene vectors. A neoantigen minigene vector library or tandem minigene vector library comprises a plurality of neoantigen minigene vectors and / or a plurality of tandem minigene vectors encoding a plurality of candidate neoantigens and / or fragments thereof. A candidate neoantigen expression library can comprise all (full mutanome), nearly all, greater than 90%, greater than 75%, greater than 50%, or a subset of the identified candidate neoantigens or fragments thereof or candidate neoepitopes from a subject.

[0024] The neoantigen expression vectors and / or tandem minigene vectors in the library can be pooled. The pool can include all of the neoantigen expression vectors and / or tandem minigene vectors in the library or a subset of the neoantigen expression vectors and / or tandem minigene vectors in the library. Alternatively, each different neoantigen expression vector and / or tandem minigene vector in the library can be maintained and / or stored separately. When each different neoantigen expression vector and / or tandem minigene vector in the library ismaintained and / or stored separately, information regarding the identity of the candidate neoantigens and / or coding sequences or amino acid sequences can be recorded for each vector. For a tandem minigene expression library, each identified candidate neoantigen can be represented in the library once. Alternatively, for a tandem minigene expression library, each identified candidate neoantigen can be represented in the library more than once. When each identified candidate neoantigen is represented in the tandem minigene expression library more than once, the neoantigen minigenes are arranged and grouped in separate tandem minigenes to facilitate identification of the neoantigen in the tandem neoantigen that is bound by a TCR based on the set of neoantigen expressing APCs that activate the TCR.

[0025] Described are methods of generating a library of neoantigen-expressing APCs expressing candidate neoantigens comprising: introducing into APCs, one or more of the described neoantigen expression vectors, either individually or as a pooled library. In some embodiments, the APCs are transfected or transduced with a described candidate neoantigen expression library. In some embodiments, a pooled neoantigen expression library is used to introduce the neoantigen minigenes into the APCs. Following transfection or transduction of the pooled neoantigen expression library into APCs, the APCs are then individually sorted into separate locations, such as separate wells in a multi-well plate, for subsequent incubation with the TCR-expressing reporter T cells. In some embodiments, each neoantigen expression vector in the neoantigen expression library is independently introduced into the APCs in separate locations, such as separate wells in a multi-well plate, for subsequent incubation with the TCR- expressing reporter T cells.

[0026] In some embodiments, the neoantigen vectors and / or tandem minigene vectors are introduced into antigen presenting cells (APCs) expressing one or more HLA alleles. The HLA alleles include, but are not limited to, HLA-A, HLA-B, and HLA-C. The APCs can express one or two alleles of each of HLA-A, HLA-B, and / or HLA-C. If the APC expresses two alleles of HLA-A, HLA-B, and / or HLA-C, the two alleles can independently be the same or different for each of HLA-A, HLA-B, and HLA-C. In some embodiments, the HLA alleles expressed by the APC are matched to the subject. In some embodiments, the neoantigen vectors and / or tandem minigene vectors are introduced into first APCs expressing a first set of HLA-A, HLA- B, and HLA-C alleles and second APCs expressing a second set of HLA-A, HLA-B, and HLA- C alleles. Each of the HLA-A, HLA-B, and HLA-C alleles in the first APCs and second APCs can independently be the same or different. In some embodiments, the first and second sets of HLA-A, HLA-B, and HLA-C alleles expressed by the first and second APCs combined are matched to the HLA genotype of the subject, such that together the first and second APCsexpress the same set of HLA-A, HLA-B, and HLA-C alleles as the subject. The APCs can be, but are not limited to, B-lymphoblastoid cells (B-LCLs) or artificial APCs. An artificial APC (aAPC) can be, but is not limited to, a K562 cell expressing an MHC molecule. In some embodiments, the APCs are transfected or transduced by one or more vectors, such as a one or more lentiviral vectors, encoding the desired heterologous HLA-A, HLA-B, and / or HLA-C alleles. In some embodiments, the APC does not express an endogenous HLA. In some embodiments, the APC is modified to knock out an endogenous HLA prior to inserting one or more heterologous HLA alleles.

[0027] APCs expressing HLA genes matched to the subject can be obtained from a library of APCs expressing combinations of HLA-A, HLA-B, and HLA-C alleles. APCs expressing HLA genes matched to the subject can also be obtained by transducing APCs with one or more lentiviral vectors encoding HLA-A, HLA-B, and HLA-C alleles. APCs expressing HLA genes matched to the subject can also be obtained by transducing APCs expressing one HLA allele (e.g., an HLA-A allele) with one or more lentiviral vectors encoding the other HLA alleles (e.g., HLA-B and HLA-C alleles). The lentiviral vectors can be from a library of lentiviral vectors encoding HLA-A, HLA-B, and / or HLA-C alleles. The lentiviral vectors can each encode an individual HLA-A, HLA-B, or HLA-C allele, a combination of two HLA alleles (e.g., two HLA-A alleles or an HLA-B and an HLA-C allele), or a combination of three HLA alleles. In some embodiments, the lentiviral vectors encode two HLA alleles. The two HLA alleles can be, but are not limited to, an HLA-B allele and an HLA-C allele (i.e., an HLA- B / HLA-C combination). In some embodiments, APCs expressing HLA genes matched to the subject are obtained by selecting APCs expressing the HLA-A alleles matched to the subject from a library of APCs each expressing one or two HLA-A alleles, and transducing the HLA- A matched APCs with a one or more lentiviral vectors encoding HLA-B and HLA-C alleles matched to the subject. In some embodiments, APCs expressing HLA genes matched to the subject are obtained by selecting and transducing the APCs with a one or more lentiviral vectors encoding HLA-A, HLA-B and HLA-C alleles matched to the subject.

[0028] Contacting the library of functional TCR-expressing reporter T cells with one or more APCs of the library of neoantigen-expressing APCs comprises combining one or more TCR- expressing reporter T cells from the library of functional TCR-expressing reporter T cells with one or more APCs from the library of neoantigen-expressing APCs under conditions suitable for activation of a T cell by binding of a TCR to a cognate antigen. In some embodiments, the TCR-expressing reporter T cells are incubated with one or more immune effector cytokines prior to contacting the TCR-expressing reporter T cells with the APCs. In some embodiments,TCR-expressing reporter T cells expressing each TCR are incubated, in separate locations (e.g., separate wells of a multi-well plate), with APCs expressing each of the neoantigen minigenes and / or tandem minigenes, such that each TCR is tested in combination with each of the neoantigens or tandem neoantigens. In some embodiments, a subset of the library of functional TCR-expressing reporter T cells is combined with a subset of the library of neoantigen- expressing APCs. In some embodiments, the library of functional TCR-expressing reporter T cells is combined with a subset of the library of neoantigen-expressing APCs, such that each TCR is tested in combination with a subset of the neoantigens or tandem neoantigens. In some embodiments, a subset of the library of functional TCR-expressing reporter T cells is combined with the library of neoantigen-expressing APCs, such that subset of the TCRs is tested in combination with each of the neoantigens or tandem neoantigens. If each neoantigen expression vector or tandem minigene expression vector is introduced into first APCs expressing a first set of HLA-A, HLA-B, and HLA-C alleles and second APCs expressing a second set of HLA-A, HLA-B, and HLA-C alleles, then the TCR-expressing reporter T cells can be combined with the first and second APCs together or separately.

[0029] The methods described herein can be multiplexed. Reporter T cells (or reporter T cell lines) expressing 1-5, 1-10, 1-20, 1-50, or 1-100 different or more TCRs can be pooled to provide a pool of reporter T cells (or reporter T cell lines). Neoantigen-expressing APCs (or neoantigen-expressing APC cell lines) expressing 1-20 or more different neoantigen expression vectors (including minigenes and / or tandem minigenes) can be pooled to provide a pool of neoantigen-expressing APCs (or neoantigen-expressing APC cell lines). A pool of reporter T cells can contain a plurality of T cells expressing each of the different TCRs. A pool of neoantigen-expressing APCs can contain a plurality of neoantigen-expressing APCs expressing each of the different neoantigen expression vectors. In any of the described methods, a pool of reporter T cells can be contacted with the neoantigen-expressing APCs. In any of the described methods, the reporter T cells can be contacted with a pool of neoantigen- expressing APCs. In any of the described methods, a pool of reporter T cells can be contacted with a pool of neoantigen-expressing APCs. In some embodiments, one or more pools of reporter T cells wherein each pool of reporter T cells expresses 1-100 different TCRs is contacted a one or more pools of neoantigen-expressing APCs wherein each pool of neoantigen-expressing APCs expresses 1-20 different neoantigen expression vectors.

[0030] In some embodiments, following detection of signal in a multiplex sample (wherein at least one of the pooled reporter T cells is activated by at least one of the APCs), the multiplex sample is deconvoluted. In some embodiments, deconvolution of a multiplex sample comprisesindividually contacting each of the reporter T cells in the pooled reporter T cells with the pooled APCs or each of the APCs in the pooled APCs and identifying the reporter T cell that is activated in a second round of detecting. Deconvolution of a multiplex sample may also comprise a second round of contacting the reporter T cells with the APCs, wherein the pool of reporter T cells is divided into two or more smaller pools of reporter T cells. Additional rounds of deconvolution can be performed until a single TCR is identified. Deconvolution can also be performed to identify the APC that activated the T cell and / or the antigen expressed by the APC that activated the T cell.

[0031] In some embodiments, the reporter T cells in a pool of reporter T cells contain distinguishable detectable markers such that activation of a reporter T cell expressing one TCR is distinguishable from activation of reporter T cells expressing a different TCR. All of the reporter T cells in the pool of reporter T cells that express the same TCR will contain the same detectable marker. In some embodiments, each reporter T cell in a pool of reporter T cells contains a detectable marker that is distinguishable from the detectable markers contained in T cells in the pool of reporter T cells that express a different TCR. By using distinguishable detectable markers, the identification of the activated T cells in the pool of reporter T cells can be determined by identification of the distinguishable detectable marker.

[0032] Detecting an activated TCR-expressing reporter T cell following incubation with a neoantigen-expressing APC can be done use methods available in the art for such detection. In some embodiments, identifying an activated T cell comprises detecting a cell surface marker, such as by flow cytometry. In some embodiments, the identifying an activated T cell comprises detecting a signal, such as fluorescence, from a fluorescent protein whose expression is induced by activation of the T cell.

[0033] In some embodiments, any of the described methods further comprise determining whether the TCR binds to the wild-type version of the neoantigen.

[0034] Described are methods for identifying one or more T cell receptors (TCRs) or antigen- binding fragments thereof that bind to one or more antigens from a pathogen, an allergen, or a protein or epitope associated with a cell or tissue that is a target of an autoimmune disorder, the methods comprising: (a) generating a library of functional TCR-expressing reporter T cells by introducing a plurality of nucleic acid molecules, each comprising a nucleic acid encoding a functional TCR, or antigen-binding fragments thereof, from a plurality of T cells obtained from a biological sample from a subject infected with the pathogen, into a plurality of reporter T cells, wherein the TCR-expressing reporter T cell is activated and provides a detectable signal if the TCR-expressing reporter T cell contacts an antigen presenting cell expressing an antigento which the TCR binds; (b) cloning one or more candidate antigens or fragments thereof of the pathogen, the allergen, or the protein or fragment thereof associated with a cell of tissue that is a target of the autoimmune disorder into one or more antigen expression vectors to form an candidate antigen expression library, wherein each candidate antigen expression vector encodes one or more candidate antigens or fragments thereof; (c) generating a library of candidate antigen-presenting cells (APCs) by introducing the one or more candidate antigen expression vectors into a plurality of APCs capable of expressing the one or more candidate antigens or fragments thereof complexed with a major histocompatibility complex (MHC) molecule; (d) contacting the library of functional TCR-expressing reporter T cells with one or more APCs of the library of APCs; (e) identifying any activated TCR-expressing reporter T cells based on detection of the detectable signal; wherein the one or more TCRs or antigen- binding fragments thereof that bind the one or more candidate antigens is expressed by the any activated TCR-expressing reporter T cells. In some embodiments, the TCR-expressing reporter T cells are incubated with one or more immune effector cytokines prior to contacting the TCR- expressing reporter T cells with the APCs. In some embodiments, a nucleic acid encoding the TCR can be isolated from the activated TCR-expressing reporter T cell. In some embodiments, a nucleic acid sequence encoding a TCR, or an antigen-binding fragment thereof, can be isolated or identified from the activated TCR-expressing reporter T cell.

[0035] In some embodiments, one iteration of the method is capable of employing a library of TCR-expressing reporter T cell that comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 TCR-expressing reporter T cells. In some embodiments, one iteration of the method is capable of employing at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 candidate tumor neoantigens or fragments thereof. In some embodiments, one iteration of the method is capable of employing a plurality of tandem minigene vectors that encode at least 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 neoantigen minigenes. In some embodiments, one iteration of the method is capable of employing a library of APCs that comprises at least 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 APCs. In some embodiments, the TCR or antigen-binding fragment thereof that binds to a tumor neoantigen is identified within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks or 1 week. In some embodiments, one iteration of the method is completed within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks or 1 week.

[0036] In some embodiments, following detection of signal in a multiplex assay, an activated cell is detected and sorted using cell sorting. The identify of the TCR can then be determinedby sequencing the TCR from the single activated cell.

[0037] In some embodiments, the APC contains a detectable marker that provides a detectable signal when bound by a reporter T cell. The APC detectable marker can be used to facilitate identification of the particular APC that activates the reporter T cell when pooled APCs are used.

[0038] In some embodiments, provided herein is an engineered cell comprising any of the TCRs or antigen-binding fragments thereof provided herein, or any of the polynucleotides or any of the vectors encoding the TCRs provided herein. The engineered cell can be, but is not limited to, an engineered T cell. The engineered T cell can be expanded and used in T cell therapy.

[0039] In some embodiments, any TCRs identified using the methods described herein, or a nucleic acid encoding the TCR, can be used to generate an engineered T cell useful in the treatment of a condition in the subject that is amendable to T cell therapy. The condition can be, but is not limited to, cancer, infection, or autoimmune disease.

[0040] In some embodiments, systems are described for identifying TCRs or antigen-binding fragments thereof that bind to tumor neoantigens. The systems comprise: (a) a first device comprising a plurality of locations, each location comprising a TCR-expressing reporter T cell; (b) a computer or computer program for identifying candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from a subject to the corresponding genomic DNA sequences of non-tumor cells from the subject; (c) a second device comprising a plurality of locations, each location comprising an APC comprising one of a plurality of neoantigen expression vectors each encoding one or more of the candidate tumor neoantigens or fragments thereof, wherein the APC expresses the one or more candidate tumor neoantigens or fragments thereof complexed with a major histocompatibility complex (MHC) molecule; (d) a third device or means for contacting one or more cells in a location of the first device with one or more cells in a location of the second device; and (e) a fourth device or means for detecting a signal generated by the TCR-expressing reporter T cell if the TCR- expressing reporter T cell is activated. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] FIG. 1 shows a schematic illustrating an exemplary computational neoantigen discovery pipeline, generally as described in detail in Example 1. Sequencing data from tumor and non-tumor DNA, and tumor RNA, was used as input. Data was aligned to a reference genome and used to identify tumor-specific, non-synonymous mutations, i.e., neoantigens.Identified neoantigens were used for in silico construction of neoantigen minigenes. Candidate neoantigen minigenes were ranked based on multiple criteria, including MHC binding predictions and tumor expression levels.

[0042] FIG. 2 shows a processed melanoma tumor sample and flow cytometry plots illustrating parameters for sorting and isolating tumor infiltrating lymphocytes (TILs) from the sample. 192 individual TILs with a CD8+ CD69hi PD1hi phenotype were isolated from the tumor sample.

[0043] FIG. 3 shows a schematic illustrating an exemplary tandem minigene (TMG) polypeptide (with ubiquitin) for expression in antigen presenting cells. The TMG polypeptide includes a modified N-terminal ubiquitin moiety, with the mutation G76V to prevent cleavage. The “non-cleavable” ubiquitin moiety promotes proteasomal degradation of the polypeptide to maximize presentation of processed neoantigens on MHC I. Spacer sequences separating the ubiquitin moiety and each of the neoantigen minigenes were designed to promote efficient epitope processing. Each neoantigen in the polypeptide typically comprised a 25 amino acid (AA) sequence, containing an identified single-nucleotide variant (SNV) and 12 amino acids upstream and downstream of the SNV.

[0044] FIG. 4 shows a schematic of seamless cloning of antigen expression vector. Gene block encoding the antigen (e.g., TMG) were cloned by Gibson assembly into lentiviral vectors for expression of the TMGs.

[0045] FIG. 5 Flow cytometry data showing results from screening of TCRs against candidate neoantigens, using Jurkat TCR-expressing reporter cell lines cultured with candidate APCs expressing TMGs, as described in Example 6. EV indicates empty vector (no TMG expressed). Each column represents a reporter cell line with a different TCR. TCR-expressing reporter cell lines were assessed by flow cytometry for TCR activation based on upregulation of CD69 and GFP expressed from a NFAT-GFP reporter transgene. Asterisks indicate conditions with TCR activation.

[0046] FIG.6. Flow cytometry data for TCR-A, TCR-C, and TCR-D showing reactivity in the presence of TMG-03-05 or a corresponding unmutated “wildtype” (WT) sequence 03 peptide (TMG-03WT-05) or 05 peptide (TMG-03-05WT). Percentages are CD69+GFP+cells.

[0047] FIG. 7. Flow cytometry data for (a) TCR-B showing reactivity in the presence of TMG-01-10 or a corresponding unmutated “wildtype” (WT) sequence 01 peptide (TMG- 01WT-10) or 10 peptide (TMG-01-10WT), (b) TCR-E showing reactivity in the presence of TMG-07-09 or a corresponding unmutated “wildtype” (WT) sequence 07 peptide (TMG- 07WT-09) or 09 peptide (TMG-07-09WT), and (c) TCR-H showing reactivity in the presenceof TMG-06-08 or a corresponding unmutated “wildtype” (WT) sequence 06 peptide (TMG- 06WT-08) or 08 peptide (TMG-06-08WT). Percentages are CD69+GFP+cells.

[0048] FIG. 8 shows a schematic illustrating an exemplary methods and systems for personalized adoptive cell therapy (ACT) to treat a cancer or a tumor, which includes neoantigen discovery and neoantigen-specific TCR discovery, as described herein and outlined in Example 7.

[0049] FIG.9. Graphs representing MFI for binding of three different anti-RPL18 TCRs to various concentrations of RPL18 KILTFDRL dextramers (darker colors represent lower dextramer concentrations).

[0050] FIG.10. Graphs representing flow cytometry data for binding of three different anti- RPL18 TCRs to two different amounts of RPL18 KILTFDRL dextramers.

[0051] FIG.11. Graphs illustrating expression of anti-RPL18 TCRs relative to transduction percentage and RPL18 KILTFDRL affinities for anti-RPL18 TCRs.

[0052] FIG.12. Graph illustrating relative expression of TCR MFI and RPL18-KILTFDRL dextramer binding compared to A09.

[0053] FIG.13A. Graphs illustrating CD8+and CD4+stained cells expressing RPL18- specific TCRs A09, I20, I02, OVA-specific TCR OT1, and an untransduced control (top) and representative TCR and RPL18-dex staining of CD8+cells (bottom).

[0054] FIG.13B. Graphs illustrating killing of MC38 tumor cells and RPL18-peptide pulsed B6WT3 cells.

[0055] FIG.13C. Graphs illustrating killing of MC38 tumor cells and RPL18-peptide pulsed B6WT3 cells.

[0056] FIG.14. Graphs illustrating tumor regression in mice treating with RPL18-specific engineered T cells.

[0057] FIG.15. Graphs illustrating tumor regression in mice treating with RPL18-specific engineered T cells. DETAILED DESCRIPTION

[0058] Described herein are methods of identifying tumor-related neoantigens and forming neoantigen minigene libraries containing nucleic acids for expressing the neoantigens in antigen presenting cells (APCs). The neoantigen minigene libraries can be used in the identification of T cell receptors (TCRs) that bind to the tumor neoantigens, i.e., to identify tumor neoantigen-specific TCRs. The described methods can be used to identify tumor neoantigens from an individual tumor, such as a tumor from a particular subject having a tumoror a cancer. The neoantigens from the particular subject (or APCs expressing the neoantigens) can be used to identify TCRs from the same subject or a donor subject that are specific for the neoantigens. Also described are nucleic acids (e.g., neoantigen minigenes, neoantigen tandem minigenes (TMGs), neoantigen minigene vectors, neoantigen TMG vectors, neoantigen minigene vector libraries, and neoantigen TMG vector libraries) and APCs expressing the neoantigen minigenes. Methods of forming the minigenes, neoantigen TMGs, neoantigen minigene vectors, neoantigen TMG vectors, neoantigen minigene vector libraries, neoantigen TMG vector libraries, and APCs expressing the neoantigen minigenes are further described. The present disclosure also relates to systems for use in or performing the methods, nucleic acids encoding such TCRs and neoantigens, engineered cells comprising such TCRs, methods of isolating and identifying such TCRs and neoantigens, and uses thereof, for example, therapeutic uses such as adoptive cell therapy.

[0059] Adoptive cell therapies (ACTs; including those involving the administration of cells expressing recombinant TCRs specific for a particular target antigen or epitope associated with a disease or disorder, such as a cancer or a tumor), as well as other adoptive immune cell and adoptive T cell therapies can be effective in the treatment of diseases and disorders. In some contexts, identification of functional TCRs that can recognize an antigen that is only expressed in a particular subject’s tumor and not expressed on normal, non-tumorous or non-cancerous cells, can be time consuming and costly, and low-frequency TCRs can be difficult to identify. The provided methods, nucleic acids (neoantigen minigenes and TMGs), nucleic acid libraries, and APCs expressing the nucleic acids can be used to reduce that time, cost, and complexity of identifying and / or cloning TCRs that recognize a tumor antigen in a subject.

[0060] Describe are methods and systems for generation of a library of APCs expressing candidate tumor neoantigens. The library of APCs expressing various candidate tumor neoantigens can be screened against a library of T cells expressing TCRs to rapidly identify functional TCRs that can specifically bind and recognize a patient-specific tumor neoantigen in a massively parallel manner. A schematic of exemplary methods and systems described herein, involving personalized adoptive cell therapy (ACT) to treat a cancer or a tumor, which includes neoantigen discovery (e.g., using a library of tumor neoantigen-expressing cells) and neoantigen-specific TCR discovery (e.g., using a library of functional TCR-expressing cells), is shown in FIG.1. In some embodiments, one or more steps of the methods can be automated. In some embodiments, the identified and isolated TCRs targeting patient-specific tumor neoantigens can be used to engineer autologous or heterologous cells, for use in adoptive cell therapy (ACT), for treatment of the tumor or cancer.

[0061] Using the described methods and compositions, TCRs with a particular desired function, for example, recognizing and targeting one or more tumor neoantigens in a particular subject, can be identified in a relatively short amount of time and in a cost-efficient manner. Further, the neoantigen minigene and TMP libraries, can be used to identify low frequency patient-specific TCRs for use in therapy. The provided embodiments can be used for personalized and customized therapy. In some embodiments, the described methods can be used to identify TCRs that recognize shared tumor antigens, wherein the shared tumor antigens are presented in the context of a specific HLA allele. Identification of a TCR that recognizes a shared tumor antigen in the context of a specific HLA allele can be used in the treatment of subjects having the shared tumor antigen and the specific HLA allele. Also described are methods of identifying TCRs, or antigen-binding fragments thereof, that bind to antigens associated with an infection, an allergy, or an autoimmune disorder. The methods comprise, identifying candidate antigens associated with the infection, the allergy, or the autoimmune disorder and forming candidate antigen expression vectors or candidate antigen-expressing libraries containing nucleic acids for expressing the candidate antigens in antigen presenting cells (APCs). A candidate antigen can be, but are not limited to, a pathogen protein or fragment thereof (e.g., viral or bacterial proteins), an allergen protein or fragment thereof, or a protein or fragment thereof associated with a cell or tissue that is a target of the autoimmune disorder. The candidate antigen vector or libraries can be used in the identification of T cell receptors (TCRs) that bind to the candidate antigens. The described methods can be used to identify antigens TCRs that bind to the antigens. In some embodiments, an antigen from a particular subject (or an APC expressing the antigen) can be used to identify TCRs from the same subject that are specific for the antigen. The candidate antigen expression vectors, and candidate antigen expressing APCs, or libraries thereof, can be made using similar methods as described for making tumor neoantigen expression vectors and libraries.

[0062] The described methods can also be used to identify antigens that are presented to the immune system in the context of HLA. Identification of a TCR that is activated by an APC expressing an antigen indicates the antigen is presented to the T cell in the context of HLA.

[0063] All publications, including patent documents, scientific articles, and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that isincorporated herein by reference.

[0064] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. I. Tumor Neoantigens

[0065] In some embodiments, the provided embodiments involve identifying a tumor- or a cancer-associated antigen, such as a tumor neoantigen. The tumor neoantigen can be, but is not limited to, an antigen that is expressed in a tumor from a particular subject, such as a patient- specific tumor neoantigen. A tumor neoantigen can comprises a full-length protein or a fragment thereof containing, for example, a mutant amino acid, insertion, or deletion. In some embodiments, the tumor neoantigen comprises an epitope (e.g., a neoepitope or tumor neoepitope). In some embodiments, the peptide epitope can be presented complexed with a major histocompatibility complex (MHC) on the surface of an antigen presenting cell (APC), for recognition by a T cell receptor (TCR) or TCR-expressing cell. In some embodiments, a neoantigen contains an amino acid mutation (substitution, deletion, and / or insertion) relative to the corresponding peptide from normal, non-cancerous or non-tumorous cells or tissue in the subject or from a control subject that does not have cancer. In some embodiments, a neoantigen is expressed at a higher level in cancerous tissue relative to expression of the corresponding peptide from normal, non-cancerous or non-tumorous cells or tissue in the subject or a control subject that does not have cancer. In some embodiments, the expression of neoantigen promotes cancer growth.

[0066] In some embodiments, tumor neoantigens (or candidate tumor neoantigens) are identified using computational methods based on sequencing of samples from a subject. In some embodiments, the described computational methods comprise comparing DNA and / or RNA sequences or expression levels identified in a tumor sample from the subject with DNA and / or RNA sequences or expression levels identified in a non-tumor sample obtained from the same subject or from a control sample from a subject that does not have a tumor or cancer.

[0067] In some embodiments, the neoantigen is an antigen involved in the tumor or cancer, or a disease associated with malignancy or transformation of cells. In some embodiments, the neoantigen is an intracellular protein antigen from a tumor or cancer cell. In some embodiments, the neoantigen is a tumor-associated antigen, and / or an antigen derived from a viral pathogen or a bacterial pathogen that is associated with a tumor or a cancer. In some embodiments, a tumor or cancer neoantigen is an antigen that can be found on a malignant cell, found inside a malignant cell or is a mediator of tumor cell growth. In some embodiments, atumor or cancer neoantigen is one that is predominantly expressed by a tumor cell or cancer cell compared to normal, non-cancerous or non-tumorous cells or tissue in the subject or a control subject that does not have cancer. In some embodiments, a tumor or cancer neoantigen is overexpressed in the subject’s tumor, compared to normal, non-cancerous or non-tumorous cells or tissue in the subject or a control subject that does not have cancer. In some embodiments, the neoantigen is a viral-associated cancer antigen. The described methods are able to identify and screen viral or cancer antigens derived from intracellular proteins that can only be targeted at the cell surface in the context of an MHC molecule by a TCR. In some embodiments, tumor antigens include, but are not limited to, mutated peptides, differentiation antigens, and overexpressed antigens, all of which could serve as targets for immune therapies, such as, but not limited to, ACT.

[0068] In some embodiments, a neoantigen polypeptide binds or is predicted to bind MHC with an IC50 or Kd value of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM.

[0069] In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide about 8 to about 15 amino acids in length. In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide about 8, 9, 10, 11, 12, 13, 14, or 15 amino acids in length. In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide about 8 to about 11 amino acids in length. In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide about 8 to about 25 amino acids in length. In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide that, in its native protein context contains or is located near a sequence motif that promotes proteasome cleavage, or a sequence motif that promotes Transporter Associated With Antigen Processing (TAP) transport. In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide that, in its native protein context contains or is located near a sequence motif that promotes cleavage by extracellular or lysosomal proteases (e.g., cathepsins). In some embodiments, a neoantigen that binds to MHC Class I is a polypeptide that, in its native protein context contains or is located near a sequence motif that promotes HLA-DM catalyzed HLA binding.

[0070] In some embodiments, the neoantigen or a peptide epitope thereof (e.g., neoepitope) is presented on the surface of a tumor. The neoantigen can be immunogenic in a subject having a tumor, e.g., capable of eliciting a T-cell response or a B cell response in the subject. Thepeptide epitope of a tumor neoantigen can be about 5 to about 30 amino acids or longer in length. In some embodiments, the peptide epitope of a tumor neoantigen is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length.

[0071] In some embodiments, the neoantigen or a peptide epitope thereof (e.g., neoepitope) is presented on an HLA protein. In some embodiments, the neoantigen or neoepitope binds an HLA molecule with greater affinity than the corresponding peptide identified from the normal, non-cancerous tissue or cells. In some embodiments, the neoantigen or neoepitope binds to the HLA protein with an IC50 of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM.

[0072] In some embodiments, the neoantigen or neoepitope is identified using any of the methods described herein. In some embodiments, the neoantigen or neoepitope is identified using other known sources, such as the Catalogue of Somatic Mutations in Cancer (COSMIC) database, which curates comprehensive information on somatic mutations in human cancer.

[0073] A neoantigen (including any of the neoantigen identified herein or identified using the methods described herein) can be encoded by a polynucleotide. The polynucleotide can be, but is not limited to, a DNA, a cDNA, a PNA, a CNA, or an RNA (e.g., mRNA). The polynucleotide can be single-stranded or double-stranded.

[0074] In some embodiments, genetic mutations in tumors can be considered useful for the immunological targeting of tumors if they lead to changes in the amino acid sequence of a protein exclusively in the tumor. Exemplary mutations that can give rise to tumor neoantigens include: (1) non-synonymous mutations leading to different amino acids in the protein; (2) read-through mutations in which a stop codon is modified or deleted, leading to translation of a longer protein with a novel tumor-specific sequence at the C-terminus; (3) splice site mutations that lead to the inclusion of an intron in the mature mRNA and thus a unique tumor- specific protein sequence; (4) chromosomal rearrangements that give rise to a chimeric protein with tumor-specific sequences at the junction of 2 proteins (i.e., gene fusion); and (5) frameshift mutations or deletions that lead to a new open reading frame with a novel tumor-specific protein sequence. Mutations can also include one or more of non-frameshift indel, missense or nonsense substitution, splice site alteration, genomic rearrangement, or gene fusion, or any genomic or expression alteration giving rise to a neoORF.

[0075] In some embodiments, neoantigens or epitopes thereof (e.g., neoepitopes), such as peptides with mutations or mutated polypeptides arising from for example, splice-site, frameshift, read-through, or gene fusion mutations in tumor cells are identified by sequencingDNA, RNA, or protein in tumor versus normal cells.

[0076] In some embodiments, a variety of methods can be used for detecting the presence of a particular mutation or allele in an individual's DNA or RNA. In some embodiments, methods for accurate, easy, and inexpensive large-scale SNP genotyping can be used. For example, several techniques have been described including dynamic allele-specific hybridization (DASH), microplate array diagonal gel electrophoresis (MADGE), pyrosequencing, oligonucleotide-specific ligation, the TaqMan system as well as various DNA “chip” technologies such as the Affymetrix SNP chips. These methods utilize amplification of a target genetic region, typically by PCR. In some embodiments additional methods, based on the generation of small signal molecules by invasive cleavage followed by mass spectrometry or immobilized padlock probes and rolling-circle amplification. In some embodiments, types of high-throughput or massively parallel sequencing is used to sequence the DNA and RNA sequences of a tumor sample and a non-tumorous sample from the subject to identify candidate tumor neoantigens or neoepitopes. Exemplary methods for high-throughput sequencing include pyrosequencing, sequencing by reversible terminator chemistry, sequencing by ligation mediated by ligase enzymes, and phospholinked fluorescent nucleotides or real time sequencing. Templates for sequencing may be prepared by any available technique including, for example, emulsion PCR, clonal bridge amplification, and gridded DNA-nanoballs. In some techniques, a single molecule of template is sequenced.

[0077] For identification of peptide epitopes that can be complexed with an MHC molecule and presented, any methods described herein, or any known methods, can be employed, such as a pan-allele / pan-length algorithm Neilsen et al., Genome Med.2016, 8:33. II. Identifying Neoantigens

[0078] Provided herein are methods that involve identification of candidate tumor neoantigens or epitopes of the candidate tumor neoantigens (e.g., candidate tumor neoepitopes). In some embodiments, the methods involve computational or bioinformatics analysis of sequences from a biological sample from a subject, for example a patient that has a tumor or a cancer. The sequences analyzed can be RNA and / or DNA sequences. The RNA and / or DNA sequences can be obtained using various high-throughput sequencing methods. The biological sample can be, but is not limited to, a tumor sample or a non-tumor from a subject. For computational or bioinformatics analysis, the sequences from the tumor sample from the subject are compared to sequences obtained from a normal, non-tumorous sample from the subject or from a control subject that does not have cancer. In some aspects, themethods comprise obtaining DNA and / or RNA sequences from a tumor sample from a subject, and comparing the DNA and / or RNA sequences to corresponding DNA and / or RNA sequences from a normal, non-tumorous sample from the same subject and / or from a control sample from a subject that does not have a tumor or cancer. A. Biological samples

[0079] In some embodiments, one or more biological samples are analyzed to identify candidate tumor neoantigens or tumor neoepitopes. The biological samples can be, but are not limited to, tissues and / or cells, or products thereof. The samples may include a tissue or cell sample obtained directly from a subject. In some embodiments, the sample comprises tissue or cells from a subject and processed, such as by purifying, separating, centrifugating, genetic engineering (e.g., transduction with viral vector), washing, and / or incubating. A tissue sample can be, but is not limited to, a tumor sample, a tumor biopsy sample, or a tissue sample. Cells can be, but are not limited to, tumor cells, tissue cells, normal (non-cancerous) tissue cells, or blood cells. A biological fluid can be, but is not limited to, blood.

[0080] Exemplary samples include, but are not limited to, whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor tissue or cells, leukemia cells, lymphoma cells, lymph node tissue or cells, gut associated lymphoid tissue or cells, mucosa associated lymphoid tissue or cells, spleen tissue or cells, other lymphoid tissue or cells, liver tissue or cells, lung tissue or cells, stomach tissue or cells, intestine tissue or cells, colon tissue or cells, kidney tissue or cells, pancreas tissue or cells, breast tissue or cells, bone tissue or cells, prostate tissue or cells, cervix tissue or cells, testes tissue or cells, ovaries tissue or cells, tonsil tissue or cells, or other organ tissue or cells, and / or cells derived therefrom. The sample can be from cancerous tissue or cells and / or non-cancerous tissue or cells. In some embodiments, the sample is, or is obtained from, a solid tumor. In some embodiments, the sample is, or is obtained from, a blood or a blood-derived sample. The blood or blood derived sample can be, or can be derived from, an apheresis or leukapheresis product. In some embodiments, the non-tumor sample is, or is derived from, peripheral blood mononuclear cells (PBMCs).

[0081] In some embodiments, a first biological sample and a second biological sample are analyzed to identify candidate tumor neoantigens or tumor neoepitopes. The first biological sample comprises a tumor sample obtained from a subject. In some embodiments, the subject is a candidate for cell therapy, such as adoptive cell therapy or alloSCT. The second biological sample comprises a non-tumor (non-cancerous) sample. The second biological sample can be obtained from the subject or a control subject or group of subjects that does (do) not havecancer.

[0082] In some embodiments, the sample comprises nucleic acid (e.g., DNA and / or RNA) derived from the one or more biological samples. B. Computational methods for identifying tumor neoantigens

[0083] Described are methods of identifying neoantigens (e.g., tumor neoantigens or candidate tumor neoantigens) in a subject having a disease or condition (e.g., cancer) amendable to cell therapy such as adoptive cell therapy or alloSCT. The methods comprise comparing genomic DNA sequences and / or RNA sequences and / or expression profiles of tumor cells from the subject with corresponding genomic DNA sequences and / or RNA sequences and / or expression profiles of non-tumor cells from the same subject and / or from a control sample from a subject (or group of subjects) that does not have a tumor or a cancer.

[0084] In some embodiments, the methods comprise computational analyses for identifying candidate mutations (e.g., the variants or alleles that are present in tumor cells). The computational analyses described herein can be used to identify candidate mutations giving rise to tumor neoantigens or tumor neoepitopes. The neoantigens and neoepitopes are present in the genome, transcriptome, proteome, or exome of cancer cells from the subject but not in normal tissue from the subject and / or from a control sample from a control subject that does not have a tumor or a cancer.

[0085] The candidate mutations can be somatic mutations. Somatic mutations giving rise to candidate neoantigens are identified by comparing tumor DNA to non-tumor DNA.

[0086] In some embodiments, sequence variations between tumor samples and non-tumor samples are further analyzed to identify non-synonymous mutations. Non-synonymous mutations result in amino acid sequence changes and are selected for use in further screening (e.g., forming neoantigen minigenes and TMGs). In some embodiments, neoantigens are selected based on cellularity, i.e., mutations found in a high percentage of cells from a particular category or sample (e.g., tumor sample). For example, when greater than 75% of the cells have a particular mutation, the mutation may be selected as a neoantigen.

[0087] In some embodiments, a computational neoantigen discovery pipeline for identifying candidate tumor neoantigens is provided. The computational neoantigen discovery pipeline is employed to identify candidate tumor neoantigens. The pipeline can use as input nucleic acid sequencing data. The sequencing data can be obtained, for example, by whole genome DNA sequencing or exome sequencing of tumor and non-tumor tissue, and RNA sequencing of tumor tissue. In some embodiments, the computational neoantigen discovery pipeline involves one or more steps, modules, programs, or scripts described herein. In some embodiments, aplurality of the steps, modules, programs, or scripts described herein are performed in sequence and / or in parallel for the pipeline. An exemplary computational neoantigen discovery pipeline is depicted in FIG.1A.

[0088] The pipeline can include one or more of the following steps: (a) aligning sequencing data to a reference genome (e.g., HG19 with decoy); (b) aligning RNA sequencing data using Spliced Transcripts Alignment to a Reference (STAR) module (Dobin et al., 2013, Bioinformatics, 29(1), 15–21); (c) aligning DNA sequencing data using a Burrows-Wheeler Aligner (BWA) module (Li and Durbin, 2010, Bioinformatics, 26(5), 589–595); and (d) locally realigning and recalibrating aligned tumor and non-tumor DNA sequences using standard GATK best practices (McKenna et al., 2010, Genome Research, 20(9), 1297–1303).

[0089] In some embodiments, neoantigens encoded by tumor-specific variants are identified. A tumor-specific variant is a mutation that is present in tumor tissue, but not in non-tumor tissue. Tumor-specific variants can be identified using one or more of: Mutect, Mutec2 (Benjamin et al., 2019, BioRxiv, 1–8. https: / / doi.org / 10.1101 / 861054), Somatic Sniper (Larson et al., 2012, Bioinformatics, 28(3), 311–317), VarScan2 (Koboldt et al., 2012, Genome Research, 22(3), 568–576), and Strelka2 (Kim et al., 2018, Nature Methods, 15, 591–594).

[0090] In some embodiments, the neoantigens encoded by non-synonymous variations are identified. Non-synonymous variations are mutations altering the amino acid sequence encoded by a gene. In some embodiments, tumor-specific non-synonymous variations are identified. Non-synonymous variations can be identified using VEP (McLaren et al., 2016, Genome Biology, 17(1), 1–14) and / or SNPeffs (Cingolani et al., 2012, Fly, 6(2), 80–92).

[0091] In some embodiments, subject HLA types are predicted in the pipeline. In some embodiments, prediction of HLA types is performed using Seq2HLA (Boegel et al., 2012, Genome Medicine 4, Article number:102), and OptiType (Szolek et al., 2014, Bioinformatics, 30(23), 3310–3316) module.

[0092] Using the described pipeline, the sequences of one or more neoantigen minigenes or tandem minigenes are constructed in silico. In some embodiments, a neoantigen minigene comprises a polypeptide fragment comprising an amino acid sequence encoding an identified mutation (e.g., a tumor-specific non-synonymous variation) and its surrounding amino acids. Exemplary candidate neoantigen minigenes include those described in Section III herein.

[0093] In some embodiments, the predicted neoantigens are further analyzed for additional characteristics. The further analysis can be, but is not limited to, predicted binding the MHC, predicted binding to particular MHC alleles, expression level, predicted ability to induce an immune response, processing, and self-similarity. The MHC allele can be, but is not limited to,a MHC class 1 allele. In some embodiments, the MHC genotype of the subject is determined and candidate neoantigens or neoepitopes that are predicted to bind to the MHC molecules expressed by the subject are selected. Human subjects carry two alleles of each of the three class-I genes, HLA-A, HLA-B and HLA-C. A human subject can express six different MHC- I alleles. HLA testing can be performed on a sample of blood from the subject, for example, on lymphocytes. HLA typing can be determined, for example, by testing the HLA proteins on the surface of white blood cells or by testing DNA from the same cells using methods typical in the art. MHC binding prediction can be made using NetMHCpan 4.0 and other methods known in the art for prediction MHC binding. (Jurtz et al., 2017, J Immunol 199(9), 3360- 3368; Nielsen and Lund, 2009, BMC Bioinformatics, 10, 296; O’Donnell et al., 2018, Cell Systems 7(1),129-132.E4).

[0094] In some embodiments, binding affinities of the neoepitopes and the MHC molecules are analyzed and neoepitopes that bind to or are predicted to bind to an MHC molecule of the subject with an IC50 or Kd value of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM are selected. Expression level of a candidate neoantigen or neoepitope can be assessed using known methods to assess the expression level of protein or mRNA. For example, methods for measuring expression levels of RNA include northern blotting, RT-qPCR, quantitative PCR on an array, hybridization microarray, serial analysis of gene expression, or high throughput RNA sequencing (RNA-Seq). Predicted likelihood of a candidate neoantigen to elicit an immune response can be done using prediction models available in the art. Methods for measuring expression levels of proteins include Western blot and enzyme-linked immunosorbent assay.

[0095] In some embodiments, neoantigen minigenes are generated for all identified expressed candidate neoantigens. In some embodiments, the identified neoantigen minigenes are ranked. In some embodiments, candidate neoantigens are ranked based on MHC binding predictions. In some embodiments, neoantigens are ranked based on tumor expression levels. In some embodiments, the candidate neoantigens are ranked based on a predicted likelihood of the neoantigen of eliciting an immune response, such as a T cell immune response, in the subject. In some embodiments, neoantigens are ranked based on multiple criteria, including MHC binding predictions and tumor expression levels. Ranking can be used to reduce the number of neoantigens used in the described methods.

[0096] In some embodiments, the pipeline produces one or more outputs, i.e., information or data produced by the pipeline using a provided input. In some embodiments, the outputcomprises a result of any pre-processing or processing steps of the pipeline. For example, the output may comprise aligned sequencing data, one or more identified tumor-specific variants, predicted subject HLA types, tumor-specific gene expression levels, or summary statistics, graphical or non-graphical representations thereof. In some embodiments, the output comprises one or more neoantigen minigenes, which may be provided as an amino acid sequence and / or nucleotide sequence. In some embodiments, the output comprises a ranked list of neoantigen minigenes. III. Assessing Candidate Tumor Neoantigens

[0097] Described are methods of expressing one or more of the candidate tumor neoantigens or neoepitopes, for example as identified based on the methods as described in Section II, in one or more antigen presenting cells (APCs). In some embodiments, the methods involve generating a library (e.g., containing a plurality) of APCs, each expressing one or more candidate tumor neoantigens or neoepitopes. In some embodiments, the candidate tumor neoantigens or neoepitopes are expressed using a neoantigen minigene system or tandem minigene system. In some embodiments, the library of APCs expressing one or more of the candidate tumor neoantigens or neoepitopes can be used to present the antigen to cells expressing a T cell receptor (TCR). APCs expressing the neoantigens can be used to identify TCRs that are specific for a tumor neoantigen or neoepitope from a subject. In some embodiments, the library of APCs can be used to screen a library (e.g., containing a plurality) of TCR-expressing cells. A. Neoantigen minigenes

[0098] Described are neoantigen minigenes. A neoantigen minigene encodes a polypeptide fragment comprising all or a portion of a gene in which a candidate neoantigen is identified, for example, in accordance with the methods as described herein such as in Section II. In some embodiments, a neoantigen minigene encodes all or a portion of a neoantigen or neoepitope. The neoantigen or neoepitope can be any neoantigen or neoepitope identified using any of the described methods for identifying neoantigen or neoepitopes. In some embodiments, a neoantigen minigene encodes a polypeptide comprising an identified mutation (e.g., a mutated amino acid resulting from a tumor-specific non-synonymous variation) and its surrounding amino acids. For example, a neoantigen minigene may encode a polypeptide containing the mutated amino acid and one or more amino acids upstream and / or downstream of the mutated amino acid. In some embodiments, the neoantigen minigene encodes an about 8 to about 30 amino acid peptide containing the mutated amino acid. In some embodiments, the neoantigenminigene encodes an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid peptide containing the mutated amino acid. In some embodiments, the neoantigen minigene encodes the mutated amino acid and about 4 to about 15 amino acids upstream and about 4 to about 15 amino acids downstream. In some embodiments, the neoantigen minigene encodes the mutated amino acid and 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids upstream and 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids downstream. In some embodiments, the neoantigen minigene encodes 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids upstream and downstream of the mutated amino acid. In some embodiments, a neoantigen minigene comprises a 25 amino-acid sequence comprising the mutated amino acid and 12 amino acids upstream and downstream of the mutated amino acid. In some embodiments, a neoantigen minigene is comprised in a vector. The neoantigen minigene vector can be, but is not limited to, a plasmid or a viral vector. The viral vector can be, but is not limited to, a lentiviral vector. The vector can be used to transfect or transduce an APC. The vector can be used to express the neoantigen minigene in an APC.

[0099] In some embodiments, a neoantigen minigene vector further encodes one or more amino acid sequences in addition to the neoantigen minigene. The one or more additional amino acid sequences may serve to enhance processing and / or presentation of the neoantigen on MHC-I when the neoantigen minigene is expressed in an antigen presenting cell. For example, the neoantigen minigene vector may encode a ubiquitin, The ubiquitin can be, but is not limited to, a modified N-terminal ubiquitin moiety having G76V mutation. In some embodiments, the modified ubiquitin moiety promotes proteasomal degradation of the polypeptide to maximize presentation of the neoantigen encoded by the neoantigen minigene on MHC-I. In some embodiments, the neoantigen minigene vector encodes a spacer sequence between an N-terminal ubiquitin moiety and the neoantigen minigene. In some embodiments, the spacer has the amino acid sequence AAY.

[0100] In some embodiments, the neoantigen minigene vector further encodes a marker for identifying or selecting for cells transfected / transduced with the vector. In some embodiments, the marker is a truncated nerve-growth-factor receptor (tNGFR) or a fluorophore (e.g., GFP, RFP, mCherry).

[0101] In some embodiments, a library of neoantigen minigene vectors is provided. A neoantigen minigene vector library comprises a plurality of neoantigen minigene vectors encoding a plurality of neoantigens. A neoantigen minigene library can comprise all (full mutanome), nearly all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60%, or greater than 50%, or a subset of theidentified neoantigens from a tumor or a subject. In some embodiments, a neoantigen minigene library can comprise all, nearly all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60%, or greater than 50%, of a subset of the neoantigens identified using the described computational methods.

[0102] In some embodiments, a neoantigen minigene is generated using synthetic DNA sequences, e.g., gene blocks (gblocks). The gene blocks can be inserted into a viral vector using seamless cloning (e.g., Gibson assembly or NEBuilder HiFi DNA Assembly). The gene blocks are synthesized to encode the antigen of interest (e.g., minigene) and sufficient sequence (e.g., 20-40 nucleotides) overlapping sequences of a vector into which the gene block is to be inserted. B. Tandem minigenes

[0103] Also described are tandem minigenes (TMGs). A TMG is a polynucleotide that encodes two or more neoantigen minigenes. In some embodiments, a TMG encodes two or more neoantigen minigenes in tandem. A tandem minigene vector can encode at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 candidate neoantigens or fragments thereof (including neoepitopes). In some embodiments, the tandem minigene vectors each encode about 2 to about 10 candidate neoantigens or fragments thereof. In some embodiments, the tandem minigene vectors each encodes about 5 to about 10 candidate neoantigens or fragments thereof. The nucleic acid sequences encoding the neoantigen minigenes in the TMG can be consecutive or separated by spacers. In some embodiments, the two or more neoantigens are expression as a fusion polypeptide. In some embodiments, the expressed fusion polypeptide is processed and cleaved into peptide fragments that can each contain an identified candidate neoepitope. A TMG can be up to about 2000 to about 3000 nucleotides in length. In some embodiments, the TMG is comprised in a vector (i.e., TMG vector). The TMG vector can be, but is not limited to, a plasmid (non-viral vector) or a viral vector. The viral vector can be, but is not limited to, a lentiviral vector. The vector can be used to transfect or transduce an APC. The vector can be used to express the TMG in an APC. Schematics of exemplary constructs for TMG are depicted in FIGS.3-4.

[0104] In some embodiments, a TMG further encodes one or more amino acid sequences in addition to the two or more neoantigen minigenes. In some embodiments, the one or more additional amino acid sequences may serve to enhance processing and / or presentation of the neoantigen(s) on MHC-I when the TMG is expressed in an antigen presenting cell. For example, the TMG may encode a ubiquitin. The ubiquitin can be, but is not limited to, a modified N-terminal ubiquitin moiety having a G76V mutation. In some embodiments, thesequence encoding the ubiquitin is located 5′ to the neoantigen minigenes. In some embodiments, the modified ubiquitin moiety promotes proteasomal degradation of the polypeptide to maximize presentation of neoantigens encoded by the TMG on MHC-I.

[0105] In some embodiments, the TMG encodes one or more spacers (i.e., linkers). The spacer comprises an intervening amino acid sequence between elements of the TMG (e.g., between neoantigen minigenes). In some embodiments, the TMG encodes one or more spacer sequences between each of the neoantigen minigenes. In some embodiments, the TMG encodes one or more spacer sequences between an N-terminal ubiquitin moiety and the neoantigen minigenes. In some embodiments, the spacer is designed to promote efficient processing and presentation of the neoantigen minigenes when the TMG is expressed in an APC. The spacers between the neoantigen minigenes and / or between the ubiquitin coding sequence and a neoantigen minigene may be the same or different. The spacers between the neoantigen minigenes or between the ubiquitin coding sequence and a neoantigen minigene may encode the same amino acid sequence or different amino acid sequences. In some embodiments, at least one of the spacers encodes the amino acid sequence AAY. In some embodiments, each of the spacers in a TMG encodes the amino acid sequence AAY.

[0106] In some embodiments, a TMG vector further encodes a marker for identifying or selecting for cells transfected / transduced with the vector. In some embodiments, the marker is a truncated nerve-growth-factor receptor (tNGFR) or a fluorophore (e.g., GFP, RFP, mCherry).

[0107] In some embodiments, a library of TMG vectors is provided. A TMG vector library comprises a plurality of TMG vectors encoding a plurality of neoantigens. A TMG library can comprise all, nearly all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60%, or greater than 50%, or a subset of the identified neoantigen from a subject. In some embodiments, a TMG library can comprise all, nearly all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60%, or greater than 50%, or a subset of the neoantigens identified using the described computational methods. A TMG vector library can contain one or more neoantigen minigene vectors (e.g., vectors encoding a single neoantigen minigene).

[0108] In some embodiments, a TMG is generated using synthetic DNA sequences, e.g., gene blocks (gblocks). The gene blocks can be inserted into a vector using seamless cloning (e.g., Gibson assembly or NEBuilder HiFi DNA Assembly). The gene blocks are synthesized to encode the about 1 to about 10 minigenes of interest with optional spacer sequences and sufficient sequence (e.g., 20-40 nucleotides) overlapping sequences of a vector into which thegene block is to be inserted. C. Cloning of antigen encoding vectors

[0109] In some embodiments, a nucleic acid encoding an antigen (including, but not limited to, a protein, a protein fragment, an antigenic epitope, a neoantigen, a neoantigen epitope, a minigene, or a tandem minigene) is synthesized (e.g., by chemical synthesis (e.g., gene block) or amplification (e.g., PCR)) as a linear nucleic acid containing, at the 5′ and 3′ ends, sequences suitable for use in Gibson cloning into a vector. The sequences suitable for use in Gibson cloning comprise sequences about 20 to about 40 nucleotides in length that overlap with (are complementary to) sequences in the vector into which the nucleic acid encoding the antigen is to be cloned (inserted). The overlapping sequences facilitate seamless (e.g., Gibson) cloning. In some embodiments, the vector into which the nucleic acid encoding an antigen is cloned contains, in order, a promoter, a sequence encoding a ubiquitin (e.g., a G67V ubiquitin), a first 2A element, and a first marker. The first marker can be, but is not limited to, a selectable marker suitable for use in mammalian cells (e.g., APCs). The selectable marker can be, but is not limited to, a resistance gene. The resistance gene can be, but is not limited to, an antibiotic resistance gene. The antibiotic resistance gene can be, but is not limited to, a puromycin resistance gene. The nucleic acid encoding the antigen (e.g., gene block) is configured such that insertion into the vector, between the sequence encoding the ubiquitin and the 2A element, results in the ubiquitin, the antigen, the 2A element, and the first marker being in frame with each other (i.e., each of the ubiquitin, antigen, and first marker are expressed from the promoter). In some embodiments, the vector further comprises a second 2A element and second marker in frame with the first selectable marker. The second marker can be, but is not limited to, a detectable marker that is detectable in mammalian cells. The detectable marker can be, but is not limited to, a cell surface protein (e.g., tNGFR) or a fluorescent protein. In some embodiments, the vector further comprises a posttranscriptional regulatory element downstream of the first and / or second markers. The posttranscriptional regulatory element can be, but is not limited to, a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE). In some embodiments, the vector further comprises a bacterial selectable marker (e.g., an ampicillin resistance gene). In some embodiments, the vector further comprises a ccdB gene located between the ubiquitin sequence and the 2A element. The ccdB gene can be operably linked to an inducible promoter (e.g., LacI).

[0110] To insert the nucleic acid encoding the antigen (e.g., minigene or TMG) into the vector by seamless cloning, the vector is first linearized (either through digestion of a circular plasmid or synthesis (e.g., by PCR) of a linear vector) such that the vector contains a gap (e.g.,double strand break) between the sequence encoding the ubiquitin and the first 2A element. If present, the ccdB gene is removed during linearization of the vector. The nucleic acid encoding the antigen is incubated with the linearized vector, enzymes (e.g., exonuclease, DNA polymerase, and DNA ligase) and other components suitable for performing seamless (e.g., Gibson) cloning. Following seamless cloning, the antigen expressing vectors are transformed into bacteria. In some embodiments, plasmid is isolated from the bacteria without plating or isolating bacterial colonies. In some embodiments, multiple nucleic acids encoding different antigens are cloned into the vector in parallel. In some embodiments, about 1 to about 500 antigen expression vectors are cloned in parallel. In some embodiments, about 1 to about 100 antigen expression vectors are cloned in parallel. In some embodiments, the cloning reaction is performed in about 0.1 to about 500 μL. In some embodiments, the cloning reaction is performed in less than 1 μL. In some embodiments, the cloning reaction is performed in about 0.1 μL, about 0.15 μL, about 0.2 μL, about 0.25 μL, about 0.3 μL, about 0.35 μL, about 0.4 μL, about 0.45 μL, about 0.5 μL, about 0.55 μL, about 0.6 μL, about 0.65 μL, about 0.7 μL, about 0.75 μL, about 0.8 μL, about 0.85 μL, about 0.9 μL, or about 0.95 μL. In some embodiments, the cloning reaction is performed in about 1 to about 50 μL. In some embodiments, the cloning reaction is performed in about 1 μL, about 1.5 μL, about 2 μL, about 2.5 μL, about 3 μL, about 4 μL, about 5 μL, about 6 μL, about 7 μL, about 8 μL, about 9 μL, about 10 μL, about 15 μL, about 20 μL, about 25 μL, about 30 μL, about 40 μL, or about 50 μL.

[0111] If the ccdB gene is present in the original vector, insertion of the nucleic acid encoding the antigen into the vector during cloning replaces the ccdB gene. Loss of the ccdB gene in the vector during cloning of the nucleic acid encoding the antigen can be used as a selection of assembled antigen expression vector in the bacteria. Proper insertion of the nucleic acid encoding the antigen into the vector results in a vector the expresses the ubiquitin, the antigen, the first marker and optionally the second marker in mammalian cells (e.g., APCs).

[0112] Analysis of the nucleic acid sequences from cells of the subject, identification of candidate neoantigens, and preparation of neoantigen expression vectors can be done in about 2 weeks or less. D. Expression of neoantigens in antigen presenting cells

[0113] Described are neoantigen-expressing antigen presenting cells (APCs) and methods of expressing neoantigens in APCs. The methods comprise inserting a one or more of the described neoantigen minigenes, neoantigen minigene vectors, TMGs, or TMG vectors, or a combination thereof, in one or more APCs to provide a library of neoantigen-expressing APCs. The APCs can be any cell line suitable for transfection or transduction, expression of theneoantigen minigenes and / or TMGs, and presentation of processed neoantigens for TCR activation (via MHC / HLA). The APC can be, but is not limited to, a lymphoblastoid cell line cell (LCL). In some embodiments the APC expresses one or more HLAs. The HLAs can be, but are not limited to, HLA-A, HLA-B, and HLA-C. In some embodiments the APC is HLA matched to a subject.

[0114] Any suitable means of introducing a neoantigen minigene or TMGs into an APC that results in expression of the neoantigen minigenes and TMGs in the APC can be used. Various method of introducing nucleic acids and nucleic acid vectors into cells are known in the art. These methods include nonviral and viral methods. Nonviral methods include, but are not limited to: electroporation (see, e.g., Chicaybam et al, (2013) PLoS ONE 8(3): e60298 and Van Tedeloo et al. (2000) Gene Therapy 7(16): 1431-1437), transposition (see, e.g., Manuri et al. (2010) Hum Gene Ther 21(4): 427-437; Sharma et al. (2013) Molec Ther Nucl Acids 2, e74; and Huang et al. (2009) Methods Mol Biol 506: 115-126) calcium phosphate transfection (see, e.g., Current Protocols in Molecular Biology, John Wiley & Sons, New York. N.Y.), protoplast fusion, cationic liposome-mediated transfection (lipofection), tungsten particle-facilitated microparticle bombardment (see, e.g., Johnston, Nature, 346: 776-777 (1990)), and strontium phosphate DNA co-precipitation (see, e.g., Brash et al., Mol. Cell Biol., 7: 2031-2034 (1987)). Viral vectors include, but are not limited to: retroviral vectors (e.g., Moloney murine leukemia virus (MoMLV), myeloproliferative sarcoma virus (MPSV), murine embryonic stem cell virus (MESV), murine stem cell virus (MSCV), or spleen focus forming virus (SFFV), and lentivirus (see, e.g., U.S. Pat. Nos. 5,219,740, 6,207,453, and 5,219,740; Miller and Rosman (1989) BioTechniques 7:980-990; Miller, A. D. (1990) Human Gene Therapy 1:5-14; Scarpa et al. (1991) Virology 180:849-852; Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037; and Boris-Lawrie and Temin (1993) Cur. Opin. Genet. Develop. 3:102-109)). Lentiviral transduction is described in, e.g., Wang et al. (2012) J. Immunother.35(9): 689-701; Cooper et al. (2003) Blood.101:1637–1644; Verhoeyen et al. (2009) Methods Mol Biol.506: 97-114; and Cavalieri et al. (2003) Blood.102(2): 497-505.

[0115] In some embodiments, an APC is transfected or transduced with a vector encoding the neoantigen minigene or TMG. In some embodiments, a plurality of APCs are transfected or transduced with the neoantigen minigene vector library or the TMG vector library. In some embodiments, transfected / transduced APCs are selected for, or enriched, based on expression of a marker encoded by the neoantigen minigene or TMG vector. In some embodiments, enrichment of transfected / transduced APCs is performed by FACS.

[0116] Introduction of a neoantigen minigene or TMG vector into an APC results inexpression of a neoantigen or neoantigens in the APC. In some embodiments, an encoded neoantigen is processed by the APC. Processing can include, for example, cleavage by components of the proteasome and / or complexation with an MHC molecule and presentation on the cell surface of the APC. In some embodiments, an encoded TMG is processed by the APC. Processing can include, for example, cleavage of the encoded TMG polypeptide by components of the proteasome into the two or more neoepitopes, which can then be complexed with or loaded onto MHC molecules to be presented on the cell surface of the APC.

[0117] In some embodiments, an APC is transfected or transduced with a vector encoding one or more proteins or protein fragments from a pathogen, an allergen, or an anti-immune- related protein. In some embodiments, a plurality of APCs are transfected or transduced with the one or more proteins or protein fragments. Introduction of the vector into an APC results in expression of a the one or more proteins or protein fragments in the APC. In some embodiments, an encoded encoding one or more proteins or protein fragments is processed by the APC. Processing can include, for example, cleavage by components of the proteasome and / or complexation with an MHC molecule and presentation on the cell surface of the APC.

[0118] The MHC molecule can be an MHC class I or an MHC class II molecule. MHC class I molecules are heterodimers having a membrane spanning α chain, in some cases with three α domains, and a non-covalently associated β2 microglobulin. The MHC class I molecule is a heterodimer composed of a 46-kDa heavy chain which is non-covalently associated with the 12-kDa light chain β-2 microglobulin. In humans, there are several MHC alleles. The MHC alleles include, but are not limited to, HLA-A2, HLA-A1, HLA-A3, HLA-A24, HLA-A28, HLA-A31, HLA-A33, HLA-A34, HLA-B7, HLA-B45 and HLA-Cw8. The sequences of MHC alleles are known and can be found, for example, at the IMGT / HLA database available from EMBL-EBI (IPD-IMGT / HLA). In some embodiments, the MHC Class I molecule is an HLA- A2 molecule. The HLA-A2 molecule can be, but is not limited to, subtype HLA-A*02:01, *02:02, *02:03, *02:06, or *02:07. MHC subtype frequency can vary between different populations. For example, more than 95% of the HLA-A2 positive Caucasian population is HLA-A*02:01. The Chinese population has been reported to be approximately 23% HLA- A*02:01, 45% HLA-A*02:07, 8% HLA-A*02:06, and 23% HLA-A*02:03. In some embodiments, the MHC molecule is HLA-A*02:01. Generally, MHC class II molecules are composed of two transmembrane glycoproteins, α and β, both of which typically span the membrane. An MHC molecule can include an effective portion of an MHC that contains an antigen binding site or sites for binding a peptide and the sequences necessary for recognition by the appropriate binding molecule, such as TCR. In some embodiments, MHC class Imolecules deliver peptides originating in the cytosol to the cell surface, where a peptide:MHC complex is recognized by T cells, such as generally CD8+T cells, but in some cases CD4+ T cells. In some embodiments, MHC class II molecules deliver peptides originating in the vesicular system to the cell surface, where they are typically recognized by CD4+T cells. Generally, MHC molecules are encoded by a group of linked loci, which are collectively termed H-2 in the mouse and human leukocyte antigen (HLA) in humans. In some embodiments, human MHC can also be referred to as human leukocyte antigen (HLA).

[0119] MHC-class I restricted peptides are typically 8 to 15 amino acids in length, such as 8, 9, 10, or 11 amino acids in length. In some embodiments, MHC class I molecules bind peptides derived from endogenous antigens, such as tumor, viral or bacterial proteins produced within a diseased or infected cell, which have been processed within the cytoplasm of the cell via the cytosolic pathway. In some embodiments, MHC class I-peptide complexes displayed on the surface of the cell are typically recognized by TCRs expressed on CD8+ T cells, such as cytotoxic T cells. In some embodiments, MHC class I-peptide complexes can be recognized by TCRs expressed on CD4+ T cells, such as by TCRs exhibiting CD8- or partial CD8- independent binding.

[0120] MHC class II proteins are expressed in a subset of nucleated vertebrate cells, including antigen presenting cells (APCs). In humans, MHC class II alleles include, but are not limited to, DR1, DR3, DR4, DR7, DR52, DQ1, DQ2, DQ4, DQ8 and DP1. In some embodiments, the MHC class II allele is HLA-DRB1*01:01, HLA-DRB*03:01, HLA- DRB*07:01, HLA-DRB*04:01, or HLA-DQB1*02:01. The sequences of MHC alleles are known and can be found, for example, at the IMGT / HLA database available from EMBL-EBI (IPD-IMGT / HLA).

[0121] In some embodiments, MHC-class II restricted peptides are generally between about 9 and 25 amino acids in length, such as between 15 and 25 amino acids in length, or between 13 and 18 amino acids in length. An MHC-class II restricted peptide can contain a binding core region of about 9 amino acids to about 12 amino acids in length. MHC class II molecules can bind peptides derived from exogenous antigens, which are internalized by phagocytosis or endocytosis and processed within the endosomal / lysosomal pathway. MHC class II-peptide complexes displayed on the surface of cells are typically recognized by CD4+ cells, such as helper T cells. In some embodiments, MHC class II-peptide complexes displayed can be recognized by TCRs expressed on CD8+ T cells.

[0122] In some embodiments, the antigen encoding vectors (vectors encoding a neoantigen, tandem minigene, protein, protein fragment, and / or other antigens) are introduced into antigenpresenting cells (APCs) expressing one or more HLA alleles. The HLA alleles include, but are not limited to, HLA-A, HLA-B, and HLA-C. The APCs can express one or two alleles of each of HLA-A, HLA-B, and / or HLA-C. If the APC expresses two alleles of HLA-A, HLA-B, and / or HLA-C, the two alleles can independently be the same or different for each of HLA-A, HLA-B, and HLA-C. In some embodiments, the HLA alleles expressed by the APC are matched to the subject. HLA matched indicates that the APCs express the same HLA-A, HLA- B, and HLA-C alleles as the subject. In some embodiments, the antigen encoding vectors are introduced into first APCs expressing a first set of HLA-A, HLA-B, and HLA-C alleles and second APCs expressing a second set of HLA-A, HLA-B, and HLA-C alleles. Each of the HLA-A, HLA-B, and HLA-C alleles in the first APCs and second APCs can independently be the same or different. In some embodiments, the first and second sets of HLA-A, HLA-B, and HLA-C alleles expressed by the first and second APCs combined are matched to the HLA genotype of the subject, such that together the first and second APCs express the same set of HLA-A, HLA-B, and HLA-C alleles as the subject. In some embodiments, the antigen encoding vectors are introduced into first APCs expressing one or two HLA-A alleles, second APCs expression one or two HLA-B alleles, and third APCs expressing one or two HLA-C alleles. In some embodiments, the one or two HLA-A alleles, one or two HLA-B alleles, and one or two HLA-C alleles expressed by the first, second, and third APCs combined are matched to the HLA genotype of the subject, such that together the first, second, and third APCs express the same set of HLA-A, HLA-B, and HLA-C alleles as the subject. The APCs can be, but are not limited to, B-lymphoblastoid cells (B-LCLs) or artificial APCs. An artificial APC can be, but is not limited to, a K562 cell expressing an MHC molecule. In some embodiments, the APCs are transfected or transduced by one or more vectors, such as a one or more lentiviral vectors, encoding the desired HLA-A, HLA-B, and / or HLA-C alleles.

[0123] In some embodiments, a neoantigen expressing APC cell line is established from a neoantigen-expressing APC or population thereof. A neoantigen expressing APC cell line can be expanded, stored (e.g., frozen in aliquots), and thawed for use in one or more experiments. Each of the neoantigen-expressing APCs (or neoantigen-expressing APC lines) in the library is maintained and / or stored in a separate vessel or container. If a given neoantigen minigene or tandem minigene is introduced into two or three APCs that together are HLA matched to a subject, the two or three APCs can be combined and maintained and / or stored together. Information regarding the identity of the neoantigen minigene or tandem minigene expressed by each APC, including but not limited to, nucleic acid sequence, amino acid sequence, and neoantigen source, can be recorded for each APC.

[0124] Neoantigen-expressing APCs (or neoantigen-expressing APC lines) containing different neoantigen expression vectors can be pooled. Neoantigen-expressing APCs containing 1-20 different neoantigen expression vectors (including minigenes and / or tandem minigenes) can be pooled to provide a pool of APCs. A pool of neoantigen-expressing APCs can express 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 different neoantigen expression vectors. In some embodiments, a pool of neoantigen-expressing APCs expresses about 1 to about 3 different neoantigen minigenes and / or tandem minigenes. In some embodiments, a pool of neoantigen-expressing APCs expresses about 1 to about 5 different neoantigen minigenes and / or tandem minigenes. In some embodiments, a pool of neoantigen- expressing APCs expresses about 1 to about 10 different neoantigen minigenes and / or tandem minigenes. In some embodiments, a pool of neoantigen-expressing APCs expresses up to about 20 different neoantigen minigenes and / or tandem minigenes. In some embodiments, a pool of neoantigen-expressing APCs expresses about 20 different neoantigen minigenes and / or tandem minigenes. In some embodiments, each neoantigen minigene or tandem minigene expressed in a pool of neoantigen-expressing APCs is expressed by at least about 5% of the cells in the pool of neoantigen-expressing APCs. In some embodiments, each neoantigen minigene or tandem minigene expressed in a pool of neoantigen-expressing APCs is expressed by at least about 10%, at least about 20%, at least 25%, at least about 33%, or at least about 50% of the cells in the pool of neoantigen-expressing APCs.

[0125] Expression of the neoantigens in APCs (including binding of the neoantigen to an MHC molecule and presentation of the MHC-neoantigen complex on the cell surface for the APC) can be used in identifying TCRs that recognize the neoantigen in the context of the MHC molecule.

[0126] In some embodiments, an antigen (e.g., neoantigen or neoepitope) is capable of inducing an immune response. The antigen can induce an immune response through recognition by a TCR on a T cell. Upon binding of a T cell TCR to an MHC-neoantigen complex, the TCR (or other MHC-peptide binding molecule) produces or triggers an activation signal to the T cell that induces a T cell response, such as T cell proliferation, cytokine production, a cytotoxic T cell response or other response.

[0127] The methods described herein for expressing neoantigens in APCs and forming neoantigen APCs or libraries of neoantigen-expressing APCs can also be used to express other antigens in APCs. Such antigens include, but are not limited to, pathogen antigens (e.g., bacterial or viral antigens), antigens associated with an allergen, or antigens associated with an autoimmune disease. The antigens can be expressed in APCs as minigenes or tandemminigenes, or the antigen can be expressed in APCs as all or a portion of one or more proteins. The APCs can be any cell line suitable for transfection or transduction, expression of antigen(s), and presentation of processed antigens for TCR activation (via MHC / HLA). The APC can be, but is not limited to, a lymphoblastoid cell line cell (LCL). In some embodiments the APC expresses one or more HLAs. The HLAs can be, but are not limited to, HLA-A, HLA- B, and HLA-C. In some embodiments, the APC is HLA matched to a subject. E. HLA matched antigen presenting cells

[0128] In some embodiments, APCs expressing HLA genes matched to the subject can be obtained from a library of APCs expressing combinations of HLA-A, HLA-B, and HLA-C alleles.

[0129] In some embodiments, a library of APCs comprises a plurality of APCs wherein each APC in the library expresses an HLA-A allele, an HLA-B allele, and an HLA-C allele. In some embodiments, each APC in the library encodes a single HLA-A allele, a single HLA-B allele, and single HLA-C allele. In some embodiments, each APC in the library encodes 1 or 2 HLA- A alleles, 1 or 2 HLA-B alleles, and / or 1 or 2 HLA-C alleles. In some embodiments, the HLA- A alleles, HLA-B alleles, and HLA-C alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in a given population. In some embodiments, the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are provided in Table 1. In some embodiments, the combinations of HLA-A, HLA-B, and / or HLA-C alleles present in the APCs in the library are selected to encompass the combinations of HLA-A, HLA-B, and HLA-C alleles present in more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the individuals in the population. The population can be, but is not limited to, a United States population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subgroups thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., United States and Europe).

[0130] In some embodiments, APCs expressing HLA genes matched to the subject can be obtained by introducing into one or more APCs, expression vectors encoding HLA-A, HLA-B and HLA-C alleles matched to the subject. The expression vectors encoding the matched HLA- A, HLA-B and HLA-C alleles can be obtained from a library of expression vectors encoding aplurality of HLA-A, HLA-B and HLA-C alleles. Each expression vector in the library can express a single HLA allele or a combination of HLA alleles. In some embodiments, the expression vectors each encode a single HLA allele. In some embodiments, the expression vectors each encode a combination of HLA alleles. The combination of HLA alleles can be 2 different HLA-A alleles, 2 different HLA-B alleles, 2 different HLA-C alleles, an HLA-A allele and an HLA-B allele, an HLA-A allele and an HLA-C allele, an HLA-B and an HLA-C allele, or an HLA-A allele, an HLA-B allele, and an HLA-C allele. In some embodiments, the library of expression vectors encoding the HLA-A, HLA-B and HLA-C alleles comprises a plurality of expression vectors each encoding a single HLA allele and a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele. An expression vector encoding two or more HLA alleles can express the two or more HLA alleles from a single promoter, with one or more translation modification elements (e.g., 2A element or internal ribosome entry site (IRES)) to allow the two or more HLA alleles to be expressed from a single mRNA (i.e., a bicistronic or tricistronic vector). An expression vector encoding one or more HLA alleles can further encode a selectable marker. The selectable marker can be expressed from a separate mRNA (i.e., expressed from a separate promoter) or the selectable marker can be expressed from the same promoter as the HLA allele(s). In some embodiments, the HLA-A alleles, HLA- B alleles, and HLA-C alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in a given population. In some embodiments, the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are provided in Table 1. In some embodiments, the combinations of HLA-A, HLA-B, and HLA-C alleles present the library are selected to encompass the combinations of HLA-A, HLA-B, and / or HLA-C alleles present in more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the individuals in the population. The population can be, but is not limited to, a United States population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subgroups thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., United States and Europe).

[0131] Exemplary expression vectors include, but are not limited to: (a) P−HLA-A−2A−ZEO-PRE, (b) P−HLA-B−2A−ZEO-PRE, (c) P−HLA-C−2A−ZEO-PRE,(d) P−HLA-A−2A−HLA-A′−2A′−ZEO−PRE, (e) P−HLA-B−2A−HLA-B′−2A′−ZEO−PRE, (f) P−HLA-C−2A−HLA-C′−2A′−ZEO−PRE, (g) P−HLA-A−2A−HLA-B−2A′−ZEO−PRE, (h) P−HLA-A−2A−HLA-C−2A′−ZEO−PRE, (i) P−HLA-B−2A−HLA-C−2A′−ZEO−PRE, or (j) P−HLA-A−2A−HLA-B−2A′−HLA-C−2A′′−ZEO−PRE; wherein: P comprises a promoter, HLA-A, HLA-A′, HLA-B, HLA-B′, HLA-C, and HLA-C′ encode HLA alleles, 2A, 2A′, and 2A′′ each encode 2A elements, ZEO encodes a selectable marker, and PRE encodes a post-transcriptional regulatory element.

[0132] The promoter can be any promoter that is active in APCs or artificial APCs. The promoter can be a constitutive or inducible promoter. The promoter can be, but is not limited to, a CMV promoter, a Igκ promoter, a PGK promoter, a SV40 promoter, a β-actin promoter, an α-actin promoter, a SRα promoter, a herpes thymidine kinase promoter, a herpes simplex virus (HSV) promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late promoter (Ad MLP), a rous sarcoma virus (RSV) promoter, an immunoglobulin promoter, EF1α promoter, ubiquitin promoter, MNDU3 promoter, metallothionein promoter, IFN gene promoter, or a GM-CSF gene promoter. In some embodiments, the promoter comprises a human 3-phosphoglycerate kinase (hPGK) promoter.

[0133] The 2A elements can independently be a P2A element, a T2A element, a F2Aelement, or an E2A element. The P2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO: 1). In some embodiments, the P2A element comprises the nucleotide sequence: gccacgaacttctctctgttaaagcaagcaggagacgtggaagaaaaccccggtccc (SEQ ID NO: 2) or gccaccaacttttcattgctcaagcaggcgggcgatgtggaggaaaaccctggcccc (SEQ ID NO: 3). The T2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO: 4). In some embodiments, the T2A element comprises the nucleotide sequence: gagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcct- ggccca (SEQ ID NO: 5). The E2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence QCTNYALLKLAGDVESNPGP (SEQ ID NO: 6). In someembodiments, the E2A element comprises the nucleotide sequence: cagtgtactaattatgctc- tcttgaaattggctggagatgttgagagcaaccctggacct (SEQ ID NO: 7). The F2A element comprises a nucleotide sequence encoding a peptide having the amino acid sequence VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 8). In some embodiments, the E2A element comprises the nucleotide sequence: gtgaagcagaccctgaacttcgacctgctgaagctggccggcgacgtggaga- gcaaccccggcccc (SEQ ID NO: 9).

[0134] The selectable marker can be, but is not limited to, an antibiotic resistance gene. The antibiotic resistance gene can be, but is not limited to, a Zeocin resistance gene (e.g., the Sh ble gene).

[0135] The post-transcriptional regulatory element can be, but is not limited to, a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE).

[0136] In some embodiments, the nucleic acids encoding the HLA alleles are codon optimized for expression in a human subject.

[0137] In some embodiments, any of the described expression vectors can be formed using seamless cloning (e.g., Gibson assembly or NEBuilder HiFi DNA Assembly).

[0138] The expression vectors can be, but are not limited to, lentiviral vectors.

[0139] More than 99% of the people in the United States have HLA-A alleles selected from the 22 HLA-A alleles shown Table 1. More than 94% of the people in the United States have HLA-B alleles selected from the 46 HLA-B alleles shown Table 1. More than 99% of the people in the United States have HLA-C alleles selected from the 30 HLA-C alleles shown Table 1. Thus, a library of 98 expression vectors encoding the 22 HLA-A alleles, 46 HLA-B alleles, and 30 HLA C alleles can be used to generate APCs that are HLA matched to more than 94% of the US population.

[0140] In some embodiments, a library of expression vectors encoding HLA-A, HLA-B and HLA-C alleles comprises a plurality of expression vectors each encoding a single HLA-A allele and a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele (i.e., an HLA-B / HLA-C combination). In some embodiments, a library of expression vectors encoding HLA-A, HLA-B and HLA-C alleles comprises a plurality of expression vectors each encoding one or two HLA-As alleles, a plurality of expression vectors each encoding one or two HLA-B alleles, and a plurality of expression vectors each encoding one or two HLA-C alleles. In some embodiments, the HLA-A alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles present in a given population. In some embodiments, the plurality of expressionvectors each encoding single HLA-A alleles comprise expression vectors encoding each of the HLA-A alleles in Table 1. In some embodiments, the plurality of expression vectors each encoding one or two HLA-A alleles comprise expression vectors encoding the HLA-A alleles in Table 1, either alone are in combination. In some embodiments, the HLA-B alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-B alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding one or two HLA-B alleles comprise expression vectors encoding the HLA-B alleles in Table 1, either alone are in combination. In some embodiments, the HLA-C alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-C alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding one or two HLA-C alleles comprise expression vectors encoding the HLA-C alleles in Table 1, either alone are in combination. In some embodiments, the HLA-B and HLA-C alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-B and HLA-C alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding an HLA- B allele and an HLA-C allele comprise expression vectors encoding each of the HLA-B and HLA-C alleles in Table 1. In some embodiments, the combinations of HLA-B and HLA-C alleles present in the library are selected to encompass the combinations of HLA-B and HLA- C alleles present in more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the individuals in the population. In some embodiments, the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele comprise expression vectors encoding the combinations of HLA-B and HLA-C alleles in Table 2. The population can be, but is not limited to, a United States population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subgroups thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., United States and Europe).

[0141] In some embodiments, APCs expressing HLA genes matched to the subject can be obtained by introducing one or more expression vectors encoding HLA-B and HLA-C alleles matched to the subject into one or more APCs expressing HLA-A alleles matched to thesubject. The expression vectors encoding the HLA-B and HLA-C alleles can encode either an HLA-B allele or an HLA-C allele, or encode a combination of an HLA-B allele and an HLA- C allele.

[0142] The APCs expressing HLA-A genes matched to the subject can be obtained from a library of APCs wherein each APC in the library expresses one or two HLA-A alleles. In some embodiments, each APC in the library encodes a single HLA-A allele. In some embodiments, the HLA-A alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles present in a given population. In some embodiments, the HLA-A alleles present in the library are provided in Table 1. The population can be, but is not limited to, a United States population, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subgroups thereof (e.g., China or sub- Saharan Africa), and combinations thereof (e.g., United States and Europe). More than 99% of the people in the United States have HLA-A alleles selected from the 22 HLA-A alleles shown Table 1. Thus, a library of 22 APCs expressing the 22 HLA-A alleles of Table 1 can be used in generating APCs that are HLA-A matched to more than 99% of the US population. Different libraries of APCs expressing HLA-A alleles can be generated and used for different populations by selecting the HLA-A alleles most prevalent in the given population.

[0143] The expression vectors encoding the matched HLA-B and HLA-C alleles can be obtained from a library of expression vectors each encoding an HLA-B allele and a HLA-C allele. In some embodiments, the HLA-B and HLA-C alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-B and HLA-C alleles present in a given population. In some embodiments, the plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele comprise expression vectors encoding each of the HLA-B and HLA-C alleles in Table 1. In some embodiments, the combinations of HLA-B and HLA-C alleles present in the library are selected to encompass the combinations of HLA-B and HLA-C alleles present in more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the individuals in the population. In some embodiments, the plurality of expression vectors each encoding an HLA- B allele and an HLA-C allele comprise expression vectors encoding the combinations of HLA- B and HLA-C alleles in Table 2. The population can be, but is not limited to, a United Statespopulation, a European population, a Middle Eastern population, an Asian population, a North American population, a South American population, an African population, subgroups thereof (e.g., China or sub-Saharan Africa), and combinations thereof (e.g., United States and Europe). Different libraries of expression vectors encoding different HLA-B and HLA-C alleles, and combinations thereof, can be generated and used for different populations by selecting the HLA-B alleles, HLA-C alleles, and combinations thereof most prevalent in the given population.

[0144] Table 2 shows the top 16 HLA-B / HLA-C haplotypes (combinations) in a European population. About 50 HLA-B / HLA-C combinations cover about 95% of the European haplotypes. About 16 HLA-B / HLA-C combinations cover about 70% of the European population haplotypes (including populations of European descent). Thus, a library of 16 expression vectors encoding the 16 HLA-B / HLA-C combinations of Table 2 can be used in generating APCs that are HLA-B / HLA-C matched to more than 70% of the European population (including populations of European descent). About 30 HLA-B / HLA-C combinations cover about 88% of the European population haplotypes (including populations of European descent). About 240 HLA-A / HLA-B combinations cover about 95% of the European population haplotypes (including populations of European descent). About 448 HLA-A / HLA-C combinations cover about 95% of the European population haplotypes (including populations of European descent). A library of the respective numbers of HLA allele combinations can be used in generating APCs that are HLA matched to the respective percentage of the European population (including populations of European descent).

[0145] Using the described libraries and methods of generating HLA matched APCs, HLA matched APCs can be readily generated for a large percentage of the population. For example, a library of APCs expressing 22 HLA-A alleles (or a library of expression vectors encoding 22 HLA-A alleles) can be combined with a library of expression vectors encoding 50 HLA- B / HLA-C combinations to generate 1100 HLA-A / HLA-B / HLA-C combinations.

[0146] The APCs in a library of APCs expressing each expressing an HLA allele or a combination of HLA alleles are maintained in isolated containers, such that all of the APCs in each isolated container express the same HLA allele (e.g., HLA-A allele) or combination of HLA alleles. Thus, a library of APCs expressing 22 different HLA-A alleles comprises 22 isolated containers, wherein each isolated container contains APCs expressing one of the 22 HLA-A alleles. Similarly, a library of expression vectors encoding an HLA allele or combination of HLA alleles comprises a plurality of isolated containers wherein each isolated container contains an expression vector or plurality of expression vectors, wherein all of theexpression vectors in each of the isolated containers encode the same HLA allele or combination of HLA alleles. Thus, a library of expression vectors encoding 50 different HLA- B / HLA-C combinations comprises 50 isolated containers, wherein each isolated container contains expression vector(s) expressing one of the 50 different HLA-B / HLA-C combinations. The expression vector can be provided as a nucleic acid, a plasmid, a viral vector, or a cell containing the nucleic acid, plasmid, or viral vector. In some embodiments, the expression vector comprises a lentiviral vector. In some embodiments, the expression vector comprises a nucleic acid for generating a lentiviral vector. In some embodiments, comprises a cell containing a nucleic acid, a plasmid, a viral vector (e.g., a lentiviral vector).

[0147] In some embodiments, the HLA genotype of the subject is determined and APCs expressing each of the HLA alleles determined for the subject are selected from a library of APCs expressing HLA alleles. If the APCs in the library each express a single HLA-A allele, HLA-B allele, and HLA-C allele, two APCs are selected such that in combination, the two APCs together express the same HLA alleles as the subject.

[0148] In some embodiments, generating HLA-matched APCs comprises: (a) determining or having determined the HLA genotype of a subject; (b) selecting from a library of APCs expressing HLA-A alleles a first APC expressing a first HLA-A allele of the subject and a second APC expressing a second HLA-A of the subject; (c) selecting from a library of expression vectors each encoding an HLA-B / HLA-C combination a first expression vector encoding a first HLA-B allele and a first HLA-C allele of the subject and a second expression vector encoding a second HLA-B allele and a second HLA-C allele of the subject; and (d) introducing the first expression vector into the first APC and introducing the second expression vector into the second APC.

[0149] In some embodiments, generating HLA-matched APCs comprises: (a) determining or having determined the HLA genotype of a subject; and (b) introducing into a first APC one or more expression vectors encoding the HLA- A alleles of the subject, introducing into a second APC one or more expression vectors encoding the HLA-B alleles of the subject, and introducing into a third APC one or more expression vectors encoding the HLA-C alleles of the subject.

[0150] In some embodiments, the library of expression vectors comprises a library of lentiviral vectors.

[0151] The library of APCs expressing HLA alleles and / or library of expression vectorsencoding HLA alleles provide for a repository of off-the-shelf resources that can be used for rapid generation of HLA-matched APCs for most subjects in a population. The HLA-matched APCs can then be used to generate neoantigen expression libraries which can in turn be used to screens for TCRs. Using the described libraries, stable HLA-matched APCs can be generated in less than 7 days. In some embodiments, stable HLA-matched APCs can be generated in 5 days. In some embodiments, stable HLA-matched APCs can be generated in 6 days. In some embodiments, stable HLA-matched APCs can be generated in 7 days. Table 1. HLA alleles and frequency in Unites States population.Table 2. HLA B / HLA-C haplotypes in European population.III. Methods For Identifying T Cell Receptors Targeting Neoantigens

[0152] Described are methods and systems for using the described minigene vector libraries and tandem minigene vector libraries for isolating or cloning nucleic acid molecules encoding one or more TCRs from a subject. The methods comprise using APCs expressing the neoantigens identified from a subject to screen a TCR library for TCRs that specifically bind to one or more of the neoantigens. In some embodiments, the described methods andcompositions can be used to rapidly identify a particular TCR of interest, for use in treatment of a tumor or cancer in a subject.

[0153] In some embodiments, the described methods and systems provide for the rapid cloning of TCRs, functional expression, and testing of TCRs from numerous T cells from subject T cells in a massively parallel manner, which is cost-efficient and requires little hands- on time. In some embodiments, the provided embodiments permit rapid and accurate identification of TCRs that are specific for antigens that are expressed in a tumor from a particular subject (e.g., patient-specific variants or various types of patient-specific tumor neoantigens). In some embodiments, the provided embodiments also include methods and systems for generation of a large of library cells, such as reporter cells, each expressing one of a variety of cloned or isolated TCRs, such as functional full-length TCRs, from a subject. For example, the methods and systems for isolation and cloning of TCRs was observed to achieve 100% coverage of all human TCR V regions, >95% amplification efficiency for each chain and >85% amplification efficiency for the pair of TCR chains (e.g., TCRα and TCRβ chains). It was observed that with the high-throughput, automated system, at least 1400 TCR chain pairs can be amplified in a day, and at least 700 pairs can be expressed and screened in the two subsequent days, at a very low cost per TCR. A. Reporter T cells, cell lines, and libraries

[0154] In some embodiments, provided herein are reporter T cells for use in identifying TCRs that are activated in the presence of an antigen, such as a tumor neoantigen. In some embodiments, the reporter T cell expresses an isolated TCR, and “reports” (e.g., expresses or upregulates a reporter gene) when the expressed TCR is activated or stimulated, and / or signal transduction is induced through the TCR.

[0155] In some embodiments, a reporter T cell is transfected or transduced with, comprises, and / or expresses a functional TCR isolated from a subject, for example, as described herein. In some embodiments, the TCR is isolated from a tumor infiltrating lymphocyte (TIL). In some embodiments, the TIL is isolated from a biological sample, such as a tumor. In some embodiments, the TIL is isolated by fluorescence activated cell sorting (FACS). In some embodiments, the TIL is isolated (i.e., sorted) based on a phenotype assessed by FACS. In some embodiments, the TIL is a CD8+ T cell. In some embodiments, the TIL has a CD69hi / PD1hiphenotype. In some embodiments, the TCR is isolated from a PBMC T cell. The subject can be an autologous subject or an allogeneic subject. A reporter T cell line is a population of reporter T cells expressing the same functional TCR and the same detectable marker.

[0156] In some embodiments, the library of functional TCR-expressing reporter T cells is obtained by a method comprising: (1) amplifying a plurality of first amplification products and a plurality of second amplification products from cDNAs generated from RNAs obtained from a plurality of T cells obtained from the subject, wherein each first amplification product comprises a nucleic acid encoding an α variable (Vα) or γ variable (Vγ) segment, and each second amplification product comprises nucleic acid encoding a β variable (Vβ) or δ variable (Vδ) segment, and wherein the first and the second amplification products from each of the plurality of T cell are sorted into separate locations of a device, and (2) assembling said first amplification product and said second amplification product from each of said plurality of separate locations to obtain an assembled nucleic acid encoding a functional T cell receptor for each of said plurality of separate locations, wherein said functional T cell receptor comprises (i) a full-length α variable region and a full-length β variable region from said single T cell or (ii) a full-length γ variable region and a full-length δ variable region from said single T cell. In some embodiments, single T cells are sorted into the separate locations prior to step (1). In some embodiments, a reverse transcription reaction is performed to obtain the cDNA prior to step (1). In some embodiments, more than 50, more than 100, more than 500, more than 1000, or more than 5000 T cells are sorted into the separate locations. The separate locations can be wells of a multi-well plate. The device can be, but is not limited to, a multi-well plate. The multi-well plate can be, but is not limited to, a 96-well plate, a 384-well plate, or a 1536-well plate. Using the described method, an expression vector encoding a function TCR from each of the plurality of T cells from the subject is generated.

[0157] In some embodiments, said first amplification product comprises nucleic acid encoding a leader (L) sequence of a Vα or Vγ segment, an α joining (Jα) or γ joining (Jγ) segment, and / or a 5′ portion of an α constant (Cα) or a γ constant (Cγ) region.

[0158] In some embodiments, said second amplification product comprises nucleic acid encoding a leader (L) sequence of a Vβ or Vδ segment, a β diversity (Dβ) or δ diversity (Dδ) segment, a β joining (Jβ) or δ joining (Jδ) segment, and / or a 5′ portion of a β constant (Cβ) or δ constant (Cδ) region.

[0159] In some embodiments, the first amplification product further comprises a first adapter sequence added to an amplified template sequence of said cDNA via a second round amplification and / or the second amplification product further comprises an second adapter sequence added to an amplified template sequence of said cDNA via a second round amplification The first and second adapter sequences can be the same or different. In some embodiments the first and second adapter sequences are different.

[0160] In some embodiments, the functional T cell receptor comprises a full-length α constant region and a full-length β constant region; or a full-length γ constant region and a full- length δ constant region.

[0161] In some embodiments, each of said assembled nucleic acid is obtained without performing nucleic acid sequencing. In some embodiments, each of said assembled nucleic acid is obtained without performing a restriction endonuclease cleavage reaction. In some embodiments, seamless cloning is used for said assembling.

[0162] In some embodiments, the assembled nucleic acid encoding the functional T cell receptor comprises a single nucleic acid sequence encoding the first amplification product and the second amplification product. Expression of the first amplification product and the second amplification product on the assembled nucleic acid can be driven by a single promotor or by separate promoters. In some embodiments, expression of the first amplification product and the second amplification product on the assembled nucleic acid is driven by a single promoter. In some embodiments, the first amplification product and the second amplification product on the assembled nucleic acid are separated by an IRES element or a self-cleaving peptide.

[0163] In some embodiments, the assembled nucleic acid encoding a functional TCR is assembled into a TCR vector. The TCR vector can be, but is not limited to, a lentiviral vector.

[0164] A “T cell receptor” or “TCR” is a molecule that contains an α chain and a β chain (also known as TCRα and TCRβ, respectively) or a γ chain and a δ chain (also known as TCRγ and TCRδ, respectively), and is capable of specifically binding to an antigen (e.g., a peptide antigen or peptide epitope, including a neoantigen or neoepitope) bound to an MHC molecule. In some embodiments, the TCR is in the αβ form. αβ TCRs and γδ TCRs are structurally similar. However, T cells expressing αβ TCRs and γδ TCRs may have distinct anatomical locations or functions. In some embodiments, the TCR is a αβ TCR. In some embodiments, the TCR is a γδ TCR. Generally, a TCR is found on the surface of a T cell (i.e., T lymphocyte) where it recognized antigens (e.g., neoantigen or neoepitopes) bound to major histocompatibility complex (MHC) molecules.

[0165] A “TCR” can encompasses a full-length TCR or antigen-binding portion or antigen- binding fragment thereof. In some embodiments, the TCR is an intact or full-length TCR, such as a TCR containing an alpha (α) chain and a beta (β) chain, or a gamma (γ) chain and a delta (δ) chain. In some embodiments, the TCR is an antigen-binding portion that is less than a full- length TCR that retains the ability to bind to a specific peptide, such as a neoantigen or neoepitope, in association with an MHC molecule. In some embodiments, an antigen-bindingportion or fragment of a TCR contains only a portion of the structural domains of a full-length or intact TCR, but yet retains the ability to bind to the same specific peptide, such as a neoantigen or neoepitope, in association with an MHC molecule as the full length TCR. In some embodiments, an antigen-binding portion contains the variable domains of a TCR, such as variable α (Vα) and variable β (Vβ) chains or the variable γ (Vγ) and variable δ (Vδ) chains.

[0166] Typically, specific binding of a TCR to a peptide epitope, is determined by one or more complementarity determining regions (CDRs). Specific binding of a TCR to a peptide epitope (in the context of an MHC molecule) means that the TCR binds the peptide epitope with higher affinity than it binds to other peptides (in the context of an MHC molecule). Higher affinity can be at least about 2-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold higher affinity.

[0167] The variable domains of a TCR contains CDRs (CDR-1, CDR-2, and CDR-3), which generally are contributors to antigen recognition and binding capabilities and specificity of the peptide, MHC molecule, and / or MHC-peptide complex. A CDR of a TCR or combination thereof forms all or substantially all of the antigen-binding site of a given TCR molecule. The various CDRs within a variable region of a TCR chain generally are separated by framework regions (FRs), which generally display less variability among TCRs as compared to the CDRs (see, e.g., Jores et al., Proc. Nat'l Acad. Sci. U.S.A. 87:9138, 1990; Chothia et al., EMBO J. 7:3745, 1988; see also Lefranc et al., Dev. Comp. Immunol. 27:55, 2003).CDR-3 is often predominantly responsible for antigen binding or specificity and / or interaction with the processed peptide portion of the peptide-MHC complex. CDR-1 of the alpha chain typically interacts with the N-terminal part of certain antigenic peptides. CDR-1 of the beta chain often interacts with the C-terminal part of the peptide. CDR-2 typically contributes most strongly to or is the primary CDR responsible for the interaction with or recognition of the MHC portion of the MHC-peptide complex. The variable region of the β-chain can contain a further hypervariable region (e.g., CDR4 or HVR4), which generally is involved in superantigen binding and not antigen recognition (Kotb (1995) Clinical Microbiology Reviews, 8:411-426).

[0168] The α chain and / or the β chain of a full length TCR, or the γ chain and / or the δ chain of a full length TCR further contains a constant domain, a transmembrane domain and a short cytoplasmic tail (see, e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd Ed., Current Biology Publications, p. 4:33, 1997). Each chain of the TCR can possess one N-terminal immunoglobulin variable domain, one immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic tail at the C-terminal end. TCRs canassociate, via their cytoplasmic tails, with invariant proteins of the CD3 complex involved in mediating signal transduction or with other CD3-like molecules.

[0169] In some embodiments, a reporter T cell library comprises a plurality of reporter T cells or reporter T cell lines, comprising and / or expressing a different functional TCRs. In some embodiments, each reporter T cell or reporter T cell line in the library comprises a TCR isolated from a different T cell or TIL, each T cell or TIL being derived from the same patient and / or tumor sample. The library of functional TCR-expressing reporter T cells can be generating using any method known in the art for generation of such libraries. In some embodiments, the library of functional TCR-expressing reporter T cells is generated using any of the methods described in US20150203886 or WO2018102473, each of which is incorporated herein by reference. In some embodiments, the TCR is an αβ TCR.

[0170] In some embodiments, the reporter T cell has been modified to knock out an endogenously expressed TCR. In some embodiments, the reporter T cell is derived from a cell line that does not express a TCR under normal conditions, or that has been engineered to not express an endogenous TCR. In some embodiments, the reporter T cell is derived from a Jurkat cell line.

[0171] A reporter T cell comprises a detectable marker (e.g., a reporter transgene the encodes the detectable marker) that provides a detectable signal when the reporter T cell is activated. In some embodiments, the detectable marker is expressed and / or upregulated when the TCR is activated and / or the TCR recognizes an antigen presented by a MHC molecule. In some embodiments, the detectable marker comprises a fluorescent protein. The fluorescent protein can be, but is not limited to Green fluorescent protein (GFP), GFP-like proteins, modified GFPs, GFP derivatives, eGFP, eqFP611, Dronpa, TagRFPs, KFP, EosFP / IrisFP, Dendra, mVenus, mCherry, emerald GFP, superfolder GFP, Azami Green GFP, TagGFP, Turbo GFP, AcGFP, ZsGreen GFP, T-sapphire GFP, blue fluorescent protein, EBFP, EGFP2, Azurite BFP, mTagBFP, Cyan fluorescent protein (CFP), SCFP, mECFP, Cerulean CFP, mTurquoise CFP, CyPET CFP, AmCyan1 CFP, Modori-Ishi Cyan CFP, TabCFP, mTFP (Teal), yellow fluorescent protein (YFP), Topax YFP, Venus YFP, mCitrine YFP, YPet YFP, TagYFP, PhiYFP, ZsYellow YFP, mBanana YFP, orange fluorescent protein (OFP), Kusabira Orange OFP, Kusabira Orange2 OFP, mOrange OFP, mOragne2 OFP, dTomato OFP, dTomato- Tandem OFP, TagRFP OFP, TagRFP-T OFP, DsRed OFP, DsRed2 OFP, DsRed-Express (T1) OFP, DsRed-Monomer OFP, mTangerine OFP, Red fluorescent protein (RFP), mRuby RFP, mApple RFP, mStrawberry RFP, AsRed2 RFP, mRFP1 RFP, JRed RFP, mCherry RFP, HcRed1 RFP, mRaspberry RFP, dKeima-Tandem RFP, HcRed-Tandem RFP, mPlum RFP,and AQ143 RFP. For example, in some embodiments, the reporter transgene is a NFAT-GFP reporter transgene that is designed to express GFP upon activation or stimulation of signaling via the TCR.

[0172] In some embodiments, the reporter T cells contain an additional or secondary detectable marker or tag to aid in detection and / or enrichment of the activated T cells. The secondary detectable marker can be, but is not limited to, a protein that binds to an antibody.

[0173] In some embodiments, the detectable marker or secondary detectable marker or tag encodes a protein or gene that induces a change in the reporter T cells.

[0174] In some embodiments, a reporter T cell line is established from a reporter T cell or population thereof. A reporter cell line can be expanded, stored (e.g., frozen in aliquots), and thawed for use in one or more experiments. Each of the reporter T cells (or reporter T cell lines) in the library is maintained and / or stored in a separate vessel or container. Information regarding the identity of the TCR, including but not limited to, nucleic acid sequence, amino acid sequence, and TCR source, can be recorded for each reporter T cell.

[0175] The reporter T cells (or reporter T cell lines) of the library can be pooled to form a pool of reporter T cells. Reporter T cells expressing about 100 or more different TCRs can be pooled to provide a pool of reporter T cells. In some embodiments, a pool of reporter T cells can express about 1 to about 10, about 5 to about 10, about 8 to about 10, about 1 to about 20, about 1 to about 50, or about 1 to about 100 different TCRs. In some embodiments, a pool of reporter T cells expresses up to about 100 different TCRs. In some embodiments, a pool of reporter T cells expresses about 100 different TCRs. In some embodiments, each TCR expressed in a pool of reporter T cells is expressed by at least about 1% of the cells in the pool of reporter T cells. In some embodiments, each TCR expressed in a pool of reporter T cells is expressed by at least about 2%, at least about 4%, at least about 5%, at least about 10%, at least about 12.5%, at least about 20%, at least about 33%, or at least about 50% of the cells in the pool of reporter T cells. B. Screening of reporter T cells against tumor neoantigens

[0176] Described herein are methods for identifying neoantigen-specific TCRs using the described neoantigen-expressing APCs. In some embodiments, the methods comprise screening a plurality of reporter T cells against a plurality of APCs expressing different neoantigen minigenes and / or TMGs, and assessing activation of the reporter cells, thereby identifying neoantigen-specific TCRs and their target neoantigens.

[0177] Also described herein are methods for identifying antigen-specific TCRs using thedescribed antigen-expressing APCs. In some embodiments, the methods comprise screening a plurality of reporter T cells against a plurality of APCs expressing one or more proteins or protein fragments for a pathogen, allergen, or autoimmune-related protein, and assessing activation of the reporter cells, thereby identifying antigen-specific TCRs and their target antigens.

[0178] The described methods can also be used to identify antigens that are presented to the immune system in the context of HLA. Identification of a TCR that is activated by an APC expressing an antigen indicates the antigen is presented to the T cell in the context of HLA. In some embodiments, the described methods can be used to identify an antigen or neoantigen associated with a cancer. In some embodiments, the described methods can be used to identify shared tumor antigens. In some embodiments, the described methods can be used to identify shared tumor antigens that bind to a specific HLA allele. In some embodiments, the described methods can be used to identify a neoantigen specific to a subject. In some embodiments, expressing a peptide, protein fragment, or protein from a pathogen, allergen, or protein associated with an autoimmune disease in an APC and identifying one or more TCRs that are activated by the APCs can be used to identify antigens or epitope that are processed by APCs and presented to the immune system and / or to identify TCRs that are specific to the antigens.

[0179] In some embodiments, one or more reporter T cell lines, e.g., from a reporter T cell library, are each individually co-cultured with one or more neoantigen-expressing APCs or neoantigen-expressing APC lines, e.g., from a neoantigen-expressing APC library. Each reporter T cell in a library (or subset thereof) can be co-cultured in a separate condition (or sample) with each neoantigen expressing APC in a library (or subset thereof). In other words, reporter T cells expressing each TCR can be individually co-cultured with APCs containing each neoantigen expression vector, with each TCR / neoantigen expression vector combination comprising a separate condition (or sample). The separate conditions or samples can be, but are not limited to, separate wells in a multi-well plate. Inclusion of multiple neoantigen minigenes per TMG allows for increased high-throughput screening of potential neoantigen- specific TCRs. In some embodiments, a TMG library is screened, with each TMG comprising a different set of neoantigen minigenes. The methods described herein, for identifying a TCR that recognizes a neoantigen, can also be used to identify TCRs that recognize other antigens.

[0180] The methods described herein can be multiplexed. Reporter T cells (or reporter T cell lines) expressing 1-5, 1-10, 1-20, 1-50, or 1-100 different TCRs can be pooled to provide a pool of reporter T cells. Neoantigen-expressing APCs (or neoantigen-expressing APC lines) expressing 1-20 different neoantigen expression vectors (including minigenes and / or tandemminigenes) can be pooled to provide a pool of neoantigen-expressing APCs. In any of the described methods, one or more pools of reporter T cells can be separately contacted with each of the neoantigen-expressing APCs in the neoantigen-expressing APCs library. In any of the described methods, the each of the reporter T cells in a reporter T cell library can be separately contacted with one or more pools of neoantigen-expressing APCs. In any of the described methods, a one or more pools of reporter T cells can be contacted with one or more pool of neoantigen-expressing APCs. In some embodiments, one or more pools of reporter T cells wherein each pool of reporter T cells expresses 1-100 different TCRs is contacted a one or more pool of neoantigen-expressing APCs wherein each pool of neoantigen-expressing APCs expresses 1-20 neoantigen expression vectors. In some embodiments, one or more pools of reporter T cells wherein each pool of reporter T cells expresses up to100 different TCRS is contacted a one or more pool of neoantigen-expressing APCs wherein each pool of neoantigen- expressing APCs expresses up to 20 neoantigen expression vectors. Use of multiplex samples or runs allows for increased high-throughput screening of large numbers of potential neoantigen-specific TCRs and neoantigens.

[0181] In some embodiments, each pool of reporter T cells in a multiplex sample or run independently expresses about 1 to about 10, about 5 to about 10, about 8 to about 10, about 1 to about 20, about 1 to about 50, or about 1 to about 100 different TCRs. In some embodiments, each pool of reporter T cells in a multiplex sample or run independently expresses up to about 100 different TCRs. In some embodiments, each pool of reporter T cells in a multiplex sample or run independently expresses about 100 different TCRs. In some embodiments, each TCR expressed in each pool of reporter T cells in a multiplex sample or run is expressed by at least about 1% of the cells in the pool of reporter T cells. In some embodiments, each TCR expressed in each pool of reporter T cells is expressed by at least about 2%, at least about 4%, at least about 5%, at least about 10%, at least about 12.5%, at least about 20%, at least about 33%, or at least about 50% of the cells in the pool of reporter T cells.

[0182] In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses about 1 to about 3 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses about 1 to about 5 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses about 1 toabout 10 different neoantigen expression vectors. In some embodiments, each pool of neoantigen-expressing APCs in a multiplex sample or run independently expresses up to about 20 different neoantigen expression vectors. In some embodiments, each pool of neoantigen- expressing APCs in a multiplex sample or run independently expresses about 20 different neoantigen expression vectors. In some embodiments, each neoantigen expression vector expressed in a pool of neoantigen-expressing APCs is expressed by at least about 5% of the cells in the pool of neoantigen-expressing APCs. In some embodiments, each neoantigen expression vector expressed in a pool of neoantigen-expressing APCs is expressed by at least about 10%, at least about 20%, at least 25%, at least about 33%, or at least about 50% of the cells in the pool of neoantigen-expressing APCs.

[0183] In some embodiments, up to about 5×105reporter T cells are co-cultured with up to about 5×105neoantigen-expressing APCs. In some embodiments, about 1×104to about 1×106reporter T cells are co-cultured with 1×104to about 1×106neoantigen-expressing APCs. In some embodiments, about 5×104to about 5×105reporter T cells are co-cultured with 5×104to about 5×105neoantigen-expressing APCs. In some embodiments, the reporter T cells and neoantigen-expressing APCs are co-cultured in a ratio of about 1:1 (e.g., 0.9–1.1:1).

[0184] In some embodiments, the T cells are incubated with an immune effector cytokine prior to contacting the cells with the APCs. The immune effector can be, but is not limited to, IFNγ or type 1 interferons.

[0185] In some embodiments, after co-culture of reporter T cell with neoantigen-expressing APCs, the reporter T cells are assessed for TCR activation. In some embodiments, reporter T cell activation is assessed based on detection and / or quantitation of the detectable marker (e.g., expression of GFP, RFP, mCherry, luciferase, or a protein that can be detected using an antibody, e.g., CD69). Detecting an activated TCR-expressing reporter T cell following incubation with a neoantigen-expressing ABC can be done use methods available in the art for detecting the detectable marker. In some embodiments, identifying an activated T cell comprises analyzing the reporter T cells from a sample by flow cytometry. In some embodiments, identifying an activated T cell comprises detecting a cell surface marker, such as by flow cytometry. In some embodiments, identifying an activated T cell comprises detecting a signal, such as fluorescence, from a fluorescent protein whose expression is induced by activation of the T cell.

[0186] In some embodiments, detecting activated reporter T cells in a sample comprises analyzing the sample by flow cytometry (e.g., cell sorting) and determining the percentage of reporter T cells expressing the detectable marker. A percentage of reporter T cells expressingthe detectable marker that is at least about one half of the percentage of reporter T cells in the sample expressing a given TCR is indicative of activation of the reporter T cell. If a sample contains a pool of reporter T cells expressing 100 different TCRs, then detection of the detectable maker in about 0.5% of the cells in the sample during cytometric analysis indicates at least one of the reporter T cell lines in the sample was activated.

[0187] In some embodiments, detecting activated reporter T cells in a sample comprises analyzing the sample by cell sorting, isolating one or more individual activated reporter T cells based on the presence of the detectable marker and culturing or sequencing all or a portion of the TCRs of the isolated individual activated reporter T cells.

[0188] In some embodiments, detecting activated reporter T cells in a sample comprises detecting a signal from the reporter T cells, such as a fluorescent or luminescent signal, using a plate reader (e.g., photometer) configured to detect the signal for the detectable marker.

[0189] In some embodiments, following detection of signal in a multiplex sample (wherein at least one of the pooled reporter T cells is activated by at least one of the APCs), the multiplex sample is deconvoluted. Deconvolution of a multiplex sample comprises individually contacting each of the reporter T cells expressing a different TCR in the pooled reporter T cells with either the pooled APCs or each of the APCs in the pooled APCs and identifying the reporter T cell that is activated in an additional round of detecting. Deconvolution can be performed in a single step or round or in multiple steps or round. For single step deconvolution, each of the different reporter T cells in the pooled reporter T cells is individually co-cultured with the neoantigen-expressing APCs in a separate sample and a second detecting step if performed to identify which of the pooled reporter T cells in activate. Each different reporter T cell can be co-cultured with the pooled neoantigen-expressing APCs or separately with each of the different neoantigen-expressing APCs from the pooled neoantigen-expressing APCs. For multi-step deconvolution, the pooled reporter T cells can be divided onto two or more smaller pools of reporter T cells for incubation with the neoantigen-expressing APCs. Following identification of the divided pool that is activated in the first round of deconvolution, additional rounds of deconvolution can be performed until single TCR is identified. In a similar manner, deconvolution can also be performed to identify the APC that activated the T cell and / or the antigen expressed by the APC that activated the T cell.

[0190] In some embodiments, the reporter T cells are enriched prior to the detecting. In some embodiments, activated reporter T cells are enriched prior to the detection. Enrichment of T cells or activated T cells can be performed using methods available in the art for such enriching.

[0191] In some embodiments, the reporter T cells contain an additional or secondary markeror tag to aid in detection and / or enrichment of the activated T cells. The additional of secondary marker or tag can be, but is not limited to, a protein that binds to an antibody. Beads coated with the antibody can be used to enrich the activated reporter T cells.

[0192] Reporter T cells in a pool of reporter T cells can contain distinguishable detectable markers. All of the reporter T cells in the pool of reporter T cells that express the same TCR will contain the same detectable marker. By using distinguishable detectable markers, the identification of the activated T cells in the pool of reporter T cells can be determined by identification of the distinguishable detectable marker. In some embodiments, the reporter T cell in a pool of reporter T cells contains a distinguishable detectable marker such that activation of the reporter T cell expressing one TCR is distinguishable from activation of at least some of the reporter T cells expressing different TCRs. In some embodiments, in a pool of reporter T cells, the detectable markers contained in reporter T cells expressing different TCRs are distinguishable. In some embodiments, in a pool of reporter T cells, the detectable marker contained in reporter T cells expressing one TCR is distinguishable from the detectable markers contained in reporter T cells expressing different TCR. In some embodiments, in a pool of reporter T cells, the detectable marker contained in reporter T cells expressing at least one of the TCRs is distinguishable from the detectable marker(s) contained in reporter T cells expressing at least one other (i.e., different) TCR. In some embodiments, each reporter T cell expressing the same TCR in the pool of reporter T cells contains the same detectable marker, wherein the detectable marker is distinguishable from the detectable markers contained in reporter T cells in the pool or reporter T cells expressing different TCRs. In some embodiments, each reporter T cell line, in a pool of reporter T cells, contains a different detectable marker that is distinguishable from detectable marker in the other reporter T cell lines in the pool of reporter T cells. In some embodiments, two or more reporter T cell lines, in a pool of reporter T cells containing distinguishable detectable markers, contain the same detectable marker. For any given pool of reporter T cell lines, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more reporter T cell lines in the pool can contain the same detectable marker.

[0193] Following detection of an activated TCR-expressing reporter T cell, the TCR encoded by the T cell and / or the neoantigen expressed by the APC can be identified. In some embodiments, the TCR and / or neoantigen can be identified by amplifying, sequencing, and / or cloning the TCR from the activated T cell and / or the neoantigen from the corresponding APC. In some embodiments, the TCR and / or neoantigen can be identified by identifying the reporter T cell or reporter T cell line and / or neoantigen-expressing APC or neoantigen-expressing APC line used in the sample that produced the activated reporter T cell. In some embodiments, theTCR and / or neoantigen can be identified by amplifying, sequencing, and / or cloning the TCR from the activated T cell and / or the neoantigen from the corresponding neoantigen-expressing APC.

[0194] In some embodiments, following detection of signal in a multiplex assay, an activated cell is detected and sorted using cell sorting. The identify of the TCR can then be determined by sequencing the TCR from the single activated reporter T cell.

[0195] In some embodiments, the neoantigen-expressing APCs are engineered to express a detectable marker when bound by a T cell or activated T cell expressing a TCR the binds to a neoantigen expressed by the APC. By providing detectable markers in both the reporter T cells and the APCs, the neoantigen and the TCR can be identified simultaneously. In some embodiments, the APC detectable marker can be used to facilitate identification of the particular APC that activates the reporter T cell when pooled APCs are used.

[0196] Using the described methods, a library of TCRs can be rapidly screened against a full mutanome. Using the described methods, 1-100 TCRs can be screened against 1-20 neoantigen expression vectors in a single sample. Screening a TCR library with a neoantigen library and identifying TCRs that bind to neoantigens can be performed in a little as one, two or three days. In some embodiments, screening a TCR library with a neoantigen library and identifying TCRs that bind to neoantigens can be performed in a little as one, two or three days.

[0197] In some embodiments, the any of the described methods further comprise contacting a reporter T cell activated by an APC expressing a neoantigen (or a T cell expressing the same TCR as the identified activated T cell) with an APC expressing the wild-type (non-mutated) version of the same peptide. Lack of activation of the reporter T cell by the APC expressing a wild-type version of the peptide indicates the TCR is specific for the neoantigen.

[0198] Described are methods of isolating and identifying T cell receptors (TCRs), or an antigen-binding fragments thereof, that bind to or target a tumor neoantigen or an epitope thereof, for example, in the context of an MHC molecule. The tumor neoantigen or neoepitope can be any of the neoantigens or neoepitopes described herein or a neoantigen or neoepitope identified using any of the methods described herein. In some embodiments, the methods provide for large-scale or high-throughput isolation and identification of TCRs, or an antigen- binding fragments thereof, that bind to or target a tumor neoantigen. Identification of a TCR includes identification of a nucleic acid that encodes the TCR.

[0199] A TCRs or antigen-binding fragments thereof, identified using the described methods, can be isolated or purified. In some embodiments, nucleic acid sequences encoding the TCRs or antigen-binding fragments thereof, identified using the described methods, can beidentified and isolated, synthesized, purified, and used for cloning. In some embodiments, the TCR, or antigen-binding fragment thereof, or a nucleic acid encoding the TCR, or antigen- binding fragment thereof is recombinant. In some embodiments, the TCR, or antigen-binding fragment thereof, is human. In some embodiments, the TCR contains two chains. In some embodiments, the two chains are encoding by two nucleic acid sequences. The two nucleic acid sequences encoding the two TCR chains can be present on two different expression vectors, a single expression vector. If the two nucleic acid sequences encoding the two TCR chains are present in a single expression vector, they can be operatively liked to two different promoters or a single promoter. If the two nucleic acids encoding the two TCR chains are operatively linked to a single promoter, the two nucleic acids can be linked by a T2 element (e.g., a P2A or T2A element) or an IRES element or operatively linked to encode a single chain TCR. In some embodiments, the TCR is a single chain. In some embodiments, the TCR contains two chains.

[0200] The identified nucleic acids encoding the TCRs can be used to generate engineered cells that express heterologous TCRs. Compositions and methods of treatment involving administering such TCRs and / or engineered cells are also described. In some embodiments, the engineered cells that express the identified TCRs, or antigen-binding fragments thereof, exhibit cytotoxic activity against target cells expressing the tumor neoantigen or an epitope thereof, such as cancer cells or tumor cells.

[0201] In some embodiments, TCRs, including tumor neoantigen-targeting TCRs, identified by any of the embodiments described herein are provided. In some embodiments, such identified TCRs can be used in a method of treatment or as a therapeutic.

[0202] In some embodiments, also provided herein are nucleic acids, such as polynucleotides, that encode any of the identified TCRs, such as tumor neoantigen-targeting TCRs. IV. Engineered Cells

[0203] The identified TCRs can be used to engineer cells, such as T cells, for use in therapy, such as, but not limited to, ACT. Also provided are compositions comprising the engineered cells described herein. The T cell can be, but is not limited to, a CD4+T cell, a CD8+T cell, or a CD4+ / CD8+T cell, a naïve T (TN) cell, an effector T (TEFF) cell, a memory T cell, a stem cell memory T (TSCM) cell, a central memory T (TCM) cell, an effector memory T (TEM) cell, a terminally differentiated effector memory T cell, tumor-infiltrating lymphocyte (TIL), an immature T cell, a mature T cell, a helper T cell (including TH1, TH2, TH3, TH17, TH9, andTH22 cells), follicular helper T cells, a cytotoxic T cell, a mucosa-associated invariant T (MAIT) cell, an adaptive regulatory T (Treg) cell, alpha / beta T cells, or delta / gamma T cells. In some embodiments, the cells are NK cells. A. Preparation of cells for genetic engineering

[0204] In some embodiments, preparation of the engineered cells includes one or more culture and / or preparation steps. The cells for introduction of the TCR may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject. In some embodiments, the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered. The subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and / or engineered.

[0205] Accordingly, the cells in some embodiments are primary cells, e.g., primary human cells. The samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g., transduction with viral vector), washing, and / or incubation. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.

[0206] In some embodiments, the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from, an apheresis or leukapheresis product. Exemplary samples include whole blood, PBMCs, leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and / or cells derived therefrom. Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources. B. Therapeutic Methods and Uses

[0207] Also provided herein are methods of administering and uses, such as therapeutic and prophylactic uses, of the TCRs and antigen-binding fragments thereof identified or isolated in accordance with the provided embodiments and / or engineered cells expressing the TCRs or antigen-binding fragments thereof. Such methods and uses include therapeutic methods and uses, for example, involving administration of the molecules, cells, or compositions containing the same, to a subject having a tumor or a cancer. In some embodiments, the molecule, cell,and / or composition is administered in an effective amount to effect treatment of the tumor or cancer. Uses include uses of the TCRs and cells in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods. In some embodiments, the methods are carried out by administering the TCRs or cells, or compositions comprising the same, to the subject having, having had, or suspected of having the tumor or cancer. In some embodiments, the methods thereby treat the tumor or cancer or disorder in the subject.

[0208] Among the diseases to be treated are cancers or tumors, or a disease associated with malignancy or transformation of cells. V. DEFINITIONS

[0209] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0210] The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Polypeptides, including the provided T cell receptors, antigen binding fragments thereof and other peptides, e.g., linkers, may include amino acid residues including natural and / or non-natural amino acid residues. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. In some embodiments, the polypeptides may contain modifications with respect to a native or natural sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.

[0211] An “isolated” nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0212] “An isolated nucleic acid molecule encoding a TCR” refers to a single nucleic acid molecule (e.g., single vector) that encodes a TCR such as a functional α / β TCR or a functionalγ / δ TCR.

[0213] “An isolated nucleic acid molecule encoding an antigen binding fragment of a TCR” refers to a single nucleic acid molecule (e.g., single vector) that encodes an antigen binding fragment of a TCR.

[0214] “Isolated nucleic acid molecules encoding a TCR” refers to two or more separate nucleic acid molecules (e.g., two or more vectors) that together encode a TCR such as a functional α / β TCR or a functional γ / δ TCR. Each of such two or more nucleic acid molecules can be present at different locations within a host cell.

[0215] “Isolated nucleic acid molecules encoding an antigen binding fragment of a TCR” refers to two or more nucleic acid molecules (e.g., two or more vectors) that together encode an antigen binding fragment of a TCR. Each of such two or more nucleic acid molecules can be present at different locations within a host cell.

[0216] The terms “express” and “expression” mean allowing or causing the information in a gene, RNA or DNA sequence to become manifest; for example, producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene. A DNA sequence is expressed in or by a cell to form an expression product such as an RNA (e.g., mRNA) or a protein. The expression product itself may also be said to be expressed by the cell.

[0217] “Operably linked” refers to the juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. For example, a promoter operably linked to a coding sequence will direct RNA polymerase mediated transcription of the coding sequence into RNA, including mRNA, which may then be spliced (if it contains introns) and, optionally, translated into a protein encoded by the coding sequence. A coding sequence can be “operably linked” to one or more transcriptional or translational control sequences. A terminator / polyA signal operably linked to a gene terminates transcription of the gene into RNA and directs addition of a polyA signal onto the RNA.

[0218] A “promoter” is a DNA regulatory region capable of binding an RNA polymerase in a cell (e.g., directly or through other promoter-bound proteins or substances) and initiating transcription of a coding sequence. A promoter may comprise one or more additional regions or elements that influence transcription initiation rate, including, but not limited to, enhancers. A promoter can be, but is not limited to, a constitutively active promoter, a conditional promoter, an inducible promoter, or a cell-type specific promoter. A variety of promoters foruse in T cells or APCs are known in the art. Examples of promoters can be found, for example, in WO 2013 / 176772. The promoter can be, but is not limited to, a CMV promoter, a Igκ promoter, a PGK promoter, a SV40 promoter, a β-actin promoter, an α-actin promoter, a SRα promoter, a herpes thymidine kinase promoter, a herpes simplex virus (HSV) promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late promoter (Ad MLP), a rous sarcoma virus (RSV) promoter, an immunoglobulin promoter, EF1α promoter, ubiquitin promoter, MNDU3 promoter, metallothionein promoter, IFN gene promoter, or a GM-CSF gene promoter.

[0219] A “translation modification element” enables translation of two or more genes from a single transcript. Translation modification elements include Internal Ribosome Entry Sites (IRES), which allow for initiation of translation from an internal region of an mRNA, and 2A peptides, which cause the ribosome to skip the synthesis of a peptide bond at the C-terminus of the element. Incorporation of a translation modulating element results in co-expression of two or more polypeptide from a single polycistronic mRNA. 2A modulators include, but are not limited to, P2A, T2A, E2A or F2A.

[0220] The terms “host cell,” “host cell line,” and “host cell culture” are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include “transformants” and “transformed cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.

[0221] As used herein, “percent (%) amino acid sequence identity” and “percent identity” when used with respect to an amino acid sequence (reference polypeptide sequence) is defined as the percentage of amino acid residues in a candidate sequence (e.g., the subject T cell receptor or fragment) that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximalalignment over the full length of the sequences being compared.

[0222] An amino acid substitution may include replacement of one amino acid in a polypeptide with another amino acid. Amino acid substitutions may be introduced into a TCR or antigen binding fragment thereof, of interest and the products screened for a desired activity, e.g., retained / improved antigen binding, decreased immunogenicity, or improved cytolytic activity.

[0223] Amino acids generally can be grouped according to the following common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe.

[0224] In some embodiments, conservative substitutions can involve the exchange of a member of one of these classes for another member of the same class. In some embodiments, non-conservative amino acid substitutions can involve exchanging a member of one of these classes for another class.

[0225] The term “vector,” as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self- replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “expression vectors.”

[0226] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a” or “an” means “at least one” or “one or more.” It is understood that aspects and variations described herein include “consisting” and / or “consisting essentially of” aspects and variations.

[0227] Throughout this disclosure, various aspects of the claimed subject matter are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, where a range of values is provided, it isunderstood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the claimed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the claimed subject matter. This applies regardless of the breadth of the range.

[0228] The term “about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”

[0229] As used herein, a composition refers to any mixture of two or more products, substances, or compounds, including cells. It may be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof.

[0230] A “mutanome” is the entirety of somatic cancer mutations in an individual tumor. Cancer mutanomes can be defined by comparing exome sequencing data obtained by next generation sequence of individual healthy tissue with sequences from tumor-derived nucleic acids.

[0231] “Treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to complete or partial amelioration or reduction of a disease or condition or disorder, such as a tumor or a cancer, or a symptom, adverse effect or outcome, or phenotype associated therewith. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. The terms do not imply complete curing of a disease or complete elimination of any symptom or effect(s) on all symptoms or outcomes.

[0232] “Delaying development of a disease” means to defer, hinder, slow, retard, stabilize, suppress and / or postpone development of the disease or disorder (such as a tumor or a cancer). This delay can be of varying lengths of time, depending on the history of the disease and / or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. For example, a late stage cancer, such as development of metastasis, may be delayed.

[0233] “Preventing,” includes providing prophylaxis with respect to the occurrence orrecurrence of a disease (such as a tumor or a cancer) in a subject that may be predisposed to the disease but has not yet been diagnosed with the disease. In some embodiments, the provided molecules and compositions are used to delay development of a disease or to slow the progression of a disease.

[0234] To “suppress” a function or activity is to reduce the function or activity when compared to otherwise same conditions except for a condition or parameter of interest, or alternatively, as compared to another condition. For example, a TCR or composition or cell which suppresses tumor growth reduces the rate of growth of the tumor compared to the rate of growth of the tumor in the absence of the TCR or composition or cell.

[0235] An “effective amount” of an agent, e.g., a pharmaceutical formulation, TCR, cells, or composition, in the context of administration, refers to an amount effective, at dosages / amounts and for periods of time necessary, to achieve a desired result, such as a therapeutic or prophylactic result.

[0236] A “therapeutically effective amount” of an agent, e.g., a pharmaceutical formulation, TCR, or cells, refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result, such as for treatment of a disease, condition, or disorder (such as a tumor or a cancer), and / or pharmacokinetic or pharmacodynamic effect of the treatment. The therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the subject, and the populations of cells administered. In some embodiments, the provided methods involve administering the TCRs, cells, and / or compositions at effective amounts, e.g., therapeutically effective amounts.

[0237] A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.

[0238] A “subject” is a mammal, such as a human or other animal, and typically is human. VII. Exemplary Embodiments

[0239] Among the provided embodiments are: 1. A method for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to a tumor neoantigen, the method comprising: (a) generating a library of functional TCR-expressing reporter T cells by introducing a plurality of nucleic acid molecules, each comprising a nucleic acid encoding a functional TCRfrom a T cell obtained from a biological sample from a subject having a tumor, into a plurality of reporter T cells; (b) identifying candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from the biological sample to the corresponding genomic DNA sequences and RNA expression profiles of non-tumor cells from the same subject; (c) generating a library of antigen-presenting cells (APCs) by introducing a plurality of tandem candidate neoantigen vectors each encoding one or more of the candidate tumor neoantigens or fragments thereof, into a plurality of APCs capable of expressing the one or more candidate tumor neoantigens or fragments thereof complexed with a major histocompatibility complex (MHC) molecule; (d) identifying an activated TCR-expressing reporter T cell following contacting one or more cells of the library of functional TCR-expressing reporter T cells with one or more cells of the library of APCs. 2. The method of embodiment 1, further comprising (e) isolating the nucleic acid encoding the functional TCR from the activated TCR-expressing reporter T cell. 3. The method of embodiment 1 or 2, wherein the TCR-expressing reporter T cell is activated if the expressed TCR binds to the candidate tumor neoantigen complexed with an MHC molecule presented on the APC. 4. The method of any one of embodiments 1-3, wherein the plurality of APCs comprise B-Lymphoblastoid Cell Line (B-LCLs). 5. The method of any one of embodiments 1-3, wherein the plurality of APCs comprise artificial APCs. 6. The method of embodiment 5, wherein the artificial APCs comprise K562 cells expressing an MHC molecule. 7. The method of any one of embodiments 1-6, wherein the tandem candidate neoantigen vectors each encodes at least two candidate neoantigens or fragments thereof, optionally at least five candidate neoantigens or fragments thereof. 8. The method of any one of embodiments 1-7, wherein the tandem candidate neoantigen vectors encode a modified ubiquitin, optionally wherein the modified ubiquitin comprises a G67V amino acid substitution. 9. The method of any one of embodiments 1-8, wherein the tandem candidate neoantigen vectors are assembled using parallel cloning.10. The method of any one of embodiments 1-9, wherein the tandem candidate neoantigen vectors are assembled without performing a restriction endonuclease cleavage reaction. 11. The method of any one of embodiments 1-10, wherein the tandem candidate neoantigen vectors are assembled using seamless cloning. 12. The method of any one of embodiments 1-11, wherein the MHC molecule comprises a Human leukocyte antigen (HLA) allele that is expressed in the subject. 13. The method of embodiment 12, wherein the MHC molecule is a human leukocyte antigens (HLA)-A molecule. 14. The method of embodiment 13, wherein the HLA-A molecule is of serotype HLA-A*02:01. 15. The method of embodiment 13, wherein the HLA-A molecule is of serotype HLA-A*02:06. 16. The method of embodiment 12, wherein the MHC molecule is an HLA-B or an HLA-C molecule. 17. The method of any one of embodiments 1-16, wherein an antigen is identified as a candidate tumor neoantigen if: (i) a single nucleotide variant (SNV) or an insertion-deletion (indel) is present in the genomic DNA sequence of the gene encoding the antigen from the tumor cells from the biological sample, compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the non-tumor cells from the same subject; and / or (ii) an SNV or an indel is present in an mRNA sequence of the gene encoding the antigen from the tumor cells from the biological sample, compared to the corresponding mRNA sequence of the gene encoding the antigen from the non-tumor cells from the same subject. 18. The method of embodiment 17, wherein the SNV results in a non-synonymous mutation, a missense mutation, or a nonsense mutation, in the gene encoding the antigen. 19. The method of embodiment 17 or 18, wherein the indel results in a frameshift mutation in the gene encoding the antigen. 20. The method of any one of embodiments 17-19, wherein the SNV or indel is present in a coding region or an exon of the gene encoding the antigen. 21. The method of any one of embodiments 17-19, wherein the SNV or indel is present in a regulatory region or an intron of the gene encoding the antigen. 22. The method of any one of embodiments 17-21, wherein an antigen is identified as a candidate tumor neoantigen if:(i) an SNV or an indel is present in the genomic DNA sequence from the tumor cells from the biological sample, compared to the corresponding genomic DNA sequence from the non-tumor cells from the same subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splicing variant RNA, a silenced retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF or a gene fusion; and / or (ii) an SNV or an indel is present in an expressed RNA sequence from the tumor cells from the biological sample, compared to the corresponding expressed RNA sequence from the non-tumor cells from the same subject, wherein the SNV or indel results in increased expression of a non-coding RNA, a splicing variant RNA, a silenced retroviral element, an alternative ORF, an upstream ORF, a regulatory ORF, a small ORF or a gene fusion. 23. The method of embodiment 22, wherein the SNV or indel is present in an intergenic region, a non-coding region, a regulatory region, an intron, a silenced retroviral element, or a heterochromatic region of the genome. 24. The method of embodiment 22 or 23, wherein: the antigen is encoded by the non-coding RNA or the splicing variant RNA; and / or the antigen comprises the alternative ORF, the upstream ORF, the regulatory ORF or the small ORF. 25. The method of any one of embodiments 1-24, wherein an antigen is identified as a candidate tumor neoantigen if the antigen or a fragment thereof is predicted to complex with an MHC molecule. 26. The method of any one of embodiments 1-25, wherein the plurality of nucleic acid molecules in (a) is obtained by a method comprising: (1) amplifying a first amplification product and a second amplification product from cDNA generated from RNA obtained from a single T cell sorted into each of a plurality of separate locations of a device, wherein said first amplification product comprises nucleic acid encoding an α variable (Vα) or γ variable (Vγ) segment, and said second amplification product comprises nucleic acid encoding a β variable (Vβ) or δ variable (Vδ) segment, and (2) assembling said first amplification product and said second amplification product from each of said plurality of separate locations to obtain an assembled nucleic acid encoding a functional T cell receptor for each of said plurality of separate locations, wherein said functional T cell receptor comprises (i) a full-length α variable region and a full-length β variable region from said single T cell or (ii) a full-length γ variable region and a full-length δ variable region from said single T cell.27. The method of embodiment 26, wherein the assembled nucleic acid encoding a functional TCR is assembled into a vector. 28. The method of embodiment 26 or 27, wherein: said first amplification product comprises nucleic acid encoding a leader (L) sequence of a Vα or Vγ segment; said first amplification product comprises nucleic acid encoding an α joining (Jα) or γ joining (Jγ) segment; said first amplification product comprises nucleic acid encoding a 5’ portion of an α constant (Cα) or a γ constant (Cγ) region; and / or said first amplification product comprises nucleic acid encoding an L sequence of a Vα or Vγ segment, a Jα or Jγ segment, and a 5’ portion of a Cα or Cγ region. 29. The method of any one of embodiments 26-28, wherein: said second amplification product comprises nucleic acid encoding a leader (L) sequence of a Vβ or Vδ segment; said second amplification product comprises nucleic acid encoding a β diversity (Dβ) or δ diversity (Dδ) segment, and / or wherein said second amplification product comprises nucleic acid encoding a β joining (Jβ) or δ joining (Jδ) segment; said second amplification product comprises nucleic acid encoding a 5’ portion of a β constant (Cβ) or δ constant (Cδ) region; and / or said second amplification product comprises nucleic acid encoding an L sequence of a Vβ or Vδ segment, a Dβ or Dδ segment, a Jβ or Jδ segment, and a 5’ portion of a Cβ or Cδ region. 30. The method of any one of embodiments 26-29, wherein said first amplification product comprises an adapter sequence added to an amplified template sequence of said cDNA via a second round amplification of said amplifying. 31. The method of any one of embodiments 26-30, wherein said second amplification product comprises an adapter sequence added to an amplified template sequence of said cDNA via a second round amplification of said amplifying. 32. The method of any one of embodiments 26-31, wherein said first amplification product comprises a first adapter sequence added to an amplified template sequence of said cDNA via a second round amplification of said amplifying, and wherein said second amplification product comprises a second adapter sequence added to an amplified template sequence of said cDNA via a second round amplification of said amplifying, wherein said first and second adapter sequence are different.33. The method of any one of embodiments 26-32, wherein said functional T cell receptor comprises a full-length α constant region and a full-length β constant region; or a full- length γ constant region and a full-length δ constant region. 34. The method of any one of embodiments 26-33, wherein: each of said assembled nucleic acid comprises a nucleic acid sequence encoding a self- cleaving peptide or an internal ribosome entry site (IRES); said method further comprises sorting single T cells into said separate locations prior to step (1); and / or said method further comprises performing a reverse transcription reaction to obtain said cDNA prior to step (1). 35. The method of any one of embodiments 26-34, wherein each of said assembled nucleic acid is obtained without performing nucleic acid sequencing. 36. The method of any one of embodiments 26-35, wherein each of said assembled nucleic acid is obtained without performing a restriction endonuclease cleavage reaction. 37. The method of any one of embodiments 26-36, wherein seamless cloning is used for said assembling. 38. The method of any one of embodiments 1-37, wherein the vector is a high-titer lentiviral vector. 39. The method of any one of embodiments 1-38, wherein each of the TCR- expressing reporter T cells is located in a plurality of separate locations of a device. 40. The method of any one of embodiments 26-39, wherein said plurality of separate locations is greater than 50, optionally wherein said plurality is greater than 500, further optionally wherein said plurality is greater than 5000. 41. The method of any one of embodiments 26-40, wherein said device comprises a multi-well plate, optionally wherein said multi-well plate is a 96-well plate, a 384-well plate, or a 1536-well plate. 42. The method of any one of embodiments 1-41, wherein one iteration of the method is capable of employing a library of TCR-expressing reporter T cell that comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 TCR-expressing reporter T cells. 43. The method of any one of embodiments 1-42, wherein one iteration of the method is capable of employing at least 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 candidate tumor neoantigens or fragments thereof. 44. The method of any one of embodiments 1-43, wherein one iteration of the method is capable of employing a plurality of tandem candidate neoantigen vectors thatcomprises at least 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 tandem candidate neoantigen vectors. 45. The method of any one of embodiments 1-44, wherein one iteration of the method is capable of employing a library of APCs that comprises at least 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 APCs. 46. The method of any one of embodiments 1-45, wherein the TCR or antigen- binding thereof that binds to a tumor neoantigen is identified within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks or 1 week. 47. The method of any one of embodiments 1-46, wherein one iteration of the method is completed within 6 months, 5 months, 4 months, 3 months, 2 months, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks or 1 week. 48. A TCR or antigen-binding fragment thereof identified by the method of any one of embodiments 1-47. 49. A polynucleotide encoding the TCR or antigen-binding fragment thereof of embodiment 48, or an alpha chain, a beta chain, a gamma chain, or a delta chain thereof. 50. A vector comprising the polynucleotide of embodiment 49. 51. The vector of embodiment 50, wherein the vector is a viral vector. 52. The vector of embodiment 51, wherein the viral vector is a lentiviral vector. 53. An engineered cell, comprising the TCR or antigen-binding fragment thereof of any of embodiments 1-47, the polynucleotide of embodiment 49 or the vector of any of embodiments 50-52. 54. A system, comprising: (a) a first device comprising a plurality of locations, each location comprising a TCR- expressing T cell comprising one of a plurality of nucleic acid molecules, each nucleic acid molecules comprising a nucleic acid encoding a functional TCR from a T cell obtained from a biological sample from a subject having a tumor; (b) a computer for identifying candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from the biological sample to the corresponding genomic DNA sequences and RNA expression profiles of non-tumor cells from the same subject; (c) a second device comprising a plurality of locations, each location comprising an antigen-presenting cell (APC) comprising one of a plurality of tandem candidate neoantigen vectors each encoding one or more of the candidate tumor neoantigens or fragments thereof,into a plurality of APCs capable of expressing the one or more candidate tumor neoantigens or fragments thereof complexed with a major histocompatibility complex (MHC) molecule; (d) a third device for contacting one or more cells in a location of the first device with one or more cells in a location of the second device. EXAMPLES

[0240] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention. Example 1. A Computational Neoantigen Discovery Pipeline

[0241] A computational neoantigen discovery pipeline was developed, an exemplary schematic of which is shown in FIG.1A and described below.

[0242] As input, the pipeline used data from DNA sequencing (e.g., whole genome sequencing or exome sequencing) of tumor and non-tumor tissue from a subject, and RNA sequencing of the tumor tissue. The sequencing information was then used to identify nonsynonymous mutations present in the tumor sequences that were not present in the non- tumor sequences. The nonsynonymous mutations were considered to be candidate neoantigens. As output, the pipeline constructed, in silico, candidate neoantigen minigenes, which were used to identify neoantigen-specific T cell receptors (TCRs). The following is a summary of the major processes of an exemplary computational neoantigen discovery pipeline.

[0243] In this exemplary pipeline, for pre-processing steps, Spliced Transcripts Alignment to a Reference (STAR) module (Dobin et al., 2013, Bioinformatics, 29(1), 15–21) was used to align RNA-seq data, and Burrows-Wheeler Aligner (BWA) module (Li and Durbin, 2010, Bioinformatics, 26(5), 589–595) was used to align genome sequencing data to the reference genome HG19 with decoy. Aligned tumor and non-tumor DNA sequences were locally realigned and recalibrated by standard GATK best practices (McKenna et al., 2010, Genome Research, 20(9), 1297–1303).

[0244] Next, tumor-specific variants were identified using Mutect, Mutec2 (Benjamin et al., 2019, BioRxiv, 1–8. https: / / doi.org / 10.1101 / 861054), Somatic Sniper (Larson et al., 2012, Bioinformatics, 28(3), 311–317), VarScan2 (Koboldt et al., 2012, Genome Research, 22(3), 568–576), and Strelka2 (Kim et al., 2018, Nature Methods, 15, 591–594) modules. Non- synonymous variations (i.e., mutations altering the amino acid sequence encoded by a gene) were identified using VEP (McLaren et al., 2016, Genome Biology, 17(1), 1–14) and SNPeffs (Cingolani et al., 2012, Fly, 6(2), 80–92) module. The identified mutations were used to designcandidate neoantigen minigene constructs (e.g., encoding polypeptide fragments comprising the amino acid sequence of the mutation and surrounding amino acids, for example, as described in Example 4).

[0245] The subject HLA types were predicted from the sequencing data, using Seq2HLA (Boegel et al., 2012, Genome Medicine 4, Article number:102), and OptiType (Szolek et al., 2014, Bioinformatics, 30(23), 3310–3316) module. Candidate neoantigen minigene constructs were ranked based on MHC binding predictions with the predicted HLA types, using NetMHCpan 4.0 module and other methods (Jurtz et al., 2017, J Immunol 199(9), 3360-3368; Nielsen and Lund, 2009, BMC Bioinformatics, 10, 296; O’Donnell et al., 2018, Cell Systems 7(1),129-132.E4). RNA-seq data was used to determine tumor expression levels of genes encoding the candidate neoantigens. Candidate neoantigen minigenes were ranked based on multiple criteria, including MHC binding predictions and tumor expression levels.

[0246] The identified and ranked neoantigen minigenes were used to construct tandem minigenes for neoantigen screening libraries, for example, as described below in Example 4. Example 2. Obtaining Samples from Subject

[0247] Samples were obtained from a 68 year-old Caucasian female with melanoma for the exemplary studies described below. A melanoma tumor sample obtained from the subject was minced and frozen in multiple aliquots for subsequent isolation of tumor cells, tumor infiltrating lymphocytes (TILs) and nucleic acid (DNA and RNA). Non-tumor peripheral blood mononuclear cells (PBMCs) were obtained from the subject for isolation of DNA. Example 3. Recombinant TCR Library Generation and Validation

[0248] Tumor infiltrating lymphocytes (TILs) were isolated from an aliquot of the tumor sample obtained in Example 2, and a library of T cell receptor (TCR)-encoding reporter cells were generated, for screening for neoantigen-specific TCRs.

[0249] Fluorescence activated cell sorting (FACS) was used to isolate individual viable tumor infiltrating CD8+ T cells with a CD69hi PD1hi phenotype, as shown in FIG.2. In total, 192 single TILs were isolated from the tumor sample aliquot.

[0250] For each isolated TIL, cDNA corresponding to TCR-encoding RNA was obtained, and used to generate a library of lentiviral TCR expression vectors, each encoding a functional TCR alpha chain and beta chain pair or gamma chain and delta chain pair, from one TIL, generally as described in, for example, WO 2018 / 102473. A total of 192 lentiviral expression vectors were generated.

[0251] A TCR-negative Jurkat cell line with a NFAT-GFP reporter transgene (designed to express GFP upon signaling via the TCR) was transduced with each of the 192 TCR-encoding lentiviral expression vectors. Flow cytometry with an anti-TCR monoclonal Ab (IP26) was used to identify successfully transduced cells expressing a functional TCR. In total, 152 of the 192 TCRs were successfully expressed (79% efficiency). Individual Jurkat reporter cell lines were established for each of the 152 TCRs. Aliquots for each of the cell lines were frozen for future use.

[0252] The Jurkat TCR-expressing reporter cell lines were validated by screening directly against tumor cells isolated from the subject. Each of the cell lines was cultured in the presence of tumor cells, then assessed by flow cytometry for TCR activation based on upregulation of CD69 (as an indicator of T cell activation) and GFP expressed from the NFAT-GFP reporter transgene.17 of the cell lines exhibited upregulation of CD69 and GFP.

[0253] The results suggest that the described methods represent an efficient platform for generating a library of TCR-reporter lines that can be screened to identify individual neoantigen-specific TCRs. Example 4. Identification of Candidate Neoantigens using the Computational Neoantigen Discovery Pipeline

[0254] Candidate neoantigens were computationally identified based on high-throughput DNA and RNA sequencing of tumor samples, for generation of candidate neoantigen minigene library. DNA was isolated from non-tumor (PBMC) and tumor samples obtained as described in Example 2, and subjected to whole genome sequencing (WGS). WGS resulted in approximately 1.3 billion reads and 90x coverage for tumor DNA, and approximately 0.4 billion reads and 30x coverage for non-tumor DNA. RNA was isolated from tumor samples obtained as described in Example 2, and subjected to high-throughput RNA-sequencing (RNAseq), resulting in approximately 50 million reads. The sequencing data was then used to identify candidate neoantigens using the computational neoantigen discovery pipeline as described in Example 1.

[0255] In total, approximately 47,000 tumor-specific variants were identified, including 250 coding mutations (amino acid changes). A tumor mutation burden (TMB) of 14 mutations per million base pairs was computed. 60% of the total somatic mutations were C:G to T:A mutations, consistent with a UV-induced mutation pattern.

[0256] Of the tumor-specific variants, 234 single-nucleotide variants (SNVs) and 6 indels (including 5 frameshifts) were identified as non-synonymous mutations.22 of the 234 SNVswere located in genes that were expressed in the tumor, based on RNAseq data. In silico- constructed neoantigen minigenes for 14 of the 22 SNVs were predicted to bind strongly to MHC. The in silico-constructed neoantigen minigenes for the 14 SNVs with tumor expression and predicted MHC binding were used to guide construction of a tandem minigene neoantigen library, as described in Example 5. Example 5. Generation of a Tandem Minigene Neoantigen Library

[0257] Tandem minigene (TMG) expression constructs were designed to express a single polypeptide containing multiple neoantigen minigenes. An exemplary schematic of the tandem minigene polypeptide encoded by the construct is depicted in FIG. 3. Each neoantigen minigene typically comprised a 25 amino acid (AA) sequence, containing the SNV and 12 amino acids upstream and downstream of the SNV. In the construct used in the study, the polypeptide had a N-terminal ubiquitin moiety, with the mutation G76V to prevent cleavage. The “non-cleavable” ubiquitin moiety promotes proteasomal degradation of the polypeptide to maximize presentation of processed neoantigen minigenes on MHC-I. Spacer sequences separating the ubiquitin moiety and each of the neoantigen minigenes were included, to promote efficient epitope processing.

[0258] The 14 SNV candidate neoantigen minigenes were cloned into 7 TMG constructs, each TMG containing 2 neoantigen minigenes. For each TMG, a gene block (gBlock; fragment of double-stranded DNA) was synthesized, encoding a TMG polypeptide sequence with the non-cleavable ubiquitin moiety and two 25-mer SNV-containing neoantigen minigenes separated by an AAY amino acid spacer sequence. gBlocks were cloned by Gibson assembly into an exemplary lentiviral vector (as depicted in FIG.4) for expression of the TMGs, and a truncated nerve-growth-factor receptor (tNGFR) or mCherry as a marker for transduction.

[0259] In this study, cloning was performed in a parallel and automated manner using automated liquid handler instruments to reduce reagent use and increase cloning efficiency. gBlocks containing sequences for assembly using Gibson cloning were incubated with linearized vector at a 3:1 molar ratio, respectively, and incubated in the presence of Gibson Reagent for 1 hour at 50°C in 96-well plate format.1µL of the Gibson assembly reaction was used to transform 25µL of competent bacteria, which were plated to obtain colonies. Colony PCR was used to verify successful assembly of TMG lentiviral constructs. TMG constructs were successfully assembled with 95% efficiency. Plasmids were recovered from colonies for transduction into antigen presenting cells, as described below.Example 6. Identification of Neoantigen-Specific TCRs using the Neoantigen-specific TCR Discovery Platform

[0260] The library of TCR-expressing reporter cell lines were screened against TMG- transduced antigen presenting cells in a high-throughput format to identify neoantigen-specific TCRs in a high-throughput manner.

[0261] The Jurkat TCR-expressing reporter cell lines, generated as described in Example 3, were successfully recovered from frozen aliquots with >85% efficiency. Lymphoblastoid cell line cells (LCLs) were used for antigen presentation. LCLs were transduced with each of the TMG-encoding constructs, generated as described in Example 5, and purified by FACS sorting based on mCherry fluorescence. Each of the recovered TCR-expressing reporter cell lines was co-cultured with each of the TMG-transduced LCLs. After co-culture, TCR-expressing reporter cell lines were assessed by flow cytometry for TCR activation based on upregulation of CD69 and GFP expressed from the NFAT-GFP reporter transgene.

[0262] As shown in FIGS5-7, in this study, 6 unique TCRs were identified as being activated in the presence of LCLs expressing TMGs, and each of the TCRs was activated by a specific TMG. Four (4) different TMGs (out of 7) led to activation of at least 1 TCR. Four (4) of the 6 activated TCRs were among the 17 TCRs activated in the presence of tumor cells, described in Example 3.

[0263] In this exemplary study, because each TMG contained two candidate neoantigen minigenes, experiments were performed to identify the neoantigen minigene each TCR was specific for. As shown in FIG.5, exemplary TCRs TCR-A, TCR-C, and TCR-D were activated in the presence of the TMG “TMG-03-05,” which contained the candidate neoantigens “Neo- 03” and “Neo-05”. As shown in FIG.6, the TCRs was tested for reactivity in the presence of (a) the original TMG with both neoantigens present (TMG-03-05), (b) the TMG with an unmutated “wildtype” (WT) sequence corresponding to Neo-03 (TMG-03WT-05), or (c) the TMG with a WT sequence corresponding to Neo-05 (TMG-03-05WT). TCR-A specifically activated in the presence of the Neo-05 neoantigen, whereas TCR-C and TCR-D specifically activated in the presence of the Neo-03 neoantigen.

[0264] As shown in FIG. 65 TCR-B activated in the presence of TMG-01-10, TCR-E activated in the presence of TMG-07-09, and TCR-H activated in the presence of TMG-06-08. As shown in FIG. 7, these TCRs were also tested for reactivity in the presence of TMGs containing WT or mutated versions of the neoantigens. TCR-B activated in the presence of Neo-01, TCR-E activated in the presence of Neo-09, and TCR-H activated in the presence of Neo-06.

[0265] In summary, 6 unique TCRs were identified that were specific for 5 different predicted neoantigens. 5 out of the 14 predicted neoantigens led to activation of the TCRs, representing a hit rate of >35% of predicted neoantigens. This hit rate was shown to be substantially higher than the hit rate as reported in a previous study (Wells et al., Cell 2020 Oct 29;183(3):818-834).

[0266] The results support the utility of the described computational neoantigen discovery pipeline and neoantigen-specific TCR discovery platform for rapid and cost-effective discovery of personalized neoantigen-specific TCRs. The described pipelines and platforms can also support biological insights regarding the nature and biological mechanism of tumor neoantigens and neoantigen-specific TCRs. Example 7. Neoantigen-specific TCR Discovery Platform for Personalized Treatment

[0267] The computational neoantigen discovery pipeline and neoantigen-specific TCR discovery platform, as described above, was used for a personalized adoptive cell therapy treatment for a subject with cancer.

[0268] A schematic of an exemplary platform combining the described components as described above, is shown in FIG.8. As described, tumor and non-tumor tissues were obtained from the subject. DNA and RNA sequencing data from the samples were used to predict candidate neoantigens and generate a TMG library, generally as described in Examples 1, 4, and 5. In parallel, individual TILs were isolated from the tumor sample, and used to sequence TCRs and generate TCR-expressing reporter cell lines, generally as described in Example 3. Reporter T cell lines were screened against the TMG library to identify neoantigen-specific TCRs, generally as described in Example 6.

[0269] A population of engineered T cells expressing one of the identified neoantigen- specific TCRs is prepared. Alternatively, multiple engineered T cell populations are prepared, each expressing a different neoantigen-specific TCR. The one or more populations of engineered T cells is administered to the subject. The engineered T cells mount an immune response against tumor tissue expressing the neoantigen, thereby reducing or eliminating the cancer. Example 8. Application of Neoantigen-Specific TCR Discovery Platform to Samples from Multiple Subjects with Head and Neck Tumors

[0270] To further demonstrate the utility of the neoantigen-specific TCR discovery platform, samples from three additional subjects having head and neck tumors were assessed. Tumor andnon-tumor samples were obtained from each subject, as described above.

[0271] Subject 1 was a 69 year-old female with squamous cell carcinoma of the oral cavity (inner mucosa of lower lip). Subject 2 was a 74 year-old male with squamous cell carcinoma of the oral cavity. Subject 3 was a 41 year-old Caucasian female with squamous cell carcinoma of the oral cavity (left lateral oral tongue).

[0272] For each subject, individual TILs were isolated and were used to clone and sequence TCRs, generate lentiviral TCR expression vectors, generally as described in Example 3. In total, 1,673 TILs were processed. Clonality of the TCRs was assessed in each of the three samples. Samples from Subject 2 were selected for further analysis.384 individual TILs with an effector memory / resident memory phenotype were isolated by flow cytometry. The TILs were used to generate a library of Jurkat TCR-expressing reporter cell lines using a high- throughput method, as described in Example 3. In parallel, tumor and non-tumor (blood) DNA, and tumor RNA were isolated and sequenced. Sequencing data was analyzed using the computational neoantigen discovery pipeline, generally as described in Examples 1 and 4. In total, approximately 40,000 tumor-specific variants were identified (representing a tumor mutation burden of approximately 13 mutations per million base pairs), including 301 non- synonymous missense and 14 frameshift mutations. 142 of the missense mutations and 1 frameshift mutation were located in genes that were expressed in the tumor, based on RNA- seq data. In silico-constructed neoantigen minigenes for 76 of the mutations were predicted to bind strongly to MHC.

[0273] Samples from Subjects 1 and 3 are processed to generate Jurkat TCR-expressing reporter cell lines, and identify in silico-constructed neoantigen minigenes. Neoantigen minigenes from each of the subjects are used to guide construction of a tandem minigene candidate neoantigen library, generally as described in Example 5. The library of Jurkat TCR- expressing reporter cell lines are screened against the candidate neoantigen libraries to identify neoantigen-specific TCRs. Example 9. Neoantigen-Specific TCR Discovery Platform

[0274] This Example describes further details of an additional exemplary computational neoantigen discovery pipeline and neoantigen-specific TCR discovery platform.

[0275] Candidate tumor neoantigen TMG library construction and screening is optimized for increased capacity and efficiency. Tumor and non-tumor tissue samples are obtained from a subject. Samples are analyzed to identify in silico-constructed candidate neoantigen minigenes, which are used to guide construction of the optimized tandem minigene library. A library of20 TMGs is constructed, containing a total of 50 neoantigen minigenes. Each TMG contains 5 neoantigen minigenes, and each neoantigen minigene is represented twice in the library (i.e., on two separate neoantigen minigenes or TMGs). Because each neoantigen minigene is expressed on a unique combination of the 20 TMGs, TCR responses to specific neoantigen minigenes can be deduced based on a unique two-TMG activation signature. The TMG library is expressed from an optimized expression vector. For example, the expression vector may contain optimized flexible linker sequences and spacer sequences, and may be tested for optimal expression in transduced cells. The 20 TMGs are transduced into antigen presenting cells (e.g., LCLs), and the transduced cells are enriched by FACS sorting.

[0276] In parallel, isolated TILs are used to generate TCR-expressing reporter cell lines. Multiple TCR-expressing reporter cell lines are tested for optimal readout of TCR activation. For example, different reporters (e.g., GFP, RFP, luciferase) are expressed from the cell lines that are compatible with a high-throughput TCR activation assay.

[0277] Each TCR expressed in an optimized TCR-expressing reporter cell line is screened against each of the 20 TMGs expressed by antigen presenting cells. TCRs are assessed for activation by specific TMGs. 2-TMG activation signatures are used to identify TCRs with specificity for individual candidate neoantigens. Example 10. Adoptive Cell Therapy for the Treatment of Solid Tumors.

[0278] MC38 tumors were isolated from five mice mouse. Tumor infiltrating T cells (TILs) were then isolated from the tumors. A high-throughput TCR cloning method (WO2018102473) was used to clone TCRs from the TILs. These TCRs were then expressed these in a reporter T cell line. As described herein, DNA sequencing of the MC38 tumor was performed and compared to a B6 reference genome to identify tumor-specific nonsynonymous mutations informatically predicted to create neoantigen peptides. After ranking on predicted MHC binding and gene expression levels, the top 212 neoantigen coding sequences were cloned into 55 tandem minigenes (TMG) and the TMG library was transduced into fibroblasts (APCs).294 TIL-associated TCRs from the MC38 tumors from the 5 different mice were tested against the 55 TMGs cells as described herein. Reactive TCRs were identified by the upregulation of CD69 in the reporter cells.36 unique TCRs responsive to MC38 mutations were identified.12 of the TCRs recognized a single amino acid difference in the gene RPL18. Neoantigen affinity and expression levels are characterized for multiple anti-RPL18 TCRs. Retrovirus vectors and CRISPR / Cas9 were then used to knock out endogenous TCR loci in T cells and insert the heterologous anti-RPL18 TCRs to create engineered T cell expressing a high affinity (A09) orlow affinity (I20) anti-RPL18 TCRs. The engineered T cells were then administered to tumor- bearing mice. Tumor growth of regression was monitored following administration of the engineered T cells. Tumor regression was observed in 76% and 74% of the tumors treated with engineered T cells expressing A09 (n=34) anti-RPL18 or I20 (n=35) anti-RPL18 TCRs. In contrast, regression was observed in only 37.5% (n=32) of the mice treated with control T cells.

[0279] A. Overview: Generation of neoantigen-reactive T cells for adoptive cell therapy. MC38 tumors were excised and genomic DNA from the tumors was isolated. The genomic DNA was then subjected to whole genome sequencing (WGS) and mutation (neoantigen) identification. A library of tumor neoantigens was created and ranked, followed by creation of TMGs for expressing the neoantigens in APCs. TCRs are cloned from tumor-infiltrating CD8+T cells isolated from the tumors, cloned, and expressed in reporter T cell line having a luciferase / eGFP / CD69 reporter gene. The TCR-transduced reporter cells were then co-cultured with the APCs expressing the TMGs and neoantigen-reactive T cells were identified and isolated. Reactive TCRs are characterized and expressed in primary T cells that had been modified to knock out the endogenous TCR. The engineered T cells were then used in adoptive T cell therapy tumor treatment.

[0280] B. MC38 Neoantigen identification and Tandem Minigene Expression. As described above, MC38 tumor cells were isolated and the genome sequenced and compared to a B6 reference genome. 320,000 variations between the MC38 genome and the B6 genome were identified. The 360,000 variations were present in 4280 exons. The variations in 4280 exons were then narrowed to 807 non-synonymous mutations. After additional analysis, the 807 non- synonymous mutations were further narrow to about 100 top predicted neoantigen genes. Seven of the identified neoantigens are shown in Table 3.

[0281] Table 3. MC38 neoantigen rankings.1 predicted binding to MHC (net-MHC score) 2 expression level as determined by published RNA-seq data

[0282] TMG Vectors. Of the 800+ genes identified, the top 100 neoantigens were assembled into a library of 26 TMG vectors. (i.e., 26 TMG vectors were generated coding for 100 neoantigens; see Table 4, TMGs 3.1-3.26). Each TMG vector encoded 6-10 minigenes (4-8 MC38 neoantigen minigenes). The first and last (e.g., 1stand 10th) minigene in each TMG encoded OVA and H60 epitopes, respectively, as expression controls not present in tumors. Each minigene encoded 25 amino acids or less. Where possible, each minigene encoded 12 amino acids upstream and 12 amino acids downstream of the identified mutation. Each MC38 minigene was represented twice in the TMG library to aid in identifying the TCR matched to the neoantigen – once in TMG vectors 3.1-3.13 and once in TMG vectors 3.14-3.26. TMG 3.0 contained previously published MC38 neoantigens. Table 4. Tandem mini-gene vectors.* differed in their published peptide sequence from our MC38 tumor line at multiple positions

[0283] C. TCR cloning. TILs from dissected MC38 cells were single cell sorted into 384- well plates. Then TCR-α and TCR-β sequences were amplified by single cell PCR and assembled into a retrovirus vector also expressing a puromycin resistance gene. Retrovirus vectors encoding 186 TCRs vectors were individually transduced into TCRnegJurkat reporter cell. Each retrovirus vectors encoded a TCRα gene and a TCRβ gene for single TCR. The TCRα and TCRβ genes linked by a P2A sequence to enable expression from a single promoter. The retroviral vectors further encoded mCherry and a puromycin resistance gene (PuroR). The coding sequence for the mCherry gene was operably linked to the coding sequence for the TCRβ gene via a IRES sequence and PuroR gene was operably linked to the mCherry gene via a T2A sequence. Enrichment for transduced Jurkat cells was done by puromycin selection. TCR cloning efficiency (percent of murine TCR-β+cells within the transduced population) was 76% as determined by flow cytometry.

[0284] D. Screening MC38 Neoantigen-Specific TCRs.145 Jurkat cultures expressing single candidate TCRs were grouped into 29 pools of 5 lines (TCRs) and co-cultured in 96 well plates against TMG-transduced B6WT3 cells, MC38 cells, B6 bone marrow dendritic cells (BMDC), or untransduced B6WT3 with H2-Dbor H2-Db / Kbdeleted. Activated T cells were determined by induction of CD69. Single TCRs from each activated pool were then coculture against the same TMGs that stimulated activation to determine which TCR recognized which neoantigen. After screening 294 TCRs against a library of 212 neoantigens, 36 unique TCRs that recognize 6 different neoantigens were identified (see Table 5.) RPL18 is a known neoantigen expressed in MC38 tumors, indicating the method is effective in identifying neoantigens useful in targeted anti-tumor therapies, such as Adoptive Cell Therapy or engineered T cell therapy. Table 5. TCRs identified that recognize MC38 neoantigens

[0285] E. In vitro Characterization of anti-RPL18 TCRs. TCRneg4G4 cells were transduced with matched titers of retroviral vectors encoding A09, I20, and I02 anti-RPL18 TCRs. Transduction was carried out to yield 20% transduction for each TCR (as determined by flow cytometry measuring TCRβ and mCherry expression). At matched transduction, the 4G4 cells were stained in serial dilution with RPL18-KILTFDRL dextramer. The results indicated a diversity of RPL18-DEX mean fluorescence intensities (MFIs) among TCRs (FIG. 9). As shown in FIGs.10-12, anti-RPL18 TCR I02 had the highest TCR expression, anti-RPL18 TCR A09 had the highest RPL18-dextramer affinity, and anti-RPL18 TCR I20 had both the lowest TCR expression and the lowest RPL18-dextramer affinity.

[0286] F. CRISPR KO and RPL18-Specific TCR Transduction in T Cells. Engineered polyclonal T cells were made by transducing nucleic acids encoding anti-RPL18 TCRs (A09, I20, or I02) or a control anti-OVA TCR into primary T cells. The primary T cells were activated using plate bound anti-CD3, soluble anti-41BB, anti-CD28 and IL-2. The endogenous TCR was knocked out in the T cells by CRISPR-Cas9 using TRAC and TRBC gRNA. FIG. 13A (top row) shows representative CD8+and CD4+stained cells expressing RPL18-specific TCRs A09, I20, I02, OVA-specific TCR OT1, and an untransduced control. FIG.13A (bottom row) shows representative TCR and RPL18-dex staining of CD8+cells. The engineered T cells were then tested for their ability to target and kill MC38 tumor cells and RPL18-peptide pulsed B6WT3 cells. As shown in FIG. 13B, the engineered T cells expressing heterologous anti- RPL18 TCRs killed both MC38 tumor cells and RPL18-peptide pulsed B6WT3 cells at a higher rate than control T cells expressing a heterologous anti-OVA TCR. Area under the curve analysis for each TCR against MC38 cells (top) and RPL18-peptide pulsed B6WT3 cells were calculated and shown in FIG.13C. Groups were compared via one-way ANOVA followed by Tukey Post-hoc test *** p < 0.01, **** p < 0.001. Example 11. Engineered T cell treatment of MC38 tumors in mice.

[0287] C57Bl / 6 mice received intradermal injections of 2×105MC38 cells. At 9 days post- injection, mice with a >2 mm tumor diameter were treated with engineered T cells expressinga heterologous anti-RPL18 TCR (A09, I20, or I02) or a control anti-OVA TCR (“day 0”). Cell numbers were normalized so that all mice received 2×106RPL18 dextramer-binding CD8+cells along with ‘carried T cells’. 18-24 h post-infusion, mice received 50 μg of anti-CD40 antibody. Tumor size was measured in two dimensions by two masked judges with a high degree of agreement. Data are representative of 1 of 3 independent experiments. The area under the curve was calculated for the tumor growth and the groups were compared via one-way ANOVA with a Tukey post-hoc test. As shown in FIG. 14, mice treated with engineered T cells expressing a heterologous A09 or I20 anti-RGP18 TCR exhibited significant tumor regression compared to mice treated with engineered T cells expressing a control anti-OVA18 TCR.

[0288] The percent changes in tumor volume from day −1 of treatment to the last day of the experiment were calculated. Pooled data from three experiments are shown in FIG. 15. The number of mice with regressed tumors in the A09 or I20 treated groups was compared to that of the control cell group via a Fisher’s Exact test. The percent regressed was significantly higher mice treated with engineered T cells expressing a heterologous A09 or I20 anti-RGP18 TCR. On the last day of the experiment, spleens were examined by flow cytometry and the donor cells identified by CD90.1 expression. The total number of donor CD8 cells per spleen was not significantly different between the different treatment groups. The immune infiltrate of the tumors as assessed by flow cytometry. Donor cells were CD90.1+. At late stages of the experiments, many tumors were only detectable at dissection and thus are not included in tumor growth scoring. The number of donor CD8+cells recovered was significantly increased in the mice treated with engineered T cells expressing a heterologous I20 anti-RGP18 TCR. There were no differences in the number of endogenous T cells in tumors. Data were compared via a Kruskal-Wallis test with a Dunn’s multiple comparison test * p=0.02. Binding of dextramer to donor CD8+cells was determined. Absolute RPL18-dextramer MFIs were higher in the tumor infiltrating lymphocytes than in the spleen.

[0289] Using the described methods, neoantigens are identified from a mouse tumor model. The identified neoantigens could then be used to capture TCRs that were specific to the identified antigens. The TCRs could then be used to generated engineered T cells that were effective in targeting and treating a tumor expressing the neoantigen. Both low and high affinity TCRs were effective in treating solid tumors. Example 12. Identification of TCRs and neoantigens from a solid tumor

[0290] A lung tumor sample was acquired, processed into quadrants, and single cell sorted. Between 1,500 tumor-infiltrating lymphocytes (TILs) are collected. A subset of the TILs were surface stained for flow cytometry and single cell sorting. Sorted plates are cryopreserved and can be returned to later if necessary (e.g., increased or additional CDR3 diversity is desired). Normal, margin, and tumor tissues were processed for genomic DNA and RNA sequencing.

[0291] Sorted plates were moved through the TcXpress (WO pipeline, in which TRAV and TRBV fragments were cloned and assembled into about 1000 expression vectors. TRBV next generation sequencing was conducted for the cloned TCRs.700 TCRs were moved through the pipeline for assembly into the lentiviral TCR expression vectors. The lentiviral TCR expression vectors were then used to generate a reporter T cell (Jurkat) cell library.

[0292] 300 non-synonymous, protein-coding mutations were identified by differential whole genome sequencing (i.e., normal tissue versus tumor tissue). A subset of those candidate mutations was supported by tumor RNA expression (from RNAseq analysis) and additional criteria. 150 neoAgs were selected for assembly into 5-antigen tandem mini gene (5TMG) constructs, yielding 30 tandem mini genes (TMGs). Predicted TMGs are ordered for gene synthesis, high-throughput cloned into a TMG expression vector, and lentivirus constructs were generated. and ultimately transduced into an APC line. The full patient HLA haplotype was re-assembled using the methods described herein. The full HLA patient haplotype was expressed in two discreet K562 cell lines, each carrying an HLA-A, B, and C. The 30 TMG- lentivirus constructs are each transduced into two K562 cell lines, yielding 60 K562 clones. Collectively, each predicted TMG construct was screened against the full patient HLA haplotype.

[0293] The APC and reporter T cell libraries are mixed at high dimensionality to screen each HLA, TCR, and neoAg combination possible.

[0294] 32 unique TCRs per well were co-cultured against 6 unique APC clones (each carrying 5 NeoAg minigenes).960 unique interactions are assessed per well at this co-culture dimensionality. The maximum “hit response” on the flow cytometry readout for a single responding TCR amongst a pool of 32 TCRs, (assuming 100% TCR transduction) was approximately 3%. Two neo-antigen specific “hit” TCRs were identified.

[0295] Reactive TCRs are deconvoluted from their respective screening pool. Single TCRs were then mapped to a specific HLA and TMG. The two reactive / hit TCRs were pool deconvoluted (moving from 32 potential TCRs down to a single unique TCR as defined by the CDR3B sequence). Following TCR deconvolution, single HLA-expressing K562 were engineered to identify and deconvolute the specific HLA restriction for the TCR. Next, thespecific TMG (amongst the pool of 6 potential TMG constructs) was deconvoluted, resulting in a single TCR paired with a single HLA allele that responded to the single TMG construct (which still contains 5 individual mini genes).

[0296] The 5TMG construct was genetically broken into single minigenes to identify the mutation of interest. That mutation was then genetically reverted to germline to confirm loss of TCR reactivity against the non-mutated antigen.

[0297] TCR #1 reacted specifically to TMG#1, which carried 5 unique neoantigen mini genes. After deconvoluting the HLA-restriction, NetMHCpan 4.1 HLA loading and prediction software was utilized to predict the specific NeoAg (of the 5 possibilities) that was specifically processed and loaded onto the previously identified HLA. NeoAg#1 alone (i.e., a single neoAg- expressing construct) was synthesized, cloned into an expression vector, and transduced into the matching HLA-expressing K562 (alternatively, HLA-restricted peptides predicted by NetMHCpan can be ordered directly for peptide synthesis). Simultaneously, a germline reversion (in which the mutated SNP was reverted to germline sequence) construct of the same NeoAg was generated. In the final confirmation, the single NeoAg and the single germline reversion of that NeoAg were assessed for reactivity against the identified TCR, thereby confirming successful identified a neoantigen TCR that does not react against the normal antigen. A similar workflow was followed to deconvolute hit TCR #2 and NeoAg #2.

[0298] Flow cytometry analyses were used to assess TCR signaling and reactivity.

[0299] The present invention is not intended to be limited in scope to the particular disclosed embodiments, which are provided, for example, to illustrate various aspects of the invention. Various modifications to the compositions and methods described will become apparent from the description and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the disclosure and are intended to fall within the scope of the present disclosure.

Claims

Claims:

1. A method for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen associated with a disease or condition, the method comprising: (a) forming a library of TCR-expressing reporter T cells, wherein each T cell in the library expresses a single functional TCR; (b) forming a library of candidate antigen-expressing antigen-presenting cells (APCs), wherein each APC in the library expresses one or more candidate antigens or fragments thereof associated with the disease or condition; (c) contacting the reporter T cells with the APCs; and (d) identifying a reporter T cell that is activated following contacting the library of TCR-expressing reporter T cells with the library of APCs, thereby identifying the TCR or antigen-binding fragment thereof that binds to the antigen associated with the disease or condition.

2. The method of claim 1, wherein the disease or condition is a cancer, an infection, a viral infection, a bacterial infection, an allergy, or an autoimmune disorder.

3. The method of claim 1 or 2, wherein forming the library of TCR-expressing reporter T cells comprises introducing a plurality of nucleic acid molecules, each comprising a nucleic acid encoding a functional TCR from a T cell obtained from a biological sample from a subject, into a plurality of reporter T cells.

4. The method of claim 3, wherein the subject has a tumor.

5. The method of any one of claims 1-4, wherein the disease is cancer, the candidate antigens or fragments thereof are tumor neoantigens, and the library of candidate antigen-expressing APCs is a library of neoantigen-expressing APCs.

6. The method of any one of claims 1-5, wherein forming the library of neoantigen-expressing APCs comprises: (i) performing genomic DNA sequencing and RNA expression profile analysis on cells obtained from a tumor in a subject; (ii) performing genomic DNA sequencing on non-cancerous cells obtained from the subject;(iii) identifying expressed mutations in the genome of the tumor cells relative to the non-cancerous cells; (iv) forming a library of neoantigen expression vectors containing neoantigen minigenes encoding candidate tumor neoantigens or fragments thereof containing the mutations identified in step (iii); and (v) introducing the library of neoantigen expression vectors into a plurality of APCs capable of expressing the one or more candidate tumor neoantigens complexed with a major histocompatibility complex (MHC) molecule.

7. The method of claim 6, wherein an antigen is identified as a candidate tumor neoantigen if: (i) a single nucleotide variant (SNV) or an insertion-deletion (indel) is present in the genomic DNA sequence of the gene encoding the antigen from the tumor cells from the biological sample, compared to the corresponding genomic DNA sequence of the gene encoding the antigen from the non-tumor cells from the same subject; and / or (ii) an SNV or an indel is present in an mRNA sequence of the gene encoding the antigen from the tumor cells from the biological sample, compared to the corresponding genomic sequence of the gene encoding the antigen from the non-tumor cells from the same subject.

8. The method of claim 7, wherein the SNV results in a non-synonymous mutation, a missense mutation, or a nonsense mutation in the gene encoding the antigen.

9. The method of claim 7, wherein the indel results in a frameshift mutation in the gene encoding the antigen.

10. The method of any one of claims 7-9, wherein the SNV or indel is present in a coding region or an exon of the gene encoding the antigen.

11. The method of any one of claims 7-9, wherein the SNV or indel is present in a regulatory region or an intron of the gene encoding the antigen.

12. The method of any one of claims 6-12, wherein the minigene encodes a 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid peptide containing the mutation, optionally wherein the minigene encodes about 4 to about 15amino acids upstream of the mutation and about 4 to about 15 amino acid downstream of the mutation.

13. The method of any one of claims 6-12, wherein each neoantigen expression vector in the library of neoantigen expression vectors each encodes one or more of the candidate tumor neoantigens or fragments thereof.

14. The method of claim 13, wherein the neoantigen expression vector encodes a fusion polypeptide comprising a modified ubiquitin moiety and at least one candidate tumor neoantigen or fragment thereof, optionally wherein the modified ubiquitin comprises a G76V amino acid substitution.

15. The method of any one of claims 6-14, wherein at least one of the neoantigen expression vectors comprises a tandem minigene vector.

16. The method of claim 15, wherein the tandem minigene vector encodes a fusion polypeptide comprising at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 candidate neoantigens or fragments thereof.

17. The method of any one of claims 6-16, wherein the neoantigen expression vectors are assembled using parallel cloning.

18. The method of any one of claims 6-17, wherein the neoantigen expression vectors are assembled using seamless cloning.

19. The method of any one of claims 6-18, wherein the neoantigen expression vectors comprise lentiviral vectors.

20. The method of any one of claims 6-19, wherein the library of neoantigen expression vectors comprises all, nearly all, greater than 95%, greater than 90%, greater than 85%, greater than 80%, greater than 75%, greater than 70%, greater than 60%, or greater than 50%, or a subset of the identified neoantigens from a subject.

21. The method of any one of claims 6-20, wherein the method further comprises predicting binding to an MHC molecule, predicting ability to induce an immune response, predicting cell processing of the identified expressed mutations.

22. The method of any one of claims 1-21, wherein the APCs comprise B- Lymphoblastoid Cell Line (B-LCLs), or artificial APCs, or K562 cells expressing an MHC molecule.

23. The method of any one of claims 1-22, wherein the MHC molecule comprises at least one human leukocyte antigen (HLA) allele that is expressed in the subject.

24. The method of claim 23, wherein the MHC molecule is a human leukocyte antigen (HLA)-A molecule.

25. The method of claim 24, wherein the HLA-A molecule is serotype HLA-A2, HLA-A*02:01, HLA-A*02:06, HLA-A*02:02, HLA-A*02:03, HLA-A*02:

07.

26. The method of claim 23, wherein the MHC molecule is an HLA-B and / or an HLA-C molecule.

27. The method any one of claims 6-26, wherein introducing the library of neoantigen expression vectors into the plurality of APCs comprises introducing each vector of the library of neoantigen expression vectors into at least two APCs, wherein the at least two APCs together are HLA matched to the subject.

28. The method of claim 27, wherein the at least two APCs comprise: (a) a first APC expressing a first HLA-A, a first HLA-B, and a first HLA-C of the subject and a second APC expressing a second HLA-A, a second HLA-B, and a second HLA-C of the subject; (b) a first APC expressing a first HLA-A and a second HLA-A of the subject, a second APC expressing a first HLA-B and a second HLA-B of the subject, and a third APC expressing a first HLA-C and a second HLA-C of the subject.

29. The method of any one of claims 6-28, wherein plurality of APCs are obtained from a library of APCs expressing combinations of HLA-A, HLA-B, and HLA-C alleles.

30. The method of claim 29, wherein library of APCs comprises a plurality of APCs wherein each APC in the library expresses an HLA-A allele, an HLA-B allele, and an HLA-C allele.

31. The method of claim 30, wherein the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in a population.

32. The method of claim 31, wherein the combinations of HLA-A, HLA-B, and / or HLA-C alleles present in the APCs in the library encompass the combinations of HLA-A, HLA-B, and HLA-C alleles present in more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the individuals in a population.

33. The method of any one of claims 29-32, wherein the HLA-A alleles, HLA-B alleles, and HLA-C alleles present in the library are provided in Table 1.

34. The method of any one of claims 6-33, wherein contacting the reporter T cells with the APCs comprises combining one or more TCR-expressing reporter T cells from the library of functional TCR-expressing reporter T cells with one or more APCs from the library of neoantigen-expressing APCs and co-culturing the cells under conditions suitable for activation of a T cell by binding of a TCR to a cognate antigen.

35. The method of claim 34, wherein contacting the reporter T cells with the APCs comprises co-culturing about 5×104to about 5×105reporter T cells with about 5×104to about 5×105neoantigen-expressing APCs.

36. The method of claim 34 or 35, wherein reporter T cells expressing each TCR are separately co-cultured with APCs containing each neoantigen expression vector, wherein each TCR / neoantigen expression vector combination is co-cultured in a separate sample.

37. The method of claim 34 or 35, wherein contacting the reporter T cells with the APCs comprises contacting a pool of reporter T cells expressing 1-100 different TCRs with a pool of APCs expressing 1-20 neoantigen expression vectors in a single sample.

38. The method of claim 37, wherein each neoantigen or fragment thereof is expressed in at least about 5% of the APCs in the pool of neoantigen-expressing APCs.

39. The method of claim 37 or 38, wherein each TCR is expressed by at least about 5% of the reporter T cells in the pool of reporter T cells.

40. The method of any one of claims 37-39, wherein the reporter T cells in the pool of reported T cells express two or more different detectable markers.

41. The method of any one of claims 1-40, wherein the library of TCR-expressing reporter T cells contains a plurality of reporter T cells expressing at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, or at least 500 different TCRs.

42. The method of any one of claims 1-41, wherein the library of neoantigen- expressing APCs contains a plurality of APCs expressing at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 different tumor neoantigens or fragments thereof.

43. The method of any one of claims 1-42, wherein the library of neoantigen- expressing APCs contains a plurality of APCs expressing at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 different neoantigen expression vectors.

44. The method of any one of claims 1-43, wherein the one iteration of the method is capable of screening at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, or at least 500 different TCRs and / or at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 different neoantigen expression vectors or tumor neoantigens or fragments thereof.

45. The method of any one of claims 1-44, wherein the reporter T cells are contacted with the APCs in a plurality of separate locations of a device.

46. The method of claim 45, wherein said plurality of separate locations is greater than 50, greater than 95, greater than 350, greater than 500, greater than 1500, greater than 3400, or greater than 5000.

47. The method of claim 45 or 46, wherein said device comprises a multi-well plate, optionally wherein said multi-well plate is a 96-well plate, a 384-well plate, or a 1536- well plate.

48. The method of any one of claims 1-47, wherein identifying an activated reporter T cell comprises detecting and / or quantitating a detectable marker.

49. The method of claim 48, wherein the detectable marker comprises a fluorescent protein or a cell surface marker.

50. The method of claim 49, wherein expression of the detectable marker by an activated reporter T cell is detected by flow cytometry.

51. The method of any one of claims 1-50, wherein identifying a sample containing an activated reporter T cell comprises determining the percentage of reporter T cells in the sample expressing the detectable marker, wherein detection of the detectable marker in at least about one half of the percentage of reporter T cells in the sample expressing a given TCR indicates activation of a reporter T cell in the sample.

52. An expression vector comprising a first nucleic acid sequence encoding a first HLA allele and a second nucleotide sequence encoding a second HLA allele wherein the first nucleic acid sequence and the second nucleic acid sequence are expressed from a single promoter and connected by a translation modification element.

53. The expression vector of claim 52, wherein the expression vector further comprises a third nucleic acid sequence encoding a selectable marker, optionally wherein the third nucleic acid sequence is expressed from the single promoter and connected to the second nucleic acid sequence by a translation modification element.

54. The expression vector of claim 52 or 53, wherein the expression vector encodes: (a) 2 different HLA-A alleles; (b) 2 different HLA-B alleles; (c) 2 different HLA-C alleles; (d) an HLA-A allele and an HLA-B allele (e) an HLA-A allele and an HLA-C allele;(f) an HLA-B and an HLA-C allele; or (g) an HLA-A allele, an HLA-B allele, and an HLA-C allele 55. A library of HLA expression vectors, wherein the library encodes a plurality of HLA-A alleles and / or HLA-B alleles and / or HLA-C alleles selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles and / or HLA-B alleles and / or HLA-C alleles present in a population.

56. The library of HLA expression vectors, wherein the population is selected from the group consisting of: a United States population, a European population, a Middle Eastern population, a Asian population, a Chinese population, a Japanese population, a Korean population, an Indian population, a North American population, a South American population, a African population, subgroups thereof, and combinations thereof.

57. The library of HLA expression vectors of claim 55, wherein (a) the plurality of HLA-A alleles comprises the HLA-A alleles of Table 1; (b) the plurality of HLA-B alleles comprises the HLA-B alleles of Table 1; and / or (c) the plurality of HLA-C alleles comprises the HLA-C alleles of Table 1.

58. The library of HLA expression vectors of any one of claims 55-57, wherein the library comprises a plurality of expression vectors each encoding a single HLA-1 allele and a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele.

59. The library of HLA expression vectors of claim 58, wherein the combinations of HLA-A, HLA-B, and HLA-C alleles present the library are selected to encompass the combinations of HLA-A, HLA-B, and / or HLA-C alleles present in more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the individuals in a population.

60. The library of HLA expression vectors of claim 58 or 59, wherein plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele, comprise expression vectors encoding the combinations of HLA-B alleles and HLA-C alleles of Table 2.

61. The library of HLA expression vectors of any one of claims 55-57, wherein the library comprises a plurality of expression vectors each encoding one or two HLA-As alleles, a plurality of expression vectors each encoding one or two HLA-B alleles, and / or a plurality of expression vectors each encoding one or two HLA-C alleles.

62. The library of HLA expression vectors of any one of claims 55-57, wherein the library comprises a plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele, optionally wherein the HLA-B alleles and HLA-C alleles selected to encompass than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-B and HLA-C alleles present in a population.

63. The library of HLA expression vectors of claim 62, wherein plurality of expression vectors each encoding an HLA-B allele and an HLA-C allele, comprise expression vectors encoding the combinations of HLA-B alleles and HLA-C alleles of Table 2.

64. The library of HLA expression vectors of any one of claims 55-63, wherein the expression vectors are lentiviral vectors.

65. The library of HLA expression vectors of any one of claims 55-64, wherein the expression vectors are codon optimized for a human subject 66. A library of APCs comprising a plurality of APC lines each expressing a single HLA-A allele, wherein the HLA-A alleles are selected to encompass more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99% of the HLA-A alleles present in a population, and wherein each line is maintained separately.

67. The library of APCs of claim 62, wherein the library of APCs comprises 22 APC lines expressing the HLA-A alleles of Table 1.

68. A combination comprising the library of APCs of claim 66 or 67 and the library of HLA expression vectors of claim 62 or 63.

69. A method of generating APCs HLA-matched to a subject comprising: (a) determining or having determined the HLA genotype of a subject;(b) selecting from the library of APCs of claim 66 or 67 a first APC expressing a first HLA-A allele of the subject and optionally a second APC expressing a second HLA-A of the subject; (c) selecting from library of HLA expression vectors of claim 62 or 63 a first expression vector encoding a first HLA-B allele and a first HLA-C allele of the subject and an optionally second expression vector encoding a second HLA-B allele and a second HLA-C allele of the subject; and (d) introducing the first expression vector into the first APC and optionally introducing the second expression vector into the second APC 70. A method of cloning a TCR or an antigen-binding fragment thereof that binds to a candidate antigen, the method comprising: performing the method of any one of claims 1-51, isolating a nucleic acid encoding the TCR from the activated reporter T cell identified in step (d), and inserting the isolated nucleic acid into a TCR expression vector.

71. The method of claim 70, wherein the TCR comprises a full-length α constant region and a full-length β constant region.

72. The method of claim 70 or 71, wherein the TCR expression vector is a lentiviral vector.

73. A TCR or antigen-binding fragment thereof identified by the method of any one of claims 1-51 or 70-72.

74. A nucleic acid encoding a TCR cloned according to the method of any one of claims 70-72.

75. A method of forming an engineered T cell for use in treating cancer comprising introducing the TCR expression vector of any one of claims 70-72 into a donor T cell.

76. An engineered T cell formed by the method of claim 75.

77. An engineered cell comprising the TCR or antigen-binding fragment thereof identified according to of any one of claims 1-51, the TCR expression vector of claim any one of claims 60-72, or the nucleic acid of claim 74.

78. A system, comprising: (a) a first device comprising a plurality of locations, each location comprising 1-100 TCR-expressing T cell lines wherein each TCR-expressing T cell line comprises a nucleic acid encoding a functional TCR from a T cell obtained from a first biological sample from a subject having a tumor; (b) a computer for identifying candidate tumor neoantigens by comparing genomic DNA sequences and RNA expression profiles of tumor cells from the subject to corresponding genomic DNA sequences from non-tumor cells from the same subject or a control subject; (c) a second device comprising a plurality of locations, each location comprising a pool of neoantigen-expressing APC lines, wherein each pool of neoantigen- expressing APC lines comprises 1-20 different neoantigen expression vectors, wherein each neoantigen expression vectors expresses 1-10 candidate neoantigens or fragments thereof, and wherein the APCs are capable of expressing the candidate neoantigens or fragments thereof complexed with a major histocompatibility complex (MHC) molecule; and (d) a third device for contacting one or more cells in a location of the first device with one or more cells in a location of the second device.

79. The system of claim 78, wherein the system further comprises a fourth device for analyzing activation of the T cells from in the TCR-expressing T cell lines following step (d).

80. The method of claim 2, wherein the disease is an infection and the candidate antigens or fragments thereof comprise one or more pathogen proteins or fragments thereof, optionally wherein the pathogen is a virus or bacterium.

81. The method of claim 2, wherein the condition is an allergy and the candidate antigens or fragments thereof comprise one or more allergen proteins or fragments thereof, optionally wherein the allergen is a food allergen or an environmental allergen.

82. The method of claim 2, wherein the condition is an autoimmune disorder and the candidate antigens or fragments thereof comprise one or more proteins or fragments thereof associated with a cell or tissue that is a target of the autoimmune disorder.

83. The method of any one of claims 1-51, wherein the method further comprises identifying the APC that activated the reporter T cell and the antigen expressed by the APC.

84. A method of identifying an antigen that is presented to the immune system in the context of HLA, the method comprising: (a) forming a library of TCR-expressing reporter T cells, wherein each T cell in the library expresses a single functional TCR; (b) forming a library of candidate antigen-expressing antigen-presenting cells (APCs), wherein each APC in the library expresses one or more candidate antigens or fragments thereof associated with the disease or condition; (c) contacting the reporter T cells with the APCs; (d) identifying a reporter T cell that is activated following contacting the library of TCR-expressing reporter T cells with the library of APCs, and (e) identifying the APC that activated the reporter T cell and the antigen expressed by the APC.

85. A method of identifying an antigen that is presented to the immune system in the context of HLA, the method comprising: performing the method of any one of claims 1- 51, and identifying the APC that activated the reporter T cell and identifying the antigen expressed by the APC.