Method of modulating mRNA translation

EP4716748A2Pending Publication Date: 2026-04-01YALE UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-23
Publication Date
2026-04-01

AI Technical Summary

Technical Problem

Current methods lack high-throughput capabilities to identify and modulate translational enhancers and silencers in mRNA 5' untranslated regions (UTRs), which are crucial for regulating mRNA translation efficiency, and there is a need for constructing mRNA molecules with desirable translational efficiencies for therapeutic applications.

Method used

A method involving modification of the 5' UTR of mRNA molecules to include specific translational enhancers or silencers, such as sequences identified by direct analysis of ribosome targeting (DART), and the incorporation of modified nucleobases to enhance or suppress translation, specifically for yeast and mammalian species, to achieve controlled ribosome retention scores.

Benefits of technology

This approach enables the modulation of mRNA translation efficiency by up to 1000-fold, facilitating the development of mRNA molecules with enhanced or reduced translation rates, suitable for producing therapeutic peptides or proteins, including vaccines, by systematically identifying and utilizing regulatory elements within the 5' UTRs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024030724_28112024_PF_FP_ABST
    Figure US2024030724_28112024_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are methods of modulating mRNA translational efficiencies with translational enhancers or silencers that affects ribosomal retention. Also described herein are mRNA molecules including translational enhancers or silencers, as well as modified nucleobases. Also described herein are methods of constructing an mRNA molecule for producing a therapeutic peptide or a therapeutic protein with the identified enhancers.
Need to check novelty before this filing date? Find Prior Art

Description

METHOD OF MODULATING mRNA TRANSLATIONCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 503,837, filed May 23, 2023, which is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under CA246118, ES031525, GM101316, GM125955, GM132358 and NS118616 awarded by National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] The XML text file named "047162-7464WOl(02242)_Seq Listing.xml" created on May 20, 2024, comprising 1,593,613 bytes, is hereby incorporated by reference in its entirety.BACKGROUND

[0004] The sequences and structures of 5’ untranslated regions (5’ UTRs) of mRNA molecules are known to affect translational efficiencies to a large extent. Specific sequence motifs in the 5’ UTR that increases and decreases translational efficiencies, called translational enhancers and translational silencers, however; remain largely unknown, and high-throughput methods that are able to identify translational enhancers and translational silencers are lacking.

[0005] Therefore, there is a need to develop high-throughput screening methods to identify translational enhancers and translational silencers, as well as a need to modulate mRNA translation with the identified enhancers / silencers and to construct mRNA molecules having desirable translational efficiencies. The present invention addresses these needs.SUMMARY

[0006] In some aspects, the present invention is directed to the following non-limiting embodiments:Method of modulating a translational efficiency of mRNA

[0007] In some aspects, the present invention is directed to a method of modulating a translational efficiency of a messenger RNA (mRNA) molecule.

[0008] In some embodiments the method includes: modifying a 5’-UTR of the mRNA molecule to include a translational enhancer or a translational silencer.

[0009] In some embodiments, modifying the 5’-UTR of the mRNA molecule includes modifying a sequence of a DNA molecule encoding the mRNA molecule.

[0010] In some embodiments, the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of a yeast species, optionally a yeast species selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris. Hansenula polymorpha, Yarrowia lipolylica. Arxula adeninivorans, Kluyveronryces lactis, and Schizosaccharomyces pomhe.

[0011] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and the translational enhancer includes at least one sequence selected from the group consisting of SEQ ID NOs: 1-3.

[0012] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 4-6.

[0013] In some embodiments, the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of a mammal, optionally a human.

[0014] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and the translational enhancer includes at least one sequence selected from the group consisting of SEQ ID NOs: 7-18, 29-51, 56-1344, 1345-1444, and 1545-1644.

[0015] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 19-28, 1445-1544, and 1645-1744.

[0016] In some embodiments, the 5’-UTR of the mRNA molecule is further modified to include a modified nucleobase.

[0017] In some embodiments, the modified nucleobase includes N6-methyladenosine, inosine, N1 -propylpseudouridine, N1 -methoxymethylpseudouridine, N1 -ethylpseudouridine, 5-meth oxy cytidine, 5-hydroxyuridine, 5-carboxyuridine, 5-formyluridine, 5-hydroxycytidine, 5- hyrdoxymethylcytidine, 5-hydroxymethyluridine, 5-formylcytidine, 5-carboxycytidine, N4- methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, N1 -methylpseudouridine, pseudouridine, 5-methyluridine, 5-methoxyuridine, dihydrouridine, 5-methylcytidine, 4- thiouridine, 2-thiouridine, uridine-5’-O-(l -thiophosphate), 5 -aminoallyluridine, or 4- acetylcytidine.

[0018] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and a ribosome retention score (RRS) of the modified mRNA molecule is 3X or higher than an RRS of the unmodified mRNA molecule.

[0019] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein a ribosome retention score (RRS) of the modified mRNA molecule is 0.3X or lower than an RRS of the unmodified mRNA molecule. mRNA molecule

[0020] In some aspects, the present invention is directed to an mRNA molecule.

[0021] In some embodiments, the mRNA molecule includes a 5’-UTR, and the 5’-UTR includes: a translational enhancer including at least one sequence selected from the group consisting of SEQ ID NOs: 1-3, 7-18, 29-51, 56-1344, 1345-1444, and 1545-1644, or a translational silencer including at least one selected from the group consisting of SEQ ID NOs: 4-6, 19-28, 1445-1544, and 1645-1744; and a modified nucleobase.

[0022] In some embodiments, the modified nucleobase includes N6-methyladenosine, inosine, N1 -propylpseudouridine, Nl-methoxymethylpseudouridine, N1 -ethylpseudouridine, 5- methoxycytidine, 5-hydroxyuridine, 5-carboxyuridine, 5-formyluridine, 5-hydroxycytidine, 5- hyrdoxymethylcytidine, 5-hydroxymethyluridine, 5-formylcytidine, 5-carboxycytidine, N4- methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, N1 -methylpseudouridine, pseudouridine, 5-methyluridine, 5-methoxyuridine, dihydrouridine, 5-methylcytidine, 4- thiouridine, 2-thiouridine, uridine-5’-O-(l -thiophosphate), 5 -aminoallyluridine, or 4- acetylcytidine.

[0023] In some embodiments, the 5’-UTR includes the translational enhancer, and wherein a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of anmRNA molecule that does not include the translational enhancer or the modified nucleobase but otherwise has the same sequence.

[0024] In some embodiments, the 5’-UTR includes at least one sequences selected from the group consisting of SEQ ID NOs: 29-50.

[0025] In some embodiments, the 5’-UTR includes the translational silencer, and wherein an RRS of the mRNA molecule is 0.3X or lower than an RRS of an mRNA molecule that does not include the translational silencer or the modified nucleobase but otherwise has the same sequence.

[0026] In some embodiments, the mRNA molecule encodes a therapeutic peptide or a therapeutic protein.

[0027] In some embodiments, the therapeutic peptide or the therapeutic protein includes a vaccine.Method of constructing an mRNA molecule

[0028] In some aspects, the present invention is directed to a method of constructing an mRNA molecule for producing a therapeutic peptide or a therapeutic protein.

[0029] In some embodiments, the method includes a translational enhancer at a 5’ UTR to the 5’ side of a coding region encoding the therapeutic peptide or a therapeutic protein.

[0030] In some embodiments the therapeutic peptide or a therapeutic protein includes a vaccine.Yeast cell for expressing protein

[0031] In some aspects, the present invention is directed to a yeast cell for expressing a protein.

[0032] In some embodiments, the yeast cell includes an mRNA molecule or a nucleotide encoding the mRNA molecule.

[0033] In some embodiments, the mRNA molecule includes: a 5 ’-UTR including at least one yeast translational enhancer; and a coding region encoding the protein, or a coding region for introducing a nucleotide sequence for encoding the protein.

[0034] In some embodiments, the 5 ’-UTR includes at least one sequence selected from the group consisting of SEQ ID NOs: 1-3.

[0035] In some embodiments, the yeast cell is a Saccharomyces cerevisiae cell, a Pichia pastoris cell, a Hansenula polymorpha cell, a Yarrow ia lipolytica cell, an Arxula adeniriivorans cell, a Kluyveromyces lactis cell, or a Schizosaccharomyces pombe cell.BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The following detailed description of exemplary embodiments will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating, nonlimiting embodiments are shown in the drawings. It should be understood, however, that the instant specification is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0037] Figs. 1A-1D demonstrates that DART quantifies 5’-UTR-mediated translational control over a 1,000-fold range, in accordance with some embodiments. Fig. 1A: Different endogenous yeast 5’ UTRs added to a common luciferase coding sequence and 3’ UTR result in large differences in translational output per mRNA in cell lysates. Colored bars represent 5’ UTR isoforms from a single gene. Fig. IB: Schematic of DNA pool design. All sequences begin with the T7 promoter, followed by122 nts of 5’ UTR sequence, then a minimum of 24 nts of coding sequence, followed by a 10 nt identifier barcode, and finally an RT handle for library preparation. Endogenous 5’ UTR sequences were derived from RNA-seq data. Fig. 1C: DART sequencing overview. Fig. ID: DART reproducibly measures ribosome recruitment over a 1,000- fold range. Comparison of three DART replicates.

[0038] Figs. 2A-2E demonstrates that the inhibitory RNA features have highly context- dependent effects on initiation, in accordance with some embodiments. Fig. 2A: Design of SL constructs. Two sets of SLs were designed to span a range of folding energies, with the second set scrambling the stem sequences of the first. Stems were inserted into 20 endogenous unstructured 5’ UTRs and positioned every 3 nts. Fig. 2B: Engineered SLs repress RRSs. All stems repress recruitment relative to sequences without an inserted stem, and the strongest stem shows the greatest level of repression, followed by the intermediate stem and the weakest stem. The p value was calculated using Fisher’s test, comparing sequences with introduced stems to those without. Fig. 2C: Individual 5’ UTRs show distinct effects of SL insertion. The relative recruitment for the YER003C 5’ UTR with the -12 kcal / mol stem inserted is shown. In this case, the stem is most repressive near the cap and at the start codon. Fig. 2D: An example 5’ UTRfrom YDR135C showing reduced ribosome recruitment upon mutation of preferred AUGi context nucleotides (-3 A, +4G, and +5C). Fig. 2D: Mutations in AUGi context nucleotides cause variable effects on ribosome recruitment, with changes of the -3A being generally the most deleterious. The density plot shows the probability distribution of the relative RRS at each position.

[0039] Figs. 3A-3C demonstrate that eIF4G binding motifs promote translation initiation, in accordance with some embodiments. Fig. 3 A: Schematic of e!F4Gl binding to designed 5’ UTR pool including both wild-type oligo(U) motifs and U->CA mutants. Fig. 3B: Violin plots of RRS distributions for 5’ UTRs containing U37, and the matched controls, for three independent replicates. The p values were calculated using Fisher’s test. Fig. 3C: Ranked changes in RRSs between oligo(U) 5’ UTRs and matched U->CA mutants. Dots indicate the mean of all replicates that met read coverage thresholds. The minimum and maximum value across the replicates is also depicted. 5’ UTRs with a statistically significant (Bonferroni-corrected two-tailed t test p < 0.05) difference between wild-type and mutant variants are shown.

[0040] Figs. 4A-4E demonstrate that DART identifies translational silencers and enhancers within alternative 5’ UTRs, in accordance with some embodiments. Fig. 4A: 5’ UTR isoforms confound the interpretation of averaged ribosome densities observed in coding sequences by ribosome profiling. Fig. 4B: Most alternative 5’ UTR isoforms tested affect ribosome recruitment (RRS). 2,653 isoform pairs differed significantly by >2-fold, 145 differed significantly, but by <2-fold, and 1,332 did not confer significant differences in RRS. The p values were calculated from a Bonferroni-corrected t test. Fig. 4C: Example genes with alternative 5’ UTR isoforms differing in RRS. The long (5’ extended) isoforms of YDL201W, YDR337W, YBR138C, and YLR440C contain putative silencer elements, and the long isoforms of YGL095C, YLR091W, YDR063W, and YGR196C contain putative enhancers. Fig. 4D Violin plots of RRS values from isoform pairs showing differential ribosome recruitment (p < 0.05). The additional 5’ sequences included in longer isoforms were used as inputs to identify enriched motifs using DREME. The top two silencing (above) and enhancing (below) motifs are shown. Fig. 4E: ACCAC motifs identified by DART analysis are sufficient to repress translation of full-length mRNAs in vitro (left) and in vivo (right). Translation activity in vivo is normalized to Flue mRNA levels and total protein.

[0041] Fig. 5 illustrates certain aspects of the DART analysis, in accordance with some embodiments.

[0042] Fig. 6 lists some resources used in the first study, in accordance with some embodiments.

[0043] Fig. 7 shows some exemplary 5. cerevisiae 5’ UTR translational enhancers identified with the DART analysis, in accordance with some embodiments.

[0044] Fig. 8 shows some exemplary 5. cerevisiae 5’ UTR translational silencers identified with the DART analysis, in accordance with some embodiments.

[0045] Figs. 9A-9B demonstrate that ribosome recruitment scores of the human 5’ UTR sequences obtained using the DART analysis are highly reproducible, in accordance with some embodiments. Fig. 9A: 5’ UTRs with unmodified nucleotides. Fig. 9B: 5’ UTRs modified with N1 -methylpseudouridine (ml'P).

[0046] Figs. 10A-10B demonstrate that the incorporation of N1 -methylpseudouridine (mlPsi) into human 5’UTRs alters ribosome recruitment, in accordance with some embodiments.

[0047] Figs. 11 A-l IB shows some exemplary human translational silencer and enhancer sequences, in accordance with some embodiments. Fig. 11A: Enhancers. Fig. 11B: Silencers.

[0048] Figs. 12A-12B show that the screening method according to some embodiments herein identified thousands of short 5 ’-UTRs that outperform current class (e.g., those used by Modema or Pfizer in mRNA-based vaccines). Fig. 12A: pool 1, 100 nucleotides to 230 nucleotides. Fig. 12B: pool 2, 10 nucleotides to 100 nucleotides.

[0049] Fig. 13 demonstrates that the ml'P sensitivity of translational efficiency is driven by the 5’-UTR, in accordance with some embodiments. The data show that the observed effects of ml'P on ribosome recruitment are driven by incorporation into the 5’ UTR and not the coding sequence. The same 5’-UTR sequence (in this case, the Moderna sequence) was testing with 3 different coding sequence segments in DART. Regardless of the coding sequence used, ml'P increases recruitment to this RNA.

[0050] Fig. 14 shows that that the screening method according to some embodiments herein identified thousands of short 5 ’-UTRs that outperform current class (e.g., those used by Modema or Pfizer in mRNA-based vaccines).

[0051] Fig. 15: non-limiting examples of modified nucleotides that are compatible with the screening method herein. The present study validated that the modifications shown in Fig. 15 arecompatible with the screening method herein. Top: N1 -methylpseudouridine, pseudouridine, 5- methyluridine, 5-methoxyuridine, dihydrouridine, 5-methylcytidine, Bottom: 4-thiouridine, 2- thiouridine, uridine-5’-O-(l-thiophosphate), 5-aminoallyluridine, 4-acetylcytidine.

[0052] Fig. 16: systematic identification of regulatory elements, in accordance with some embodiments. Fig. 16 describes a variation of the screening method herein in a systematic manner. Here, the present study took the 100 best and 100 worst sequences and generated variants with scanning, non-overlapping 6 nucleotide deletions across the UTR sequence (over 6,000 variants). This pool was then subjected to the screening method herein. Putative regulatory sequences (enhancers or repressors) were identified by comparing the ribosome recruitment scores of the deletion variants to that of the parent UTR sequence.

[0053] Fig. 17 shows an example of the screening method according to Fig. 16. The present study identified a possible translation-enhancing element in an individual 5’ UTR. The top graph shows the log2RRS for each variant, bottom shows the fold change in RRS compared to the parental sequence. Deletion of nucleotides 1-6 and 7-12 causes a significant decrease in ribosome recruitment to this sequence.

[0054] Figs. 18A-18C: a non-limiting screen method according to some embodiments (DART) quantifies 200-fold differences in 5’ UTR-mediated ribosome recruitment that predicts protein synthesis in vitro and in cells. Fig. 18A: Schematic of the DART workflow. The sequences in the DNA pool begin with a T7 promoter followed by > 27nt of common GFP coding sequence and an RT handle for library preparation. Endogenous 5’ UTR sequences were derived from Ensembl annotations. Fig. 18B: DART reproducibly measures ribosome recruitment of a 200-fold range. Comparison of three DART replicates. Fig. 18C: Ribosome recruitment scores predict 5’ UTR- driven translational activity in full-length mRNAs in vitro (Hela cytoplasmic lysate, middle) and in cells (Hela cell transfection, lower).

[0055] Figs. 19A-19H: a non-limiting screen method according to some embodiments (DART) quantifies the regulatory impact of 5’ UTR length, secondary structure, Kozak context, and alternative isoform usage. Fig. 19A: 5’ UTR length is significantly anticorrelated with ribosome recruitment. Correlation plot of UTR length versus ribosome recruitment scores. Fig. 19B: The correlation of 5’ UTR length on activity is driven by sequences shorter than 80 nucleotides. 5’ UTRs were combined into increasing 10 nucleotide-length bins and plotted against RRS. RRS steadily decreases as 5’ UTR length increases until leveling off above 80 nucleotides. Fig. 19C:DART analysis of 1 1,000 5’ UTRs ranging from 100-230 nucleotides long demonstrates negligible correlation between UTR length and ribosome recruitment. Fig. 19D: Secondary structure has a moderate activity on ribosome recruitment activity. In silico predicted free energy of folding for each UTR is plotted against its RRS score. Fig. 19E: Top- and bottom -scoring 5’ UTRs show no meaningful difference in their Kozak sequence composition. Plots show the nucleotide composition of ten nucleotides upstream of the start codon for the top 25% (left, n=4937) and bottom 25% (right, n=4937) 5’ UTR sequences. Fig. 19F: Kozak sequence optimality has no impact on ribosome recruitment activity. Per-sequence Kozak scores were determined using TIS-Predictor. UTRs with the most optimal Kozak sequence (“Top 25%”) show no significant difference compared to the middle 50% or worst 25%. Fig. 19G: The majority of 5’ UTR isoform pairs exhibit significantly different ribosome recruitment activity. 8,109 isoform pairs differed significantly by >2-fold (red), 9,788 differed significantly, but by <2-fold, and 5,058 did not exhibit significant differences in RRS. Fig. 19H: Example genes with alternative 5’ UTR isoforms with large differences in RRS. The shorter isoforms of RBPJ and SYNGR3 show significantly higher activity than the longer isoforms, while the longer isoforms of SEPTIN9 and SLC12A9 are more active than their shorter isoforms.

[0056] Figs. 20A-20D: N1 -methylpseudouridine incorporation into 5’ UTRs significantly alters ribosome recruitment, in accordance with some embodiments. Fig. 20A: Replicates of uridine (left)- and Nl-methypseuoduri dine (m l 'P, right)-containing 5’ UTRs exhibit strong correlation, while comparing identical sequences containing uridine versus ml'P (middle) reveals significant differences. The RRS scores plotted are an average of six replicates (error bars = S.D.). Fig. 20B: The impact of ml'P on ribosome recruitment is context dependent. 1,404 5’ UTRs exhibit significantly reduced ribosome recruitment when uridine is replaced with ml Y (right side; fold change > 2, Benjamini-Hochberg adjusted p < 0.01), while 2,600 5’ UTRs show significantly increased ribosome recruitment with ml Y (left side; fold change > 2, Benjamini- Hochberg adjusted p < 0.01). Figs. 20C-20D: Single substitutions of uridine with ml'P can significantly impact ribosome recruitment activity both negatively (Fig. 20C, 6.8-fold decrease, p < 0.0001), and positively (Fig. 20D, 4.24-fold increase, p < 0.0001).

[0057] Figs. 21A-21H: CCC motifs are a novel translational repressor, in accordance with some embodiments. Fig. 21A: Increasing cytidine content significantly represses ribosome recruitment. 5’ UTRs were binned according to their percent cytidine. Fig. 2 IB: C-richsequences are enriched in poor-recruiting 5’ UTRs. The poorest 10% of recruiters were used as inputs for motif enrichment using DREME. 3 out of the top 5 motifs contain a CCC trinucleotide element. Fig. 21C: The presence of CCC motifs correlates with decreased ribosome recruitment. 5’ UTRs containing 30-35% cytidine were selected to hold overall cytidine constant. These UTRs were then binned based on the number of CCC motifs they contain. The data are represented as mean RRS for each bin (error bars = S.D.). Figs. 21D-21E: CCC motifs are sufficient to repress ribosome recruitment in a dose-dependent manner. CCC sequences were iteratively added to 5’ UTRs and these UTRs were then subjected to DART analysis. The dosedependent repressive effect is displayed for the 5’ UTR of ZFPL1 (Fig. 2 ID) and across all UTRs tested (Fig. 21E, n = 225 parent 5’ UTRs, 1350 total variants). Fig. 2 IF: CCC motifs identified by DART are sufficient to repress translation in full-length mRNAs. Figs. 21G-21H Removal of CCC motifs from human 5’ UTRs increases ribosome recruitment. CCC motifs were iteratively deleted from 5’ UTRs and these were subjected to DART analysis. The effect of successive CCC removal is demonstrated for the 5’ UTR of POC1B (Fig. 21G) and across all UTRs tested (Fig. 21H, n = 225 parent 5’ UTRs, 1350 total variants).DETAILED DESCRIPTION

[0058] The following disclosure provides many different embodiments, or examples, for implementing different features of the provided subject matter. Specific examples of components and arrangements are described below to simplify the present disclosure. These are, of course, merely examples and are not intended to be limiting. For example, the formation of a first feature over or on a second feature in the description that follows may include embodiments in which the first and second features are formed in direct contact, and may also include embodiments in which additional features may be formed between the first and second features, such that the first and second features may not be in direct contact. In addition, the present disclosure may repeat reference numerals and / or letters in the various examples. This repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed.

[0059] In the first study described herein (“the first study”), a method capable of identifying translational enhancers and translational silencers in the 5’ untranslated regions (5’ UTRs) of mRNA molecules was developed. Specifically, in the first study, a library of mRNA moleculeshaving similar coding regions but different 5’ UTR sequences were mixed with 80s ribosomes to form complexes. The complexes in the mixture were stabilized with cycloheximide and the mixture were then subjected to density gradient fractionation to isolate the ribosome-mRNA complexes and the mRNA. The ribosomal recruitment efficiencies of the 5’ untranslated regions were determined according to the relative abundances of the mRNA molecules in the complex.

[0060] In the second study described herein (“the second study”), using the method developed in the first study, translational enhancers and translational silencers in the 5’ UTR were determined in the budding yeast.

[0061] In the third study described herein (“the third study”), using the method developed in the first study, translational enhancers and translational silencers in the 5’ UTR were determined in humans.

[0062] Accordingly, in some aspects, the present invention is directed to a method of modulating a translational efficiency of a messenger RNA (mRNA) molecule.

[0063] In some aspects, the present invention is directed to a non-naturally occurring mRNA molecule. In some embodiments, the non-naturally occurring mRNA molecule has increased or decreased translational efficiencies in comparison to similar naturally occurring mRNA molecules.

[0064] In some embodiments, the present invention is directed to a method of constructing mRNA molecules for producing therapeutic proteins / peptide.Definitions

[0065] As used herein, each of the following terms has the meaning associated with it in this section. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Generally, the nomenclature used herein and the laboratory procedures in animal pharmacology, pharmaceutical science, peptide chemistry, and organic chemistry are those well-known and commonly employed in the art. It should be understood that the order of steps or order for performing certain actions is immaterial, so long as the present teachings remain operable. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documentsreferred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.

[0066] In the application, where an element or component is said to be included in and / or selected from a list of recited elements or components, it should be understood that the element or component can be any one of the recited elements or components and can be selected from a group consisting of two or more of the recited elements or components.

[0067] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.

[0068] In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as "A, B, or A and B."

[0069] " About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in certain embodiments ±5%, in certain embodiments ±1%, in certain embodiments ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.Method of Identifying Translational Enhancers and / or Translational Silencers in 5’ UTRs of mRNA Molecules

[0070] In some embodiments, the instant specification is directed to a method of identifying translational enhancers and / or translational silencers in 5’ untranslated regions (5’ UTRs) of mRNA molecules.

[0071] In some embodiments, the method includes: preparing a plurality of mRNA molecules, wherein each mRNA molecules including a 5’ UTR and a coding region to the 3’ end of the 5’ UTR; contacting the plurality of mRNA molecules with a ribosome; isolating the ribosome; and

[0072] determining sequences of 5’ UTRs of mRNA molecules in complex with the isolated ribosomes.

[0073] In some embodiments, the 5’ UTRs of an mRNA molecule includes a translational enhancer if the mRNA molecule is more likely to be found in complex with the isolated ribosomes than average.

[0074] In some embodiments, the 5’ UTRs of an mRNA molecule includes a translational silencer if the mRNA molecule is less likely to be found in complex with the isolated ribosomes than average.

[0075] In some embodiments, the method further includes identifying one or more translational enhancers by determining one or more sequence motifs commonly found in 5’ UTRs of mRNA molecules that are more likely to be found in complex with the isolated ribosomes than average; or identifying one or more translational silencers by determining one or more sequence motifs commonly found in 5’ UTRs of mRNA molecules that are less likely to be found in complex with the isolated ribosomes than average.

[0076] In some embodiments, the plurality of mRNA molecules has the same sequence in the coding region. In some embodiments, the coding regions of the plurality of mRNA molecules have similar sequences. In some embodiments, the coding regions of the plurality of mRNA molecules affect translational efficiency at similar levels.

[0077] In some embodiments, isolating the ribosomes includes isolation according to the sedimentation coefficient of the ribosome.

[0078] In some embodiments, the ribosomes are isolated by density gradient fractionation.

[0079] In some embodiments, contacting the plurality of mRNA molecules with the ribosomes includes stabilizing complexes formed by mRNA molecules and ribosomes.

[0080] In some embodiments, stabilizing the complexes includes contacting the complexes with cycloheximide.

[0081] In some embodiments, the method includes calculating a ribosome retention score based on the relative abundance of the mRNA ribosome complex. As used herein, the term ribosome retention score or RRS refers to a numeric descriptor of the ability of a particular mRNA 5’ UTR to promote ribosome binding and thus translation of the 3’ coding region of the mRNA. The attached appendices describe non-limiting examples of methods for determining an RRS.

[0082] In some embodiments, the ribosome retention score mRNA molecules in complex with the isolated ribosomes is calculated based on the relative abundance of the mRNA moleculeisolated in complex with ribosomes in comparison to an abundance of the mRNA molecule in the input pool.[000831 In some embodiments, the ribosome retention score of an mRNA molecule in complex with the isolated ribosomes is calculated according to a relative abundance the mRNA molecule isolated in complex with ribosome in comparison to a sum of an abundance of the mRNA molecule isolated in complex with ribosome and an abundance of the mRNA molecule isolated without forming complex with ribosome.

[0084] In some embodiments, determining the sequences of 5’ UTRs of mRNA molecules includes sequencing the 5’ UTRs.

[0085] In some embodiments, the plurality of mRNA molecules further includes barcoding sequences.

[0086] In some embodiments, the barcoding sequences correspond to the sequences of the 5’ UTRs.

[0087] In some embodiments, determining the sequences of 5’ UTRs of mRNA molecules includes identifying the barcoding sequences of the mRNA molecules.

[0088] In some embodiments, the method further includes verifying the identified 5’ UTR translational enhancers and / or translational silencers.

[0089] In some embodiments, verifying the identified 5’ UTR translational enhancers and / or translational silencers includes constructing a first mRNA molecule including a first 5’ UTR and a coding region encoding a reporter protein.

[0090] In some embodiments, the first 5’ UTR includes the identified translational enhancers and / or translational silencers; constructing a second mRNA molecule including a second 5’ UTR and the coding region encoding the reporter protein.

[0091] In some embodiments, the second 5’ UTR does not include the identified translational enhancers and / or translational silencers, but is otherwise the same as the first 5’ UTR.

[0092] In some embodiments, verifying the identified 5’ UTR translational enhancers and / or translational silencers further includes contacting the first mRNA molecule and the second mRNA molecule with ribosome.

[0093] In some embodiments, verifying the identified 5’ UTR translational enhancers and / or translational silencers further includes measuring a first level of reporter signal from the translation of the first mRNA molecule.

[0094] In some embodiments, verifying the identified 5’ UTR translational enhancers and / or translational silencers further includes measuring a second level of reporter signal from the translation of the second mRNA molecule.

[0095] In some embodiments, verifying the identified 5’ UTR translational enhancers and / or translational silencers further includes comparing the first level and the second level.Method of Modulating Translational Efficiency of mRNA Molecules

[0096] In some aspects, the present invention is directed to a method of modulating a translational efficiency of an mRNA molecule.

[0097] In some embodiments, the method includes modifying a 5 ’-UTR of the mRNA molecule to include a translational enhancer or a translational silencer.

[0098] In some embodiments, modifying the 5 ’-UTR of the mRNA molecule includes modifying a sequence of a DNA molecule encoding the mRNA molecule.

[0099] In some embodiments, the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of yeasts. It is worth noting that, although the working examples described herein were tested in Saccharomyces cerevisiae, since the translation machinery is highly conserved among yeast species, the translational enhancers or translational silencers identified in Saccharomyces cerevisiae are expected to work in yeast in general. In some embodiments, the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, Arxula adeninivorans, Kluyveromyces lactis, or Schizosaccharomyces pombe.[000100] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein the translational enhancer includes at least one sequence selected from the group consisting of SEQ ID NOs: 1-3.[000101] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 4-6.[000102] In some embodiments, the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of a mammal,such as a human. It is worth noting that, although the working examples described herein were tested in human cells, the translational machinery among mammals are conserved. As such, translational enhancer and translational silencers identified for humans are expected to work in other mammals.[000103] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein the translational enhancer includes at least one sequence selected from the group consisting of SEQ ID NOs: 7-18, 29-51, 56-1344, 1345-1444, and 1545- 1644.[000104] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 19-28, 1445-1544, and 1645-1744.[000105] In some embodiments, the 5’-UTR of the mRNA molecule is further modified to include a modified nucleobase. In some embodiments, the modified nucleobase includes N6- methyladenosine, inosine, N1 -propylpseudouridine, N1 -methoxymethylpseudouridine, Nl- ethylpseudouridine, 5-methoxycytidine, 5-hydroxyuridine, 5-carboxyuridine, 5 -formyluridine, 5- hydroxycytidine, 5-hyrdoxymethylcytidine, 5-hydroxymethyluridine, 5 -formylcytidine, 5- carboxycytidine, N4-methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, Nl- methylpseudouridine, pseudouridine, 5-methyluridine, 5-methoxyuridine, dihydrouridine, 5- methylcytidine, 4-thiouridine, 2-thiouridine, uridine-5’-O-(l -thiophosphate), 5- aminoallyluridine, or 4-acetylcytidine.[000106] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein a ribosome retention score (RRS) of the modified mRNA molecule is 2X or higher, such as 3X or higher, 10X or higher, 100X or higher or 1000X or higher, than an RRS of the unmodified mRNA molecule.[000107] In some embodiments, the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein a ribosome retention score (RRS) of the modified mRNA molecule is 0.5X or lower, such 0.3X or lower, 0.1X or lower, 0.01X or lower or 0.001X or lower, than an RRS of the unmodified mRNA molecule.[000108] In some embodiments, the 5’-UTR is modified to include the translational enhancer and a modified nucleobase that is able to enhance translation. In some embodiments, the 5’-UTR is modified to include the translational silencer and a modified nucleobase that is able to suppresstranslation. Whether a modified nucleobase in the 5’-UTR enhances or suppresses translation of an mRNA molecule is context dependent (i.e., a modified nucleobase that enhances translation in one position of one 5’UTR sequence might suppress translation if placed in another position, or in another 5’UTR sequence). mRNA Molecule[000109] In some embodiments, the present invention is directed to an mRNA molecule. [000110] In some embodiments, the mRNA molecule does not exist in the nature. In some embodiments, the mRNA molecule does not exist in the nature because the mRNA molecule includes a modified nucleobase. As used herein, the term “modified nucleobase” refers to nucleobases other than the four common nucleobases adenine (A), cytosine (C), uracil (U), and guanine (G). The term “modified nucleobase” does not exclude naturally occurring nucleobases that are found in non-mRNA molecules. For example, nucleobases like pseudouridine, 5- methylcytosine, N1 -methylpseudouridine and 2’-O-methylated exist in nature. These nucleobases are considered to be examples of modified nucleobases herein.[000111] In some embodiments, the mRNA molecule includes a 5’-UTR.[000112]In some embodiments, the 5’-UTR includes: a translational enhancer including at least one sequence selected from the group consisting of SEQ ID NOs: 1-3, 7-18, 29-51, 56-1344, 1345-1444, and 1545-1644, or a translational silencer including at least one selected from the group consisting of SEQ ID NOs: 4-6, 19-28, 1445-1544, and 1645-1744; and a modified nucleobase.[000113] In some embodiments, the modified nucleobase is the nucleobases of N6- methyladenosine, inosine, N1 -propylpseudouridine, N1 -methoxymethylpseudouridine, Nl- ethylpseudouridine, 5-methoxycytidine, 5-hydroxyuridine, 5-carboxyuridine, 5-formyluridine, 5- hydroxycytidine, 5-hyrdoxymethylcytidine, 5-hydroxymethyluridine, 5 -formylcytidine, 5- carboxycytidine, N4-methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, Nl- methylpseudouridine, pseudouridine, 5-methyluridine, 5-methoxyuridine, dihydrouridine, 5- methylcytidine, 4-thiouridine, 2-thiouridine, uridine-5’-O-(l-thiophosphate), 5- aminoallyluridine, or 4-acetylcytidine.[000114] In some embodiments, the 5’-UTR includes the translational enhancer, and the modified nucleobase is able to enhance translation. In some embodiments, the 5’-UTR includes the translational silencer, and the modified nucleobase is able to suppress translation.[000115] In some embodiments, the 5’-UTR includes the translational enhancer. In some embodiments, a ribosome retention score (RRS) of the mRNA molecule is 2X or higher, such as 3X or higher, 10X or higher, 100X or higher or 1000X or higher, than an RRS of an mRNA molecule that does not include the translational enhancer or the modified nucleobase but otherwise has the same sequence.[000116] In some embodiments, the 5’-UTR includes the translational silencer. In some embodiments, an RRS of the mRNA molecule is 0.5X or lower, such as 0.3X or lower, 0.1X or lower, 0.01X or lower or 0.001X or lower, than an RRS of an mRNA molecule that does not include the translational silencer or the modified nucleobase but otherwise has the same sequence.[000117] In some embodiments, the mRNA molecule encodes a therapeutic peptide or a therapeutic protein.[000118] In some embodiments, the therapeutic peptide or the therapeutic protein includes a vaccine.Method of Constructing mRNA Molecules for Producing Therapeutic Protein / Peptide[000119] In some embodiments, the present invention is directed to a method of constructing an mRNA molecule for producing a therapeutic peptide or a therapeutic protein.[000120] In some embodiments, the method includes including a translational enhancer at a 5’ UTR to the 5’ side of a coding region encoding the therapeutic peptide or a therapeutic protein. [000121] In some embodiments, the therapeutic peptide or a therapeutic protein includes a vaccine.Yeast Cell for Expressing Protein[000122] In some embodiments, the present invention is directed to a yeast cell, such as a yeast cell for expressing a protein. In some embodiments, the yeast cell is a bioengineered yeast cell. In some embodiments, the protein to be expressed by the yeast cell is a protein exogenous or endogenous to the yeast cell. In some embodiments, the protein is a secreted protein.[000123] In some embodiments, the yeast cell is a recombinant yeast cell having a sequence encoding a 5’-UTR translational enhancer engineered into either the genomic DNA or a plasmid / expression vector.[000124] In some embodiments, the nucleic acid encoding the protein to be expressed is already in the yeast cell and is located downstream of the 5’-UTR translational enhancer such that the expression of the protein is enhanced by the 5’-UTR translational enhancer. In some embodiments, the nucleic acid encoding the protein to be expressed has not been engineered into the yeast cell, such that any desired nucleic acid sequences for encoding a protein can be placed downstream of the 5’-UTR translational enhancer.[000125] In some embodiments, the 5’-UTR translational enhancers for yeasts are the same as or similar to those as detailed elsewhere herein.[000126] In some embodiments, the yeast cell is Saccharomyces cerevisiae, Pichia pastoris Hansenula polymorpha, Yarrowia lipolytica, Arxula adeninivorcms, Khiyveromyces lactis^ or Schizosaccharomyces pombe.Examples[000127] The instant specification further describes in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the instant specification should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.Example 1[000128] In the study described in Example 1 (“the first study”), a method to quantify translation initiation on thousands of 5’ UTRs in parallel was developed. The first study uncovered sequence-specific motifs that control translation by varied mechanisms and establish a platform for systematic interrogation of 5’ UTR variants that can be used to engineer mRNAs for optimized protein output.[000129] Translational control shapes the proteome in normal and pathophysiological conditions. Current high-throughput approaches reveal large differences in mRNA-specific translationactivity but cannot identify the causative mRNA features. The first study developed direct analysis of ribosome targeting (DART) and used it to dissect regulatory elements within 5’ untranslated regions that confer 1,000-fold differences in ribosome recruitment in biochemically accessible cell lysates. Using DART, the first study determined a functional role for most alternative 5’ UTR isoforms expressed in yeast, revealed a general mode of increased translation via direct binding to a core translation factor, and identified numerous translational control elements including C-rich silencers that are sufficient to repress translation both in vitro and in vivo. DART enables systematic assessment of the translational regulatory potential of 5’ UTR variants, whether native or disease-associated, and will facilitate engineering of mRNAs for optimized protein production in various systems.Example 1-1 : Related information[000130] Translation initiation is an important step in eukaryotic gene expression, the dysregulation of which is linked to heritable human diseases and cancer. Systematic characterization has shown that mRNA-specific translational activity varies by orders of magnitude under normal growth conditions and is extensively regulated in response to a wide range of physiological signals. Despite growing interest in the mRNA features responsible for this widespread translational control, current high-throughput methods, which rely on quantification of the average number of translating ribosomes per transcript, have revealed only partial correlations (R = 0.3-0.8) that leave many differences in translation activity unexplained. In contrast, in-depth genetic and biochemical analysis has revealed detailed regulatory mechanisms for certain mRNAs.[000131] Genome-wide association studies (GWASs) show diverse disease phenotypes associated with non-coding single-nucleotide polymorphisms (SNPs) found within 5’ UTRs. However, current efforts to identify causal variants, which are potential targets for new therapies, are largely restricted to non-synonymous changes within protein coding sequences. A richer understanding of mRNA sequence-specific translation mechanisms is needed to predict which 5’ UTR variants are likely to do damage by dysregulating protein levels. The first study developed direct analysis of ribosome targeting (DART) technology as a bridge between high-throughput, but mechanistically difficult to parse, in vivo approaches and mechanistically precise, but low- throughput, in vitro translation reconstitution assays. In DART, thousands of synthetic mRNAsinitiate translation in vitro. Differential abundance analysis of ribosome-bound and input mRNA reveals differences in translation activity. By massively parallel testing of defined sequences, both endogenous and mutated, the approach moves beyond correlation analysis to enable rapid, hypothesis-driven dissection of the causative role of specific 5’ UTR elements to determine their mechanisms of action.[000132] Here, the first study demonstrates the broad power of DART to illuminate the mechanisms underlying translational control. Overall, the first study tested 4,354 full-length alternative mRNA isoforms from 2,064 yeast genes, which revealed widespread translational control by alternative 5’ UTRs. The first study also exploited the throughput of the DART approach to systematically interrogate the effects of RNA secondary structure, start codon context, and protein binding motifs on translation initiation. The results establish a broad stimulatory role for eIF4Gl binding sequences and also demonstrate highly context-dependent control by inhibitory 5’ UTR structures. This illustrates the potential of DART to illuminate the function of putative RNA regulatory elements identified by other high-throughput approaches. The first study further leveraged the alternative 5’ UTR isoform comparisons to discover hundreds of previously uncharacterized translational enhancers and silencers, short sequence elements that are sufficient to promote or repress ribosome recruitment. The study validated several C-rich silencers as sufficient to repress translation both in vitro and in vivo. Together, the results reveal thousands of previously unidentified functional elements within 5’ UTRs that substantially affect translation. This study establishes DART as a powerful new high-throughput method that can be broadly applied to both discover and interrogate regulatory features within 5’ UTRs.Example 1-2: Development of DART for quantitative comparison of translation initiation [000133] 5’ UTRs directly contact the translation initiation machinery and can strongly influence translation activity (Fig. 1 A), but the features that distinguish efficiently translated mRNAs are largely unknown. The first study developed DART as a high-throughput method to enable rapid determination of the role of individual regulatory elements within 5’ UTRs. The first study designed a library of DNA oligonucleotides (oligos), based on deep sequencing of yeast mRNA isoforms (Pelechano et al., 2014) (STAR Methods), that included 12,000 sequences corresponding to the full-length 5’ UTR sequences from 4,252 genes. This pool design focuseson identifying functional elements within endogenous 5’ UTRs, in contrast to complementary studies that interrogate random sequences. The library covers 68% of genes expressed during exponential growth and includes alternative mRNA isoforms for many genes. A common (5’) T7 promoter and a (3’) priming site for reverse transcription flanked each unique mRNA sequence. The 5’ UTR sequence was extended to include at least 24 nucleotides of endogenous coding sequence to preserve potentially important downstream sequences that are protected by initiating ribosomes. Each oligo also included a unique 10 nt barcode to distinguish closely related sequences (Fig. IB).[000134]Next, the first study used these designed pools to generate dsDNA templates for in vitro transcription, followed by enzymatic mRNA capping to produce the pooled RNA substrates for in vitro translation initiation. RNAs were enzymatically biotinylated at their 3’ ends to facilitate quantitative recovery. RNA pools were incubated in yeast translation extracts (Gilbert et al., 2007; Hodgman and Jewett, 2013; lizuka et al., 1994) for 30 min, a time point that maximizes quantitative differences in ribosome recruitment between 5’ UTRs while yielding enough initiated mRNA for robust library preparation. Cycloheximide was included in the translation reaction to freeze recruited ribosomes at initiation codons and prevent ribosome run-off during ultracentrifugation to separate 80S ribosome-mRNA complexes from untranslated mRNAs. Ribosome-bound mRNA was isolated and sequenced, and the relative abundance of each sequence was compared to its abundance in the input pool to determine a ribosome recruitment score (RRS) for each 5’ UTR (Fig. 1C). DART revealed up to 1,000-fold differences in ribosome recruitment that were highly reproducible (R2 = 0.94-0.95) among three independent replicates (Fig. ID). Six 5’ UTRs were selected for low-throughput validation and observed good agreement with DART measurements. Thus, the first study established a robust method to determine the translation initiation activity of defined 5’ UTR sequences.[000135] A caveat to the 80S / input calculation used to assess translation initiation activity is that sequences that destabilize 5’ UTRs in extracts could also lead to a reduction in 80S-bound RNA compared to the input pool. The first study therefore tested an alternative method of calculating RRSs by sequencing the untranslated mRNA from the top of the gradient in addition to the 80S fraction, using the formula RRS0 = 80S / (80S+mRNP). These two metrics, RRS and RRS0, produced correlated, but not identical, results (R = 0.61; p < 2.2e-16). Notably, each of the main conclusions reported below is consistent between calculation methods. Because changes intranslation initiation can indirectly affect mRNA levels, the 80S / input calculation (RRS) is preferred.Example 1-3: A broad stimulatory role for initiation factor binding motifs in 5’ UTRs [000136] It was hypothesized that 5’ UTR elements that bind preferentially to eukaryotic initiation factors (elFs) may function as translational enhancers. Consistent with this model, diverse viruses rely on high-affinity interactions between their 5’ UTRs and cellular initiation factors and / or ribosomes for efficient translation. The eIF4G subunit of the cap binding complex is a prime candidate to mediate the activity of translational enhancer sequences. eIF4G contains three RNA binding domains that directly interact with mRNA and are essential for yeast growth, although specific functional interactions between eIF4G and cellular mRNAs had not been characterized. A high-throughput approach, RNA Bind-n-Seq (RBNS), was used to interrogate the RNA binding specificity of eIF4Gl. Using a library of random 20-mer RNA to test -87,380 distinct RNA 7-mer motifs for binding to different concentrations of recombinant eIF4Gl, the first study uncovered a preference for RNA sequences containing oligo-uridine (U).Consistently, it was found that inserting oligo(U) into an unstructured RNA increased binding to eIF4Gl by 20-fold.[000137] Here, the first study sought to comprehensively test the impact of endogenous oligo(U) motifs on translation initiation. Hundreds of native yeast 5’ UTRs contain oligo(U) sequences, which are evolutionarily conserved among budding yeast species and enriched in genes with regulatory roles. The first synthesized a pool of capped mRNAs consisting of all yeast 5’ UTR sequences <94 nt long that contain U37 (168 in total), together with their start codons and some coding sequence. The pool included matched controls for each 5’ UTR in which the oligo(U) motif was replaced with a CA repeat of equal length (Fig. 3A). The first study performed DART on these native 5’ UTR sequences and compared their activity with and without their endogenous oligo(U) motifs. In all three replicates, wild-type oligo(U)-containing mRNAs were recruited more efficiently to the ribosomal fraction than their matched mutant counterparts (Fig. 3B). Of the 5’ UTR sequences whose ribosome recruitment differed significantly (p < 0.05 by two-tailed paired t test) between the wild-type and mutant variants, all were recruited better with the oligo(U) motif present (Fig. 3C). These results are consistent with and substantially extend previous low -throughput experiments that showed endogenous 5’ UTR oligo(U) motifsstimulated translation of full-length mRNA in yeast lysates. The results reveal a broad stimulatory role for eIF4G binding motifs within yeast 5’ UTRs and illustrate the power of DART to assess the function of putative RNA regulatory elements identified by other high- throughput approaches.Example 1-4: Production of alternative 5’ UTR isoforms generally affects translation activity [000138] Many eukaryotic genes express multiple mRNA isoforms that differ in their 5’ UTRs, which complicates the analysis of ribosome profiling data to identify translational control elements. Because ribosome-protected footprints within coding sequences cannot be correctly assigned to translation initiation by specific 5 UTRs, the mRNA-specific translational efficiency inferred from ribosome profiling data may not accurately reflect the actual translation activity of any mRNA isoform (Fig. 4A). DART was therefore used to directly compare the activity of expressed alternative mRNA isoforms whose 5’ UTRs differ by at least 10 nucleotides.[000139] The first study analyzed RNA sequencing (RNA-seq) data from wild-type yeast (STAR Methods) and identified 4,354 alternative mRNA isoforms expressed from 2,064 genes that we tested for isoform-specific translation activity by using DART. Notably, 1,639 isoform pairs with reproducible differences in ribosome recruitment were identified (p < 0.05, Bonferroni corrected two-tailed t test), of which 843 differed by more than 3 -fold. These results provide significantly evidence that alternative 5’ UTRs differ in ribosome association in vivo. DART establishes the direct contribution of differences in 5’ UTR sequences to differences in translation initiation and eliminates potentially confounding effects of co-occurring alternative 3 ’-UTR sequences.Example 1-5: C-rich sequences silence translation[000140] These mRNA isoforms were leveraged comparisons to identify previously undetected translational control elements within 5’ UTRs. Enhancer and silencer elements were operationally defined as sequences present in a longer 5’ UTR variant that showed a higher RRS than a shorter alternative 5’ UTR of the same gene (enhancer) or lower RRS than the corresponding shorter alternative 5’ UTR (silencer). 658 enhancer regions and 541 silencer regions were identified by the criteria that their inclusion reproducibly changed RRS more than 2-fold (p < 0.001, n = 3 replicates). Of these, 72 enhancers and 67 silencers changed RRS by more than 10-fold (Fig. 4C). Remarkably, sequence differences of only ten nucleotides weresufficient to significantly alter translation initiation in many cases. Thus, DART reveals relatively short RNA sequences (10-13 nucleotides) that are sufficient to significantly alter ribosome recruitment when present near the 5’ end of the mRNA. Overall, it was found that 68% of genes with alternative 5’ UTRs showed significant differences in translation initiation between isoforms.[000141] To illuminate the mechanisms of translational control, the first study looked for overrepresented motifs within enhancers and silencers using DREME (Bailey et al., 2015). Long 5’ UTR isoforms with higher ribosome recruitment activity were enriched for AU-rich sequences, which are distinct from the previously identified eIF4G-binding U7 motif. Intriguingly, the silencer regions were enriched in CCH motifs. The first study observed similar C-rich motifs in the bottom 10% of all 5’ UTRs (Fig. 4D), which suggests a common mechanism of translational repression.[000142] The first study verified the repressive effects of C-rich silencer motifs on the translational output of full-length mRNAs by using luciferase reporters. For selected genes containing the motif of interest in the longer 5’ UTR isoform, mutations were introduced to disrupt the putative silencer in the long isoform, thereby testing its necessity for translation repression. In parallel, the motif was added to the short isoform, thereby testing its sufficiency. In each case, disruption of the motif from the longer isoform resulted in an increase in protein production whereas addition of the motif reduced luciferase activity from the short isoform (Fig. 4E). Similar effects with these constructs expressed in vivo were observed (Fig. 4E), and somewhat smaller differences in translation between 5’ UTRs in vivo and in vitro were noted. Together, these results validate the C-rich sequence motifs uncovered by DART analysis as translational control elements that repress ribosome recruitment in vitro and protein production in cells.Example 1-6[000143] Here DART is presented as a new approach for high-throughput functional testing of endogenous and engineered 5’ UTR variants. The first study applied DART to more than 8,000 endogenous 5’ UTRs from the model eukaryote S. cerevisiae and identified C-rich motifs as translational silencers present within hundreds of 5’ UTRs. The study also used DART to systematically probe the effect of oligo(U) motifs and thereby established a general stimulatoryrole for this 5’ UTR element in endogenous mRNAs. The results illustrate the power of the DART method to uncover the regulatory elements underlying mRNA-specific differences in protein output, which are anticipated will be broadly applicable to the study of translation initiation, including by human mRNAs.[000144] 5’ UTR sequences that increased or decreased ribosome recruitment by more than 1,000-fold in cell lysates were identified. Specific sequences, such as C-rich motifs, that affected ribosome recruitment as measured by DART similarly affected protein synthesis from luciferase reporters in cells (e.g., Figs. 4D and 4E). However, the magnitude of 5’ UTR differences was larger in vitro.Example 1-7: Materials and Methods[000145] The yeast strain YWG1245 (MATa trplDleu2-3,l 12 ura3-52 gcn2D::hisG PGAL1- myc-UBRl::TRPl::ubrl, pRS316 < URA3 > ) used in this assay was cultured in liquid YPAD (1% yeast extract, 2% peptone, 2% glucose, 0.01% adenine hemisulfate) at 30°C with constant shaking.5’ UTR pool design and synthesis[000146] Each sequence in the pool consisted of approximately 122 nucleotides of 5’ UTR sequence followed by at least 24 nucleotides of coding sequence followed by a randomized 10 nucleotide unique identifier barcode and an adaptor sequence used for priming reverse transcription and Illumina sequencing (Fig. 1 A). For 5’ UTR annotations, 5’ UTR abundances were calculated from deep RNA sequencing of wild type yeast (Pelechano et al., 2013, 2014). Each 5’ UTR was merged with its most abundant neighbor within 10 nts in either direction such that no two 5’ UTRs were within 10 nts of each other. We then imposed the following requirements for inclusion in the pool: (1) 5’ UTRs must be expressed within 25% of the mode abundance for a given 5’ UTR, and (2) 5’ UTRs must make up at least 5% of the total abundance for that ORF, unless the mode was < 5% of the total, in which case we used the mode. Upstream AUGs within 761 (6.3% of all) 5’ UTR sequences were mutated to AGT such that the first AUG encountered by a scanning pre-initiation complex moving 50 to 30 would be the annotated AUGi. We included a parallel set of constructs testing the ribosome recruitment activity of each uAUG individually, in which case the downstream (canonical) AUG was mutated to AGT. Intotal, the study measured recruitment to 1334 uAUGs. Designed oligos were purchased as a pool (Twist Bioscience) and PCR amplified with RN7 and RN8. RNAs were produced by runoff T7 transcription from gel-purified DNA template. RNAs were 5’ capped using the Vaccinia Capping System (NEB M2080S) and 3’ biotinylated using the Pierce RNA 3’ end biotinylation kit (Thermo Scientific 20160).Translation assays[000147] Yeast translation extracts were made as described (Rojas-Duran and Gilbert, 2012) from YWG1245 (MATa trplDleu2-3,l 12 ura3-52 gcn2D::hisG PGALl-myc-UBR1 : :TRP1 : :ubrl, pRS316 < URA3 > ) cultured in liquid YPAD (1% yeast extract, 2% peptone, 2% glucose, 0.01% adenine hemisulfate). Cultures were grown to mid-log phase, harvested and then washed two times in mannitol buffer (30mM HEPES pH 7.4, lOOmM KO Ac, 2mM Mg(OAc)2, 2mM DTT, O.lmM PMSF, 8.5% mannitol). Cells were then resuspended in 1.5x volume of mannitol buffer and subsequently lysed by bead beating with 5x pellet volume of glass beads. Six 1 min rounds of bead beating were performed with intermittent one minute cooling periods on ice. Beads were pelleted and the supernatant transferred to a fresh tube. Cell debris was pelleted by a 30 min spin at 16,000 ref. Supernatant was removed and dialyzed using Slide-A-lyzer, 3-12 mb, 3,500 MWCO (Pierce #66110) for four h (30mM HEPES pH 7.4, lOOmM KO Ac, 2mM Mg(OAc)2, 2mM DTT), changing the buffer once. Approximately 40 pmoles of mRNA were added per 2 m in vitro translation reaction (22 mM HEPES pH 7.4, 120 mM KOGln, 3 mM MgOGln, 3.75 mM ATP, 0.5 mM GTP, 25 mM creatine phosphate, 1.6mM DTT, 400U RNaseln, 2mM PMSF, 650 mg creatine phosphokinase, IX cOmplete EDTA-free protease inhibitor) containing 50% yeast extract. Reactions were incubated with 0.5mg / mL cycloheximide at 26°C for 30 min in a shaking thermomixer.[000148] To measure translation activity in vivo YWG1245 was transformed with pGAL-5’ UTR-Fluc plasmids and grown to log phase in media containing 2% raffinose. 5’ UTR sequences were generated by gBlock (Twist Bioscience) mRNA expression was induced by addition of galactose to a final concentration of 2%. Whole-cell lysates were prepared by vortexing with glass beads in 1 X PBS with protease inhibitors (2 mM phenylmethanesulfonyl fluoride, and 1 3 protease inhibitor cocktail (Roche). Luciferase activity was measured using the Luciferase Bright-Glo Assay System (Promega) on a Berthold Centro XS Luminometer. Luciferase valueswere normalized to both FLUC mRNA levels and total protein. Flue mRNA levels were determined by Northern blot on total cellular RNA isolated from whole-cell lysates by hot phenol extraction and normalized to U1 RNA levels. Flue mRNA levels were determined by Northern blot on total cellular RNA isolated from whole-cell lysates by hot phenol extraction and normalized to U1 RNA levels. Probes made using radiolabeled PCR products from the following primer pairs: 5’-AAGGCGTGTTTGCTGACGTTTC-3’ (SEQ ID NO: 52), 5'- CACCCGTTCCTACCAAGACC-30 (Ul) (SEQ ID NO: 53); 5’- TGGGCGCGTTATTTATCGGAGTTGC-3’ (SEQ ID NO: 54), 5’- GAGCCCATATCCTTGCCTGAT ACC-3’ (Flue) (SEQ ID NO: 55).80S isolation[000149] Translation reactions were loaded onto 10%-50% sucrose gradients in polysome lysis buffer (20 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate, 0.1 M potassium acetate, 0.1 mg / mL cycloheximide, 1% Triton X-100) and centrifuged at 27,000 x g in a Beckman SW28 rotor for 3 h. Gradients were fractionated from the top down using a Biocomp Gradient Station (Biocomp Instruments) with continual monitoring of absorbance at 254 nm. Fractions corresponding to the 80S peak were pooled and RNA extracted using phenol / chloroform followed by isopropanol precipitation.Library preparationRNA pellets from the input pool, total lysate, and gradient fractions were resuspended in binding buffer (0.5M NaCl, 20mM Tris-HCl pH 7.5, ImM EDTA) and biotinylated 5’ UTRs were recovered using Hydrophilic Streptavidin Beads (NEB S1421S). Isolated RNA was reverse transcribed using the barcoded primer OWG921 and Superscript III (Invitrogen 18080093). Gel- purified cDNA products were ligated to the adaptor OWG920 using T4 RNA ligase 1 (NEB M0437M). cDNA cleanup was performed using 10 ml MyOne Silane beads (Thermo Scientific 37002D) per sample. Libraries were then PCR amplified with primers RP1 and OBC and sequenced on a HiSeq 2500.Example 2: Identification of additional yeast translational enhancers and translational silencers[000150] In the second study described herein (“the second study”), using the method developed in the first study, translational enhancers and translational silencers in the 5’ UTR were determined in the budding yeast. These enhancers and silencers are shown in Figs. 7 and 8 and listed in Table 1 below:Table 1 : Identified Saccharomyces cerevisiae translational enhancers and translational silencersExample 3: Identification of additional human translational enhancers and translational silencers [000151] In the third study described herein (“the third study”), using the method developed in the first study, translational enhancers and translational silencers in the 5’ UTR were determined in humans.[000152] Specifically, a human 5’ UTR pool was designed and synthesized. In this 5’-UTR pool, each sequence in the human 5’ UTR pool consisted of a T7 promoter followed by between 10- 230 nucleotides of 5’ UTR sequence followed by at least 24 nucleotides of GFP coding sequence followed by an adaptor sequence used for priming reverse transcription and Illumina sequencing. 5’ UTR sequences were derived from Ensembl annotations. Designed oligos were purchased as pools (Twist Bioscience) and PCR amplified. RNAs were produced by runoff T7 transcription from gel-purified DNA template. RNAs were 5’ capped using the Vaccinia Capping System (NEB M2080S).[000153] In the human translation assays, 20 pmoles of pool RNA were added per 500 microliter translation reaction (16 mM HEPES KOH pH 7.4, 40 mM KOGln, 2 mM MGOGln, 0.8 mM ATP, 0.1 mM GTP, 20 mM creatine phosphate, 0.1 mM spermidine, 1.6 mM DTT, 2 mM PMSF, 140U RNasin Plus, 165 mg creatine phosphokinase, IX cOmplete EDTA-free protease inhibitor) containing 50% Hela cytoplasmic extract (Ipracell). Reactions were incubated with 0.5 mg / mL cycloheximide at 37°C for 30 min in a shaking thermomixer.[000154] The human 80S was isolated according to the following: translation reactions were loaded onto 10%-50% sucrose gradients in polysome lysis buffer (20 mM HEPES-KOH pH 7.4, 2 mM magnesium glutamate, 0. 1 M potassium glutamate, 0.5 mg / mL cycloheximide, 1% Triton X-100) and centrifuged at 35,000 x g in a Beckman SW41 rotor for 3 h. Gradients were fractionated from the top down using a Biocomp Gradient Station (Biocomp Instruments) with continual monitoring of absorbance at 254 nm. Fractions corresponding to the 80S peak were pooled and RNA extracted using phenol / chloroform followed by isopropanol precipitation. [000155] The study confirmed that the DART analysis developed in the first study is highly reproduceable (Figs. 9A-9B).[000156] One batch of identified enhancers and silencers are shown in Figs. 11 A-l IB, and listed in Table 2 below:Table 2: Identified human translational enhancers and translational silencers[000157] The study further shows that the incorporation of modified nucleobases, such as the N1 -methylpseudouridine, in the 5’ UTRs resulted in in the change of translational efficiencies (Figs. 10A-10B). The most efficiency human 5’ UTR sequences with N1 -methylpseudouridine identified in this batch are listed below in Table 3:Table 3[000158] A further screening identified more than a thousand short 5’-UTR sequences that, when combined with N1 -methylpseudouridine, resulted in higher translational efficiency than the 5’- UTR used in Modema mRNA-based vaccine. The short 5’-UTR sequences in this batch are listed below in Table 4 and Table 5 below:Table 4Ill[000159] In a further experiment, the present study identified more 5’-UTR containing N1 - methylpseudouridine, which has increased translational efficiencies or reduced translation efficiencies, shown in Tables 5-8:Table 5: 100-230 nucleotides, highest RRSTable 6: 100-230 nucleotides, 75% percentile RRSTable 7: 10-100 nucleotides, highest RRSTable 8: 10-100 nucleotides, 75% percentile RRSEnumerated embodiments[000160] In some aspects, the present invention is directed to the following non-limiting embodiments:[000161] Embodiment 1: A method of modulating a translational efficiency of a messenger RNA (mRNA) molecule, the method comprising: modifying a 5’-UTR of the mRNA molecule to include a translational enhancer or a translational silencer.[000162] Embodiment 2: The method of Embodiment 1, wherein modifying the 5’-UTR of the mRNA molecule comprises modifying a sequence of a DNA molecule encoding the mRNA molecule.[000163] Embodiment 3: The method of any one of Embodiments 1-2, wherein the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of a yeast species, optionally a yeast species selected from the group consisting of Saccharomyces cerevisiae Pichia pastoris, Hansemila polymorphic Yarrowia lipolytica, Arxula adeninivorans Kluyveromyces lactis, and Schizosaccharomyces pombe.[000164] Embodiment 4: The method of Embodiment 3, wherein the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein the translational enhancer includes at least one sequence selected from the group consisting of SEQ ID NOs: 1-3. [000165] Embodiment 5: The method of Embodiment 3, wherein the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 4-6.[000166] Embodiment 6: The method of any one of Embodiment 1-2, wherein the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of a mammal, optionally a human.[000167] Embodiment 7: The method of Embodiment 6, wherein the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein the translationalenhancer includes at least one sequence selected from the group consisting of SEQ ID NOs: 7- 18, 29-51, 56-1344, 1345-1444, and 1545-1644.[0001681 Embodiment 8: The method of Embodiment 6, wherein the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 19-28, 1445- 1544, and 1645-1744.[000169] Embodiment 9: The method of any one of Embodiment 1-8, wherein the 5’-UTR of the mRNA molecule is further modified to comprise a modified nucleobase.[000170] Embodiment 10: The method of Embodiment 9, wherein the modified nucleobase comprises N6-methyladenosine, inosine, N1 -propylpseudouridine, Nl- methoxymethylpseudouridine, N1 -ethylpseudouridine, 5-methoxycytidine, 5-hydroxyuridine, 5- carboxyuridine, 5-formyluridine, 5-hydroxycytidine, 5-hyrdoxymethylcytidine, 5- hydroxymethyluridine, 5-formylcytidine, 5-carboxycytidine, N4-methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, N1 -methylpseudouridine, pseudouridine, 5- methyluridine, 5-methoxyuridine, dihydrouridine, 5-methylcytidine, 4-thiouridine, 2-thiouridine, uridine-5’-O-(l -thiophosphate), 5-aminoallyluridine, or 4-acetylcytidine.[000171] Embodiment 11 : The method of any one of Embodiment 1-10, wherein the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein a ribosome retention score (RRS) of the modified mRNA molecule is 3X or higher than an RRS of the unmodified mRNA molecule.[000172] Embodiment 12: The method of any one of Embodiments 1-10, wherein the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein a ribosome retention score (RRS) of the modified mRNA molecule is 0.3X or lower than an RRS of the unmodified mRNA molecule.[000173] Embodiment 13: An mRNA molecule comprising a 5’-UTR, wherein the 5’-UTR comprises: a translational enhancer comprising at least one sequence selected from the group consisting of SEQ ID NOs: 1-3, 7-18, 29-51, 56-1344, 1345-1444, and 1545-1644, or a translational silencer comprising at least one selected from the group consisting of SEQ ID NOs: 4-6, 19-28, 1445-1544, and 1645-1744; and a modified nucleobase.[000174] Embodiment 14: The mRNA molecule of Embodiment 13, wherein the modified nucleobase comprises N6-methyladenosine, inosine, N1 -propylpseudouridine, Nl-methoxymethylpseudouridine, N1 -ethylpseudouridine, 5-methoxycytidine, 5-hydroxyuridine, 5- carboxyuridine, 5-formyluridine, 5-hydroxycytidine, 5-hyrdoxymethylcytidine, 5- hydroxymethyluridine, 5-formylcytidine, 5-carboxycytidine, N4-methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, N1 -methylpseudouridine, pseudouridine, 5- methyluridine, 5-methoxyuridine, dihydrouridine, 5-methylcytidine, 4-thiouridine, 2-thiouridine, uridine-5’-O-(l -thiophosphate), 5-aminoallyluridine, or 4-acetylcytidine.[000175] Embodiment 15: The mRNA molecule of any of Embodiments 13-14, wherein the 5’- UTR comprises the translational enhancer, and wherein a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer or the modified nucleobase but otherwise has the same sequence.[000176] Embodiment 16: The mRNA molecule of any of Embodiments 13-15, wherein the 5’- UTR comprises at least one sequences selected from the group consisting of SEQ ID NOs: 29- 50.[000177] Embodiment 17: The mRNA molecule of any of Embodiment 13-14, wherein the 5’- UTR comprises the translational silencer, and wherein an RRS of the mRNA molecule is 0.3X or lower than an RRS of an mRNA molecule that does not comprise the translational silencer or the modified nucleobase but otherwise has the same sequence.[000178] Embodiment 18: The mRNA molecule of any one of Embodiment 13-17, wherein the mRNA molecule encodes a therapeutic peptide or a therapeutic protein.[000179] Embodiment 19: The mRNA molecule of Embodiment 18, wherein the therapeutic peptide or the therapeutic protein comprises a vaccine.[000180] Embodiment 20: A method of constructing an mRNA molecule for producing a therapeutic peptide or a therapeutic protein, the method comprising including a translational enhancer at a 5’ UTR to the 5’ side of a coding region encoding the therapeutic peptide or a therapeutic protein.[000181] Embodiment 21 : The method of Embodiment 20, wherein the therapeutic peptide or a therapeutic protein comprises a vaccine.[000182] Embodiment 22: A yeast cell for expressing a protein, comprising an mRNA molecule or a nucleotide encoding the mRNA molecule, wherein the mRNA molecule comprises: a 5’- UTR comprising at least one yeast translational enhancer; and a coding region encoding the protein, or a coding region for introducing a nucleotide sequence for encoding the protein.[000183] Embodiment 23 : The yeast cell of Embodiment 22, wherein the 5’-UTR comprises at least one sequence selected from the group consisting of SEQ ID NOs: 1-3.[000184] Embodiment 24: The yeast of any one of Embodiment 22-23, wherein the yeast cell is a Saccharomyces cerevisiae cell, a Pichia pastoris cell, a Hansenula polymorpha cell, a Yarrow ia lipolytica cell, an Arxula adeninivorans cell, a Khiyveromyces lactis cell, or a Schizosaccharomyces pombe cell.[000185] The foregoing outlines features of several embodiments so that those skilled in the art may better understand the aspects of the present disclosure. Those skilled in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carrying out the same purposes and / or achieving the same advantages of the embodiments introduced herein. Those skilled in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure, and that they may make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure.

Claims

CLAIMSWhat is claimed is:

1. A method of modulating a translational efficiency of a messenger RNA (mRNA) molecule, the method comprising: modifying a 5’-UTR of the mRNA molecule to include a translational enhancer or a translational silencer.

2. The method of claim 1, wherein modifying the 5’-UTR of the mRNA molecule comprises modifying a sequence of a DNA molecule encoding the mRNA molecule.

3. The method of any one of claims 1-2, wherein the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of a yeast species, optionally a yeast species selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, Arxula adeninivorans, Kluyveromyces lactis, and Schizosaccharomyces pombe.

4. The method of claim 3, wherein the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein the translational enhancer includes at least one sequence selected from the group consisting of SEQ ID NOs: 1-3.

5. The method of claim 3, wherein the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 4-6.

6. The method of any one of claims 1-2, wherein the translational enhancer or the translational silence is a translational enhancer or a translational silencer for the translational machinery of a mammal, optionally a human.

7. The method of claim 6, wherein the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein the translational enhancer includes atleast one sequence selected from the group consisting of SEQ ID NOs: 7-18, 29-51 , 56- 1344, 1345-1444, and 1545-1644.

8. The method of claim 6, wherein the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein the translational silencer includes at least one sequence selected from the group consisting of SEQ ID NOs: 19-28, 1445-1544, and 1645-1744.

9. The method of any one of claims 1-8, wherein the 5’-UTR of the mRNA molecule is further modified to comprise a modified nucleobase.

10. The method of claim 9, wherein the modified nucleobase comprises N6- m ethyladenosine, inosine, N1 -propylpseudouridine, N1 -methoxymethylpseudouridine, N1 -ethylpseudouridine, 5-methoxy cytidine, 5-hydroxyuridine, 5-carboxyuridine, 5- formyluridine, 5-hydroxycytidine, 5-hyrdoxymethylcytidine, 5-hydroxymethyluridine, 5- formylcytidine, 5-carboxycytidine, N4-methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, N1 -methylpseudouridine, pseudouridine, 5-methyluridine, 5- methoxyuridine, dihydrouridine, 5-methylcytidine, 4-thiouridine, 2-thiouridine, uridine- 5’-O-(l-thiophosphate), 5-aminoallyluridine, or 4-acetylcytidine.

11. The method of any one of claims 1-10, wherein the 5’-UTR of the mRNA molecule is modified to include the translational enhancer, and wherein a ribosome retention score (RRS) of the modified mRNA molecule is 3X or higher than an RRS of the unmodified mRNA molecule.

12. The method of any one of claims 1-10, wherein the 5’-UTR of the mRNA molecule is modified to include the translational silencer, and wherein a ribosome retention score (RRS) of the modified mRNA molecule is 0.3X or lower than an RRS of the unmodified mRNA molecule.

13. An mRNA molecule comprising a 5’-UTR, wherein the 5’-UTR comprises:a translational enhancer comprising at least one sequence selected from the group consisting of SEQ ID NOs: 1-3, 7-18, 29-51, 56-1344, 1345-1444, and 1545-1644, or a translational silencer comprising at least one selected from the group consisting of SEQ ID NOs: 4-6, 19-28, 1445-1544, and 1645-1744; and a modified nucleobase.

14. The mRNA molecule of claim 13, wherein the modified nucleobase comprises N6- methyladenosine, inosine, N1 -propylpseudouridine, N1 -methoxymethylpseudouridine, N1 -ethylpseudouridine, 5-methoxy cytidine, 5-hydroxyuridine, 5-carboxyuridine, 5- formyluridine, 5-hydroxycytidine, 5-hyrdoxymethylcytidine, 5-hydroxymethyluridine, 5- formylcytidine, 5-carboxy cytidine, N4-methylcytidine, pseudoisocytidine, 2-thiocytidine, 4-thiocytidine, N1 -methylpseudouridine, pseudouridine, 5-methyluridine, 5- methoxyuridine, dihydrouridine, 5-methylcytidine, 4-thiouridine, 2-thiouridine, uridine- 5’-O-(l-thiophosphate), 5-aminoallyluridine, or 4-acetylcytidine.

15. The mRNA molecule of any of claims 13-14, wherein the 5’-UTR comprises the translational enhancer, and wherein a ribosome retention score (RRS) of the mRNA molecule is 3X or higher than an RRS of an mRNA molecule that does not comprise the translational enhancer or the modified nucleobase but otherwise has the same sequence.

16. The mRNA molecule of any of claims 13-15, wherein the 5’-UTR comprises at least one sequences selected from the group consisting of SEQ ID NOs: 29-50.

17. The mRNA molecule of any of claims 13-14, wherein the 5’-UTR comprises the translational silencer, and wherein an RRS of the mRNA molecule is 0.3X or lower than an RRS of an mRNA molecule that does not comprise the translational silencer or the modified nucleobase but otherwise has the same sequence.

18. The mRNA molecule of any one of claims 13-17, wherein the mRNA molecule encodes a therapeutic peptide or a therapeutic protein.

19. The mRNA molecule of claim 18, wherein the therapeutic peptide or the therapeutic protein comprises a vaccine.

20. A method of constructing an mRNA molecule for producing a therapeutic peptide or a therapeutic protein, the method comprising including a translational enhancer at a 5’ UTR to the 5’ side of a coding region encoding the therapeutic peptide or a therapeutic protein.

21. The method of claim 20, wherein the therapeutic peptide or a therapeutic protein comprises a vaccine.

22. A yeast cell for expressing a protein, comprising an mRNA molecule or a nucleotide encoding the mRNA molecule, wherein the mRNA molecule comprises: a 5’-UTR comprising at least one yeast translational enhancer; and a coding region encoding the protein, or a coding region for introducing a nucleotide sequence for encoding the protein.

23. The yeast cell of claim 22, wherein the 5’-UTR comprises at least one sequence selected from the group consisting of SEQ ID NOs: 1-3.

24. The yeast of any one of claims 22-23, wherein the yeast cell is a Saccharomyces cerevisiae cell, a Pichia pastoris cell, a Hansenula polymorpha cell, a Yarrowia lipolytica cell, an Arxula adeninivorans cell, a Kluyveromyces lactis cell, or a Schizosaccharomyces pombe cell.