Codon optimized pmcv sequences
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- INTERVET INT BV
- Filing Date
- 2024-06-26
- Publication Date
- 2026-05-06
Smart Images
Figure IMGF000012_0001
Abstract
Description
[0001] CODON OPTIMIZED PMCV SEQUENCES
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application Serial No. 63 / 523,476, filed on June 27, 2023, the entire disclosure of which is incorporated herein by reference.
[0004] TECHNICAL FIELD
[0005] The disclosure relates to sequences of Piscine Myocarditis Virus (PMCV) sequences that have been modified to comprise codons optimized for expression in cells.
[0006] BACKGROUND AND SUMMARY OF THE INVENTION
[0007] Cardiomyopathy syndrome (CMS) is an emerging disease of economic importance in salmon. In particular, the Piscine Myocarditis Virus (PMCV) has been identified as a causative link for CMS. PMCV is of large economic concern in the salmonid industry because it causes morbidity and mortality in adult fish that are nearly full grown and almost ready for harvest.
[0008] PMCV encodes at least three major proteins: a capsid (ORF1), an RNA- dependent RNA polymerase (ORF2), and a structural protein of unknown function (ORF3) that may be involved in virus assembly or egress. However, attempts to propagate PMCV using in vitro cell culture systems have failed. As a result, traditional live, attenuated, and inactivated vaccine approaches have not yet materialized. Thus, there exists a need for a PMCV vaccine that utilizes DNA, RNA, or recombinant approaches for design, in particular those utilizing nucleic acid sequences that have been modified to comprise codons optimized for improved expression.
[0009] Accordingly, the present disclosure, in one aspect, provides nucleic acid molecules (e.g., described in one aspect as sequences) encoding Piscine Myocarditis Virus (PMCV) protein(s). In one example, the nucleic acid sequences of the present disclosure have been modified to comprise codons optimized for improved expression in cells.
[0010] DETAILED DESCRIPTION
[0011] Various embodiments are described herein as follows.
[0012] Illustrative aspects of the present disclosure include SEQ ID NO: 1. As described herein, SEQ ID NO: 1 corresponds to a codon optimized sequence for ORF_1 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 1 is provided.
[0013] Illustrative aspects of the present disclosure include SEQ ID NO: 2. As described herein, SEQ ID NO: 2 corresponds to a codon optimized sequence for ORF_3 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO:
[0014] 2 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 2 is provided.
[0015] Illustrative aspects of the present disclosure include SEQ ID NO: 3. As described herein, SEQ ID NO: 3 corresponds to a codon optimized sequence for ORF_3 FR13 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 3 is provided.
[0016] Illustrative aspects of the present disclosure include SEQ ID NO: 4. As described herein, SEQ ID NO: 4 corresponds to a second codon optimized sequence for ORF_1 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 4 is provided.
[0017] Illustrative aspects of the present disclosure include SEQ ID NO: 5. As described herein, SEQ ID NO: 5 corresponds to a second codon optimized sequence for ORF_3 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 5 is provided.
[0018] Illustrative aspects of the present disclosure include SEQ ID NO: 6. As described herein, SEQ ID NO: 6 corresponds to second codon optimized sequence for ORF_3 FR13 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 6 is provided.
[0019] In illustrative aspects, an expression vector is provided. The expression vector comprises one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences can comprise any of the codon optimized nucleic acid sequences described herein.
[0020] The following numbered embodiments are contemplated and are non-limiting.
[0021] 1. A codon optimized nucleic acid sequence comprising SEQ ID NO:1.
[0022] 2. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:1.
[0023] 3. A codon optimized nucleic acid sequence consisting of SEQ ID NO:1.
[0024] 4. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 1.
[0025] 5. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:1.
[0026] 6. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 1.
[0027] 7. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:1.
[0028] 8. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 1.
[0029] 9. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ 1D NO:1.
[0030] 10. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 1.
[0031] 11. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 1.
[0032] 12. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:1.
[0033] 13. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 1. 14. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 1.
[0034] 15. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:1.
[0035] 16. A codon optimized nucleic acid sequence comprising SEQ ID NO:2.
[0036] 17. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:2.
[0037] 18. A codon optimized nucleic acid sequence consisting of SEQ ID NO:2.
[0038] 19. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:2.
[0039] 20. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:2.
[0040] 21. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:2.
[0041] 22. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:2.
[0042] 23. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:2.
[0043] 24. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:2.
[0044] 25. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:2.
[0045] 26. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:2.
[0046] 27. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:2.
[0047] 28. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:2.
[0048] 29. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:2.
[0049] 30. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:2.
[0050] 31. A codon optimized nucleic acid sequence comprising SEQ ID NO:3.
[0051] 32. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:3.
[0052] 33. A codon optimized nucleic acid sequence consisting of SEQ ID NO:3. 34. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:3.
[0053] 35. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:3.
[0054] 36. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:3.
[0055] 37. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:3.
[0056] 38. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:3.
[0057] 39. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:3.
[0058] 40. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:3.
[0059] 41. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:3.
[0060] 42. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:3.
[0061] 43. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:3.
[0062] 44. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:3.
[0063] 45. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:3.
[0064] 46. A codon optimized nucleic acid sequence comprising SEQ ID NO:4.
[0065] 47. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:4.
[0066] 48. A codon optimized nucleic acid sequence consisting of SEQ ID NO:4.
[0067] 49. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:4.
[0068] 50. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:4.
[0069] 51. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:4. 52. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:4.
[0070] 53. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:4.
[0071] 54. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:4.
[0072] 55. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:4.
[0073] 56. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:4.
[0074] 57. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:4.
[0075] 58. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:4.
[0076] 59. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:4.
[0077] 60. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:4.
[0078] 61. A codon optimized nucleic acid sequence comprising SEQ ID NO:5.
[0079] 62. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:5.
[0080] 63. A codon optimized nucleic acid sequence consisting of SEQ ID NO:5.
[0081] 64. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:5.
[0082] 65. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:5.
[0083] 66. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:5.
[0084] 67. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:5.
[0085] 68. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:5.
[0086] 69. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:5. 70. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:5.
[0087] 71. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:5.
[0088] 72. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:5.
[0089] 73. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:5.
[0090] 74. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:5.
[0091] 75. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:5.
[0092] 76. A codon optimized nucleic acid sequence comprising SEQ ID NO:6.
[0093] 77. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:6.
[0094] 78. A codon optimized nucleic acid sequence consisting of SEQ ID NO:6.
[0095] 79. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:6.
[0096] 80. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:6.
[0097] 81. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:6.
[0098] 82. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:6.
[0099] 83. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:6.
[0100] 84. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:6.
[0101] 85. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:6.
[0102] 86. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:6.
[0103] 87. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:6. 88. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:6.
[0104] 89. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:6.
[0105] 90. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:6.
[0106] 91. An expression vector comprising one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences are selected from any one of clauses 1 to 90 and any combination thereof.
[0107] EXAMPLE 1
[0108] Exemplary Codon Optimized Nucleic Acid Sequences
[0109] Exemplary codon optimized nucleic acid sequence were constructed. The nucleic acid sequences as shown in Table 1 can be utilized according to the present disclosure.
[0110] Table 1.
[0111] The sequences include the following:
[0112] ATGGAGCCCAATACCAGCGTGATCGCTACCGAACAACAACAAGCTGCTATGAGAG
[0113] AAGTCGAAGCTGAAGCTGCTGCTAGAGATGAGGTCGTCGAAAAAATTGCCTTTGCC
[0114] GAGGGAGCCATGATGGTGCAAACCAGAAGACTGCCCAGCGGAAAATCCAGCGTGG
[0115] GCGGATTCCTGGGAGAGCTCGCTCAAAATATCAGGGCTATGAACAGATCCCTGCAT
[0116] ACCGACACAAATATGCTCACAGAGGGAGCTATGGTCGATAGGGCTAGAGCCAAGG
[0117] TGCATAAGATTATCAGAGAGGGAAACCTGGATTCCAGAGTGTTCAGCAATACCGGC
[0118] TCCAATACCATGCTGAGCCTCTGGGTGCCTGCTGTGCCAGGCCCTCCCGCTGTGCCC
[0119] GAACACTGGGATGTGGCTCCAAGCTGGTTTGTGTGTAGGCCAGGCAAGAAAGGCG GAATCAAAATTACCCAGTCCGCTAGCATGGCTGCTCTGAATCCCCTGTTCAGGGGA
[0120] GCCGATGTCGGACCTATTGGAACCGCTGTGAGAGCCGACGTGAATGCCTTCTCCAT
[0121] GAACGCTGTGCTCGGAGCTCTGAGGGCTGGCGGATTCAATACAGAGCACAGCCTCG
[0122] TCAGCTTTGTGGAGCCCCTGATCAGGATTCTGCTGATGGGAGTGCAGACCCAGGAT
[0123] AGAGGAACAAGCCCTTGGGACTGGGTGGGCGGAATGTCCAGCAGGATCGTGAACC
[0124] CTCTGGTGTTTACCACCTCCGGAAATTTTTTTCCCGGCGGACCTAACCTGAGAGTCT
[0125] GGGGCGCTAATGACACCGTCGCTAGAATCGTGAATGTGGAAGATTATATGAGGGA
[0126] AGCTGCTGGAGAAGGAAGATTTGATGCTGGATGGGGACCAGAGTTTTGGGGCGGA
[0127] ACCGGAGATGATGCTGTCGCTGTCGTGCCAATCAGAGCTGTGGAGGCTGGACTGGG
[0128] AGAGGTGAATGCTGGATGGACCCTGGCTCATATGGAGTATCCCGTGAAAGTGAGG
[0129] CTGCTGGATGTGGATGATAGAACCATCGGACCCGGCGGAAGCCTCCCACTGAATGC
[0130] TAATAGGGAGTATACCGCTGCTGGAGCTACCCACGTGCCAGGACCTTACGCTAGAG
[0131] TGCTCTATGTGGTGGTCGATCAGAATGCCGATAGATGTGTCGGAGTCAGAGTCCAA
[0132] GGACAAGGAGCTGTGATCGATGTCGACCCCGCCCTGAACTATGTCATCGGCGGAGC
[0133] CGACCTGGGAATGCTGCCCCTGATCCAATGGAGCGTGGGACTCGGAGCTGAAGAT
[0134] ATGGCTCAAGGATCCATCGCCCAAACCCAAAGATGGGTCAGAATGTACGGCAATG
[0135] AAGATGACTGGGAGTCCGCTTGGCACCTGGTCTCCAGCGCCTATACCGTCTATAGC
[0136] CCAGCTTTTAGAAGATCCGGAGTGGCTGTCGAAGGCGGATTTTGGGCTCAGCCTGC
[0137] TGCTGGAGCTGCTCCCTTCCCCCTGGGCGGACTGGCCGGCTGGGTCAGATATGATA
[0138] ACCAAGCTAGAGCTGCTCAAGTGGCTCTGTGTAGGGAAAGAGCTGACATGGCTGA
[0139] ATGTCCATGGGGCGGATATAGAGAAAGAGGAGTCAGACCCGGAAGCGTCGCTAAT
[0140] TGGCAATATGTGAGATTTGACCCAACCGTCGCTGTGGGAGTGGCTGCCCATTTTTG
[0141] GTCCGTGGTCAAAGTCATGGTCGCTCCAGTGCCTGATAGGGCTGCTGCCCTCGCCG
[0142] ATATGGCCTGGGGCAAAGGAAAAGTCCAGGCTATGGGAGAAGACGTCATTAATGG
[0143] CCAAATGGGACAGCCCGAAAGCATGATGAGGGGAGTCGCTCTCAATGAAAATCAA
[0144] GGACTGGCTGCTGCTACCGTGAGAAGAGTCGTGGGCCTCGAAAATGAAAGCATGC
[0145] AGACCACCCATTGGTCCACCACCGAAGTGGCCATGAATGGCTATTATGGAAGAGCT
[0146] GGAGCTACCGCTCATCATGCTGCTTTCCCCCTGAGCGAAGGCGGAACCATGAGGAA
[0147] GAGAATCCCCGCCATCGAAATGAGAGAAAATGGAGTCGAAGGCGATCTCATGAAT
[0148] GACGACCTGTACTCCATCGGAACCGCCGCCGGCTATCTCGCTGTGGAAGGAATGGC
[0149] TGGAGCTCAAGGCGGAATTTGGGATGTCGTGCAATATCAACTCCCAGGACCAGATG
[0150] ACGAAGCTAGAGGAGTCATGAATACCGTCGGAGCTATGGGCGGATGGACCAGAGC
[0151] TGTCACCCCTGTGGATAACGTCGCTACAATGAGAGATAATGGAGTGGAAGGCGAG
[0152] CCCTGCGGAATCGTCATGAGCCTGCCTACCTCCGGAACAGCTGTCGTCGACAGACT GGCCAACTTTGGACTGCCTCCCGCTAGAGCTGAGCTGAGAGAGGTGCCTTTCGGAG
[0153] GATATCAGAGGTCCGTGACCAATACAAATCATAGAGTGAAAGTCTCCGTCAGCGGC
[0154] GGAAGGGCTGTGGTGCAGAAGGGAAATAAGGCTGAAATGAACCCCGTGTTCGTGA
[0155] ACAGAACCCCTGGACAGACCACACTGGGACAGCCTACCACCGATACCACCGGAAT
[0156] GACCACCGCTGACTTCCTGGACATCTGA (SEQ ID NO: 1)
[0157] ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA
[0158] GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA
[0159] GGGTGCCACTGGTCGGAGAAGGAAGAGCTGAAAAAATTGAACTGTTTAACCAATC
[0160] CGCTACCTGCGGCAAAAAGGAACTGATCATCACCTGGAAAGGAAAAAGATGGTGT
[0161] TATGACATCGAATCCAAAAGGGGCAAGATCCTGGTGAAAACCCTCAGCGGCGGAG
[0162] GCCACCTCGAGAGAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT
[0163] GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG
[0164] GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG
[0165] GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT
[0166] TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGAGGCGGATCCGT
[0167] GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC
[0168] GACATGCTGCCCCTGGTGGTGGGAATCGCTGGCGGATGCCTGATCGTCATCGTGGT
[0169] GCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG
[0170] CCCGCTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGAAGAAGACTGGAACCTA
[0171] GGCCTCCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA
[0172] GTTTATGGGAGTGGAGGGATCCGAGAGCCCTGATTCCGGATGTCAAAGCGACGAG
[0173] GAAGGCTTTAGGGTGGGAGTGTGA (SEQ ID NO: 2)
[0174] ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA
[0175] GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA
[0176] GGGTGCCACTGGTCGGAGAAGGAAGAGCTGAAAAAATTGAACTGTTTAACCAATC
[0177] CGCTACCTGCCGGAAAAAGGAACTGATCATCACCTGGAAAGGAAAAAGATGGTGT
[0178] TATGACATCGGATCCAAAAGGGGCAAGGTGCTGGTGCAGACCCTCAGCGGCGGAG
[0179] GCCACCTCGAGCAGGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT
[0180] GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG
[0181] GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG
[0182] GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGAGGCGGATCCGT
[0183] GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC
[0184] GACATGCTGCCCCTGGTGGTGGGAATCGCTGGCGGATGCCTGATCGTCATCGTGAT
[0185] CCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAGC
[0186] CCGTGGAGCCAGAAGAGCATGAAATGAGAGACCTGAGAAGAAGACTGGAACCTAG
[0187] GCCTCCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGAG
[0188] TTTATGGGAGTGGAGGGATCCGAGAGCCCTGATTCCGGATGTCAAAGCGACGAGG
[0189] AAGGCTTTAGGGTGGGAGTGTGA (SEQ ID NO: 3)
[0190] ATGGAGCCTAATACTAGCGTTATAGCTACAGAACAACAACAAGCAGCTATGCGCG
[0191] AAGTCGAAGCTGAAGCTGCTGCTCGCGATGAGGTCGTCGAAAAAATTGCTTTTGCA
[0192] GAGGGGGCTATGATGGTCCAAACAAGAAGACTCCCTAGCGGGAAAAGCAGCGTCG
[0193] GGGGATTCTTGGGAGAGCTCGCTCAAAATATTAGAGCTATGAACAGAAGCCTCCAT
[0194] ACTGACACAAATATGCTCACAGAGGGAGCTATGGTCGATCGCGCTAGAGCTAAGG
[0195] TCCATAAGATTATAAGAGAGGGAAACCTCGATAGCAGAGTCTTCAGCAATACAGG
[0196] ATCTAATACAATGCTCAGCCTCTGGGTCCCTGCTGTCCCTGGGCCTCCTGCTGTCCC
[0197] TGAACACTGGGATGTCGCTCCTAGCTGGTTTGTCTGTCGCCCTGGAAAGAAAGGAG
[0198] GAATTAAAATTACTCAGTCTGCTAGCATGGCTGCTCTCAATCCTCTCTTCCGCGGAG
[0199] CTGATGTCGGACCTATTGGAACTGCTGTTAGAGCTGACGTCAATGCTTTCAGCATG
[0200] AACGCTGTCCTCGGGGCTCTCCGCGCTGGAGGGTTCAATACAGAGCACAGCCTCGT
[0201] CAGCTTTGTCGAGCCTCTCATAAGAATTCTCCTCATGGGAGTCCAGACTCAGGATA
[0202] GAGGAACATCTCCTTGGGACTGGGTCGGGGGAATGAGCAGCAGAATTGTTAACCCT
[0203] CTCGTCTTTACTACTTCTGGAAATTTTTTTCCTGGAGGGCCTAACCTCAGAGTCTGG
[0204] GGGGCTAATGACACTGTCGCTAGAATTGTCAATGTCGAAGATTATATGAGAGAAGC
[0205] TGCTGGAGAAGGAAGATTTGATGCAGGGTGGGGGCCTGAGTTTTGGGGAGGAACT
[0206] GGAGATGATGCTGTCGCTGTCGTCCCTATTAGAGCTGTCGAGGCTGGACTCGGGGA
[0207] GGTCAATGCTGGATGGACTCTCGCTCATATGGAGTATCCTGTTAAAGTCCGCCTCCT
[0208] CGATGTTGATGATAGAACTATAGGGCCTGGAGGATCTCTCCCTCTCAATGCTAATC
[0209] GCGAGTATACAGCTGCTGGGGCAACACACGTCCCTGGACCTTACGCTAGAGTCCTC
[0210] TATGTTGTTGTCGATCAGAATGCTGATAGATGCGTCGGAGTCCGCGTCCAAGGGCA
[0211] AGGAGCAGTCATAGATGTCGACCCTGCTCTCAACTATGTCATTGGAGGGGCTGACC
[0212] TCGGAATGCTCCCTCTCATTCAATGGAGCGTCGGACTCGGAGCTGAAGATATGGCT
[0213] CAAGGGAGCATAGCTCAAACACAAAGATGGGTCAGAATGTACGGGAATGAAGATG
[0214] ACTGGGAGAGCGCTTGGCACCTCGTCAGCTCTGCTTATACTGTCTATTCTCCTGCTT TTAGACGCAGCGGAGTTGCTGTCGAAGGGGGGTTTTGGGCTCAGCCTGCAGCTGGA
[0215] GCTGCTCCTTTCCCTCTCGGGGGGCTCGCTGGATGGGTCAGATATGATAACCAAGC
[0216] TAGAGCTGCTCAAGTCGCTCTCTGTCGCGAAAGAGCTGACATGGCTGAATGCCCAT
[0217] GGGGAGGATATAGAGAACGCGGAGTCCGCCCTGGAAGCGTCGCTAATTGGCAATA
[0218] TGTCAGATTTGACCCTACTGTCGCAGTCGGGGTCGCAGCACATTTTTGGAGCGTCGT
[0219] CAAAGTCATGGTCGCACCTGTTCCTGATCGCGCTGCAGCACTCGCTGATATGGCTT
[0220] GGGGAAAAGGAAAAGTCCAGGCTATGGGAGAAGACGTCATTAATGGACAAATGGG
[0221] GCAGCCAGAAAGCATGATGCGCGGAGTCGCTCTCAATGAAAATCAAGGGCTCGCT
[0222] GCTGCAACTGTTAGAAGAGTCGTCGGACTCGAAAATGAAAGCATGCAGACTACAC
[0223] ATTGGAGCACTACAGAAGTCGCTATGAATGGATATTATGGACGCGCTGGGGCTACT
[0224] GCTCATCATGCAGCTTTCCCTCTCAGCGAAGGAGGAACTATGAGAAAGAGAATTCC
[0225] TGCAATTGAAATGAGAGAAAATGGAGTCGAAGGAGATCTCATGAATGACGACTTG
[0226] TACAGCATAGGGACAGCTGCTGGATATCTCGCTGTCGAAGGAATGGCTGGAGCTCA
[0227] AGGAGGAATTTGGGATGTCGTTCAATATCAACTCCCAGGACCAGATGACGAAGCTA
[0228] GAGGAGTCATGAATACAGTCGGAGCTATGGGAGGGTGGACAAGAGCTGTCACTCC
[0229] TGTCGATAACGTCGCTACAATGAGAGATAATGGAGTCGAAGGAGAGCCATGCGGG
[0230] ATTGTCATGAGCCTCCCTACTAGCGGAACAGCAGTCGTCGACAGACTCGCAAACTT
[0231] TGGGCTCCCTCCTGCTAGAGCTGAGCTCCGCGAGGTCCCTTTCGGAGGATATCAGC
[0232] GCAGCGTTACTAATACAAATCATCGCGTTAAAGTCAGCGTCAGCGGAGGAAGAGC
[0233] TGTCGTCCAGAAGGGAAATAAGGCTGAAATGAACCCTGTTTTCGTTAACAGAACTC
[0234] CTGGGCAGACAACACTCGGACAGCCTACTACTGATACAACTGGAATGACTACAGCT
[0235] GACTTCCTCGACATTTAA (SEQ ID NO: 4)
[0236] ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA
[0237] GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA
[0238] GGGTGCCACTGGTCGGGGAAGGGAGAGCAGAAAAAATTGAACTGTTTAACCAATC
[0239] CGCTACCTGCGGCAAAAAGGAACTGATCATCACCTGGAAAGGGAAAAGATGGTGT
[0240] TATGACATCGAATCCAAAAGGGGCAAGATCCTGGTGAAAACCCTCTCTGGCGGAG
[0241] GCCACCTCGAGAGAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT
[0242] GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG
[0243] GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG
[0244] GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT
[0245] TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGGGGCGGGTCCGT
[0246] GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC GACATGCTGCCCCTGGTGGTGGGGATCGCTGGCGGATGCCTGATCGTCATCGTGGT GCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG CCCGCTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGACGCAGACTGGAACCTA GGCCACCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA GTTTATGGGAGTGGAGGGATCCGAGTCTCCTGATTCCGGGTGTCAAAGCGACGAGG AAGGCTTTAGGGTGGGGGTGTGA (SEQ ID NO: 5)
[0247] ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA GGGTGCCACTGGTCGGGGAAGGGAGAGCAGAAAAAATTGAACTGTTTAACCAATC CGCTACCTGCCGCAAAAAGGAACTGATCATCACCTGGAAAGGGAAAAGATGGTGT TATGACATCGGATCCAAAAGGGGCAAGGTCCTGGTGCAAACCCTCTCTGGCGGAG GCCACCTCGAGCAAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGGGGCGGGTCCGT GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC GACATGCTGCCCCTGGTGGTGGGGATCGCTGGCGGATGCCTGATCGTCATCGTGAT ACTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG CCCGTTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGACGCAGACTGGAACCTA GGCCACCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA GTTTATGGGAGTGGAGGGATCCGAGTCTCCTGATTCCGGGTGTCAAAGCGACGAGG AAGGCTTTAGGGTGGGGGTGTGA (SEQ ID NO: 6)
[0248] EXAMPLE 2
[0249] Exemplary Vectors
[0250] Exemplary vectors can be constructed using fusion technology to create various plasmids. For instance, starting with an existing plasmid, a variant plasmid can be designed to include one or more codon optimized nucleic acid sequences of the present disclosure.
Claims
WHAT IS CLAIMED IS:
1. A codon optimized nucleic acid sequence comprising SEQ ID NO: 1.
2. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:1.
3. A codon optimized nucleic acid sequence consisting of SEQ ID NO:1.
4. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:1.
5. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:1.
6. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:1.
7. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:1.
8. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:1.
9. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:1.
10. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:1.
11. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:1 .
12. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:1.
13. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:1.
14. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:1.
15. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:1.
16. A codon optimized nucleic acid sequence comprising SEQ ID NO:2.
17. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:2.
18. A codon optimized nucleic acid sequence consisting of SEQ ID NO:2.
19. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:2.
20. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:2.
21. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:2.
22. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:2.
23. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:2.
24. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:2.
25. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:2.
26. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:2.
27. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:2.
28. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:2.
29. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:2.
30. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:2.
31. A codon optimized nucleic acid sequence comprising SEQ ID NO:3.
32. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:3.
33. A codon optimized nucleic acid sequence consisting of SEQ ID NO:3.
34. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:3.
35. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:3.
36. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:3.
37. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:3.
38. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:3.
39. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:3.
40. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:3.
41. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:3.
42. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:3.
43. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:3.
44. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:3.
45. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:3.
46. A codon optimized nucleic acid sequence comprising SEQ ID NO:4.
47. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:4.
48. A codon optimized nucleic acid sequence consisting of SEQ ID NO:4.
49. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:4.
50. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:4.
51. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:4.
52. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:4.
53. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:4.
54. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:4.
55. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:4.
56. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:4.
57. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:4.
58. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:4.
59. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:4.
60. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:4.
61. A codon optimized nucleic acid sequence comprising SEQ ID NO:5.
62. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:5.
63. A codon optimized nucleic acid sequence consisting of SEQ ID NO:5.
64. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:5.
65. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:5.
66. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:5.
67. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:5.
68. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:5.
69. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:5.
70. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:5.
71. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:5.
72. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:5.
73. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:5.
74. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:5.
75. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:5.
76. A codon optimized nucleic acid sequence comprising SEQ ID NO:6.
77. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:6.
78. A codon optimized nucleic acid sequence consisting of SEQ ID NO:6.
79. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:6.
80. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:6.
81. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:6.
82. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:6.
83. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:6.
84. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:6.
85. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:6.
86. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:6.
87. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:6.
88. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:6.
89. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:6.
90. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:6.
91. An expression vector comprising one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences are selected from any one of claims 1 to 90 and any combination thereof.
92. An immunogenic composition comprising the expression vector of claim 91.
93. A plurality of expression vectors, wherein at least one expression vector comprises the one or more codon optimized nucleic acids sequences are selected from any one of claims 1 to 90.
94. An immunogenic composition comprising the plurality of expression vectors of claim 93.
95. A method of immunizing a non-human animal with the immunogenic composition of claim 94.
96. The method of claim 95, wherein the non-human animal is a fish.