Recombinant bacillus subtilis displaying prrsv e5 protein on spore surface, construction method and application thereof
By displaying optimized PRRSV E5 protein on the surface of Bacillus subtilis spores, the problems of insufficient immunogenicity and broad-spectrum protection of existing vaccines were solved, achieving a highly efficient PRRSV prevention and control effect and simplifying the immunization procedure.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SICHUAN AGRI UNIV
- Filing Date
- 2026-03-18
- Publication Date
- 2026-06-12
AI Technical Summary
Existing porcine reproductive and respiratory syndrome virus (PRRSV) vaccines suffer from insufficient immunogenicity, high cost, and difficulty in providing broad-spectrum protection. In particular, traditional vaccines are not effective in controlling genotype variations.
A recombinant Bacillus subtilis strain was constructed. By displaying the PRRSV E5 protein on the spore surface, the stress resistance and probiotic properties of Bacillus subtilis were utilized. The antigen fragment was shortened by combining GP3, GP4, and GP5 proteins, and the linker peptide design was optimized to achieve efficient display and enhanced immunogenicity.
Inducing high levels of specific and neutralizing antibodies in mice and pigs significantly enhanced cross-protection against prevalent PRRSV variants, simplified immunization procedures, and reduced animal stress and labor costs.
Smart Images

Figure CN122189046A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a method for constructing recombinant Bacillus subtilis that displays the Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) E5 protein on the surface of spores, and its application. Background Technology
[0002] Porcine reproductive and respiratory syndrome (PRRS) is one of the most serious infectious diseases in the global pig industry, severely impacting food safety. It primarily causes reproductive disorders in sows and a range of respiratory diseases in newborn piglets and finishing pigs. Because it can cause cyanosis (blue discoloration) of the ears and other terminal tissues in affected pigs, it is also known as "blue ear" disease. Its causative agent is porcine reproductive and respiratory syndrome virus (PRRSV), a small, enveloped, positive-sense, single-stranded RNA virus belonging to the Arteriviridae family. The virus particles are nearly spherical or elliptical. The PRRSV genome is approximately 15.4 kb, consisting of single-stranded, positive-sense, unsegmented RNA encapsulated by nucleocapsid proteins. The viral genome contains 10 overlapping open reading frames (ORFs). ORF1a and ORF1b encode the virus's RNA replicase and polymerase, respectively; ORF2a, ORF2b, ORF3, ORF4, ORF5a, ORF5, ORF6, and ORF7 encode GP2, E, GP3, GP4, ORF5a (abbreviated as 5a), GP5, matrix protein M, and nucleocapsid protein N, respectively. Based on the above genome and structural proteins, PRRSV is currently considered to be divided into two different genotypes: the European type (PRRSV-1) and the North American type (PRRSV2). The representative strain of PRRSV-1 is Lelystad virus (LV strain), and the representative strain of PRRSV-2 is VR-2332 strain. The genomic nucleic acid homology between these two genotypes is less than 70%, resulting in antigenic variability and immunological diversity, posing a significant challenge to the epidemiological surveillance and control strategies for PRRSV.
[0003] Studies have shown that vaccines are currently the most effective method for preventing PRRSV infection, mainly including: traditional inactivated vaccines, live attenuated vaccines, subunit vaccines, and genetically engineered vaccines still under development. Inactivated vaccines are safe but have weak immunogenicity; live attenuated vaccines have safety risks such as virulence reversion and recombination with wild-type strains, and their cross-protection against heterologous strains is also limited; subunit and vector vaccines are safer, but their immunogenicity is insufficient and their cost is high, and they are mostly administered by injection. Furthermore, due to the high genetic variability of PRRSV, existing injectable vaccines cannot simultaneously meet the requirements of broad-spectrum protection, high safety, and low cost. Therefore, developing a new vaccine is of great significance for the effective prevention and control of PRRSV, as well as ensuring the stability of the pig industry and guaranteeing food security.
[0004] In existing technologies, Bacillus subtilis is a recognized safe probiotic whose spores exhibit strong resistance, surviving in extreme environments such as high temperature, dryness, and strong acidity. Utilizing spore surface display technology to anchor exogenous antigen proteins onto the spore surface for oral vaccine development has become a new direction in vaccine research. Prior studies have reported on the tandem display of conserved fragments of PRRSV genes such as ORF1b, GP5, M, and N on the surface of Bacillus subtilis spores (e.g., prior patent CN120310816A). However, the antigen fragments selected in this approach are mainly derived from non-structural and internal proteins, and the induced neutralizing antibody levels and cross-protective capabilities still need improvement.
[0005] In summary, developing a novel oral mucosal vaccine-type probiotic formulation for PRRSV with high safety, strong immunogenicity, and broad-spectrum protection remains a key research focus and technological need in this field. Summary of the Invention
[0006] The purpose of this application is to provide a novel and more immunogenic E5 gene, a recombinant Bacillus subtilis strain based on this gene that can display PRRSV E5 protein on the spore surface, its construction method and its application.
[0007] The technical solution adopted in this application is as follows: The first aspect of this application discloses an E5 gene, the nucleotide sequence of which is shown in SEQ ID No.1; and the E5 gene is constructed with ATG as the start codon, and the antigen protein encoded by it includes, from the N-terminus to the C-terminus, a truncated antigen fragment of GP3 protein, a truncated antigen fragment of GP4 protein, and a truncated antigen fragment of GP5 protein of porcine reproductive and respiratory syndrome virus linked sequentially by a linker peptide.
[0008] Specifically, the E5 gene in this application contains an optimized GP3-GP4-GP5 gene protein's immune cell epitope antigen fragment, the nucleotide sequence of which is shown in SEQ ID No. 1. The E5 gene uses ATG as the start codon, and its chimeric antigen protein, from the 5' end to the 3' end (or the N-terminus to the C-terminus), sequentially includes: a truncated GP3 protein antigen fragment, a first linker peptide, a truncated GP4 protein antigen fragment, a second linker peptide, and a truncated GP5 protein antigen fragment. The nucleotide sequence shown in SEQ ID No. 1 was obtained by the inventors after extensive screening and optimization. This sequence is not naturally occurring; rather, it was formed by truncating and optimizing the coding genes of GP3, GP4, and GP5 proteins using PRRSV NADC30-Like strain (GenBank: KF611905.1) as a template, and then linking them together with linkers. Specifically, based on the domains and antigenicity of the GP3, GP4, and GP5 proteins, fragments that easily induce the production of non-neutralizing antibodies, as well as signal peptides and transmembrane regions that may affect the correct folding of the fusion protein, were identified and removed. This operation not only preserves the core neutralizing epitopes, but also avoids expression instability and epitope masking problems caused by the complex conformation of full-length proteins.
[0009] Furthermore, by designing suitable linker peptides (first linker peptide, second linker peptide) to sequentially connect the three truncated fragments, it is ensured that each fragment can fold independently after translation, maximizing the exposure of its conformational neutralizing epitopes. Specifically, the linker peptides provide sufficient spatial freedom for each fragment, preventing adjacent fragments from interfering with each other's folding due to steric hindrance. Moreover, each truncated fragment can form its native conformation relatively independently, thereby enabling the immune system to effectively recognize neutralizing epitopes targeting different proteins, potentially inducing a broad-spectrum immune response.
[0010] Through the above design, the antigen protein encoded by the E5 gene of this invention forms a modular structure from the N-terminus to the C-terminus: "GP3 truncated fragment - first linker peptide - GP4 truncated fragment - second linker peptide - GP5 truncated fragment". This structure includes multiple key neutralizing epitopes while avoiding interference from unfavorable regions, laying the molecular foundation for efficient display on the spore surface and full realization of immunogenicity. Moreover, experiments have shown that recombinant bacteria containing this gene can induce high levels of specific antibodies and neutralizing antibodies in mice and pigs, with significantly better results than unoptimized natural sequences or simple tandem sequences.
[0011] The second aspect of this application discloses a recombinant Bacillus subtilis comprising the E5 gene disclosed in the first aspect of this application. Introducing the E5 gene into Bacillus subtilis, a probiotic, allows full utilization of the excellent characteristics of Bacillus subtilis and its spores. For example, Bacillus subtilis is an internationally recognized edible probiotic with a clear genetic background, non-pathogenic and non-invasive, making it suitable as a delivery vector for oral vaccines. Moreover, spores are dormant forms of Bacillus subtilis formed under harsh environments, exhibiting extremely strong resistance to heat, dryness, acid, and bile salts. This allows the recombinant bacteria containing the E5 gene to exist in spore form, maximizing the preservation of the immunogenicity of the antigen during vaccine production, storage, transportation, and oral administration through the gastrointestinal tract.
[0012] Furthermore, the recombinant Bacillus subtilis is obtained by fusing the gene encoding the spore capsid protein CotB with the E5 gene, constructing it on plasmid pDG364 to obtain the fusion gene CotB-E5, and then transferring the obtained fusion gene CotB-E5 into Bacillus subtilis 168. That is, the recombinant Bacillus subtilis is obtained by fusing the spore capsid protein CotB with the E5 gene using the integration vector pDG364, and then transferring the obtained fusion gene CotB-E5 into Bacillus subtilis 168.
[0013] CotB is a major component of the spore capsid of Bacillus subtilis and is located on the spore surface during spore formation. Fusing the E5 gene with the CotB gene allows the expressed CotB-E5 fusion protein to be accurately anchored and displayed on the outer surface of the spore during spore formation, obtaining spores displaying the surface antigen without disrupting the bacterial cell. pDG364 is an integrative plasmid that integrates a foreign gene (CotB-E5) into the chromosome of Bacillus subtilis strain 168 via homologous recombination. The genetically engineered bacteria obtained in this way exhibit extremely high genetic stability; the foreign gene is not easily lost during continuous passage without resistance selection pressure, ensuring the stability of the vaccine production strain. Furthermore, Bacillus subtilis 168 is one of the most thoroughly studied model strains, with a mature genetic manipulation system, facilitating genetic engineering and large-scale fermentation culture.
[0014] The recombinant bacteria obtained through the above methods not only achieve stable display of antigens on the spore surface, but also possess the advantages of genetic stability and ease of cultivation for industrial production.
[0015] The third aspect of this application discloses a method for constructing the recombinant Bacillus subtilis disclosed in the second aspect of this application, which includes the following steps:
[0016] S1. The E5 gene with the nucleotide sequence shown in SEQ ID No.1 is synthesized and stored in an expression vector. The expression vector containing the synthesized E5 gene is transformed into competent cells of Escherichia coli to obtain a recombinant expression plasmid.
[0017] S2, using the recombinant expression plasmid pET-32a-E5 obtained in step S1 as a template, homologous arms were added to both ends of the E5 gene by PCR amplification, and the product was obtained by gel extraction.
[0018] S3. The product obtained in step S2 is combined with the enzyme-digested integrative plasmid and homologous recombination ligation based on DNA ligase, and then transformed into E. coli DH5α to obtain the recombinant integrative plasmid.
[0019] S4, the recombinant integrative plasmid pDG364-CotB-E5 was transformed into Bacillus subtilis 168 competent cells. After screening, recombinant Bacillus subtilis displaying PRRSV E5 antigen protein on the spore surface was obtained.
[0020] In the construction method, the expression vector is pET-32a plasmid, the *E. coli* strain is *E. coli* BL21, and the recombinant expression plasmid is constructed as pET-32a-E5; the integrative plasmid is pDG364-CotB containing the gene encoding the spore capsid protein CotB, and the recombinant integrative plasmid is constructed as pDG364-CotB-E5. pET-32a is a highly efficient prokaryotic expression vector, facilitating the induction of E5 protein expression in the BL21 strain for subsequent validation and antibody preparation. pDG364-CotB, being a pre-constructed integrative plasmid containing the CotB gene, is a direct vector for constructing the CotB-E5 fusion gene.
[0021] In the construction method, primers E5-F2 and E5-R2 for PCR amplification in step S2 are pre-designed, wherein the nucleotide sequence of primer E5-F2 is shown in SEQ ID No. 4, and the nucleotide sequence of primer E5-R2 is shown in SEQ ID No. 5.
[0022] In the construction method, the integrative plasmid pDG364-CotB in step S3 is an integrative plasmid that has been double-digested with HindIII and EcoRI. Double digestion with the restriction endonucleases HindIII and EcoRI linearizes the plasmid and exposes ends that match the homologous arms of the PCR product, thereby efficiently achieving homologous recombination ligation.
[0023] Specifically, in the construction method disclosed in this application, step S1 is the gene synthesis and cloning step, which involves directly obtaining the precisely designed E5 gene through chemical synthesis, avoiding the tedious process and potential mutation risks of cloning from viruses; moreover, cloning the gene into an expression vector provides a sufficient template for subsequent amplification and verification; step S2 is the step of adding homologous arms, which involves introducing fragments (homologous arms) homologous to the sequences at both ends of the CotB gene on the integrative plasmid through PCR, preparing for subsequent homologous recombination ligation. This achieves efficient directional ligation; step S3 is the step of homologous recombination ligation, which involves ligating the E5 fragment with homologous arms to the linearized integrative plasmid. This method is more efficient than traditional enzyme digestion ligation, and the ligation product can be directly used to construct the integrative plasmid; step S4 is the transformation and screening step, which involves transforming the constructed integrative plasmid into Bacillus subtilis competent cells, and obtaining recombinant strains with the target gene correctly integrated into the chromosome through resistance screening and functional verification (such as loss of amylase activity).
[0024] In a specific embodiment, the specific implementation process of the construction method in this application can be described as follows: S1, synthesize the E5 gene on the pET-32a plasmid, transform it into competent cells of Escherichia coli BL21 strain to obtain the recombinant expression plasmid pET-32a-E5; S2, using the recombinant expression plasmid pET-32a-E5 obtained in step S1 as a template, design primers E5-F2 and E5-R2 to add homologous arms to both ends of the E5 gene by PCR, and then recover the product by gel extraction; S3, ligate the product obtained in step S2 with the integrative plasmid pDG364-CotB digested with HindIII and EcoRI using DNA ligase, and transform it into Escherichia coli DH5α to obtain the recombinant integrative plasmid pDG364-CotB-E5; S4, transform the recombinant integrative plasmid pDG364-CotB-E5 into competent cells of Bacillus subtilis 168 by chemical transformation, and screen for PRRSV display on the spore surface. Recombinant Bacillus subtilis containing the E5 antigen protein.
[0025] In this field, it is generally believed that GP3, GP4, and GP5, due to their signal peptides, transmembrane regions, and complex spatial conformations, are prone to problems such as folding interference, expression instability, and epitope masking during fusion expression. Therefore, conventional antigens such as ORF1b, M, and N, which have more stable structures, are usually preferred. This application creatively selects PRRSV envelope glycoproteins GP3, GP4, and GP5 as antigen sources. These three are all structural proteins on the viral surface and contain important neutralizing epitopes. Specifically, this invention successfully removed unfavorable fragments that easily induce non-neutralizing antibodies by screening, truncation, and linker peptide optimization, while retaining the core neutralizing epitopes and optimizing the connection mode between fragments, resulting in a novel E5 fusion gene. This gene was efficiently displayed on the surface of Bacillus subtilis spores and induced significant humoral and cellular immune responses in mice and pigs, producing high levels of specific antibodies and neutralizing antibodies, providing a novel technical solution for the prevention and control of PRRSV.
[0026] In other words, unlike existing technologies that select conserved fragments of ORF1b, GP5, M, and N in the viral genome, this application selects GP3, GP4, and GP5 fragments of PRRSV to construct a fusion antigen. Furthermore, this application does not simply replace antigen fragments, but rather screens, truncates, and optimizes linker peptides for the target regions of GP3, GP4, and GP5, removing unfavorable fragments that easily induce non-neutralizing antibodies, improving the exposure of neutralizing epitopes and the display efficiency of the fusion protein on the spore surface, thereby achieving unexpected technical effects. That is, while maintaining genetic stability and the convenience of oral immunization, it further enhances humoral immunity, mucosal immunity, and the ability to induce neutralizing antibodies, and improves the cross-protective potential against PRRSV epidemic variants. In addition, this invention has systematically optimized the design of the recombinant strain construction process, and directly obtained the target fusion sequence using gene synthesis technology, which simplifies the traditional cloning operation process from the source and significantly improves experimental efficiency and accuracy. At the same time, this invention uses a homologous recombination strategy to achieve precise integration of the integrative plasmid into the Bacillus subtilis genome. Compared with the existing T-vector-dependent ligation method, this is more efficient, reliable and controllable, fully demonstrating the advanced and innovative nature of this invention in gene engineering construction methods.
[0027] The fourth aspect of this application discloses the use of the E5 gene as disclosed in the first aspect of this application in the preparation of a drug or vaccine against porcine reproductive and respiratory syndrome virus infection.
[0028] The fifth aspect of this application discloses the use of recombinant Bacillus subtilis as disclosed in the second aspect of this application in the preparation of a drug or vaccine against porcine reproductive and respiratory syndrome virus infection.
[0029] Further, according to the application disclosed in aspect four or five of this application, the drug or vaccine is an oral preparation, and the drug or vaccine is capable of inducing a specific immune response in pigs manifested as humoral immunity and / or cellular immunity.
[0030] In summary, compared with the prior art, the present invention has the following beneficial effects:
[0031] This invention innovatively designs an E5 fusion gene based on truncated and optimized fragments of PRRSV GP3, GP4, and GP5 proteins. This design overcomes the technical bias in the field that "enveloped glycoproteins are not suitable for fusion expression." Through screening, truncating, and optimizing linker peptides, unfavorable regions were successfully removed while retaining the core neutralizing epitopes, laying the molecular foundation for the development of highly effective and broad-spectrum vaccines.
[0032] Furthermore, this invention utilizes the Bacillus subtilis spore capsid protein CotB as an anchoring protein to stably display the E5 antigen on the spore surface. This system combines the safety of probiotics with the resilience of spores, enabling the vaccine to be administered orally, greatly simplifying the immunization process and reducing animal stress and labor costs.
[0033] Furthermore, the CotB-E5 fusion gene was integrated into the chromosome of Bacillus subtilis 168 using the integrative plasmid pDG364, resulting in an engineered strain with extremely high genetic stability. Continuous passage under no resistance pressure did not easily result in the loss of the target gene, ensuring the stability and genetic consistency of the vaccine production strain.
[0034] This invention not only validated its immunogenicity in the BALB / c mouse model, but more importantly, it was validated in pigs, the natural host of PRRSV, demonstrating the great potential of this recombinant bacterium in practical applications. Attached Figure Description
[0035] Figure 1 This is a schematic diagram of the E5 genome and the protein structure predicted by Alphfold3 and Pymol in an embodiment of the present invention.
[0036] Figure 2 This is a schematic diagram of agarose gel electrophoresis in Embodiment E5 of the present invention.
[0037] Figure 3 This is a schematic diagram of the SDS-PAGE and WB assay results for prokaryotic expression of E5 protein in an embodiment of the present invention.
[0038] Figure 4 This is a schematic diagram of the integrated plasmid pDG364-CotB-E5 in an embodiment of the present invention.
[0039] Figure 5This is a schematic diagram illustrating the double enzyme digestion verification results of the integrated plasmid pDG364-CotB-E5 in an embodiment of the present invention.
[0040] Figure 6 This is a schematic diagram illustrating the process of the E5 gene being integrated into the Bacillus subtilis 168 genome in an embodiment of the present invention.
[0041] Figure 7 This is a schematic diagram of the amylase activity screening test of recombinant genetically engineered bacteria in an embodiment of the present invention.
[0042] Figure 8 This is a schematic diagram of the genomic PCR identification results of recombinant genetically engineered bacteria in an embodiment of the present invention.
[0043] Figure 9 This is a schematic diagram of the immunofluorescence assay of recombinant genetically engineered bacteria according to an embodiment of the present invention.
[0044] Figure 10 This is a schematic diagram illustrating the differentiation ratios of CD3+, CD4+, and CD8+ cell populations in the spleen of mice after oral administration of recombinant Bacillus subtilis, as determined by immunohistochemical assay in an embodiment of the present invention.
[0045] Figure 11 This is a schematic diagram showing the serum IgG level and the sIgA level of the intestinal contents of mice induced by oral administration of recombinant Bacillus subtilis in an embodiment of the present invention.
[0046] Figure 12 This is a schematic diagram showing the levels of various cytokines in the ileum tissue of mice after oral administration of recombinant Bacillus subtilis, according to an embodiment of the present invention.
[0047] Figure 13 This is a schematic diagram showing the levels of various cytokines in the serum of mice after oral administration of recombinant Bacillus subtilis, according to an embodiment of the present invention.
[0048] Figure 14 This is a schematic diagram showing the results of detecting the level of neutralizing antibodies in mouse serum after oral administration of recombinant Bacillus subtilis, according to an embodiment of the present invention.
[0049] Figure 15 This is a schematic diagram showing the detection results of specific antibody levels and neutralizing antibodies in porcine serum after oral administration of recombinant Bacillus subtilis, according to an embodiment of the present invention. Detailed Implementation
[0050] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention. It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other.
[0051] I. Biomaterials involved in this invention
[0052] (1) Bacillus subtilis strain 168: preserved by the Fermentation Engineering Laboratory of the Microecology Research Center of the College of Veterinary Medicine, Sichuan Agricultural University.
[0053] (2) Plasmid pET-32a(+), Escherichia coli BL21, and Escherichia coli DH5α were all purchased from TaKaRa Biotechnology (Beijing) Co., Ltd.
[0054] (3) Recombinant integrated plasmid pDG364-CotB: constructed and preserved by the Fermentation Engineering Laboratory of the Microecology Research Center of the College of Veterinary Medicine, Sichuan Agricultural University.
[0055] (4) PRRSV and Marc-145 cells: provided by the Pig Farm Health Testing and Evaluation Center of the College of Veterinary Medicine, Sichuan Agricultural University.
[0056] II. E5 gene
[0057] Using NADC30-Like strain (Gene Bank: KF611905.1) as a template, fragments of GP3, GP4, and GP5 from the viral genome were selected. The signal peptide and transmembrane region were optimized, and the three gene fragments were tandemly linked by a linker peptide to form a new gene fragment with a total length of 1179 bp, named the E5 gene. Its nucleotide sequence is shown in SEQ ID No. 1.
[0058]
[0059] In the nucleotide sequence SEQ ID No. 1, positions 1-3 are the start codons, positions 4-588 are truncated antigen fragments of the GP3 protein of porcine reproductive and respiratory syndrome virus (PRRSV), positions 589-603 are the first linker peptide gene sequence, positions 604-951 are truncated antigen fragments of the GP4 protein of PRRSV, positions 952-966 are the second linker peptide gene sequence, and positions 967-1179 are truncated antigen fragments of the GP5 protein of PRRSV.
[0060] The protein structure corresponding to the E5 gene predicted by Alphfold3 and Pymol is as follows: Figure 1 As shown, the agarose gel electrophoresis of the E5 gene is as follows: Figure 2 As shown.
[0061] The sequences of the primers for amplifying the above E5 gene sequence are as follows:
[0062] E5-F1 (SEQ ID No. 2): GGTACCATGGGTGGTGGTGAAG KpnI
[0063] E5-R1 (SEQ ID No. 3): CTCGAGACGCTTGTGGAAATAGCC XhoI.
[0064] III. Construction of Prokaryotic Expression Plasmids
[0065] (1) The above-mentioned E5 gene fragment was directly synthesized on plasmid pET-32a by Qingke Biotechnology Co., Ltd.
[0066] (2) The synthesized pET-32a-E5 plasmid was transformed into competent Escherichia coli BL21 to construct the prokaryotic expression strain E. coli BL21 / pET-32a-E5. Single colonies were picked and inoculated into LB liquid medium and cultured with shaking until OD. 600When the cytokine concentration (nm) reaches 0.5-0.6 (approximately 4-5 hours), 10 ml of bacterial culture is taken as the 0-hour (pre-induction) sample. IPTG is then added to a final concentration of 0.1 mM, and the mixture is induced at 37°C and 160 rpm for 2 hours. The bacterial cells are collected, sonicated, centrifuged, and the precipitate is dissolved in 8 M urea. A strain carrying the empty pET-32a vector is used as a negative control. After separation by 12% SDS-PAGE, the samples are stained with Coomassie Brilliant Blue G-250, and the proteins are transferred to a nitrocellulose membrane (Servicebio, Wuhan) for Western blotting. The membrane is blocked overnight at 4°C with 2% BSA-TBST. The membrane is then incubated sequentially with mouse anti-His tag antibody (1:1000, M30975-1, BOSTER, Wuhan) for 1 hour and HRP-labeled goat anti-mouse IgG (1:2000, BA1050, BOSTER, Wuhan) for 1 hour each. Finally, the specific band of E5 was detected using the DAB colorimetric reagent kit (BOSTER, Wuhan) in the dark.
[0067] The extraction and purification of recombinant E5 protein were carried out according to Ni Sepharoser. TM The procedure was performed according to the Fast Flow (Cytiva, Marlborough, MA, USA) instructions. Purified E5 protein was diluted to 1 mg / mL and emulsified with an equal volume of Freund's complete adjuvant. This emulsification was administered to BALB / c mice via multiple subcutaneous injections in the abdomen (0.3 mL / mouse). Two weeks after the first immunization, an equal volume of E5 protein was emulsified with Freund's incomplete adjuvant in the same manner for a second immunization. Booster immunizations were then administered weekly as described above for a total of three weeks. Three days after the final immunization, blood was collected and serum was separated to obtain hyperimmune E5 serum.
[0068] (3) Using the recombinant expression plasmid pET-32a-E5 as a template, PCR was performed with E5-F2 and E5-R2 primers to add homologous arms.
[0069] The primer sequences for E5-F2 and E5-R2 are as follows:
[0070] E5-F2 (SEQ ID No.4):TCAATCATCCAAGCTTGGTGGGTGGTGAAG
[0071] E5-R2 (SEQ ID No.5): AGCTGTCAAACATGAGAATTCACGCTTGTGGAAATAGCC
[0072] The PCR reaction system consisted of: 10 μL of 2×PCR Hero Mix (Dye), 0.5 μL of upstream primer, 0.5 μL of downstream primer, 1 μL of plasmid, and ddH2O to a final volume of 20 μL.
[0073] The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 62℃ annealing for 20 s, 72℃ extension for 20 s, 30 cycles; 72℃ final extension for 5 min; and storage at 4℃.
[0074] (4) The product from step (3) was ligated with the recombinant integrative plasmid pDG364-CotB via In-Fusion Cloning MiX and then transformed into E. coli DH5α. After successful double enzyme digestion, PCR, and sequencing verification, the recombinant integrative plasmid pDG364-CotB-E5 was obtained, and its structure is shown below. Figure 4 As shown.
[0075] The double enzyme digestion system consisted of: 43 μL pDG364-CotB, 1 μL each of HindIII and EcoRI, 5 μL 10×QuickCutBuffer, and ddH2O to a final volume of 20 μL. The reaction conditions were: 37℃ for 15 min.
[0076] The ligase ligation system consisted of: 2 μL of gel-recovered E5 fragment, 3 μL of pDG364-CotB, 5 μL of In-FusionCloning MiX, and Nuclease-Free Water to a final volume of 10 μL. The reaction conditions were: ice-water bath, reaction time 10 min.
[0077] The results of double enzyme digestion verification of pDG364-CotB-E5 are as follows: Figure 5 As shown.
[0078] IV. Transform the recombinant plasmid into Bacillus subtilis 168 competent cells (e.g.) Figure 6 )
[0079] (1) E. coli carrying pDG364-CotB-E5 was cultured on a large scale. The integrative plasmid vector pDG364-CotB-E5 was extracted using the SanPrep column DNA mini-extraction kit and digested with restriction endonuclease Xba I at 37 ℃ for 15 min. The target fragment was separated by electrophoresis and the linearized plasmid fragment was recovered.
[0080] (2) Add an appropriate amount of linearized plasmid DNA fragment to 500 μL of Bacillus subtilis 168 competent cells and mix gently. Incubate with shaking at 37 ℃ and 80 r / min for 1 h. Then, take 100 μL of the transformed bacterial solution and spread it on LB agar plates containing 5 μg / mL chloramphenicol. Incubate at 37 ℃ for 16 h. After positive clones grow, pick a single colony and inoculate it into LB liquid medium containing 5 μg / mL chloramphenicol. Incubate at 37 ℃ and 160 r / min for 16 h.
[0081] (3) Select the positive transformants obtained from the screening and carry out amplification culture. The positive strain and Bacillus subtilis 168 competent cell culture were separately inoculated onto the surface of nutrient agar medium containing 1% soluble starch and cultured at 37 ℃ for 24 h. After the culture was completed, iodine solution was added to the plate and the amylase activity of the recombinant strain was detected and analyzed. The results are shown in Figure 7.
[0082] (4) Expanding the culture of amylase to identify the correct recombinant bacteria, bacterial DNA was extracted and used as a template, with Bacillus subtilis 168 genome as a control. PCR identification was performed using four primer pairs: E5 F2 / R, amyEF / R, amyEF / E5 R2, and CotBF / E5 R2. The PCR identification results are as follows: Figure 8 .
[0083] The amplification primers for the CotB protein gene are shown below:
[0084] CotB-F: CGGGATCCAGGATTAGGCCGTTTGTCC BamH I
[0085] CotB-R:GGGAAGCTTGGATGATTGATCATCTGAAG HindIII
[0086] The primers for amplifying the amyE amylase gene of Bacillus subtilis strain 168 are shown below:
[0087] Amy EF: CCAATGAGGGTTAAGAGTATTCC
[0088] Amy ER:CGAGAAGCTATCACCGCCCAGC
[0089] (5) The recombinant bacteria were induced to produce spores using the nutrient depletion method. The resulting spores were then fixed and observed using an immunofluorescence microscope. The primary antibody was murine anti-E5 positive serum at a working concentration of 1:100; the secondary antibody was Cy3-labeled goat anti-mouse IgG at a working concentration of 1:500. The specific procedure was as follows: the purified spore-forming solution was dropped onto a clean glass slide and allowed to air dry to complete fixation. Then, 3% BSA blocking solution was added to completely cover the spores, and the slide was blocked at room temperature for 30 min. The slide was then washed three times with PBS. Next, murine anti-E5 positive serum diluted 1% BSA at a 1:100 ratio was added, and the slide was incubated at room temperature for 1 h. After washing, Cy3-labeled goat anti-mouse IgG diluted 1% BSA at a 1:500 ratio was added, and the slide was incubated at room temperature in the dark for 45 min. After washing, the slide was observed and images were acquired under a fluorescence microscope. The results are shown in [Figure 1]. Figure 9 .
[0090] The above experimental results prove that the recombinant plasmid pDG364-CotB-E5 was successfully transformed into Bacillus subtilis 168, and the genetically engineered bacteria were successfully constructed.
[0091] VI. Preparation of spore powder from genetically engineered bacteria
[0092] The obtained genetically engineered bacteria were inoculated into NA liquid medium and cultured with shaking at 37 ℃ and 160 r / min for 16 h. Separately, 1.3% soybean flour, 1.3% corn flour, 0.5% wheat bran, 0.3% peptone, 0.2% glucose, 0.1% beef jerky, 0.5% sodium chloride, and 1.2% edible agar were weighed according to the formula and placed in a stainless steel container with an appropriate amount of distilled water. All components except agar were mixed and boiled for 3 h, with water added as needed to maintain a relatively stable total volume. Then, agar was added and fully dissolved. After mixing, the pH was adjusted to 7.0, and the mixture was dispensed into covered sterile porcelain dishes, maintaining a medium thickness of approximately 1 cm. After the medium cooled and solidified, the obtained liquid bacterial culture was evenly poured onto the surface and fermented at 37 ℃ for 127 h–153 h. The spore formation rate was detected daily using the spore staining method during fermentation. Cultivation was stopped when the spore formation rate reached 90% or more. Then, the surface bacterial growth was gently scraped off with a sterilized glass slide, and an appropriate amount of corn flour was added as an auxiliary material and mixed well. The mixture was then dried at 65 °C for 3–4 h to make the resulting material particles small and evenly dispersed. Finally, the dried product was pulverized and passed through a 120-mesh sieve to obtain recombinant Bacillus subtilis RG spore raw powder. After viable cell counting, it was stored at 4 °C for later use.
[0093] VII. Animal Experiments
[0094] Ninety-six 21-day-old female BALB / c mice (20.0 ± 2.0 g) purchased from Chengdu Dashuo Experimental Animal Co., Ltd. were selected and pre-fed for 7 days. They were then randomly divided into four groups, with four cages per group and six mice per cage. The experiment was conducted according to the protocol shown in Table 1. The CK group served as a blank control, receiving only the basal diet. The WB and RG groups were fed wild-type Bacillus subtilis 168 spores and RG spores respectively via feed mixing, with the spore addition amount in the diet being 2.5 × 10^6 spores. 6 The CFU / g group; the VA group received 100 μL of PRRSV inactivated vaccine via intraperitoneal injection once a week from the start of the experiment. Throughout the experiment, each mouse in each group was fed 3-5 g of feed daily, with free access to food and water, while the ambient temperature was maintained at 18℃-23℃.
[0095] Table 1 Immunization Schedule
[0096] Grouping dose Immunization program Immune frequency CK - - - WB <![CDATA[2.5×10 6 CFU / g]]> Mixed feed Full process RG <![CDATA[2.5×10 6 CFU / g]]> Mixed feed Full process VA 100 μL Multiple subcutaneous injections weekly
[0097] On days 0, 14, 28, and 42 of the experiment, six mice were randomly selected from each group, weighed, and samples of serum, ileum tissue and contents, spleen, and thymus were collected and preserved under specified conditions.
[0098] (1) Immunohistochemical experiments to examine immune cell populations.
[0099] Experimental results are as follows Figure 10 As shown, the recombinant Bacillus subtilis strain constructed in this invention exhibits significant advantages in inducing mucosal immune responses. Specifically, this recombinant strain can effectively promote the differentiation and activation of T lymphocytes and β-cells. This function is of great significance for constructing a comprehensive and effective immune defense mechanism and is a characteristic not possessed by most currently commercially available vaccines. Therefore, this recombinant strain shows broad application prospects in the field of mucosal vaccine adjuvant development.
[0100] (2) The levels of anti-E5 protein IgG and sIgA in mouse serum and intestinal mucus were detected by indirect ELISA.
[0101] The purified E5 protein was diluted to 5 μg / mL with 0.05 mol / L, pH 9.6 carbonate buffer and added to 100 μL per well of a 96-well high-adsorption flat-bottom polystyrene microplate (Wuhan Saive Biotechnology Co., Ltd.). The plate was coated at 37 ℃ until the liquid evaporated to dryness. After coating, the plate was washed three times with 300 μL of PBS washing buffer (PBST, pH 7.4) containing 0.05% Tween 20 each time. Then, 250 μL of 3% BSA-PBS blocking buffer was added to each well, and the plate was blocked at 37 ℃ for 2 h. After blocking, the plate was washed three times with PBST. Mouse serum was diluted 1:100 with blocking buffer and added to each well of an ELISA plate (100 μL). The plate was incubated at 37 °C for 2 h, followed by three washes. Horseradish peroxidase-labeled rabbit anti-mouse IgG and goat anti-mouse IgA antibody (Santa Cruz Biotechnology, USA) were diluted 1:4000 with blocking buffer and added to each well (100 μL). The plate was incubated at 37 °C for another 2 h, followed by three washes. Then, 100 μL of TMB substrate chromogenic solution (Sangon Biotech (Shanghai) Co., Ltd.) was added to each well, and the reaction was carried out at room temperature in the dark for 5–10 min. The reaction was terminated by adding 100 μL of 2 mol / L H₂SO₄. Finally, the absorbance of each well was measured at 450 nm using a Thermo Multiskan FC ELISA reader. Antibody levels are expressed as P / N values, where P / N = OD450 of sample wells / OD450 of PBS wells.
[0102] like Figure 11 As shown, the immunoglobulin levels in the small intestinal contents of mice revealed that the recombinant strain treatment group (RG group) was more effective in inducing the production of specific antibodies against E5 protein. Compared with the blank control group and the non-recombinant Bacillus subtilis 168 treatment group, the levels of specific IgG and sIgA in the small intestinal contents of mice in the RG group were higher. The above indirect ELISA results indicate that this recombinant Bacillus subtilis can effectively induce humoral immune responses, suggesting that it has good antigen presentation ability and a certain degree of immune enhancement.
[0103] (3) Enzyme-linked immunosorbent assay (ELISA).
[0104] The levels of five cytokines—IL-2, IL-4, IL-6, IL-10, and IFN-γ—in mouse ileal tissue and serum were detected using an enzyme-linked immunosorbent assay (ELISA) kit (purchased from Shanghai Yuanju Biotechnology Center). The assay method followed the instructions in the kit's manual.
[0105] Test results as follows Figure 12 and Figure 13 As shown, analysis of cytokine expression levels in mouse ileum tissue revealed significantly increased expression levels of interleukin-2, interleukin-4, and interferon-γ, and decreased IL-6 in the RG group mice. These differences were statistically significant compared to the control group (P < 0.05). These cytokines play a core regulatory or stabilizing role in the antiviral immune response, suggesting that recombinant Bacillus subtilis E5 can effectively activate the host's cellular immune pathways, thereby enhancing the body's antiviral capacity to some extent.
[0106] (4) Detect the titer of neutralizing antibodies in mouse serum.
[0107] Serum samples were serially diluted 2-fold with maintenance medium, with 6 replicates per dilution. Simultaneously, PRRSV (GenBank: DQ355796.1) of known titer was diluted to 100 TCID50 / 50 μL. 50 μL of each serum dilution was mixed with an equal volume of virus solution and incubated at 37 ℃ for 1 h to promote antibody-virus binding. After discarding the original culture medium in the 96-well plate, cells were gently washed once with PBS. 100 μL of virus-serum mixture was added to each well, with 3 replicates per dilution. Controls were set up: virus control wells contained only virus solution, cell control wells contained only maintenance medium, and serum virulence control wells contained only serum without virus. After inoculation, the plate was incubated at 37 ℃ in a 5% CO2 incubator for 1–2 h to allow virus adsorption to the cell surface. The liquid in each well was then discarded, and 100 μL of fresh maintenance medium was added to each well. During the culture period, the cytopathic effect (CPE) was observed daily, and the number of wells without CPE at each dilution was recorded. The neutralizing antibody titer was calculated using the Reed-Muench method, and the results were expressed in Log2 form.
[0108] like Figure 14 As shown, the levels of neutralizing antibodies in mouse serum were measured, and the neutralizing antibody titers in the RG group were significantly higher than those in the control group and the non-recombinant strain treatment group. This result indicates that oral administration of recombinant Bacillus subtilis RG can effectively induce the production of functional neutralizing antibodies, thereby enhancing immune protection against porcine reproductive and respiratory syndrome virus (PRRSV), further validating the application value of this strain in oral vaccine development.
[0109] (5) Oral immunization test in pigs and detection of IgG and neutralizing antibodies
[0110] Twelve 4-week-old PRRSV-negative piglets were selected for the experiment. They were first acclimatized to a basal diet for 7 days, and then randomly divided into three groups (n=4 per group): a blank control group (CK), a wild-type spore group (WB), and a recombinant spore group (RG). Oral immunization was administered according to the protocol in Table 2: the spores were thoroughly mixed with the basal diet to achieve a final spore concentration of 2.5 × 10⁻⁶. 6 CFU / g, the CK group was fed only a basal diet. Peripheral blood was collected on days 0, 14, and 28 post-immunization. Serum was separated, aliquoted, and stored at -80 ℃ for later use.
[0111] Table 2 Immunization Schedule
[0112] Grouping dose Immunization program Immune frequency CK - - - WB <![CDATA[2.5×10 6 CFU / g]]> Mixed feed Full process RG <![CDATA[2.5×10 6 CFU / g]]> Mixed feed Full process
[0113] To detect porcine-specific antibody levels, experiments and results analysis were performed according to the method described in (2). The secondary antibody used was ActivAb™ Goat Anti-Pig IgG / HRP (PBST 1:3000 dilution, Solarbio, Cat#SE137). Furthermore, the titer of neutralizing antibodies in porcine serum was determined according to the method described in (4).
[0114] like Figure 15 As shown, detection of serum immunoglobulin levels in pigs revealed that the recombinant strain treatment group (RG group) exhibited superior effects in inducing specific antibody production. Compared with the blank control group and the non-recombinant Bacillus subtilis strain 168 treatment group, mice in the RG group secreted higher levels of specific IgG against the E5 protein. Measurement of neutralizing antibody levels in pig serum showed that the neutralizing antibody titer in the RG group was significantly higher than that in the control group and the non-recombinant strain treatment group, further validating the application potential of this strain in oral vaccine development.
[0115] In summary, this invention successfully constructed a recombinant Bacillus subtilis strain capable of displaying PRRSV E5 protein on the spore surface and systematically evaluated its immunomodulatory effects. Using Bacillus subtilis 168 as the host and CotB, a spore capsid protein, as the anchoring protein, the CotB-E5 fusion gene was integrated into the host chromosome via chemical transformation and homologous double crossover recombination, resulting in a genetically stable recombinant strain RG that stably expresses PRRSV E5 protein on the spore surface. Animal experiments showed that oral administration of this recombinant strain induced strong specific humoral and mucosal immune responses, manifested by significantly elevated levels of anti-E5 protein-specific IgG and sIgA, indicating good antigen presentation capacity and a certain degree of immunomodulatory enhancement. Simultaneously, immunohistochemical analysis showed that this recombinant strain promoted T cell differentiation and activation, suggesting a positive role in the initiation of mucosal immune responses. Cytokine assays further revealed significantly elevated expression levels of antiviral-related cytokines such as IL-2, IL-4, and IFN-γ in the ileum tissue of RG group mice, indicating that this strain can activate cellular immune responses in addition to inducing humoral immunity, thus contributing to a more comprehensive antiviral immune defense. Serum neutralizing antibody titers in mice also showed that this recombinant strain can induce the production of functional neutralizing antibodies, further enhancing the body's defense against PRRSV. Furthermore, immunization experiments conducted in pigs also verified the good immunogenicity of this strain, characterized by elevated levels of specific IgG and the induction of neutralizing antibody production. Therefore, this recombinant Bacillus subtilis shows promising application prospects in antigen delivery, immune activation, and oral vaccine vector applications.
[0116] The recombinant Bacillus subtilis displaying PRRSV E5 protein on the spore surface provided in this embodiment of the invention is a recombinant vector constructed using genetic engineering technology based on the integrative plasmid pDG364. This vector uses the spore capsid protein CotB as an anchoring protein to position and display the PRRSV E5 antigen protein on the spore surface. Subsequently, the recombinant vector is introduced into wild-type Bacillus subtilis 168 by chemical transformation, thereby obtaining engineered Bacillus subtilis capable of displaying the PRRSV E5 antigen protein on the spore surface.
[0117] The recombinant Bacillus subtilis obtained in this invention allows the antigen protein to be directly localized on the outer surface of the spores. Immunization can be administered by mixing it into feed or adding it to drinking water, reducing the complexity of the inoculation process and alleviating immune stress. Compared to common genetically engineered bacteria using Lactobacillus, Lactococcus, or Enterococcus as expression vectors, the spores formed by this recombinant Bacillus subtilis can maintain the immunogenicity of the antigen even under relatively harsh environmental conditions. This reduces the possibility of antigen inactivation or degradation during production, storage, transportation, and the digestive tract, ensuring its effective level in the body, further promoting the formation of intestinal-specific mucosal immune responses, reducing losses at each stage of production and application, and improving overall application efficiency.
[0118] The Bacillus subtilis used in this invention is an internationally recognized edible probiotic with a clear genetic background and non-invasiveness, which can be used to develop commercial vaccines.
[0119] This invention utilizes an integrative recombinant plasmid to display antigen proteins on the surface of spores, which can stably introduce exogenous target genes into the chromosome of Bacillus subtilis 168, thereby endowing the recombinant strain with good genetic stability and making it less prone to loss of target genes during continuous subculture.
[0120] This invention, through application experiments using mammalian models (mice, for example) and host pigs, found that the constructed recombinant Bacillus subtilis can effectively induce a targeted immune response in mice, manifested by significantly increased serum IgG levels and sIgA levels in intestinal contents compared to the blank control. Simultaneously, oral administration of this recombinant strain also altered the expression of intestinal mucosal cytokines in mice to varying degrees. Immunohistochemical results further showed that this recombinant Bacillus subtilis can also affect the proportion of CD3+ and CD8+ cells within a certain range. Further research indicates that this recombinant strain can also induce a specific immune response in pigs, thus providing a new technical approach for the prevention and control of PRRSV.
[0121] Overall, the recombinant Bacillus subtilis E5 constructed in this invention can be used as an oral subunit vaccine-type probiotic immunomodulator, exhibiting significant comprehensive application advantages:
[0122] 1) The recombinant Bacillus subtilis E5 constructed in this invention can stably display the PRRSV E5 antigen protein on the spore surface, thereby effectively inducing the body to produce a specific immune response against PRRSV;
[0123] 2) This invention uses oral immunization, which can be administered through feed or drinking water. The operation is simple, which can reduce the cumbersome procedures of traditional injection immunization and reduce the stress response of animals during the immunization process.
[0124] 3) The Bacillus subtilis used in this invention is a recognized edible probiotic with a clear genetic background, non-invasiveness, and good safety, making it suitable for development as an oral vaccine carrier and a microecological immune agent carrier.
[0125] 4) This invention utilizes an integrative recombinant plasmid to integrate the exogenous target gene into the genome of Bacillus subtilis strain 168, resulting in a recombinant strain with good genetic stability, and the target gene is not easily lost during continuous subculture.
[0126] 5) This invention uses the spore capsid protein CotB as an anchoring protein, which can achieve stable anchoring and expression of fusion antigens on the spore surface, which is beneficial to improving the exposure degree of antigen epitopes and the antigen presentation efficiency.
[0127] 6) The E5 fusion antigen designed in this invention is derived from the GP3, GP4 and GP5 related fragments of PRRSV. After optimization design, it forms a multi-epitope fusion antigen, which is beneficial to enhance the immunogenicity of the antigen and improve the breadth of viral immune recognition.
[0128] 7) The recombinant spores obtained by this invention have strong stress resistance and can maintain their activity and immunogenicity well during storage, transportation and delivery through the digestive tract, thereby helping to reduce the loss caused by antigen inactivation or degradation;
[0129] 8) Animal experiments showed that the recombinant Bacillus subtilis constructed in this invention can not only significantly increase the levels of specific IgG and sIgA in the body, but also induce the production of neutralizing antibodies and promote the expression of related antiviral cytokines, indicating that it can simultaneously activate humoral immunity, mucosal immunity and a certain degree of cellular immune response.
[0130] 9) The recombinant strain obtained in this invention showed good immunogenicity in both mouse models and host pigs, indicating that it has good practical application potential and can provide a new technical solution for the research and development of PRRSV oral vaccines and related microecological immune agents.
[0131] 10) The preparation process of this invention is relatively clear, which facilitates large-scale cultivation and industrialization. It has good application prospects in reducing vaccine usage costs and improving the convenience of herd immunity.
[0132] It should be noted that all features disclosed in this specification, or all steps in all methods or processes disclosed, may be combined in any way, except for mutually exclusive features and / or steps.
[0133] Furthermore, the specific embodiments described above are exemplary. Those skilled in the art can devise various solutions inspired by the disclosure of this invention, and these solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and not intended to limit the scope of the claims. The scope of protection of this invention is defined by the claims and their equivalents.
Claims
1. An E5 gene, characterized in that, The nucleotide sequence of the E5 gene is shown in SEQ ID No. 1; the E5 gene is constructed with ATG as the start codon, and the antigen protein it encodes includes, from the N-terminus to the C-terminus, truncated antigen fragments of GP3, GP4 and GP5 proteins of porcine reproductive and respiratory syndrome virus linked sequentially by linker peptides.
2. A recombinant Bacillus subtilis, characterized in that, It contains the E5 gene as described in claim 1.
3. The recombinant Bacillus subtilis according to claim 2, characterized in that, It is obtained by fusing the gene encoding the spore capsid protein CotB with the E5 gene, constructing it on plasmid pDG364, obtaining the fusion gene CotB-E5, and then transforming the obtained fusion gene CotB-E5 into Bacillus subtilis 168.
4. A method for constructing recombinant Bacillus subtilis as described in claim 2 or 3, characterized in that, Includes the following steps: S1. The E5 gene with the nucleotide sequence shown in SEQ ID No.1 is synthesized and stored in an expression vector. The expression vector containing the synthesized E5 gene is transformed into competent cells of Escherichia coli to obtain a recombinant expression plasmid. S2, using the recombinant expression plasmid pET-32a-E5 obtained in step S1 as a template, homologous arms were added to both ends of the E5 gene by PCR amplification, and the product was obtained by gel extraction. S3. The product obtained in step S2 is combined with the enzyme-digested integrative plasmid and homologous recombination ligation based on DNA ligase, and then transformed into E. coli DH5α to obtain the recombinant integrative plasmid. S4, the recombinant integrative plasmid pDG364-CotB-E5 was transformed into Bacillus subtilis 168 competent cells. After screening, recombinant Bacillus subtilis displaying PRRSV E5 antigen protein on the spore surface was obtained.
5. The construction method according to claim 4, characterized in that, The expression vector is pET-32a plasmid, the Escherichia coli strain is Escherichia coli BL21, and the recombinant expression plasmid is constructed as pET-32a-E5; the integrative plasmid is pDG364-CotB containing the gene encoding the spore capsid protein CotB, and the recombinant integrative plasmid is constructed as pDG364-CotB-E5.
6. The construction method according to claim 4, characterized in that, Primers E5-F2 and E5-R2 are pre-designed for PCR amplification in step S2, wherein the nucleotide sequence of primer E5-F2 is shown in SEQ ID No. 4 and the nucleotide sequence of primer E5-R2 is shown in SEQ ID No.
5.
7. The construction method according to claim 5, characterized in that, The integrative plasmid pDG364-CotB in step S3 is an integrative plasmid that has been digested with HindIII and EcoRI.
8. The use of the E5 gene as described in claim 1 in the preparation of a drug or vaccine against porcine reproductive and respiratory syndrome virus infection.
9. The use of the recombinant Bacillus subtilis as described in claim 2 or 3 in the preparation of a drug or vaccine against porcine reproductive and respiratory syndrome virus infection.
10. The application according to claim 8 or 9, characterized in that, The drug or vaccine is an oral formulation, and the drug or vaccine is capable of inducing a specific immune response in pigs, manifested as humoral immunity and / or cellular immunity.