Detection method for mycobacteria
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- THE ROYAL VETERINARY COLLEGE
- Filing Date
- 2024-07-10
- Publication Date
- 2026-05-20
AI Technical Summary
Current methods for detecting mycobacteria are hindered by their thick cell walls, slow growth rates, and the difficulty in lysing viable cells, leading to challenges in diagnosing mycobacterial infections, particularly in resource-limited settings and agricultural contexts where rapid, sensitive, and specific tests are needed.
A method involving a lysis agent comprising bacteriophages bound to a solid support that selectively lyse viable mycobacteria, followed by isothermal amplification of mycobacterial nucleic acid to detect their presence, allowing for rapid and specific diagnosis without the need for specialized equipment.
This approach enables rapid detection of viable mycobacteria within hours, distinguishing between viable and non-viable cells, and differentiating between treatment-resistant and non-resistant strains, providing a cost-effective and equipment-free diagnostic solution suitable for low-income countries and agricultural applications.
Smart Images

Figure IMGF000042_0001 
Figure IMGF000044_0001 
Figure IMGF000045_0001
Abstract
Description
[0001] DETECTION METHOD FOR MYCOBACTERIA
[0002] FIELD OF THE DISCLOSURE
[0003] The disclosure concerns a method for detecting the presence or absence of mycobacteria in a sample and a method for diagnosing the presence or absence of a mycobacterial infection in a subject. The disclosure also concerns a lysis agent comprising bacteriophage capable of lysing viable mycobacteria and use of the lysis agent in the methods of the disclosure.
[0004] BACKGROUND
[0005] Members of the genus Mycobacterium are responsible for various bacterial infections in humans and animals. For example, tuberculosis (TB) is caused by Mycobacterium tuberculosis complex (MTBC) bacteria. An estimated 1.4 million people die each year from TB, even though the disease is treatable in principle. There is a strong economic driver for improved disease control because, without significant improvement, the 2015-2030 period is expected to see losses of USD983 billion, with the largest economic losses expected in low-to-middle income countries. The massive scale of the problem has caused the World Health Organisation (WHO) to call for new and improved diagnostics to be developed.
[0006] Mycobacterium bovis is a member of the MTBC and causes bovine TB (bTB), a zoonotic infection that primarily affects the lungs and is a significant problem to the agricultural industry in the UK (excluding Scotland) and Republic of Ireland. This chronic infectious disease led to the slaughter of over 25,000 cattle in England in 2021. Control efforts have been reported to cost taxpayers approximately £70 million and farmers £50 million each year in England.
[0007] Johne’s disease (JD) is caused by Mycobacterium avium subsp. paratuberculosis (MAP) and is responsible for chronic wasting in infected animals. The disease is endemic in commercial ruminant herds worldwide. The associated clinical features have been estimated to cost farmers up to £26 per dairy cow per year. Given the tight margins farmers operate within, this is an important economic concern.
[0008] Effective diagnostics are the cornerstone of control for these infectious diseases. The welfare and economic importance of TB, bTB and JD demand diagnostics that are: affordable, sensitive, specific, user-friendly, rapid, robust, equipment-free and deliverable to end-users. Diagnostics encompassing these criteria are vital to meeting the targets described in the END TB strategy and the roadmap for zoonotic tuberculosis. Unfortunately, however, mycobacteria can be difficult to detect in a sample. Diagnosis of mycobacterial infections is therefore challenging. This difficulty can arise from unique biological features of mycobacteria. Firstly, mycobacteria have a thick cell wall, making them difficult to lyse. Without lysis, access to intracellular molecular biomarkers is prevented. Thus, difficulty of lysis limits the usefulness of diagnostic tests that rely on detecting intracellular components. Secondly, some mycobacteria grow very slowly. Whilst rapid-growing mycobacteria can form visible colonies on solid medium within seven days, slow growing mycobacteria take weeks to form colonies. As slow-growing mycobacteria are typically the most clinically-relevant type, diagnostic tests based on culturing mycobacteria have limited usefulness. Thirdly, the traditional tuberculin skin test used in cattle is time-consuming and labour intensive, requiring multiple visits to any given farm and individual. Accordingly, there is a need for improved methods for detecting mycobacteria and diagnosing mycobacterial infections.
[0009] SUMMARY OF THE DISCLOSURE
[0010] The disclosure provides a method for detecting the presence or absence of mycobacteria in a sample, comprising: (a) contacting the sample with a lysis agent comprising one or more bacteriophages each bound to a solid support, such that if viable mycobacteria are present in the sample the viable mycobacteria are lysed by the lysis agent and a mycobacterial nucleic acid is released; (b) performing an isothermal amplification process to amplify the mycobacterial nucleic acid and thereby providing an amplification product; and (c) detecting the presence or absence of the amplification product, wherein presence of the amplification product indicates the presence of mycobacteria in the sample and absence of the amplification product indicates the absence of mycobacteria in the sample.
[0011] The disclosure further provides: a method for diagnosing the presence or absence of a mycobacterial infection in a subject, comprising detecting the presence or absence of mycobacteria in a sample obtained from the subject using the detection method described herein, wherein the presence of mycobacteria in the sample indicates the presence of a mycobacterial infection in the subject and absence of mycobacteria in the sample indicates the absence of a mycobacterial infection in the subject; a lysis agent capable of lysing viable mycobacteria, comprising two or more different bacteriophage species each bound to a solid support; and a kit comprising the lysis agent described herein.
[0012] DESCRIPTION OF THE FIGURES
[0013] Figure 1: Comparison of LAMP readouts. (A) The limit of detection (LOD) of endpoint PCR (top panel, “Endpoint”) was compared with the LOD of LAMP using gel electrophoresis (top-middle panel, “LAMP”), colourimetric detection (bottom-middle panel, “Colour-LAMP”) and real-time fluorescence detection (bottom panel, “Realtime LAMP”) are shown FOR MAP using IS900 (left), MTBC using IS6770 (middle) and M. bovis using RD4 (right). The colour-LAMP images were visualised by eye and the values indicated in the image represent the colour hue (°). (B) Alternative representation of data in (A), showing results for colourimetric detection (bottom-middle panel, “Colour- LAMP”) and real-time fluorescence detection (bottom panel, “Realtime LAMP”) in binary form.
[0014] Figure 2: Effect of DNA sample cleaning and concentration on qPCR. (A) MAP, (B) M. bovis BCG. Error bars represent a mean of three repeats.
[0015] Figure 3: Workflow of Actiphage®-LAMP. (A) Schematic workflow of Actiphage®-LAMP. Three blood processing steps were tested, each having an average time of 1 h. Bacteriophages were then added and incubated for 3.5 h. LAMP, lasting 45 min, allows detection from a variety of methods. Yes / no determination by colour change, fluorescence, and lateral flow dipstick are all possibilities. (B) Molecular mechanism of LAMP. Six primers are used targeting Mycobacterium tuberculosis complex (MTBC) gene IS6770 and Mycobacterium avium subsp. paratuberculosis gene IS900 (not shown). (C) Example colour change (orange to yellow) using SYBR green 1 is shown. (D) Schematic showing the move from Actiphage® (provincial-level 3) to Actiphage®-LAMP (district-level 2).
[0016] Figure 4: Binding of phage to bead. Phage D29 (A), TM4 (B), D29 + TM4 (C) binding is shown. Supernatant was titred before and after binding to beads, and titred again after each successive phage-bead wash step. Error bars represent the standard deviation of three repeats. Figure 5: Confirmation of phage-bead binding. Plaques of D29 (A), D29 + TM4 (B), TM4 (C) phage-beads are shown. Arrows indicate the D29 plaque (right) and TM4 plaque (left) that were selected for PCR. The confirmatory PCR (D) lanes are shown: 100 bp DNA ladder (far left); D29 positive control (1); D29 negative control (2); D29 plaque using D29 primers (3); TM4 plaque using D29 primers (4); TM4 positive control (5); TM4 negative control (6); TM4 plaque using TM4 primers (7); D29 plaque using TM4 primers (8). Figure 6: Optimisation of mycobacterial capture by phage-beads. qPCR of residual MAP detected in the supernatant after Phagomagnetic capture. Parameters of capture were changed: (A) mixing orientation, (B) time of capture, (C) type of phage bound to bead. Error bars represent the standard deviation of three repeats. Figure 7: Capture efficiency of phage-beads. The percentage difference in supernatant pfu / ml counts before and after phagomagnectic capture is shown. Media (white bars) or blood (grey bars) spiked with MAP (top) and M. bovis BCG (bottom) were captured by phage-beads coated with D29 (left), D29 + TM4 (middle) and TM4 (right). Error bars represent the standard deviation of three repeats. Figure 8. Lysis of whole blood for the detection of mycobacteria. Light microscope images of (A) whole blood, (B) whole blood spiked with M. bovis and diluted 1:1 with ultrapure H2O. (C) PhMS-LAMP detection of M. bovis spiked into whole blood diluted with ultrapure H2O in the H2O:blood ratios as indicated or diluted with chaotropic buffer (CM) in the CM:blood ratios as indicated. H2O 1:1 (green line, i.e. fourth line from the top at 50 min), H2O 1:5 (light blue line, i.e. sixth line from the top at 50 min), H2O 1:10 (dark blue line, i.e. first line from the top at 50 min), CM 1:1 (red line, i.e. fifth line from the top at 50 min), CM 1:5 (orange line, i.e. second line from the top at 50 min), CM 1:10 (yellow line, i.e. third line from the top at 50 min), non-template control (pink line, i.e. final line from the top at 50 min). Figure 9: PhMS and Actiphage® qPCR comparison. qPCR data from DNA lysate processed from the PhMS and Actiphage® assays are shown. (A) M. bovis; (B) MAP. Error bars represent the standard deviation of three repeats. Figure 10: PhMS (TM4 / D29 + TM4) and Actiphage® qPCR comparison. (A) MAP, TM4; (B) MAP, D29 + TM4; (C) M. bovis BCG, TM4; (D) M. bovis BCG, D29 + TM4. Figure 11: The effect of removing magnetic separation and adding filtration on the time to detection of serially diluted MAP cells. Black circles denote PhMS without the initial magnetic separation and concentration step; black squares denote PhMS with magnetic separation and a filtration step; black triangles denote the phage-LAMP assay control without filtration or magnetic separation. Experiments were carried out in triplicate. Error bars show the standard deviation.
[0017] Figure 12: KatG LAMP time-to-detection of DNA extracted from BCG and an isoniazid-resistant mutant. Experiments were carried out in triplicate. The line denotes the average time-to-detection of the three replicates.
[0018] Figure 13: PhMS-LAMP time-to-detection of serially diluted MAP cells in cerebrospinal fluid (CFS). Black squares denote detection in CSF; black circles denote detection in media and lysis buffer. Line shows the average time to detect from three replicates.
[0019] Figure 14: PhMS-LAMP time-to-detection of serially diluted MAP cells in sputum. Black squares denote detection in sputum; black circles denote detection in media and lysis buffer. Line shows the average time to detect from three replicates.
[0020] Figure 15: PhMS-LAMP time-to-detection of serially diluted MAP cells in urine. Black squares denote detection in urine, black circles denote detection in media and lysis buffer. Line shows the average time to detect from three replicates.
[0021] Figure 16: PhMS-LAMP time-to-detection of serially diluted BCG cells in cerebrospinal fluid (CFS). Black squares denote detection in CSF; black circles denote detection in media and lysis buffer. Line shows the average time to detect from three replicates.
[0022] Figure 17: PhMS-LAMP time-to-detection of serially diluted BCG cells in sputum. Black squares denote detection in sputum; black circles denote detection in media and lysis buffer. Line shows the average time to detect from three replicates.
[0023] Figure 18: PhMS-LAMP time-to-detection of serially diluted BCG cells in urine. Black squares denote detection in urine; black circles denote detection in media and lysis buffer. Line shows the average time to detect from three replicates.
[0024] Figure 19: LAMP time-to-detection of serially diluted MAP cells when using a wet mastermix (MM) and a lyophilised MM. Black circles correspond to the wet LAMP MM; black squares correspond to the lyophilised MM. Experiments were carried out in triplicate. Error bars show the standard deviation.
[0025] Figure 20: Average number of viable phages detected from beads with and without virucide treatment. Experiments were carried out in triplicate. Error bars show the standard deviation. Figure 21: Average number of viable BCG cells detected before and after magnetic separation (MS) and after the phage lysis (End of Assay). Experiments were carried out in triplicate. Error bars show the standard deviation. Asterisks (*) denote a significant difference (p < 0.05) as assessed by ANOVA.
[0026] Figure 22: Average number of heat-inactivated BCG cells in plaque-forming units per millilitre (PFU / ml) detected before and after magnetic separation (MS) and after the phage lysis (End of Assay). Experiments were carried out in triplicate. Error bars show the standard deviation.
[0027] Figure 23: Average number of viable BCG cells detected in the supernatant before and after magnetic separation (MS) using beads with no phage bound to them. Experiments were carried out in triplicate. Error bars show the standard deviation.
[0028] DESCRIPTION OF THE SEQUENCE LISTING
[0029] SEQ ID NO: 1 - nucleic acid sequence of IS6 / / 0
[0030] SEQ ID NO: 2 - nucleic acid sequence of IS900
[0031] SEQ ID NO: 3 - nucleic acid sequence of IS2404
[0032] SEQ ID NO: 4 - nucleic acid sequence of RD4 (Rvl506c-Rvl516c of Mycobacterium tuberculosis)
[0033] SEQ ID NO: 5 - nucleic acid sequence of F3 primer for IS6770.
[0034] SEQ ID NO: 6 - nucleic acid sequence of B3 primer for IS6770.
[0035] SEQ ID NO: 7 - nucleic acid sequence of FIP primer for IS6770.
[0036] SEQ ID NO: 8 - nucleic acid sequence of BP primer for IS6770.
[0037] SEQ ID NO: 9 - nucleic acid sequence of LF primer for IS6770.
[0038] SEQ ID NO: 10 - nucleic acid sequence of LR primer for IS6770.
[0039] SEQ ID NO: 11 - nucleic acid sequence of F3 primer for IS900.
[0040] SEQ ID NO: 12 - nucleic acid sequence of B3 primer for IS900.
[0041] SEQ ID NO: 13 - nucleic acid sequence of FIP primer for IS900.
[0042] SEQ ID NO: 14 - nucleic acid sequence of BP primer for IS900.
[0043] SEQ ID NO: 15 - nucleic acid sequence of LF primer for IS900.
[0044] SEQ ID NO: 16 - nucleic acid sequence of LR primer for IS900.
[0045] SEQ ID NO: 17 - nucleic acid sequence of F3 primer for deletion of REM.
[0046] SEQ ID NO: 18 - nucleic acid sequence of B3 primer for deletion of RD4. SEQ ID NO: 19 - nucleic acid sequence of FIP primer for deletion of RD4. SEQ ID NO: 20 - nucleic acid sequence of BP primer for deletion of RD4.
[0047] SEQ ID NO: 21 - nucleic acid sequence of LF primer for deletion of RD4.
[0048] SEQ ID NO: 22 - nucleic acid sequence of LR primer for deletion of RD4.
[0049] SEQ ID NO: 23 - nucleic acid sequence of FIP primer for differentiating INH resistance.
[0050] SEQ ID NO: 24 - nucleic acid sequence of BIP primer for differentiating INH resistance.
[0051] SEQ ID NO: 25 - nucleic acid sequence of F3 primer for differentiating INH resistance.
[0052] SEQ ID NO: 26 - nucleic acid sequence of B3 primer for differentiating INH resistance.
[0053] SEQ ID NO: 27 - nucleic acid sequence of FLP primer for differentiating INH resistance.
[0054] SEQ ID NO: 28 - nucleic acid sequence of BLP primer for differentiating INH resistance.
[0055] DETAILED DESCRIPTION
[0056] It is to be understood that different applications of the disclosed methods, products and uses may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the disclosure only, and is not intended to be limiting.
[0057] General definitions
[0058] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which this disclosure belongs.
[0059] As used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a cell” includes “cells”, reference to “a bacteriophage” includes “bacteriophages”, reference to “a mycobacterial nucleic acid” includes two or more such mycobacterial nucleic acids, reference to “a clinical disease” includes “clinical diseases”, and the like.
[0060] In general, the term “comprising” is intended to mean including but not limited to. For example, the phrase “a lysis agent capable of lysing viable mycobacteria, comprising two or more bacteriophage species each bound to a solid support” should be interpreted to mean that the lysis agent contains two or more bacteriophage species each bound to a solid support, but that the lysis agent may contain additional components.
[0061] In some aspects of the disclosure, the word “comprising” is replaced with the phrase “consisting of’. The term “consisting of’ is intended to be limiting. For example, the phrase “a composition consisting of guanidinium thiocyanate” should be understood to mean that the composition contains guanidinium thiocyanate and no additional components.
[0062] The terms “protein” and “polypeptide” are used interchangeably herein, and are intended to refer to a polymeric chain of amino acids of any length.
[0063] The terms “bacteriophage” and “phage” are used interchangeably herein, and are intended to refer to a virus that infects and replicates within bacteria.
[0064] For the purpose of this disclosure, in order to determine the percent identity of two sequences (e.g., two polynucleotide sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in a first sequence for optimal alignment with a second sequence). The nucleotide residues at nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide residue as the corresponding position in the second sequence, then the nucleotides are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions in the reference sequence x 100).
[0065] Typically, the sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence has a certain percentage identity to SEQ ID NO: X, SEQ ID NO: X would be the reference sequence. For example, to assess whether a sequence is at least 80% identical to SEQ ID NO: X (an example of a reference sequence), the skilled person would carry out an alignment over the length of SEQ ID NO: X, and identify how many positions in the test sequence were identical to those of SEQ ID NO: X. If at least 80% of the positions are identical, the test sequence is at least 80% identical to SEQ ID NO: X. If the sequence is shorter than SEQ ID NO: X, the gaps or missing positions should be considered to be non-identical positions.
[0066] The skilled person is aware of different computer programmes that are available to determine the homology or identity between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. Method for detecting the presence or absence of mycobacteria
[0067] The disclosure provides a method for detecting the presence or absence of mycobacteria in a sample. In the method, a lysis agent comprising bacteriophage bound to a solid support is used to lyse viable mycobacteria to release mycobacterial nucleic acid. The mycobacterial nucleic acid is then amplified using an isothermal amplification process. The presence or absence of the amplification product is detected to indicate the presence or absence of mycobacteria in the sample, respectively. The method of the disclosure has several advantages over prior art methods for detecting mycobacteria in a sample.
[0068] In more detail, many prior art methods involve the use of the polymerase chain reaction (PCR) to amplify a mycobacterial nucleic acid. It is well known in the art the PCR involves thermal cycling through temperatures that include those capable of lysing mycobacteria, including non-viable mycobacteria. If any residual non-viable mycobacteria remain in the nucleic acid sample upon which PCR is performed (such as a sample obtained by lysing viable mycobacteria) the non-viable mycobacteria will be lysed by the temperatures obtained during thermal cycling. In this case, nucleic acids from non-viable bacteria are released to the sample, and are available for amplification by subsequent thermal cycles. The amplification product of PCR then includes amplified nucleic acids from non-viable mycobacteria. Accordingly, a PCR-based method cannot be used to determine the presence or absence of viable mycobacteria only, unless non-viable mycobacteria are removed from the sample prior to PCR. This requires an additional step of cleaning and concentrating the nucleic acids released from viable bacteria prior to PCR.
[0069] In contrast, in the method of the disclosure, the lysis agent is designed to selectively lyse viable mycobacteria. Thus, mycobacterial nucleic acids are released from viable mycobacteria only. Use of an isothermal process for amplification of such nucleic acids avoids thermal lysis of non-viable mycobacteria. Thus, the amplification product does not include amplified nucleic acids from non-viable mycobacteria. The amplification product includes amplified nucleic acids from viable mycobacteria only. In this way, the method of the disclosure can be used to determine the presence or absence of viable mycobacteria only, without needing to remove non-viable mycobacteria are removed from the sample prior to amplification. There is no need for an additional step of cleaning and concentrating the nucleic acids released from viable bacteria prior to amplification. The method is therefore simpler and quicker to perform than PCR-based methods in the prior art. Furthermore, specialised thermal cyclers are not required for the method of the disclosure, and so the method may easily be performed in the field. These benefits are not at the expense of sensitivity or specificity. Therefore, the method of the disclosure can be used in a sensitive and specific test that is suitable for low- and middle-income countries. The use may be veterinary / agri cultural.
[0070] Accordingly, disclosed herein is a method for detecting the presence or absence of mycobacteria in a sample. The method comprises: (a) contacting the sample with a lysis agent comprising one or more bacteriophages each bound to a solid support, such that if viable mycobacteria are present in the sample the viable mycobacteria are lysed by the lysis agent and a mycobacterial nucleic acid is released; (b) performing an isothermal amplification process to amplify the mycobacterial nucleic acid and thereby providing an amplification product; and (c) detecting the presence or absence of the amplification product, wherein presence of the amplification product indicates the presence of mycobacteria in the sample and absence of the amplification product indicates the absence of mycobacteria in the sample.
[0071] While culture-based detection methods in the prior art are notoriously slow, and may take days or weeks as set out above, the method of the disclosure may be completed in less than 10 hours. For instance, the method of the disclosure may be completed in less than 9 hours, less than 8 hours, less than 7 hours, less than 6 hours, less than 5 hours, less than 4 hours, or less than 3 hours, optionally the method of the disclosure may be completed in 3 to 8 hours, such as 4 to 7 hours or 5 to 6 hours. Typically, the method of the disclosure may be completed in less than 6 hours.
[0072] The method of the disclosure may be used to distinguish between mycobacteria resistant to treatment (i.e. treatment-resistant mycobacteria) and mycobacteria not resistant to treatment (i.e. non-treatm ent-resistant mycobacteria) in a sample, optionally wherein the treatment is treatment using isoniazid. Isoniazid is an antibiotic used for the treatment of tuberculosis and the prevention of the reactivation of tuberculosis. Some mycobacterial strains are resistant to isoniazid. Isoniazid resistance may be driven by mutations in the katG gene, which encodes a catalase-peroxidase that converts isoniazid into its active form. Therefore, a method for distinguishing between isoniazid-resistant mycobacteria and nonisoniazid-resistant mycobacteria would be useful for determining the presence or absence of isoniazid-resistant mycobacteria in a sample. Mycobacteria
[0073] The mycobacteria whose presence or absence is detected by the method may comprise (i) one or more Mycobacterium tuberculosis complex (MTBC) species (e.g., Mycobacterium tuberculosis and / or Mycobacterium bovis}, (ii) one or more Mycobacterium avium complex (MAC) species (e.g., Mycobacterium avium subspecies paratuberculosis (MAP)); (iii) Mycobacterium smegmatis: (iv) Mycobacterium ulcerous: (v) Mycobacterium leprae,' and / or (vi) one or more non-tuberculosis mycobacteria (NTM) (e.g., Mycobacterium abscessus complex, Mycobacterium kansasii and / or Mycobacterium marinum). For instance, the mycobacteria may comprise: (i); (ii); (iii); (iv); (v); (vi); (i), (ii); (i), (iii); (i), (iv); (i), (v); (i), (vi); (ii), (iii); (ii), (iv); (ii), (v); (ii), (vi); (iii),
[0074] (iv); (iii), (v); (iii), (vi); (iv), (v); (iv), (vi); (v), (vi); (i), (ii), (iii); (i), (ii), (iv); (i), (ii),
[0075] (v); (i), (ii), (vi); (i), (iii), (iv); (i), (iii), (v); (i), (iii), (vi); (i), (iv), (v); (i), (iv), (vi); (i),
[0076] (v), (vi); (ii), (iii), (iv); (ii), (iii), (v); (ii), (iii), (vi); (ii), (iv), (v); (ii), (iv), (vi); (ii), (v),
[0077] (vi); (iii), (iv), (v); (iii), (iv), (vi); (iii), (v), (vi); (iv), (v), (vi); (i), (ii), (iii), (iv); (i), (ii),
[0078] (iii), (v); (i), (ii), (iii), (vi); (i), (ii), (iv), (v); (i), (ii), (iv), (vi); (i), (ii), (v), (vi); (i), (iii),
[0079] (iv), (v); (i), (iii), (iv), (vi); (i), (iii), (v), (vi); (i), (iv), (v), (vi); (ii), (iii), (iv), (v); (ii), (iii), (iv), (vi); (ii), (iii), (v), (vi); (ii), (iv), (v), (vi); (iii), (iv), (v), (vi); (i), (ii), (iii), (iv),
[0080] (v); (i), (ii), (iii), (iv), (vi); (i), (ii), (iii), (v), (vi); (i), (ii), (iv), (v), (vi); (i), (iii), (iv), (v),
[0081] (vi); (ii), (iii), (iv), (v), (vi); or (i), (ii), (iii), (iv), (v), (vi).
[0082] Sample
[0083] The method detects the presence or absence of mycobacteria in a sample. In step (a), the sample is contacted with a lysis agent as set out above.
[0084] The sample may be a sample obtained from a subject. For instance, the sample may be an ex vivo sample. Thus, the method maybe performed ex vivo or in vitro. The sample may be a sample that is not intended for consumption as a food, such as a research sample or a clinical sample.
[0085] The subject may be any subject capable of harbouring mycobacteria. For example, the subject may be a human or a non-human animal. The non-human animal is typically a mammal. The non-human mammal may, for example, be a farm animal. The non-human mammal may, for example, be a ruminant such as a bovine, ovine or caprine. The non- human mammal may, for example, be a wild animal such as a badger or a deer. The non- human mammal may be any other kind of animal, such as a companion animal (e.g. dog, cat, horse, rabbit) or a laboratory animal (e.g. a rodent, such as a mouse, rat or guinea pig). The sample may be a body fluid sample. For example, the sample may be a blood (e.g. whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be a blood (e.g. whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be a blood (e.g. whole blood), cerebrospinal fluid, sputum, or urine sample. The sample may be from a body fluid sample, such as a blood (e.g. whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be from a blood (e.g. whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be from a blood (e.g. whole blood), cerebrospinal fluid, sputum, or urine sample. In other cases, the sample may be a stool sample or a breath sample. The sample may be from a stool sample or a breath sample. In any case, a sample that is “from” a particular type of sample may refer to a sample that has been processed in some way after collection and prior to step (a). Processing may, for instance, comprise purification or isolation of eukaryotic cells comprised in the unprocessed sample. Processing may further comprise concentration of dilution of the purified or isolated eukaryotic cells. For viscous samples (e.g. sputum) or solid samples (e.g. stool), processing may comprise maceration and / or suspension in a suitable fluid, such as saline. Prior art methods for detecting mycobacteria from, for example, sputum often include homogenisation, typically using N-acetyl-l-cysteine (NALC) or by vortexing. However, the inventors have found that, surprisingly, the method of the disclosure can be used to detect mycobacteria in unhomogenised sputum samples (see Example 7).
[0086] When the sample is a milk sample or is from a milk sample, the milk sample may be obtained from one or more subjects. That is, the milk sample may be an individual milk sample (i.e. a sample obtained from a single individual), or a milk sample pooled from multiple individuals. For instance, a pooled milk sample may be obtained two or more, five or more, 10 or more, 20 or more, 50 or more, 100 or more, 150 or more, or 200 or more individuals. The milk sample may, for instance, be a bulk milk tank sample. In the context of the present disclosure, the term “bulk milk tank sample” refers to a pooled milk sample that is obtained from a vessel that receives and holds milk produced by multiple animals farmed for their milk. The animals may for example be dairy cattle, dairy goats, or dairy sheep. The animals are typically kept on a single farm, for the purpose of producing milk. In any case, the milk may be in a form that is not intended for direct human consumption. In other words, the milk may be in a form that is not intended for human consumption without further processing. Further processing may be required to improve the suitability of the milk for human consumption, such as to reduce the presence of viable pathogens in the milk. Further processing may comprise pasteurisation. The milk may be unpasteurised.
[0087] The sample may, for example, be a tissue sample. The sample may, for instance, be a fine needle aspirate, a tissue swab or a biopsy. In any case, the sample may be taken from the site at which the presence of mycobacteria is suspected. The sample may, for example, comprise lung tissue. The sample may, for example, comprise gut tissue, such as tissue from the oesophagus, stomach, duodenumjejunum, ileum, cecum, appendix, colon, rectum or the perianal region. The sample may, for example, comprise skin. The sample may, for example, be from a tissue sample. A sample that is “from” a tissue sample may refer to a tissue sample that has been processed in some way after collection and prior to step (a). Processing may, for instance, comprise maceration of a solid tissue sample and / or suspension of tissue particles in a suitable fluid, such as saline.
[0088] The sample may alternatively be a food sample. The food sample may be of animal origin. For instance, the food sample may comprise meat, eggs, milk or another dairy product such as cheese or yoghurt. The milk or dairy product may be in a form that is intended for direct human consumption. In other words, the milk or dairy product may have been processed to improve its suitability for human consumption. Processing may, for instance, reduce the presence of viable pathogens in the milk or dairy product. Processing may, for instance comprise pasteurisation. The milk or dairy product may be pasteurised.
[0089] The sample may alternatively be an environmental sample. The environmental sample may comprise domestic water, surface water, river water, domestic water, water treatment plant water, aerosol, soil or sediment.
[0090] Steps
[0091] In the method of the disclosure, step (a) is typically carried out before step (b), and step (b) is typically carried out before step (c). It is, though, envisaged that one or more of the steps may be combined. That is, one or more of the steps may be performed together, in a single reaction. For instance, steps (a) and (b) may be performed together before step (c) is performed separately. Step (a) may be performed separately, before steps (b) and (c) are performed together. Steps (a), (b) and (c) may be performed together.
[0092] Steps (a), (b) and (c) are described in detail below. Lysis of eukaryotic cells
[0093] The sample may comprise eukaryotic cells. As mycobacteria are intracellular, mycobacteria may be present inside eukaryotic cells. Eukaryotic cells in the sample may be infected by mycobacteria. The eukaryotic cells may comprise one or more different cell types. A eukaryotic cell may be a mammalian cell, such as a blood cell, an endothelial cell or an epithelial cell. The blood cell may be a red blood cell or a white blood cell, such as a neutrophil, macrophage or lymphocyte.
[0094] To allow the lysis agent of step (a) to access mycobacteria in the sample, it may be necessary to lyse eukaryotic cells such that mycobacteria are released. Therefore, the method may comprise selectively lysing eukaryotic cells present in the sample. Selective lysis of eukaryotic cells may be performed prior to and / or during step (a).
[0095] In the context of the present disclosure, selective lysis of eukaryotic cells may refer to lysis of eukaryotic cells without lysis of mycobacteria. Where eukaryotic cells are infected by mycobacteria, selective lysis involves lysing infected eukaryotic cells without compromising mycobacterial integrity.
[0096] Methods of lysing eukaryotic cells without compromising mycobacterial integrity are known in the art. For example, the eukaryotic cells may be selectively lysed by contacting the sample with H2O (e.g., ddELO), a composition comprising guanidinium thiocyanate, a composition comprising saponin, a composition comprising sodium cholate, phosphate buffered saline (PBS), and / or mycobacterial growth medium. For instance, the sample may be contacted ddFFO at a 1 : 1 ratio. If selective lysis of eukaryotic cells is performed prior to and / or during step (a), the composition used for lysis of eukaryotic cells may be formulated with the lysis agent that is used to lyse mycobacteria. That is, the lysis agent may be comprised in H2O (e.g., ddELO), a composition comprising guanidinium thiocyanate, a composition comprising saponin, a composition comprising sodium cholate, phosphate buffered saline (PBS), or mycobacterial growth medium.
[0097] Step (a)
[0098] Step (a) comprises contacting the sample with a lysis agent comprising one or more bacteriophages each bound to a solid support, such that if viable mycobacteria are present in the sample the viable mycobacteria are lysed by the lysis agent and a mycobacterial nucleic acid is released. Contacting
[0099] The sample is contacted with the lysis agent. In the context of step (a), "contacting" may be taken to mean that the sample and the lysis are physically co-located, for example in a single reaction vessel. In other words, the sample and the lysis agent may be mixed. The sample and the lysis agent may be incubated together.
[0100] Contacting may take place for any suitable period of time. A suitable period of time is one that permits lysis of viable mycobacteria and release of a mycobacterial nucleic acid, if viable mycobacteria are present in the sample. For example, contacting may take place for a period of up to 1 hour, up to 2 hours, up to three hours, up to four hours, up to five hours, or up to six hours. Contacting may, for instance, take place for a period of 0.5 to 7 hours, such as 1 to 6 hours, 2 to 5 hours, or 3 to 4 hours. For example, contacting may take place for a period of about 3.5 hours.
[0101] Lysis agent
[0102] The lysis agent comprises one or more bacteriophages each bound to a solid support. The lysis agent may, for example, comprise two or more, 10 or more, 100 or more, 1000 or more, 10,000 or more, 100,000 or more, 1,000,000, 10,000,000 or more, or 100,000,0000 or more bacteriophages each bound to a solid support. Bacteriophages may, for example, be present in the lysis agent at a concentration of 10° to 1010pfu / ml, such as 101to 109, 102to 108, 103to 107, or 104to 106pfu / ml.
[0103] Each of the one or more bacteriophages is bound to a solid support. In other words, each of the one or more bacteriophages may be attached to a solid support. Attachment may be temporary or, preferably, permanent. The purpose of the solid support is to capture mycobacteria bound by the bacteriophage that is attached to the solid support, such that the solid support and any captured mycobacteria may be separated from the sample. Thus, the lysis agent may capture mycobacteria on the solid support by means of an interaction between the one or more bacteriophages and the mycobacteria. As explained in the bacteriophage section below, the mycobacteria may be viable mycobacteria. The interaction may be binding of the bacteriophage to the mycobacteria or viable mycobacteria. In particular, the bacteriophage may bind to the surface of a mycobacterial cell or a viable mycobacterial cell.
[0104] Bacteriophages and solid supports are described in detail below. Bacteriophages
[0105] The one or more bacteriophages may comprise two or more different bacteriophage species. In other words, the one or more bacteriophages may comprise two or more individual bacteriophages each belonging to a different bacteriophage species. For example, the one or more bacteriophages may comprise three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten or more different bacteriophage species. In other words, the one or more bacteriophages may comprise three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten or more individual bacteriophages each belonging to a different bacteriophage species. The one or more bacteriophages may, for example, comprise one to 10, two to nine, three to eight, four to seven, one to five, one to six, five to 10 or six to 10 different bacteriophage species. In other words, the one or more bacteriophages may comprise one to 10, two to nine, three to eight, four to seven, one to five, one to six, five to 10 or six to 10 individual bacteriophages each belonging to a different bacteriophage species. In one aspect described herein, the one or more bacteriophages comprise two different bacteriophage species (i.e. two individual bacteriophages each belonging to a different bacteriophage species).
[0106] The one or more bacteriophages may be capable of lysing mycobacteria. For example, the one or more bacteriophages may be capable of lysing viable mycobacteria, or selectively lysing mycobacteria. The one or more bacteriophages may each be capable of lysing mycobacteria. For example, the one or more bacteriophages may each be capable of lysing viable mycobacteria, or selectively lysing viable mycobacteria. In this regard, “ selectively lysing viable mycobacteria" may be taken to refer to lysis of viable mycobacteria without lysis of non-viable mycobacteria, or to lysis of viable mycobacteria in preference to lysis of non-viable mycobacteria. A bacteriophage capable of selectively lysing viable mycobacteria may, for example, lyse viable mycobacteria may two or more times (such as five or more, 10 or more, 20 or more, 50 or more, or 100 or more times) as effectively as non-viable mycobacteria. Non-viable mycobacteria may be considered to be mycobacteria that are unable to reproduce, or dead mycobacteria.
[0107] In order to be able to lyse mycobacteria, a bacteriophage must be capable of binding to the mycobacteria. Accordingly, the one or more bacteriophages may be capable of binding to mycobacteria. The one or more bacteriophages may each be capable of binding to mycobacteria. In other words, the one or more bacteriophages may be capable, or may each be capable, of attaching to the surface of a mycobacterial cell. Typically, bacteriophages only bind to viable hosts. Therefore, the one or more bacteriophages may be capable, or may each be capable, of selectively binding to viable mycobacteria (i.e. of binding to viable mycobacteria but not to non-viable mycobacteria). A given bacteriophage may be capable of binding to mycobacteria of one or more species. For example, a given bacteriophage may be capable of binding to two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten or more mycobacterial species.
[0108] The ability of a bacteriophage to lyse mycobacteria may, for example, be linked to the ability of a bacteriophage to infect and / or replicate in the mycobacteria. For instance, lysis may be an effect of successful infection of mycobacteria by the bacteriophage. Lysis may, for example, be an effect of successful bacteriophage replication in mycobacteria. Successful infection and / or replication may only be possible in viable mycobacteria.
[0109] The one or more bacteriophages may therefore comprise a bacteriophage species that is capable of infecting and / or replicating in mycobacteria. That is, the one or more bacteriophages may comprise a bacteriophage species that is (i) capable of infecting mycobacteria, (ii) capable of replicating in mycobacteria or (iii) capable of infecting and replicating in mycobacteria. The bacteriophage species may be capable of infecting and / or replicating in one mycobacterial species. The bacteriophage species may be capable of infecting and / or replicating in two or more mycobacterial species. The bacteriophage species may be capable of infecting and / or replicating a broad range of mycobacterial species, such as three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten or more mycobacterial species. By using a bacteriophage species that is capable of infecting and / or replicating in two or more different mycobacterial species, the presence or absence of two or more different mycobacterial species may be detected concurrently.
[0110] The one or more bacteriophages may comprise two or more bacteriophage species, each capable of replicating in at least one mycobacterial species. Using such a combination of bacteriophage species provides an alternative means for detecting the presence or absence of two or more different mycobacterial species concurrently.
[0111] The one or more bacteriophages may comprise a bacteriophage species that is incapable of infecting and / or replicating in non-mycobacterial cells.
[0112] Bacteriophage species capable of lysing mycobacteria (such as lysing viable mycobacteria or selectively lysing viable mycobacteria) are known in the art. The one or more bacteriophages may comprise any such bacteriophage species. In addition, suitable bacteriophage species may be identified by phage hunting. Phage hunting is a mechanism for identifying bacteriophage species having one or more desired properties, from bacteriophages abundant in the environment. An exemplary protocol for hunting for bacteriophage species capable of lysing mycobacteria is as follows: - Collect sample from e.g. soil, water, mud or cattle faeces were collected into sterile 15 ml centrifuge. - Transfer approximately 10g or 10ml into a sterile 50 ml centrifuge tube containing 40ml 7H9 media supplemented with OADC (10%) and CaCl2 (2mM). - Add actively growing M. smegmatis (approximately 105 cfu.ml-1) to the mixture and mix. - Incubate at 37°C overnight whilst shaking. - Centrifuged at 1000 x g for 10 min. - Filter sterilise (0.45µm) supernatant into a clean 50 ml centrifuge tube. - Plate samples with molten 7H10 agar (1:1) and 1 ml of M. smegmatis (108cfu.ml-1). Leave to set and incubate at 37°C for up to 48 h. - Pick plaques and place into fresh 7H9 media supplemented with OADC (10%) and CaCl2(2mM) to provide a stock of bacteriophage. The one or more bacteriophages may comprise a bacteriophage species isolated according to this exemplary protocol. The one or more bacteriophages may, for example, comprise any one or more of D29 (Accession No: AF022214) and TM4 (Accession No: AF068845). The one or more bacteriophages may comprise D29. The one or more bacteriophages may comprise TM4. The one or more bacteriophages may comprise D29 and TM4. D29 and TM4 are thought to bind to different sites on the mycobacterial cell surface. As illustrated in the Examples, a lysis agent comprising both D29 and TM4 improved over a lysis agent comprising D29 or TM4 alone. Alternatively or additionally, the one or more bacteriophages may, for example, comprise any one or more of (i) B1, (ii) Bxz2 (Accession No. AY129332), (iii) L5 (Accession No. Z18946) and (iv) PG2. For instance, the one or more bacteriophages may comprise: (i); (ii); (iii); (iv); (i) and (ii); (i) and (iii); (i) and (iv); (ii) and (iii); (ii) and (iv); (iii) and (iv); (i), (ii) and (iii); (i), (ii) and (iv); (ii), (iii) and (iv); or (i), (ii), (iii) and (iv); instead of or in addition to D29 and / or TM4. B1, Bxz2, L5, and PG2 are understood to have similar properties to D29 and TM4. Solid support
[0113] Each of the one or more bacteriophages comprised in the lysis agent is bound to a solid support. As set out above, the purpose of the solid support is to capture mycobacteria bound by the attached bacteriophage. As explained in more detail below, the solid support and any captured mycobacteria may then be separated from the sample. In other words, the solid support permits separation of mycobacteria, such as viable mycobacteria, from the sample. Accordingly, a complex may be formed comprising the bacteriophage, the solid support and a mycobacterium.
[0114] The solid support may therefore be any solid moiety that is capable of being separated from the sample. Separation may be achieved based on the physical or chemical properties of the solid support, for example.
[0115] The solid support may, for example, be a bead. The bead may, for example, be a magnetic bead or a paramagnetic bead. In this case, a magnetic field may be applied to the sample in order to separate the solid support and any bound bacteriophage from the sample. Hence, separation may be achieved by or comprise application of a magnetic field. The separation may be achieved by or comprise magnetic separation. Magnetic bead (or paramagnetic bead) based separation is well-known in the art.
[0116] The bead may, for example, be a non-magnetic bead. In this case, separation may be achieved by non-magnetic means. For instance, the bead may be labelled with a binding molecule. Separation may be achieved by contacting the binding molecule with a corresponding binding partner. The binding partner may be immobilised on a second solid support, such as a column, so that the bead and bound mycobacteria are retained in the column whereas other components of the sample are eluted. The binding molecule may, for example, comprise biotin and the binding partner streptavidin. The binding molecule may, for example, comprise streptavidin and the binding partner biotin. The binding molecule may, for example, comprise an antibody or antibody fragment and the binding partner its cognate ligand. The binding partner may, for example, comprise an antibody or antibody fragment and the binding molecule its cognate ligand.
[0117] Separation of a non-magnetic bead may alternatively be based on size. For instance, the sample may be contacted with a filter, such that beads and bound mycobacteria are retained by the filter whereas other components of the sample pass through. Hence, separation may be achieved by or comprise filtration. Separation of a non-magnetic bead may alternatively be based on mass. The sample may be centrifuged, such that beads and bound mycobacteria precipitate whereas other components of the sample remain in the supernatant, which may be discarded.
[0118] In any case, the bead may have a diameter of up to 10 nm, up to 20 nm, up to 30 nm, up to 40 nm, up to 50 nm, up to 60 nm, up to 70 nm, up to 80 nm, up to 90 nm, up to 1 pm, up to 2 pm, up to 3 pm, up to 4 pm, up to 5 pm or up to 6 pm. For instance, the bead may have a diameter of 10 to 90 nm, such as 20 to 80 nm, 30 to 70 nm, 40 to 60 nm, or 20 to 30 nm. The bead may have a diameter of 10 nm to 6 pm, such as 20 nm to 5 pm, 30 nm to 4 pm, 40 nm to 3 pm, 50 nm to 2 pm, 60 nm to 1 pm, 70 nm to 500nm, or 80 nm to 100 nm. If filter-based separation is to be employed, the size of the filter can be selected based on the size of the bead. For example, where the bead has a diameter of 1 pm or more, suitable filters may have a pore size of 0.1 to 0.9 pm. In this case, the filter may have a pore size of 0.22 pm.
[0119] The bacteriophage may be bound to the solid support. Methods of binding a bacteriophage to a solid support without affecting the infectivity of the bacteriophage are known in the art. Binding may, for instance, be by a chemical group such as a tosyl group. Binding may, for instance, be covalent. Binding may, for instance, be by a pair of binding partners. For instance, the bacteriophage may be decorated with a first member of the pair, and the solid support may be decorated with a second member of the pair. The pair may, for example, comprise biotin and streptavidin.
[0120] Once bound to mycobacteria, the lysis agent may be detected. The lysis agent may be labelled to aid in the detection of the lysis agent bound to mycobacteria. The label may be a fluorophore, an enzyme (e.g., horse radish peroxidase), a gold bead, a radioisotope or a tag (e.g., a particular synthetic peptide epitope, a synthetic oligonucleotide or a lanthanide). Any suitable fluorophore may be used to label the lysis agent. For example, the fluorophore may be green fluorescent protein, rhodamine, eosin, Oregon green or Texas red. Where one or more different lysis agents are used in the methods disclosed herein (e.g., where two different lysis agents are used), each lysis agent may be labelled differently. For example, each lysis agent is labelled differentially with differently coloured fluorophores (e.g., a red fluorophore and a green fluorophore) so that binding of each of the lysis agents to mycobacteria may be distinguished and / or so that co-localisation of the lysis agents may be detected.
[0121] As set out above, each of the one or more bacteriophages in the lysis agent is bound to a solid support. Each bacteriophage may be bound to a different or separate solid support. In this case, each of the solid supports may be the same. For instance, each of the solid supports may be a paramagnetic bead. Alternatively, the solid supports may differ in their identity. For instance, some bacteriophages may be bound to a paramagnetic bead, and some bacteriophages may be bound to a non-magnetic bead. The bacteriophages may each belong to the same species, or to two or more different species. Thus, the lysis agent may comprise two or more different bacteriophage species bound to different solid supports
[0122] Alternatively, two or more bacteriophages may be bound to the same solid support. That is, a single solid support (e.g. bead or paramagnetic bead) may be attached to two or more bacteriophages. The two or more bound bacteriophages may all be of the same species. The two or more bound bacteriophages may all be of different species. If there are three or more bound bacteriophages, some of the bound bacteriophages may be of the same species, and some other of the bound bacteriophages may be of a different species. Thus, the lysis agent may comprise two or more different bacteriophage species bound to the same solid support.
[0123] Release of a mycobacterial nucleic acid
[0124] As explained above, the bacteriophage comprised in the lysis agent lyses mycobacteria (such as viable mycobacteria) following binding and infection of the mycobacteria. Mechanism of bacteriophage lysis are well-known in the art and include, for example, the production of proteins that create lesions in the cytoplasmic membrane of the host cell. Such lesions provide a pathway for phage endolysins to release to the cell wall, where they cause cleavage and cell burst.
[0125] This bursting of the host cell necessarily releases host cell components to the surrounding substrate. In this way, bacteriophage-mediated lysis of a mycobacterial cell present in the sample causes release of mycobacterial components, including genetic material. One or more mycobacterial nucleic acids are thus released.
[0126] As demonstrated in the Examples, mycobacteria are typically lysed following about 3.5 hours of contact with the lysis agent. That is, the one or more bacteriophages typically release a mycobacterial nucleic acid within around 3.5 hours of first contact with the mycobacteria. Thus, the mycobacterial nucleic acid is typically released around 3.5 hours after the sample is contacted with the lysis agent. Routine adaptations may be made though, such that the mycobacterial nucleic acid is released up to 1 hour, up to 2 hours, up to three hours, up to four hours, up to five hours, or up to six hours after contact with the lysis agent, such as a period of 0.5 to 7 hours, such as 1 to 6 hours, 2 to 5 hours, or 3 to 4 hours after contact with the lysis agent. Contact may be taken to mean first contact of mycobacteria with the lysis agent. Contact with the lysis agent is typically maintained throughout the specified period, as the bacteriophage part of the lysis agent will be bound to the mycobacteria.
[0127] The mycobacterial nucleic acid may comprise DNA. For instance, the mycobacterial nucleic acid may comprise a genomic nucleic acid, such as genomic DNA. The mycobacterial nucleic acid may comprise RNA. The mycobacterial nucleic acid may, for instance, comprise rRNA or mRNA. The mycobacterial nucleic acid may comprise DNA and RNA.
[0128] The mycobacterial nucleic acid sequence may be characteristic of mycobacteria or of a given mycobacterial species. That is, the mycobacterial nucleic acid sequence may be found in mycobacteria, or in a particular species of mycobacteria, but not in other organisms. The mycobacterial nucleic acid may, for example, comprise an insertion sequence, optionally a mycobacterial insertion sequence. For instance, the mycobacterial nucleic acid may, for example, comprise IS6770 (SEQ ID NO: 1), or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 1. IS6770 is an insertion sequence found within the members of the MTBC. The mycobacterial nucleic acid may, for example, comprise IS900 (SEQ ID NO: 2), or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 2. IS900 is an insertion sequence found within Mycobacterium avium subsp. Paratuberculosis. The mycobacterial nucleic acid may, for example, comprise IS2404 (SEQ ID NO: 3), or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 3. IS2404 is an insertion sequence found within Mycobacterium ulcerans.
[0129] The mycobacterial nucleic acid may, for example, comprise deletion or lack of an RD4 (region of deletion 4). RD4 encompasses Rvl506c-Rvl516c of Mycobacterium tuberculosis H37Rv, and may play a role in mycobacterial virulence. RD4 is deleted in certain other mycobacteria, such as M. bovis. The deleted sequence is shown in (SEQ ID NO: 4). The mycobacterial nucleic acid may lack SEQ ID NO: 4, or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 4. Thus, the mycobacterial nucleic acid may comprise deletion of SEQ ID NO: 4, or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 4. Deletion or lack of SEQ ID NO: 5, or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 5 may, for example, be detected using primers designed to span the where the sequence would otherwise be found. Exemplary primers are provided in SEQ ID NOs: 17 to 22. Further exemplary primers are provided in SEQ ID NOs: 23 to 28. In particular, primers comprising a sequence of SEQ ID NOs: 23 to 28 can be used to detect isoniazid resistance. Accordingly, primers comprising a sequence of SEQ ID NOs: 23 to 28 can be used in the method of distinguishing between treatment-resistant mycobacteria and non-treatmentresistant mycobacteria described herein.
[0130] The mycobacterial nucleic acid may, for example, encode a 16S rRNA sequence, or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the 16S rRNA sequence. The 16S rRNA sequence may be a mycobacterial 16S rRNA sequence.
[0131] The mycobacterial nucleic acid may, for example, encode a signature DNA sequence specific for mycobacteria. That is, the mycobacterial nucleic acid may encode a DNA sequence that is found in mycobacteria, but not in other micro-organisms. The mycobacterial nucleic acid may alternatively encode a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the signature DNA sequence. The signature DNA sequence, for example, comprise a DNA sequence comprised in the HSPX gene, which encodes alpha-crystallin.
[0132] Separation of mycobacteria from the sample
[0133] As explained above, the solid support part of the lysis agent employed in step (a) permits mycobacteria present in the sample and bound by the bacteriophage part to be captured. Following capture on the solid support, the solid support and any captured mycobacteria may be separated from the sample. Such separation may, for example, take place prior to release of the mycobacterial nucleic acid. This allows the environment to which the mycobacterial nucleic acid is released to be controlled. For instance, separated solid supports and captured mycobacteria may be placed in a reaction mixture (e.g. buffer) of the operator’s choosing, such that the mycobacterial nucleic acid is ultimately released to that reaction mixture rather than to the original sample. In this way, undesirable components of the sample are excluded from the reaction mixture upon which the isothermal amplification process is performed in step (b). Such components may include debris (such as eukaryotic cell debris or faecal matter, depending on the sample type) and / or molecules (such as proteins, lipids or carbohydrates), which may have a detrimental effect on the efficiency of the isothermal amplification process and / or its results.
[0134] Accordingly, the lysis agent may capture mycobacteria (such as viable mycobacteria) on the solid support by means of an interaction between the one or more bacteriophages and the viable mycobacteria, as set out above. Step (a) may further comprise separating the solid support and any captured viable mycobacteria from the sample prior to release of the mycobacterial nucleic acid.
[0135] As explained above, the mycobacterial nucleic acid is typically released around 3.5 hours (such as 2 to 5 hours, 2.5 to 4.5 hours, or 3 to 4 hours) after first contact of mycobacteria in the sample with the lysis agent. Thus, the solid support and any captured viable mycobacteria may be separated from the sample before this point. For instance, the solid support and any captured viable mycobacteria may be separated from the sample less than 3.5 hours (such as around 3 hours, around 2.5 hours, around 2 hours, around 1.5 hours, around 1 hour or around 0.5 hours) after first contact of mycobacteria in the sample with the lysis agent. The solid support and any captured viable mycobacteria may be separated from the sample 0.5 to 3.5 hours (such as 1 hour to 3 hours, or 1.5 hours to 2 hours) after first contact of mycobacteria in the sample with the lysis agent. Preferably, the solid support and any captured viable mycobacteria may be separated from the sample around 3 hours or less (such as around 2.5 hours or less, around 2 hours or less, around 1.5 hours or less, around 1 hour or less or around 0.5 hours or less) after first contact of mycobacteria in the sample with the lysis agent.
[0136] Potential mechanisms for separation are described in the “Solid support” section above. For instance, the solid support may be a magnetic bead or a paramagnetic bead, in which case separation may be achieved by application of a magnetic field. In particular, the bead and any captured mycobacteria may be separated from the sample by immobilising the bead through the application of an external magnetic field and removing the sample (e.g., in a wash step). The captured viable mycobacteria may then be released from the bead by adding elution buffer and removing the magnetic field.
[0137] The solid support may be a non-magnetic bead, such as a labelled bead. In this case, the labelled bead and any captured mycobacteria may be separated from the sample by immobilising the labelled bead with a surface-bound molecule that binds the label and removing the sample (e.g., in a wash step). For example, a biotinylated bead and any captured mycobacteria may be separated from the sample by immobilising the biotinylated bead using surface-bound streptavidin and removing the sample (e.g., in a wash step).
[0138] The solid support and any captured mycobacteria may be separated from the sample on the basis of mass, for instance by centrifugation. Methods of isolating and / or concentrating phage-bead-bound mycobacteria using mass-based separation techniques are known in the art. Alternatively, the solid support and any captured mycobacteria may be separated from the sample by filtration. Methods of isolating and / or concentrating phage- bead-bound mycobacteria using size-based separation techniques are known in the art.
[0139] Step of isolating and / or concentrating released mycobacterial nucleic acid
[0140] The methods disclosed herein may comprise an optional step of isolating and / or concentrating any released mycobacterial nucleic acid between step (a) and step (b). This may, for example, be performed to give further information about the sample or a subject from which it has been obtained. It is important to note, though, that the step of isolating and / or concentrating any released mycobacterial nucleic acid between step (a) and step (b) is not essential to the method for detecting the presence or absence of mycobacteria in the sample. As explained above, this is one of the benefits of the method of the disclosure over prior art detection methods.
[0141] This optional step may, for example, comprise removing un-lysed mycobacteria. For instance, this may comprise the use of antibodies as a capture agent to bind un-lysed, typically non-viable, mycobacteria. Un-lysed mycobacteria may also be removed by centrifugation, filtration or by barrier methods. Un-lysed mycobacteria may also be removed by binding viable and non-viable mycobacteria to a substrate prior to the addition of the lysis agent, adding the lysis agent and lysing the viable bound mycobacteria, and then removing the substrate and any bound, typically non-viable, mycobacteria. The substrate may be a chromatography column, magnetic beads or other material coated with a polypeptide that specifically binds to the mycobacteria.
[0142] After the removal of the un-lysed mycobacteria, the presence or absence of non- viable mycobacteria in the sample may be determined. Methods for doing so are known in the art. This may be useful for determining whether a subject has been exposed to mycobacteria without mycobacterial infection becoming established, and / or whether a sample has been contaminated by non-viable mycobacteria.
[0143] Alternatively, the method may comprise no step of isolating and / or concentrating any released mycobacterial nucleic acid between step (a) and step (b), as explained above. Step (b)
[0144] Step (b) comprises (b) performing an isothermal amplification process to amplify the mycobacterial nucleic acid and thereby providing an amplification product. As set out above, the mycobacterial nucleic acid may comprise a DNA sequence and / or an RNA sequence. If the mycobacterial nucleic acid comprises RNA, a reverse transcription step may be performed prior to or during step (b) to provide a DNA complementary to the RNA for amplification. Methods for reverse transcription of an RNA molecule are known in the art.
[0145] As set out above, more than one mycobacterial nucleic acid may be released. Step (b) may comprise performing an isothermal amplification process to amplify a plurality of different mycobacterial nucleic acids released in step (a), and thereby produce a plurality of different amplification products. For instance, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or 10 or more different mycobacterial nucleic acids may be amplified using an isothermal process. Two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or 10 or more different amplification products may be produced. Amplifying multiple different mycobacterial nucleic acids each characteristic for a different species of mycobacteria may allow the method to detect a broader range of mycobacterial species. Amplifying multiple different mycobacterial nucleic acids each characteristic for the species of mycobacteria may increase the specificity of the method for detecting that mycobacterial species.
[0146] It is advantageous to utilise an isothermal amplification process because operating at a single temperature removes the need for specialised and often large detection equipment otherwise required for PCR-based methods. In addition, use of an isothermal process for amplification avoids thermal lysis of non-viable mycobacteria. Thus, the amplification product does not include amplified nucleic acids from non-viable mycobacteria. The amplification product includes amplified nucleic acids from viable mycobacteria only. In this way, the method of the disclosure can be used to determine the presence or absence of viable mycobacteria only, without needing to remove non-viable mycobacteria are removed from the sample prior to amplification. There is no need for an additional step of cleaning and concentrating the nucleic acids released from viable bacteria prior to amplification. The method is therefore simpler and quicker to perform than PCR-based methods in the prior art. Furthermore, the method may be performed in one reaction vessel (e.g., in a single test tube, a single microcentrifuge tube or a single well of a multi-well plate). Therefore, the method may be used in high throughput screening, which is particularly advantageous if a large number of samples are needed to be tested (e.g., if multiple subjects need to be tested for the presence or absence of a mycobacterial infection).
[0147] The isothermal amplification process may comprise loop-mediated isothermal amplification (LAMP) or recombinase polymerase amplification (RPA). Both LAMP and RPA are known in the art. LAMP is a promising nucleic acid amplification test, which has been reported to be more resistant to inhibition by sample components, such as blood sample components, than conventional PCR-based methods. Thus, as shown in the Examples, LAMP -based methods do not require any upstream sample processing that would otherwise be required for PCR-based methods prior to nucleic acid amplification. Similar advantages may apply to RPA.
[0148] The isothermal amplification process uses primers to amplify the mycobacterial nucleic acid. Each primer is complementary to a target primer-binding site in mycobacterial nucleic acid. Primer design for isothermal amplification is routine in the art.
[0149] By way of example, the isothermal amplification process (e.g. LAMP) may involve the use of a set of primers comprising a forward outer primer (F3), a reverse outer primer (B3), a forward inner primer (FIP) and a backward inner primer (BIP). The set of primers may further comprise a loop forward primer (LF) and / or loop backward primer (LR). Using an LF and an LR may enhance reaction speed.
[0150] A mycobacterial nucleic acid comprising IS6770 may, for example be amplified using a set of primers comprising AGACCTCACCTATGTGTCGA (SEQ ID NO: 5) as the F3; TCGCTGAACCGGATCGA (SEQ ID NO: 6) as the B3;
[0151] ATGGAGGTGGCCATCGTGGAAG-CCTACGTGGCCTTTGTCAC (SEQ ID NO: 7) as the FIP; and AAGCCATCTGGACCCGCCAA-CCCCTATCGTATGGTGGAT (SEQ ID NO: 8) as the BIP. The set of primers may further comprise AGGATCCTGCGAGCGTAG (SEQ ID NO: 9) as the LF; and / or AAGAAGGCGTACTCGACCTG (SEQ ID NO: 10) as the LR.
[0152] A mycobacterial nucleic acid comprising IS900 may, for example be amplified using a set of primers comprising CGCAACGCCGATACCGT (SEQ ID NO: 11) as the F3; CCCAGGATGACGCCGAA (SEQ ID NO: 12) as the B3; CATCACCTCCTTGGCC- AGGCCCGCTAACGCCCAACAC (SEQ ID NO: 13) as the FIP; and GCGACACCGACGCGATGAT-TCCGGGCATGCTCAGGA (SEQ ID NO: 14) as the BIP. The set of primers may further comprise AGTGGCCGCCAGTTGTTG (SEQ ID NO: 15) as the LF and / or ACCGCCACGCCGAAATC (SEQ ID NO: 16) as the LR.
[0153] A mycobacterial nucleic acid comprising deletion of RD4 may, for example be amplified using a set of primers comprising GCCGCTCCCAAAAATTACCA (SEQ ID NO: 17) as the F3; GACGCTACTACGGCACGG (SEQ ID NO: 18) as the B3; AGGCCACTCCAAGAGTGTTGCG-TGACGCCTTCCTAACCAGA (SEQ ID NO: 19) as the FIP; and GCGCGGGCGTACCGGATAT-GCGCCCCGTAGCGTTA (SEQ ID NO: 20) as the BIP. The set of primers may further comprise CTTCTGCACGACTACGGCT (SEQ ID NO: 21) as the LF; and / or AGCCATTTTTCAGCAATTTCTCAG (SEQ ID NO: 22) as the LR.
[0154] The primers may be modified. In other words, one or more of the primers may comprise a chemically modified DNA or RNA sequence. For example, the primer may be phosphorothioated. In particular, the FIP and / or the BIP may be phosphorothioated. The primer may be fluorescently labelled. The fluorescent label may be quenched in its unbound state and fluoresce when the primer is comprised in an amplification product.
[0155] The isothermal amplification process may also use other reagents. A non-limiting example set of reagents is described in the Examples.
[0156] For example, the isothermal amplification process uses DNA polymerase. Any suitable DNA polymerase may be used in the methods described herein.
[0157] The DNA polymerase may be a eukaryotic polymerase. Examples of eukaryotic polymerases that may be used include pol-a, pol-P, pol-6, pol-s or any functional variant, analogue, homologue or derivative thereof and any combination thereof. The DNA polymerase is typically Bst DNA polymerase, more typically Bst 2.0 DNA polymerase. Bst 2.0 DNA polymerase does not initiate nucleic acid amplification until about 40°C. This property reduces the likelihood of obtaining false-positive results.
[0158] The DNA polymerase may be a prokaryotic polymerase. Examples of prokaryotic polymerases that may be used include Bacillus stearothermophilus (Bst) DNA polymerase, BcaBESTDS.E polymerse (TaKaRa), E. coli DNA polymerase I KI enow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, Bacillus stearothennophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, Staphylococcus aureus DNA polymerase 1 (Sau), or any functional variant, analogue, homologue or derivative thereof or any combination thereof. The DNA polymerase may be a bacteriophage polymerase. Examples of bacteriophage polymerases that may be used in the methods described herein include Phi- 29 DNA polymerase, T7 DNA polymerase, bacteriophage T4 gp43 DNA polymerase, or any functional variant, analogue, homologue or derivative thereof or any combination thereof.
[0159] The DNA polymerase may comprise strand displacing properties, and typically a high strand displacement activity.
[0160] DNA polymerases can use the free 3 ’-hydroxyl of the invading strand to catalyse DNA synthesis by incorporation of new nucleotides. A number of polymerases can use the 3 ’-hydroxyl of the invading strand to catalyse synthesis and simultaneously displace the other strand as synthesis occurs. For example, E. coli polymerase II or III can be used to extend invaded D-loops. In addition, E. coli polymerase V normally used in SOS-lesion- targeted mutations in E. coli can be used. All of these polymerases can be rendered highly processive through their interactions and co-operation with the P-dimer clamp, as well as single-stranded DNA binding protein (SSB) and other components. Other polymerases from prokaryotes, viruses, and eukaryotes can also be used to extend the invading strand.
[0161] Many DNA polymerases possess 3 ’-5’ exonuclease activity, and some also possess 5 ’-3’ exonuclease activity. 3 ’-5’ exonuclease activity increases the fidelity of the replication reaction. Accordingly, a DNA polymerase with 3 ’-5’ exonuclease activity may be used.
[0162] In some cases, using a DNA polymerase with 3’-5’ exonuclease activity and / or 5’- 3’ exonuclease activity may be undesirable, because it results in digestion of one DNA strand progressively as the polymerase moves forward, rather than displacement. Free oligonucleotides may also be subject to end-dependant degradation when polymerases possessing 3 ’-5’ exonuclease are employed. Mis-priming may also result from oligonucleotides that have been shortened by the 3 ’-5’ exonuclease activity of polymerases, leading to increased reaction noise. Accordingly, the DNA polymerase may not have 3 ’-5’ exonuclease activity and / or may not have 5 ’-3’ exonuclease activity.
[0163] The isothermal amplification process also uses dNTPs, such as dATP, dGTP, dCTP and dTTP, and derivatives and analogues thereof. In leading and lagging strand synthesis, RPA, ATP, GTP, CTP, and UTP may also be used for synthesis of RNA primers. A mixture of dNTP and ddNTP (e.g. ddATP, ddTTP, ddGTP and ddGTP and derivatives and analogues thereof) may be used. Chemicals that destabilise the DNA helix (i.e. DNA destabilisers) may improve isothermal amplification efficiency. Suitable chemicals may be selected by the skilled person. For example, betaine (N,N,N-trimethylglycine) or L-proline, which reduce base stacking, can stimulate not only the overall rate of the reaction but also increase target selectivity with a significant reduction in amplification of off-target sequences.
[0164] The isothermal amplification process may use a buffer. For example, an (RT- )LAMP reaction may comprise a Tris-HCl buffer, a Tris-Acetate buffer, or a combination thereof. The buffer may comprise potassium acetate. Reducing agents, such as DTT, may be used.
[0165] In RT-LAMP, the starting template is RNA, such as an RNA transcript of a bacterium. A reverse transcriptase may be used to produce cDNA from the RNA template as an initial step. The cDNA provides the template for amplification. Any suitable reverse transcriptase may be used in the kits, devices or methods described herein.
[0166] In many cases, it may be useful to use a reverse transcriptase that has a similar working temperature as the DNA polymerase that is used, such that, for example, the method described herein can be carried out at a single reaction temperature. As set out above, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten or more different mycobacterial nucleic acids may be amplified by performing an isothermal amplification process. Thus, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or 10 or more different amplification products may be produced. Each of the two or more nucleic acid sequences may be amplified simultaneously using the isothermal amplification process, by including a primer set for each of the different mycobacterial nucleic acids.
[0167] Step (c)
[0168] Step (c) comprises detecting the presence or absence of the amplification product, wherein presence of the amplification product indicates the presence of mycobacteria in the sample and absence of the amplification product indicates the absence of mycobacteria in the sample.
[0169] Any known mechanism for detecting the presence or absence of the amplification product may be used. A mechanism that gives a read-out visible to the naked eye may be particularly advantageous, as it minimises the equipment required to perform the method and facilitates use in the field. By way of example, detection may involve using a nucleic acid stain that produces a colorimetric reaction. Presence of the colorimetric reaction may indicate the presence of the amplification product and, therefore of mycobacteria in the sample. Absence of the colorimetric reaction may indicate the absence of the amplification product and, therefore of mycobacteria in the sample. Exemplary nucleic acid stains producing a colorimetric reaction include SYBR green 1, EvaGreen, calcein and hydroxynapthol blue.
[0170] In another example, detection may involve using a reagent that produces a change in turbidity. An increase in turbidity relative to the turbidity of a negative control may indicate the presence of the amplification product and, therefore of mycobacteria in the sample. Lack of an increase in turbidity relative to the turbidity of a negative control may indicate the absence of the amplification product and, therefore of mycobacteria in the sample. Turbidity may be assessed by the naked eye.
[0171] In another example, detection may involve using a nucleic acid stain that produces a fluorescent reaction. Presence of fluorescence may indicate the presence of the amplification product and, therefore of mycobacteria in the sample. Absence of fluorescence may indicate the absence of the amplification product and, therefore of mycobacteria in the sample.
[0172] In a further example, detection may involve gel electrophoresis of the amplification product. The presence of a DNA fragment of a particular known size may indicate presence of the amplification product and, therefore of mycobacteria in the sample. Absence of a DNA fragment of a particular known size may indicate the absence of the amplification product and, therefore of mycobacteria in the sample.
[0173] Presence of the amplification product may, in some cases, indicate one or more characteristics of mycobacteria present in the sample. Such characteristics may include species, strain, lineage, treatment resistance (e.g. drug resistance, such as isoniazid resistance) and / or virulence of the mycobacteria. Whether or not such characteristics are indicated by presence of the amplification product will determined by the choice of primers used for isothermal amplification. Primers leading to amplification of a speciesspecific nucleic acid sequence will, for example, allow the presence of the amplification product to indicate the species of mycobacteria present in the sample. Primers leading to amplification of a strain-specific nucleic acid sequence will, for example, allow the presence of the amplification product to indicate the strain of mycobacteria present in the sample. Primers leading to amplification of a lineage-specific nucleic acid sequence will, for example, allow the presence of the amplification product to indicate the lineage of mycobacteria present in the sample. Primers leading to amplification of a nucleic acid sequence providing a marker of drug-resistance will, for example, allow the presence of the amplification product to indicate drug resistance (e.g. isoniazid resistance) of mycobacteria present in the sample. Primers leading to amplification of a nucleic acid sequence providing a marker of virulence will, for example, allow the presence of the amplification product to indicate virulence of mycobacteria present in the sample. RD4 may be a marker of virulence, as set out above.
[0174] Method for diagnosing the presence or absence of mycobacterial infection
[0175] The method disclosed herein for detecting the presence or absence of mycobacteria in a sample may be used to diagnose the presence or absence of a mycobacterial infection in a subject. Thus, the disclosure provides a method for diagnosing the presence or absence of a mycobacterial infection in a subject, comprising detecting the presence or absence of mycobacteria in a sample obtained from the subject using the method disclosed herein for detecting the presence or absence of mycobacteria in a sample, wherein the presence of mycobacteria in the sample indicates the presence of a mycobacterial infection in the subject and absence of mycobacteria in the sample indicates the absence of a mycobacterial infection in the subject. That is, the disclosure provides a method for diagnosing the presence or absence of a mycobacterial infection in a subject, comprising detecting the presence or absence of mycobacteria in a sample obtained from the subject, wherein the presence or absence of mycobacteria in the sample is detected by (a) contacting the sample with a lysis agent comprising one or more bacteriophages each bound to a solid support, such that if viable mycobacteria are present in the sample the viable mycobacteria are lysed by the lysis agent and a mycobacterial nucleic acid is released; (b) performing an isothermal amplification process to amplify the mycobacterial nucleic acid and thereby providing an amplification product; and (c) detecting the presence or absence of the amplification product, wherein presence of the amplification product indicates the presence of mycobacteria in the sample and absence of the amplification product indicates the absence of mycobacteria in the sample; and wherein the presence of mycobacteria in the sample indicates the presence of a mycobacterial infection in the subject and absence of mycobacteria in the sample indicates the absence of a mycobacterial infection in the subject.
[0176] Any of the features described above in connection with the method for detecting the presence or absence of mycobacteria in a sample may also apply to the method for diagnosing the presence or absence of a mycobacterial infection in a subject. The subject may be any subject capable of harbouring mycobacteria. For example, the subject may be a human or a non-human animal. The non-human animal is typically a mammal. The non-human mammal may, for example, be a farm animal. The non-human mammal may, for example, be a ruminant such as a bovine, ovine or caprine. The non- human mammal may, for example, be a wild animal such as a badger or a deer. The non- human mammal may be any other kind of animal, such as a companion animal (e.g. dog, cat, horse, rabbit) or a laboratory animal (e.g. a rodent, such as a mouse, rat or guinea pig).
[0177] The sample may be a body fluid sample. For example, the sample may be a blood (e.g. whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be a blood (e.g. whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be a blood (e.g. whole blood), cerebrospinal fluid, sputum, or urine sample. The sample may be from a body fluid sample, such as a blood (e.g. whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be from a blood (e.g. whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine sample. The sample may be from a blood (e.g. whole blood), cerebrospinal fluid, sputum, or urine sample. In other cases, the sample may be a stool sample or a breath sample. The sample may be from a stool sample or a breath sample. In any case, a sample that is “from” a particular type of sample may refer to a sample that has been processed in some way after collection and prior to step (a). Processing may, for instance, comprise purification or isolation of eukaryotic cells comprised in the unprocessed sample. Processing may further comprise concentration of dilution of the purified or isolated eukaryotic cells. For viscous samples (e.g. sputum) or solid samples (e.g. stool), processing may comprise maceration and / or suspension in a suitable fluid, such as saline. Prior art methods for detecting mycobacteria from, for example, sputum often include homogenisation, typically using N-acetyl-l-cysteine (NALC) or by vortexing. However, the inventors have found that, surprisingly, the method of the disclosure can be used to detect mycobacteria in unhomogenised sputum samples (see Example 7).
[0178] When the sample is a milk sample or is from a milk sample, the milk sample may be obtained from one or more subjects. That is, the milk sample may be an individual milk sample (i.e. a sample obtained from a single individual), or a milk sample pooled from multiple individuals. For instance, a pooled milk sample may be obtained two or more, five or more, 10 or more, 20 or more, 50 or more, 100 or more, 150 or more, or 200 or more individuals. In this case, the method may diagnose the presence or absences of a mycobacterial invention in a group of subjects, such as a herd. The milk sample may, for instance, be a bulk milk tank sample. In the context of the present disclosure, the term “bulk milk tank sample” refers to a pooled milk sample that is obtained from a vessel that receives and holds milk produced by multiple animals farmed for their milk. The animals may for example be dairy cattle, dairy goats, or dairy sheep. The animals are typically kept on a single farm, for the purpose of producing milk. In any case, the milk may be in a form that is not intended for direct human consumption. In other words, the milk may be in a form that is not intended for human consumption without further processing. Further processing may be required to improve the suitability of the milk for human consumption, such as to reduce the presence of viable pathogens in the milk. Further processing may comprise pasteurisation. The milk may be unpasteurised.
[0179] The sample may, for example, be a tissue sample. The sample may, for instance, be a fine needle aspirate, a tissue swab or a biopsy. In any case, the sample may be taken from the site at which the presence of mycobacteria is suspected. The sample may, for example, comprise lung tissue. The sample may, for example, comprise gut tissue, such as tissue from the oesophagus, stomach, duodenumjejunum, ileum, cecum, appendix, colon, rectum or the perianal region. The sample may, for example, comprise skin. The sample may, for example, be from a tissue sample. A sample that is “from” a tissue sample may refer to a tissue sample that has been processed in some way after collection and prior to step (a). Processing may, for instance, comprise maceration of a solid tissue sample and / or suspension of tissue particles in a suitable fluid, such as saline.
[0180] The mycobacteria whose presence or absence is detected by the method may comprise any of those described above in connection with the method for detecting the presence or absence of mycobacteria in a sample. The mycobacterial infection may comprise infection with (i) one or more Mycobacterium tuberculosis complex (MTBC) species (e.g., Mycobacterium tuberculosis and / or Mycobacterium bovis),' (ii) one or more Mycobacterium avium complex (MAC) species (e.g., Mycobacterium avium subspecies paratuberculosis (MAP)); (iii) Mycobacterium smegmatis: (iv) Mycobacterium ulcerous: (v) Mycobacterium leprae,' and / or (vi) one or more non-tuberculosis mycobacteria (NTM) (e.g., Mycobacterium absessus complex, Mycobacterium kansasii and / or Mycobacterium marinum). For instance, the mycobacterial infection may comprise infection with: (i); (ii); (iii); (iv); (v); (vi); (i), (ii); (i), (iii); (i), (iv); (i), (v); (i), (vi); (ii), (iii); (ii), (iv); (ii), (v); (ii), (vi); (iii), (iv); (iii), (v); (iii), (vi); (iv), (v); (iv), (vi); (v), (vi); (i), (ii), (iii); (i), (ii), (iv); (i), (ii), (v); (i), (ii), (vi); (i), (iii), (iv); (i), (iii), (v); (i), (iii), (vi); (i), (iv),
[0181] (v); (i), (iv), (vi); (i), (v), (vi); (ii), (iii), (iv); (ii), (iii), (v); (ii), (iii), (vi); (ii), (iv), (v);
[0182] (ii), (iv), (vi); (ii), (v), (vi); (iii), (iv), (v); (iii), (iv), (vi); (iii), (v), (vi); (iv), (v), (vi); (i), (ii), (iii), (iv); (i), (ii), (iii), (v); (i), (ii), (iii), (vi); (i), (ii), (iv), (v); (i), (ii), (iv), (vi); (i), (ii), (v), (vi); (i), (iii), (iv), (v); (i), (iii), (iv), (vi); (i), (iii), (v), (vi); (i), (iv), (v), (vi);
[0183] (ii), (iii), (iv), (v); (ii), (iii), (iv), (vi); (ii), (iii), (v), (vi);; (ii), (iv), (v), (vi); (iii), (iv), (v),
[0184] (vi); (i), (ii), (iii), (iv), (v); (i), (ii), (iii), (iv), (vi); (i), (ii), (iii), (v), (vi); (i), (ii), (iv), (v), (vi); (i), (iii), (iv), (v), (vi); (ii), (iii), (iv), (v), (vi); or (i), (ii), (iii), (iv), (v), (vi).
[0185] The mycobacterial infection may cause, or be suspect of causing, a disease in the subject. The disease may be any disease in which mycobacteria contribute to the aetiopathogenesis. Numerous such diseases are known in the art. For example, in humans, mycobacteria are implicated in tuberculosis, Crohn’s disease, ulcerative colitis, irritable bowel syndrome, psoriasis, thyroiditis, sarcoidosis, Parkinson’s disease, multiple sclerosis, type 1 diabetes, arthritis, ankylosing spondylitis, Buruli ulcer, leprosy, non-tuberculosis mycobacteria (NTM) infection, cystic fibrosis, localized granuloma, and ascending lymphangitis (e.g. resembling sporotrichosis). The subject may have, or be suspected of having, any of these diseases. In animals, such as ruminants, mycobacteria are implicated in tuberculosis and Johne’s disease, amongst others. The subject may have, or be suspected of having, either of these diseases. Thus, the method for diagnosing the presence or absence of a mycobacterial infection in a subject may be a method for diagnosing tuberculosis, Crohn’s disease, ulcerative colitis, irritable bowel syndrome, psoriasis, thyroiditis, sarcoidosis, Parkinson’s disease, multiple sclerosis, type 1 diabetes, arthritis, ankylosing spondylitis, Buruli ulcer, leprosy, non-tuberculosis mycobacteria (NTM) infection, cystic fibrosis, localized granuloma, ascending lymphangitis (e.g. resembling sporotrichosis), or Johne’s disease.
[0186] If the method indicates the presence of a mycobacterial infection in the subject, appropriate action may be implemented. For instance, treatment may be administered for the mycobacterial infection. The treatment may be a prophylactic or therapeutic treatment. Such treatments for mycobacterial infection are known in the art. The treatment, may, for example, comprise an oral antibiotic such as isoniazid, clarithromycin, azithromycin, rifampin, rifabutin, ethambutol, streptomycin and / or amikacin. The treatment may, for example, comprise mycobacterial vaccine (e.g., a TB vaccine, a bTB vaccine or MAP vaccine). If the method indicates the presence of a mycobacterial infection in an animal subject, the subject may be isolated or culled, for instance as part of a programme for controlling the spread of the mycobacterial infection.
[0187] It is known that mycobacterial infection can be present in a subject in the absence of clinical signs. That is, mycobacterial infection may be present without causing active disease. The mycobacterial infection may, for instance, be latent. The mycobacterial infection may, for instance, be a sub-clinical infection. The method for diagnosing the presence or absence of a mycobacterial infection in a subject may be used to diagnose the presence or absence of a mycobacterial infection in the absence of clinical disease. Subjects determined to have mycobacterial infection in the absence of clinical disease may be treated pre-emptively to guard against the onset of clinical disease, and / or monitored for the onset of clinical signs. Implementation of early treatment in this way may improve the outcome of infection.
[0188] The method for diagnosing the presence or absence of a mycobacterial infection in a subject may be used to monitor the course of the infection in the subject. For instance, the method may be used to monitor the response of the infection to treatment.
[0189] The method of diagnosing the presence or absence of a mycobacterial infection in a subject may comprise determining one or more characteristics of the mycobacteria present in the sample. The one or more characteristics may comprise resistance to a treatment, such as isoniazid treatment. Determination of the presence or absence of isoniazidresistant mycobacteria in a sample may inform treatment decisions. For example, where a subject is diagnosed as having a mycobacterial infection and the sample obtained from the subject is determined to comprise viable isoniazid-resistant mycobacteria, a treatment not comprising isoniazid may be administered to the subject. Alternatively, if the sample obtained from the subject is determined not to comprise viable isoniazid-resistant mycobacteria, isoniazid may be administered to the subject. Determination of the presence or absence of isoniazid-resistant mycobacteria in a sample may also be useful for monitoring the response of an infection to isoniazid treatment.
[0190] Lysis agent
[0191] The disclosure further provides a lysis agent capable of lysing viable mycobacteria, comprising two or more different bacteriophage species each bound to a solid support. As demonstrated in the Examples, such a lysis agent is highly efficient in selectively lysing viable mycobacteria. In particular, a lysis agent comprising two or more different bacteriophage species demonstrates improved lysis compared to a lysis agent comprising only one bacteriophage species.
[0192] Bacteriophages and solid supports are described in detail above in connection with a lysis agent used in the methods of the disclosure. Any of the features disclosed above in connection with a lysis agent used in the methods of the disclosure may also apply to the lysis agent of the disclosure.
[0193] The lysis agent may comprise two or more different bacteriophage species bound to the same solid support. In this case, one solid support (e.g. bead) is bound to at least two bacteriophages, each of a different species.
[0194] The lysis agent may comprise two or more different bacteriophage species bound to different solid supports. That is, the lysis agent may comprise (i) a first bacteriophage species bound to a first solid support, and (ii) a second bacteriophage species bound to a second solid support. The first and second solid supports may be of the same type or species. For instance, the first and second solid support may both be a bead, a magnetic bead, a paramagnetic bead, a non-magnetic bead, or a labelled non-magnetic bead. The first and second solid supports may be of different types or species. For instance, the first and second solid support may each be a different moiety selected from: a bead, a magnetic bead, a paramagnetic bead, a non-magnetic bead, or a labelled non-magnetic bead.
[0195] Each of the two or more bacteriophage species may be capable of lysing viable mycobacteria. Bacteriophages capable of lysing viable mycobacteria are described above. In a preferred aspect of the disclosure, the two or more bacteriophage species comprise D29 and / or TM4. The two or more bacteriophage species may comprise D29. The two or more bacteriophage species may comprise TM4. Preferably, the two or more bacteriophage species may comprise D29 and TM4.
[0196] Uses and kits
[0197] The lysis agent of the disclosure may be used in the method of the disclosure. Thus, the disclosure provides use of the lysis agent of the disclosure in a method of the disclosure.
[0198] The disclosure further provides a kit for performing a method of the disclosure comprising the lysis agent of the disclosure. The kit may optionally comprise one more additional components. The one or more additional components may be any of the reagents descried herein and in any of the concentrations described herein, in any suitable combination. The one or more additional components may comprise one or more reagents for performing an isothermal amplification process such as LAMP or RPA, such as the primers, DNA polymerase, dNTPs, DNA destabilisers and / or buffer components described herein. Where the kit is for performing a method of the disclosure requiring reverse transcription, the kit may comprise the reverse transcriptase described herein. The one or more additional components may comprise one or more reagents for detecting the amplification product, such as a nucleic acid stain described herein.
[0199] The lysis agent and / or the one or more additional components of the kit may be dried. Drying offers the advantage of not requiring refrigeration to maintain the activity of the lysis agent or the activity of the one or more additional components. For example, if dried, the lysis agent and / or the one or more additional components of the kit may be stored at room temperature. This is especially useful in field conditions where access to refrigeration is limited.
[0200] The lysis agent and / or the one or more additional components of the kit may be dried by any suitable method. The lysis agent and / or the one or more additional components of the kit may be vacuum-dried. The lysis agent and / or the one or more additional components of the kit may be freeze-dried (i.e. lyophilised). Suitable methods for vacuum-drying or lyophilisation are known in the art.
[0201] The lysis agent and / or the one or more additional components of the kit may be dried onto the bottom of a tube, or on a bead or any other suitable type of solid support. Before use, dried components of the kit may be reconstituted in a buffered solution or water, depending on the composition of the dried components. Then, the target or template nucleic acid described herein, or the sample described herein, may be added. Alternatively, the reconstitution liquid may contain the target or template nucleic acid or the sample. The reconstituted reaction may be incubated for a suitable time period and at a suitable temperature as described herein. The amplification product, if present, may then be detected as described herein.
[0202] Stabilising agents such as dextran, lactose or trehalose sugar may be included in the dried mixture in order to improve drying performance and shelf life. Bovine serum albumin may be included. If desired, the dried reagents may be stored before use (e.g. for up to 2 weeks, 3 weeks, 1 month, 6 months, 1 year, 2 years or 3 years or more before use).
[0203] The dried components may be re-dissolved in water, typically DNase- and / or RNase-free water, or any other suitable buffer as may be determined by the skilled person in the art. The pH of the re-dissolved reagents may be adjusted before use. The lysis agent and the one or more components of the kit may be combined as a reagent mix, for example, in or on a same solid support, such as a reaction tube. The lysis agent and / or the one or more additional components of the kit may be provided in any suitable amount such that, when reconstituted, the appropriate reagent concentration is achieved.
[0204] The one or more additional components of the kit may comprise instructions for use.
[0205] The kit may be used in the methods of the invention.
[0206] Any of the features described above in connection with the methods or lysis agent of the disclosure may also apply to the uses and kits of the disclosure.
[0207] EXAMPLES
[0208] The following Examples are provided to illustrate the invention but are not intended to limit the invention.
[0209] Example 1
[0210] Materials and methods
[0211] Strains and culture
[0212] Laboratory strains of mycobacteria used in this study were A- / . smegmatis (mc2155), M. bovis BCG (Pasteur), Mycobacterium avium subsp. paratuberculosis (MAP) strain (ATCC 19698) and a MAP goat strain (clinical isolate). Both M. bovis and MAP were maintained in liquid culture on Middlebrook 7H9 (Sigma- Aldrich, USA) and solid culture 7H10 (Sigma-Aldrich, USA) agar, both supplemented with OADC (PBD Biotech Ltd, UK). Growth media for MAP were also supplemented with mycobactin-J (2 pg / pl; IDVet, France). All liquid cultures were incubated at 37°C with shaking (200 rpm). Bacteriophage D29 (Actiphage Reagent) was supplied in the Actiphage kit (PBD Biotech Ltd, UK) and was used to infect mycobacteria.
[0213] Enumeration of mycobacteria
[0214] To determine the concentration of mycobacteria in liquid culture, the enumeration method was carried out according to Swift et al. 2016
[0215] (doi: 10.1080 / 21505594.2016.1191729). Briefly, cultured mycobacteria were mixed with D29 bacteriophage (approximately 108pfu / ml; PBD Biotech Ltd, UK) and incubated at 37°C for 1 h, allowing the bacteriophage to bind and infect mycobacteria. Extracellular bacteriophages were inactivated with virucide (ferrous ammonium sulfate, 10 mM; PBD Biotech Ltd, UK) for 5 min at ambient temperature. The virucide was neutralised by diluting with 5 ml Actiphage media before plating with 7H10 agar (final concentration of 0.75 % w / v). The mycobacterial cell number was determined by counting plaques on the M. smegmatis reporter lawn (recorded as pfu / ml).
[0216] Bacteria isolation from blood
[0217] To isolate the bacteria from blood, HetaSep™, an erythrocyte aggregation agent, was used to separate nucleated cells from red blood cells. The HetaSep™ reagent was mixed 1 :5 with blood and centrifuged (100 x g; 1 min). The sample was left on the bench at ambient temperature for 10 min. The plasma layer was carefully removed and placed into 5 ml PBS, before centrifugation (200 x g; 10 min). The supernatant was removed and the pellet was suspended in 1 ml sterile water. The sample was then centrifuged (13000 x g; 3 min) before use in the Actiphage® assay.
[0218] Actiphage® assay
[0219] Peripheral blood mononuclear cells were first extracted from samples using MolYsis™ Basic 5. The Actiphage® assay was then carried out according to Swift et al., 2020 (doi: 10.1111 / 1751-7915.13518). Briefly, the processed samples were suspended in 100 μl Actiphage reagent and incubated for 3.5 h at 37°C. Following incubation, the lysate was centrifuged (13,000 x g; 3 min) in the Rapid tubes. The filtrate was then cleaned and concentrated (Monarch® PCR & DNA Cleanup Kit (5 pg), New England Biotech) prior to DNA elution using lOμl (double loaded) of molecular-grade water (55°C) instead of elution buffer. The eluted DNA was used as template DNA for nucleic acid amplification.
[0220] LAMP optimisation
[0221] The DNA used in optimisation reactions was from MAP or M. bovis BCG that were enumerated and then serially diluted from 105 / 5 μl to 10° cell / 5 μl and subject to crude DNA extraction (boiling at 95°C for 10 min). These DNA lysates were used as template in all optimisation reactions.
[0222] A matrix of effects was investigated to optimise each LAMP assay. This included determining the optimal reaction temperature using a temperature gradient (60-67.5°C), before optimising the loop forward and loop reverse primer concentrations (0.8, 1.4 and
[0223] 2.4 pM). The effect of primer sets with and without phosphorothioated forward inner primer (Flc) and backward inner primer (Bic) regions (Table 1) and the effect of LAMP enhancers such as guanidine hydrochloride (40 pM; Thermo Fisher Scientific), urea (3.6 pM; Thermo Fisher Scientific) and DMSO (2%; Thermo Fisher Scientific) were also investigated.
[0224] Table 1. Primer sequences and modifications.
[0225] Analytical sensitivity testing
[0226] The limit of detection (LOD) of the optimised LAMP reactions was determined initially by enumerating cultured mycobacteria and then serially diluting to a final concentration of 10° cell / 5 pl. These dilutions were subject to crude DNA extraction (95°C for 10 min) and used as template in the optimised MTBC, MAP and M. bovis LAMP assays. These LOD experiments were repeated in triplicate. The LOD of the optimised LAMP reactions were compared against the LOD of endpoint PCR that targeted the same genetic elements. The same crude DNA was used in both comparison reactions.
[0227] The Actiphage®-LAMP LOD was determined by enumerating the mycobacteria and serially diluting to a concentration of 10° cell / ml. These dilutions were processed through the Actiphage® assay and 5 μl non-purified lysate was used as a template in optimised MTBC, MAP and M. bovis LAMP assays. DNA lysates were then cleaned and concentrated (New England Biotech, USA) and 5 μl purified filtrate was used as template in the optimised MTBC, MAP and M. bovis LAMP assays. The Actiphage®-LAMP LOD experiments were repeated three times. A negative no-template control was carried out for every run.
[0228] Use of Actiphage®-LAMP in blood
[0229] Blood spiking experiments were carried out using defibrinated sheep blood (Oxoid Ltd, UK). 5 ml blood was spiked with cultures of MAP or M. bovis BCG to a final concentration of 104cell / ml and serially diluted to approximately 10° cell / ml. Blood cells were lysed using MolYsis™ Basic 5. Lysed blood was then processed through the Actiphage® assay and DNA lysate detected with LAMP.
[0230] Analytical specificity testing
[0231] Non-target bacteria were tested in each LAMP assay to assess specificity. For each bacterial species, one colony was harvested and subjected to crude DNA extraction (boiling at 95°C for 10 min). Then 5 μl of DNA was used as the template and tested in MTBC, MAP and M. bovis LAMP assays.
[0232] LAMP product visualisation
[0233] Fluorescence was measured in real-time and melt-curve analysis was performed using the on-board Genie® II software (OptiGene Limited, UK). For colour reactions, 0.5 μl l,000X SYBR green 1 (Sigma- Aldrich) was added to the tube cap before amplification and was shaken after amplification. Relative colour was quantified by measuring the hue value in the Hue Value Saturation (HSV) model using a free Android app Color Grab™ (Loomatix Ltd). Images for analysis were captured using a Moto G5 Android phone (Motorola, USA). Amplification was then confirmed by gel electrophoresis using 10 pl product on a 2% TAE gel containing 0.01% GelRed (Sigma-Aldrich, USA) followed by UV-transillumination. PCR reactions
[0234] DNA samples from the phage lysate (5 pl) were used as template for amplification of signature sequences. Members of the MTBC were identified by IS6770-specific qPCR as described in Eisenach et al., 1990 (doi: 10.1093 / infdis / 161.5.977). MAP was identified by ISPOO-specific qPCR as described in Slana et al., 2009 (doi: 10.1016 / j.prevetmed.2009.02.020). All qPCR reactions were carried out using QuantiFast® SYBR green master mix (Qiagen).
[0235] Statistical analysis
[0236] LAMP florescence was analysed using Genie®Explorer V 2.0.7.11 (OptiGene Limited). Statistical analysis including Pearson’s correlation and Cohen’s kappa were performed using GraphPad Prism V 9.0.0 (GraphPad Software, USA). qPCR results were analysed using Bio-Rad CFX Maestro V 2.3 (Bio-Rad Laboratories).
[0237] Results
[0238] Optimisation of LAMP assays
[0239] Three separate LAMP assays were optimised targeting MTBC, M. bovis (RD4) and MAP. The optimal amplification temperature was found to be 66, 65 and 67.5°C, respectively (Table 2).
[0240] Table 2. Optimisation of LAMP temperature. Temperatures are displayed in degrees
[0241] Celsius (°C).
[0242] After optimisation with reaction enhancers (Table 3), all assays could detect 10° cell / ml and cut-off times were determined as 45, 80 and 45 min, respectively. Table 3. Optimisation of LAMP enhancers. Time to detection (MM:SS). LF, loopforward; LR, loop-reverse.
[0243] LAMP assay readout methods
[0244] LAMP assays can be read in different ways. Gel electrophoresis, real-time flurorescence and colorimetric detection were each assessed. Gel electrophoresis produced laddering typical of the LAMP amplified DNA products. Using real-time fluorescence, the accumulation of fluorescent signal (FAM) was produced at each dilution and measured using a fluorimeter. Using colourimetric detection, a colour change from green to orange was seen in the presence of all dilutions of mycobacteria DNA. The limit of detection (LOD) when using gel electrophoresis, real-time fluorescence and colourimetric detection were all the same (Figure 1), although quantification was not possible with the colourimetric method. Compared to published MTBC, RD4 and MAP PCR primer sets, the LAMP reactions were, respectively, 1000-, 1000- and 10,000-fold more sensitive (Figure 1). The colourimetric readout was selected as the most appropriate, and a positive or negative output was adopted. Analytical LAMP specificity
[0245] The optimised LAMP assays were tested with DNA from non-target bacterial species to determine analytical specificity. The results in Table 4 show there was no nontarget amplification in the MTBC, MAP or M. bovis assays.
[0246] Table 4. Analytical specificity of LAMP assays. Use of Actiphage® without DNA sample cleaning and concentration
[0247] To develop the Actiphage®-LAMP assay, the effect of the cleaning and concentration step was examined first. There was a strong positive correlation between ct values of the crude and the “cleaned and concentrated” M. bovis BCG samples (r2= 0.96, 99% CI = 0.5 to 0.99). The trend was consistent with the corresponding values obtained for the MAP samples (r2= 0.99, 99% CI = 0.69 to 0.99). After removing the cleaning and concentration step, the ct thresholds were unchanged, as were the analytical sensitivities. Actiphage® endpoint comparison between qPCR and LAMP
[0248] After the cleaning and concentration step was removed from the Actiphage® assay, the effect of changing the endpoint from qPCR to LAMP was assessed. When the MTBC LOD of the two methods were compared, there was a perfect correlation (K = 1, 95% CI = 1 to 1). This trend was consistent with MAP samples. There was no impact on LOD when changing to the LAMP endpoint. However, LAMP allowed a faster time to detection while qPCR could be used quantitatively.
[0249] Testing Actiphage®-LAMP in artificially inoculated blood
[0250] To evaluate the assay’s performance in clinically relevant sample types, mycobacteria were spiked into blood and processed using the Actiphage®-LAMP assays. The MTBC, RD4 and MAP assays were each able to detect 101cell / ml in blood. In all LAMP assays, the spiking of blood increased the TOD and reduced the LOD 10-fold. Because of the increase in TOD, assay cut-off times were increased by 15 min. When used with blood samples, the MTBC, RD4 and MAP assays used cut-off times of 60, 90 and 60 min, respectively.
[0251] Actiphage®-LAMP clinical evaluation
[0252] Clinical blood samples were obtained from people suspected of having TB and their close contacts from a low TB burden setting. Each sample had undergone interferon gamma release assay (IGRA) reference testing and were then processed through the Actiphage®-LAMP assay. The inventors were blinded to their IGRA status until data analysis. Of the 19 samples tested, eight (42.1%) were positive and eleven (57.9%) were negative by IGRA, whilst six (31.6%) were positive and thirteen (68.4%) were negative by Actiphage®-LAMP. There was moderate agreement between the two methods (K = 0.49, 75 %).
[0253] Discussion
[0254] LAMP Optimisation
[0255] LAMP enhancers showed contradictory findings to those which have previously been shown to lower amplification temperatures. Urea and phosphorothioation of primers have been reported to lower amplification temperature. However, this was not observed in the inventors’ experiments, possibly owing to the longer amplification time used. Alternatively, the high GC content of the MTBC and MAP Flc and Bic primers may influence the stability of the foldback hairpin structures.
[0256] Including DMSO improved both the time to detection and limit of detection (LOD). Because LAMP is still in its infancy of development, less is known about chemical effects on amplification in comparison to PCR. Nevertheless, DMSO is known to affect PCR by making it more heat-labile, which destabilises the DNA structure and lowers denaturation temperature. It is unknown why DMSO improved the time to detection, but the inventors theorise that the same mode of action is true for LAMP.
[0257] Guanidine hydrochloride has been reported to improve time to detection. The inventors found that it acted as an inhibitor in MTBC and MAP assays but improved time to detection in the RD4 assay without affecting analytical sensitivity or specificity. Speculated to improve base pairing between primers and target sequences, the increased length of RD4 FIP and BIP primers (in comparison to MTBC and MAP), may explain this effect.
[0258] LAMP development
[0259] The specificity of the assay comes from two aspects. First, D29 bacteriophage only infects and lyses mycobacterial hosts. Therefore, DNA from non-mycobacteria should only be present in low amounts. Second, the inventors show that the LAMP assays only amplify the targeted insertion sequences (Table 5). The original reporting of the MAP LAMP assay by Trangoni el aL 2015 (doi: 10.1590 / S1517-838246220131206), did not examine specificity. Here, it is demonstrated that MAP LAMP is specific. Furthermore, the range of bacterial species for which MTBC LAMP is known to not produce false positives has been expanded beyond those originally reported by Aryan et al., 2010 (doi: 10.1016 / j .micres .2009.05.001).
[0260] The time to detection (positive LAMP result) was lengthened when tested in artificially inoculated blood. This suggests that some components of blood inhibit the LAMP assay, a common finding in PCR, but less frequently associated with LAMP reactions. Though LAMP has been reported to be tolerant to inhibition, it is not impervious to inhibition.
[0261] Different LAMP readouts were explored (Figure 1). Whilst all readouts had the same analytical sensitivity, the inventors decided to adopt the colourimetric readout. Indeed, a workflow with as little equipment as possible was preferable. The use of SYBR green dye added at the end of a LAMP assay is well established in the art. However, the need to open the reaction vessel at the end of the assay introduces the possibility of crosscontamination. To circumvent this limitation, the inventors utilised a method in which dye is added to the reaction vessel cap before the reaction begins and mixed by shaking when finished.
[0262] Actiphage®-LAMP
[0263] The first step when incorporating the optimised LAMP assay into the Actiphage® assay was to remove the cleaning and concentration step. There was no difference between the crude sample and the “clean and concentrate” sample (Figure 2), possibly because the samples were inoculated in media. The use of the LAMP endpoint allowed the inventors to remove the cleaning and concentration step without potentially reducing sensitivity due to inhibition by other components in the sample.
[0264] When colourimetric LAMP was used instead of qPCR, there was a trade-off with an improved TOD but an inability to be used quantitatively. However, portable LAMP amplification equipment is currently the focus of great interest, and these technologies can bring the Actiphage® assay closer to the end-user and combine well with the colourimetric output.
[0265] Clinical evaluation of Actiphage®-LAMP
[0266] With any novel LAMP assay, it is important to demonstrate its use with clinically relevant samples. The inventors have shown not only an NAAT endpoint but also the full upstream sample processing, thus demonstrating a complete diagnostic and the usefulness of the test in real world settings.
[0267] Clinical samples were used to demonstrate the assay as a proof-of-concept. The Cohen’s kappa analysis indicated moderate agreement with the IGRA. The difference in agreement could be because the cohort of samples included index cases and their close contacts. IGRA is an immunological test and detects exposure, not infection, whilst the Actiphage®-LAMP directly detects viable circulating mycobacteria.
[0268] Consideration of the Actiphage®-LAMP method
[0269] The WHO have called for new molecular diagnostics that can be used close to the point-of-care from samples other than sputum. The Actiphage®-LAMP assay meets this call. Detecting mycobacteria from blood allows ex -pulmonary TB to be diagnosed, a group often missed by current diagnostics.
[0270] The speed of detection by Actiphage®-LAMP is limited by the 3.5 h incubation during the Actiphage® step. This is due to the D29 replication cycle, which is seemingly unavoidable. The 5.5 h time to detection of Actiphage®-LAMP does not preclude its application in district level laboratories and still allows results to be relayed within a working day.
[0271] The cost of Actiphage®-LAMP is estimated at 12.45 USD per test (Table 6), which is above the WHO’s recommended 5 USD per test for a human TB test and is expected to be lowered further by the commercialisation of the technology. Whilst the price does not include infrastructure cost, this cost is expected to be low because the reaction can be performed on a heat block or water bath, whilst the colourimetric output removes any need for expensive detection equipment.
[0272] Table 6. Price per Actiphage®-LAMP test.
[0273] The landscape of current TB tests and how Actiphage®-LAMP adds to this mosaic is shown in Table 7.
[0274]
[0275] Using LAMP as an endpoint instead of qPCR has several advantages. Time to detection is faster, a constant power source is not required, equipment is cheaper and portable, colour readouts are easier to interpret than cq values, and a cleaning and concentration step is not needed. These benefits are not at the expense of sensitivity or specificity, and represents a move closer to the point-of-care that is more applicable in low and middle-income countries. Actiphage®-LAMP now fulfils more of the ASSURED criteria than equivalent qPCR-based methods.
[0276] Example 2
[0277] Materials and methods
[0278] Strains and culture
[0279] Laboratory strains of mycobacteria used in this study were M. smegmatis (mc2155), M. bovis BCG (Pasteur), Mycobacterium avium subsp. paratuberculosis (MAP) strain (ATCC 19698) and a MAP goat strain (clinical isolate). Both M. bovis and MAP were maintained in liquid culture on Middlebrook 7H9 (Sigma- Aldrich) and solid culture 7H10 (Sigma-Aldrich) agar, both supplemented with OADC (PBD Biotech Ltd). For long-term storage, MAP was grown on Herrold Egg Yolk medium slants (BD) and M. bovis was grown on Lowenstein- Jensen medium slants (BD). All liquid cultures were incubated at 37°C with shaking (200 rpm). Liquid cultures of MAP were supplemented with mycobactin J (2 pg / pl; IDVet). Cultures were confirmed as MAP or a member of the Mycobacterium tuberculosis complex by end-point PCR targeting IS900 or IS6 / / 0 genetic elements, respectively. Bacteriophage D29 (PBD Biotech Ltd) was used to infect mycobacteria. When performing phage assays, Middlebrook 7H9 media was modified with 2 mM CaCL and OADC to make 7H9(+). Non-mycobacterial strains used in specificity testing (see “Analytical specificity” section) were grown on BHI agar (Sigma- Aldrich).
[0280] Enumeration of mycobacteria
[0281] To determine the concentration of mycobacteria in liquid culture, the enumeration method was carried out according to Swift et al., 2016 (doi: 10.1080 / 21505594.2016.1191729). Briefly, cultured mycobacteria were mixed with D29 bacteriophage (approximately 108pfu / ml) and incubated at 37°C for 1 h, allowing the bacteriophage to bind and infect mycobacteria. Extracellular bacteriophages were inactivated with virucide (ferrous ammonium sulfate, 10 mM; PBD Biotech Ltd) for 5 min and samples were mixed with approximately 109M. smegmatis and 5 ml molten 7H10 agar. Mycobacterial cell number was determined by counting plaques on the M. smegmatis reporter lawn (recorded as pfu / ml).
[0282] Phage titre
[0283] To determine the pfu / ml of liquid phage stocks, a titre was performed. The phage stock was serially diluted along a ten-fold gradient of 7H9(+). Dilutions were mixed with 5 ml 7H9(+), 1 ml M. smegmatis (a reporter organism) and 6 ml 7H10. The phage LOG was calculated by counting the number of plaques on the reporter lawn.
[0284] Bacteria isolation from blood
[0285] To isolate the bacteria from blood, a truncated processing method based on the MolYsis™ Basic 5 (Molzym GmbH & Co. KG) was used. Briefly, whole blood (up to 5 ml) was mixed with buffer CM (2 ml) and vortexed for 15 s. The sample was left on the bench at ambient temperature for 5 min. Buffer DU (2 ml) and MolDNase (10 pl) was added to the sample and vortexed for 15 s. The sample was incubated on the bench for 15 min at ambient temperature, before centrifugation (9500 x g; 10 min). The supernatant was removed and the pellet was resuspended in 1 ml Actiphage media. The sample was then centrifuged (13000 x g; 3 min) before use in the Actiphage® assay.
[0286] Ultrapure water was also used to lyse blood cells. 5 ml ultrapure water was added to whole sheep blood (up to 5 ml; Oxoid) and vortexed for 15 s. The sample was left on the bench for 5 min before use in the PhMS-LAMP assay.
[0287] Actiphage® assay
[0288] The Actiphage® assay was carried out according to Swift et al., 2020 (doi: 10.1111 / 1751-7915.13518). Before the assay, PBMCs were extracted using MolYsis™ Basic 5. Briefly, the processed samples were suspended in 100 μl Actiphage reagent (100 pl) and incubated for 3.5 h at 37°C. Following incubation, the lysate was centrifuged (13,000 x g; 3 min) in the Rapid tubes. The filtrate was then cleaned and concentrated (Monarch® PCR & DNA Cleanup Kit (5 pg), New England Biotech) prior to DNA elution using 10 μl (double loaded) molecular-grade water (55°C) instead of elution buffer. The eluted DNA was used as template DNA for nucleic acid amplification.
[0289] Binding of bacteriophage to paramagnetic bead
[0290] 150 mg of 1 pm BcMag™ Tosyl-activated magnetic beads (Bioclone) were resuspended in 1.5 ml isopropanol (99.9%; Sigma-Aldrich) to create a stock solution of beads at 100 mg / ml. Then, 10 mg (100 pl) of re-suspended beads were washed with 1 ml 0.1 M sodium bicarbonate (Sigma-Aldrich) buffer (pH 9.5), vortexed briefly and placed on a magnetic separator for 3 min, before the supernatant was removed. The wash step was repeated three times. Washed beads were re-suspended in 1 ml of approximately 108pfim / ml phage (diluted in sodium bicarbonate pH 9.5). This was continuously mixed for 12 h at 37°C, 30-40 rpm on a Stuart rotator mixer (Cole-Parmer). The beads were then washed three times with sodium bicarbonate, without vortexing between washes. Beads were then re-suspended in 1 ml PBS pH 7.4 and incubated at room temperature for 1 h. The prepared beads were then stored at 4°C.
[0291] Optimisation of phagomagnetic capture
[0292] An experiment was designed to optimise the capture of mycobacteria by phagebeads. Three different types of phage-bead were tested: D29, TM4 and combination (D29 + TM4). Alongside these different preparations, the method of mixing was tested, in particular, vertical (on a Stuart rotator mixer, 40 rpm) and horizontal (on an orbital mixer 200 rpm) mixing. Simultaneously, the length of mixing was tested at 30 min and 45 min. Firstly, 15 μl phage-beads were added to 1 ml mycobacteria of an enumerated concentration and incubated at 37°C during the test conditions. Afterwards, the supernatant was removed and DNA was crudely extracted (boiling at 95°C for 10 min). This DNA lysate was later used in qPCR detection.
[0293] Phagomagnetic capture efficiency
[0294] The efficiency of mycobacteria capture by phage-beads was assessed. Mycobacteria of a known concentration were diluted in 7H9(+) or whole sheep blood (previously lysed using ultrapure water) to a concentration of 101cell / ml. Then, 15 pl phage-beads were added to each dilution and incubated at 37°C in the conditions found optimal from the optimisation experiments. The supernatant was then extracted and enumerated.
[0295] Analytical sensitivity
[0296] The limit of detection (LOD) of PhMS-qPCR and PhMS-LAMP was determined initially by enumerating cultured mycobacteria and then serially diluting to a final concentration of 10° cell / 5 pl. These dilutions were processed through the PhMS assay and DNA lysates were amplified using qPCR or LAMP.
[0297] Loop-mediated isothermal amplification
[0298] DNA samples from PhMS lysate (5 pl) were used as template for amplification of signature sequences as described in Example 1. Members of the MTBC were identified by IS6770-specific LAMP as described in Aryan et al., 2010 (doi: 10.1016 / j.micres.2009.05.001). MAP was identified by ISPOO-specific LAMP as described in Trangoni et al., 2015 (doi: 10.1590 / S1517-838246220131206). M. bovis was identified by RD4-specific LAMP as described in Kapalamula et al., 2021 (doi: 10.1371 / joumal.pntd.0008996).
[0299] PCR reactions
[0300] DNA samples from the phage lysate (5 pl) were used as template for amplification of signature sequences. Members of the MTBC were identified by IS6770-specific qPCR as described in Eisenach et al., 1990 (doi: 10.1093 / infdis / 161.5.977). MAP was identified by ISPOO-specific qPCR as described in Slana et al., 2009 (doi: 10.1016 / j.prevetmed.2009.02.020). All qPCR reactions were carried out using QuantiFast® SYBR green master mix (Qiagen).
[0301] Statistical analysis
[0302] LAMP florescence was analysed using Genie®Explorer V 2.0.7.11 (OptiGene Limited, UK). qPCR results were analysed using Bio-Rad CFX Maestro V 2.3 (Bio-Rad Laboratories, USA).
[0303] All statistical tests were performed using GraphPad Prism V 9.0.0 (GraphPad Software, USA). Results: Development of Phagomagnetic separation
[0304] Binding of bacteriophage to beads
[0305] The binding of bacteriophage to tosyl-activated magnetic beads was achieved with a high efficiency (Figure 4). TM4 phage bound with the highest efficiency, with 99.99% (SD ± 0.006) of the phage incubated binding to the magnetic beads. Similar efficiency was observed for the combination of D29 and TM4 phage at 99.99% (SD ± 0.005), and for D29 phage, alone, at 99.96% (SD ± 0.057). Across experiments, TM4 bound with a higher efficiency than D29. Subsequent washes removed all extracellular phage when TM4 phage and the combination phage were used. However, free D29 phage remained in the supernatant of the phage-beads at a mean concentration of 6.75 x 102pfu / ml. There was a mean ratio of 3 : 1 phage per bead in D29, TM4 and D29 + TM4 phage-beads.
[0306] The binding of phage to bead was confirmed (Figure 5). After phage-beads were plated on agar, plaque morphology was compared (comparison by size; D29 large plaques vs. TM4 pin-prick plaques). This analysis confirmed typical D29 and TM4 plaques, which was then corroborated by plaque PCR for D29 (360 bp product) and TM4 (440 bp product). Plaques formed by the combination beads were positive for both TM4 and D29 by PCR.
[0307] Optimisation of mycobacterial capture
[0308] Central to the success of phagomagnetic separation is the initial capture of mycobacteria. A series of experiments were designed to optimise mycobacterial capture by phage-beads (Figure 6). These results show that orientation of mixing is the most important factor. Indeed, the difference in capture between horizontal and vertical mixing was statistically significant (p = 0.027). Whilst using vertical mixing, the subsequent optimisation experiments did not impact the success of mycobacterial capture. Therefore, when performing phagomagnetic separation, phage-beads were mixed vertically with the sample for 30 min.
[0309] After the capture of mycobacteria by phage-beads was optimised, the capture efficiency of these phage-beads was assessed (Figure 7). This assessment showed that as the concentration of mycobacteria lowered the percentage of mycobacteria captured by phage-beads increased. The effect was consistent in M. bovis BCG and MAP, and in media and artificially spiked whole blood. Additionally, when the capture of phage-beads was evaluated in artificially spiked whole blood, the capture efficiency increased; a trend seen in both M. bovis BCG and MAP. The D29 + TM4 phage-beads captured more MAP and M. bovis BCG than either of their individual counterparts. Indeed, there was a statistically significant difference between the level of capture and the type of phage (including combination) bound to the magnetic bead (p = 0.022).
[0310] D29 phage-beads could capture a mean of 36.78% (SD ± 4.62) MAP in media, 82.45% (SD ± 13.63) MAP in artificially spiked whole blood, 61.08% (SD ± 14.34) M. bovis BCG in media, and 66.15% (SD ± 7.28) M. bovis BCG in artificially spiked whole blood. TM4 phage-beads could capture a mean of 30.39% (SD ± 7.86) MAP in media and 49.38% (SD ± 7.12) M. bovis BCG in media. The D29 + TM4 phage-beads captured a mean of 55.94% (SD ± 16.17) MAP in media and 72.91% (SD ± 6.06) M. bovis BCG in media.
[0311] Results: Development of PhMS-LAMP
[0312] Whole blood lysis
[0313] To develop PhMS into a complete diagnostic, a sample processing step before phagomagnetic capture was needed to extract mycobacteria from circulating peripheral blood mononuclear cells. The lytic ability of blood lysis buffers was investigated (Figure 8). A 5: 1 blood to chaotropic buffer (MolYsis™ Basic 5) ratio and 1 : 1 blood to ultrapure water ratio were found to exhibit equivalent capacity in lysing whole blood. The 1 : 1 blood to ultrapure water ratio was used in the final workflow.
[0314] PhMS and Actiphage® qPCR comparison
[0315] To evaluate the capture and lytic ability of PhMS, this method was compared against a contemporary phage-based diagnostic, Actiphage® (Figure 9). The two methods were shown to be equivalent. Indeed, there was a strong positive correlation between PhMS and Actiphage® when tested using M. bovis (r2= 0.99, 99% CI = 0.40 to 1.00, / ? = 0.0025) and when tested using MAP (r2= 0.98, 95% CI = -0.34 to 0.99, / ? = 0.01). Both methods could detect 10° cell / 5 μl M. bovis and MAP.
[0316] PhMS-qPCR and PhMS-LAMP analytical sensitivity
[0317] To explore the applicability of different detection endpoints, the limit of detection of LAMP was compared with the limit of detection of qPCR. These experiments showed that LAMP and qPCR were equivalent when media was processed through the PhMS assay; however, when artificially spiked whole blood was processed through the PhMS assay, qPCR failed to detect any concentration of mycobacteria, unlike LAMP which could reliably detect down to 101cell / 5 μl. PhMS-LAMP analytical specificity To explore the analytical specificity of the PhMS-LAMP assay, a range of non- target and non-mycobacterial species were processed through the assay (Table 8). No non- target species were detected using either the MTBC, MAP or RD4 PhMS-LAMP assays. Table 8. Analytical specificity of PhMS-LAMP. Table 9. Clinical sensitivity and specificity of PhMS-LAMP.
[0318] Discussion
[0319] Development of phagomagnetic separation
[0320] The development of the PhMS-LAMP assay began by evaluating the binding of the phage to tosyl-activated paramagnetic beads. The inventors theorised that the high efficiency of binding observed was attributed to the large and smooth capsid heads of D29 and TM4, which present amine groups with high availability and thus allow covalent bonding. Additionally, the phage titre in the initial binding step was lower than many other approaches in the prior art and very high binding efficiencies were achieved because of it. The inventors aimed to demonstrate that the capture and lysis of mycobacteria was due to phage-bead complexes and not free phage in the supernatant of the phage-bead preparations. This was demonstrated by the successive wash steps and low supernatant titre at the end of preparations.
[0321] The type of phage on each bead was confirmed and it was demonstrated for the first time that two different phage types can be bound to the same magnetic bead. Again, low titres of phage were used in the binding steps, which may keep binding sites free for other phage types to bind.
[0322] The optimisation of capture highlighted the importance of sample mixing. The vertical mixing method increased the possible phage-bead to mycobacteria interactions, resulting in higher capture. Moreover, the higher kinetic energy passed into the sample may improve the chances of successful phage attachment to its host receptor. Example 3 - Comparison of qPCR and LAMP endpoints for PhMS
[0323] Materials and methods
[0324] 5 ml defibrinated sheep blood (Oxoid Ltd, UK) was lysed using the water lysis protocol described above. M. bovis BCG and MAP cultures were serially diluted 10-fold from 104to 10° cell / 5 μl and spiked into the lysed blood samples. PhMS was performed on all blood samples and another set of M. bovis BCG and MAP cultures that were serially diluted 10-fold from 104to 10° cell / 5 μl in bacterial growth media 7H9(+). No clean up or concentration steps were performed on the PhMS lysate. The PhMS lysates were used as template in qPCR and LAMP reactions. Time to detection and limit of detection were then compared.
[0325] Results and discussion
[0326] The time to detection and limit of detection of qPCR and LAMP were compared using whole blood samples. Tables 10 and 11 show the inhibitory effect of whole blood on qPCR and LAMP when detecting M. bovis BCG and M. paratuberculosis (MAP), respectively, in whole blood.
[0327] Table 10. qPCR and LAMP detection of M. bovis BCG in whole blood. Data were generated in triplicate and the numbers in parentheses show the number of samples that detected their target out of the three replicates. qPCR data are given a Ct value. LAMP data are shown as time-to-detection.
[0328] M. bovis BCG Table 11. qPCR and LAMP detection of M. paratuberculosis (MAP) in whole blood.
[0329] Data were generated in triplicate and the numbers in parentheses show the number of samples that detected their target out of the three replicates. qPCR data are given a Ct value. LAMP data are shown as time-to-detection.
[0330] In media, both qPCR and LAMP could detect M. bovis BCG and MAP up to a concentration of 10° cell / 5 pl. LAMP could consistently detect M. bovis BCG and MAP in spiked blood samples with a reduced sensitivity, up to 101cell / 5 pl. However, qPCR could not detect any M. bovis BCG and MAP in spiked blood samples. This was attributed to nucleic acid amplification inhibitors present in the blood sample that inhibited qPCR. LAMP is more resistant to this inhibition.
[0331] Example 4 - Effect of removing magnetic separation and adding filtration to PhMS- LAMP
[0332] Materials and methods
[0333] 1 ml MAP cultures were serially diluted 10-fold from 104to 10° cell / 5 μl before being incubated with 15 μl D29 and TM4 phage-beads at 37°C for 3.5 h. The sample was exposed to a magnet for 3 min. 5 μl supernatant was used as template in LAMP.
[0334] 1 ml MAP cultures were serially diluted 10-fold from 104to 10° cell / 5 μl before being incubated with 15 μl D29 and TM4 phage-beads at 37°C for 3.5 h. The samples were loaded into Actiphage® filter tubes (0.22 pm pore size) and centrifuged at 13,000 x g for 3 min. Filtrate was used as template in LAMP. Another 10-fold serial dilution of MAP was processed with phage-LAMP as described above and used as a control. Results and discussion
[0335] Both phage-LAMP and PhMS (without magnetic separation) were able to detect 10° cell / ml, whereas PhMS (with filtration) could detect up to 101cell / ml (Figure 11). This reduction in sensitivity was attributed to the trapping of DNA in the filter column.
[0336] Example 5 - Detection of MTBC and MAP from clinical samples using PhMS-LAMP
[0337] Materials and methods
[0338] Blood samples were collected in 10 ml lithium heparin blood tubes (BD, USA). 3 ml blood was processed using the water lysis protocol described above. PhMS was performed using 45 μl D29 and TM4 phage-beads. 5 μl lysate was used as template in an IS6770 LAMP reaction (for human samples) or an IS900 LAMP reaction (for bovine samples).
[0339] Results and discussion
[0340] The PhMS-LAMP assay detected viable MTBC in 70% (7 / 10) of TB contacts that were recently exposed to M. tuberculosis (Table 12).
[0341] Table 12. IGRA and PhMS-LAMP results carried out on blood of ten TB contacts that were recently exposed to M. tuberculosis. The PhMS-LAMP assay also detected viable MAP in cattle samples (Table 13). Samples were collected from eight cattle considered to be positive for Johne’s based on red ELISA results, ten cattle considered at risk based on amber ELISA results, and twelve cattle considered negative based on green ELISA results. The PhMS-LAMP assay detected viable MAP in ten samples. In particular, five out of eight ELISA-red cattle were confirmed positive, five out of ten ELISA-amber cattle were confirmed positive, and no ELISA-green cattle were confirmed positive for MAP. It is possible that the three ELISA- red cattle and the five ELISA-amber cattle that were not confirmed positive for MAP did not in fact have live MAP infections but rather had residual antibodies generated from a previous MAP infection. This could explain why these cattle tested ELISA-red or ELISA- amber but did not yield a positive result using the PhMS-LAMP assay.
[0342] Table 13. PhMS-LAMP assay results of thirty blood samples from cattle that had their Johne’s disease status determined via routine blood ELISA.
[0343] These results show that the PhMS-LAMP workflow can be used to detect mycobacteria from clinical samples.
[0344] Example 6 - Differentiation of INH-resistant and -susceptible M. tb
[0345] Materials and methods
[0346] M. bovis was processed with the PhMS assay using D29 and TM4 phage-beads. 5 μl 103M. bovis PhMS lysate or 5 μl 103genomic copies of an isoniazid-resistant H37Rv M. tb strain TMC 303 (ATCC® No. 35822™) were used as template in a published isoniazid-resistant LAMP assay (Altattan et al., 2024 (doi: 10.1038 / s41598-024-55289-x)). The LAMP assay contained 1.6 pM FIP / BIP (SEQ ID NOs: 23 and 24), 0.2 pM F3 / B3 (SEQ ID NOs: 25 and 26), 0.6 pM FLP / BLP (SEQ ID NOs: 27 and 28), lx LAMP fluorescent dye (New England Biolabs, USA), lx WarmStart® Multi-Purpose LAMP / RT- LAMP 2X Master Mix (with UDG) (New England Biolabs, USA), and the 25 μl reaction volume was completed with molecular-grade water. The LAMP assay was heated at 65 °C for 60 min and fluorescence readings were taken every 15 s using Genie® II (OptiGene Limited, UK).
[0347] Results and discussion
[0348] The wild-type KatG gene (carried by BCG) was differentiated from the isoniazidresistant mutant gene (carried by M.tb 303) using the KatG LAMP assay (Figure 12). The difference in mean time-to-detection informed which gene target was detected (wild-type vs. mutant). The results demonstrate that alternative LAMP endpoints can be used after the PhMS assay to inform characteristics of the sample, such as isoniazid resistance. Example 7 - PhMS-LAMP detection of mycobacteria spiked into cerebrospinal fluid, sputum or urine
[0349] Materials and methods
[0350] MAP
[0351] 3 ml artificial cerebrospinal fluid (CSF), sputum or urine (Biochemazone, CA) was treated with saponin sodium cholate to lyse eukaryotic cells. MAP cultures were serially diluted 10-fold from 104to 10° cell / ml and spiked into the artificial sample. PhMS (using D29 and TM4 phage-beads) was performed on all artificial samples and another set of MAP cultures, which were serially diluted 10-fold from 104to 10° cell / ml in bacterial growth media 7H9(+) treated with saponin sodium cholate. 5 μl PhMS lysate was used in the IS900 LAMP assay.
[0352] M. bovis
[0353] 3 ml artificial CSF, sputum or urine (Biochemazone, CA) was treated with saponin sodium cholate to lyse eukaryotic cells. M. bovis BCG cultures were serially diluted 10- fold from 103to 10° cell / ml and spiked into the artificial sample. PhMS (using D29 and TM4 phage-beads) was performed on all artificial samples and another set of M. bovis BCG cultures, which were serially diluted 10-fold from 103to 10° cell / ml in bacterial growth media 7H9(+) treated with saponin sodium cholate. 5 μl PhMS lysate was used in the IS6770 LAMP assay.
[0354] Results and discussion
[0355] MAP
[0356] Compared with the media and lysis buffer control, CSF delayed time-to-detection but did not impact assay sensitivity (Figure 13). Sputum had little effect on the average time-to-detection and no effect on sensitivity of the PhMS-LAMP assay, compared with the media and lysis buffer control (Figure 14). Similarly, urine decreased time-to-detection but did not impact sensitivity (Figure 15). M. bovis
[0357] CFS and urine had little impact on time-to-detection (Figures 16 and 18). However, sputum showed an increase in the time-to-detection with no effect on sensitivity (Figure 17). 10° cell / ml M. bovis BCG was detected in CFS, urine and sputum but not the media and saponin lysis buffer control. This was attributed to the lysis buffer damaging or destroying mycobacteria cells, an effect that was likely mitigated by the complex matrix found in the sample types tested. CSF, sputum and urine likely acted as a buffer to prevent damage to mycobacteria caused by the lysis buffer.
[0358] CSF is an important sample type in TB meningitis, which is a traditionally difficult manifestation of TB to detect. Sputum is frequently used to detect pulmonary TB and this work demonstrates that use of the PhMS-LAMP assay to detect mycobacteria in CSF and sputum is possible. Urine is a sample type that is only used in frontline TB testing, and few commercial assays target this sample type. Demonstrating that urine could be used as a sample type expands the use cases of the PhMS-LAMP assay.
[0359] Example 8 - Detection of MAP using PhMS and lyophilised LAMP reactions
[0360] Materials and methods
[0361] 20 μl lyophilised beads were made using 1 x WarmStart® Multi-Purpose LAMP / RT-LAMP 2X Master Mix (with UDG) (New England Biolabs, USA), lx LAMP fluorescent dye (New England Biolabs, USA), 1 x IS900 primer master mix (FIP / BIP 1.6 pM, F3 / B3 0.16 pM, FLP / BLP 0.8 pM), 10 x trehalose (IM) 37.8% w / v ml, and the volume was completed with molecular-grade water. MAP cultures were serially diluted 10-fold from 104to 10° cell / ml and processed with PhMS. 5 μl PhMS lysate was used as template. Before template addition, the lyophilised beads were resuspended with 20 pl molecular-grade water. Template DNA was then added before performing the LAMP reaction.
[0362] Results and discussion
[0363] The need of a cold chain to transport assay reagents is not typically possible in the areas where mycobacterial tests are needed. To enable the PhMS-LAMP assay to operate close to the point-of-care, the LAMP assay was successfully lyophilised. There was an increase in time-to-detection and a reduction in sensitivity (Figure 19). However, the lyophilisation procedure allows the LAMP reagents to be stored at room temperature and above, without affecting assay performance.
[0364] Example 9 - Confirmation of phage viability in phage-bead complexes
[0365] Materials and methods
[0366] D29 phage-beads were exposed to ferrous ammonium sulphate (a known virucide) for 5 min and titred. The plaque-forming units / ml (pfu / ml) were compared against a D29 phage-bead titre that was not treated with virucide.
[0367] Results and discussion
[0368] The reduction in pfu / ml indicates that viable phages were inactivated by the virucide (Figure 20). These data confirm that the phage bound to the magnetic beads used in the experiments described above are viable and are responsible for lysis.
[0369] Example 10 - Ability of PhMS to lyse mycobacteria
[0370] Materials and methods
[0371] 103cell / ml M. bovis BCG were incubated at 37°C with D29 phage-beads for 30 min. The supernatant was then phage titred (before MS). The sample was then exposed to a magnet for 3 min and the supernatant was removed. The magnetic beads were resuspended in 50 μl 7H9(+) and the supernatant was titred (after MS). The sample was incubated at 37°C for 3 h when the sample was exposed to a magnet for 3 min and the supernatant was titred (end of assay).
[0372] Results and discussion
[0373] The ability of phage-beads to lyse mycobacteria was investigated. In the phage life cycle, there is production of progeny phage before host lysis. The increase in phage in the supernatant at the end of the assay indicates the production and release of progeny phage (Figure 21). Example 11 - Inability of phage-beads to capture and lyse heat-inactivated BCG
[0374] Materials and methods
[0375] 103cell / ml M. bovis BCG were heated at 95°C for 10 min. D29 phage-beads were then added and incubated at 37°C for 30 min. The supernatant was then phage-titred (before MS). The sample was then exposed to a magnet for 3 min and the supernatant was removed. The magnetic beads were resuspended in 50 μl 7H9(+) and the supernatant was titred (after MS). The sample was incubated at 37°C for 3 h when the sample was exposed to a magnet for 3 min and the supernatant was titred (end of assay).
[0376] Results and discussion
[0377] As demonstrated in Figure 22, mycobacteria need to be viable in order to be infected by the phage-bead lysis agent and produce progeny phage.
[0378] Example 12 - Inability of magnetic beads without bound phage to capture BCG
[0379] Materials and methods
[0380] Using 103cell / ml of M. bovis BCG, the PhMS assay was performed using magnetic beads that do not have any bound phages. The number of M. bovis BCG cells in the supernatant were enumerated before and after magnetic separation.
[0381] Results and discussion
[0382] A lack of reduction in free mycobacteria before and after magnetic separation was observed (Figure 23). This shows that phages are needed to capture mycobacteria. SEQUENCE LISTING
[0383] SEQ ID NO: 1 tgaatcgccc cggcatgtcc ggagacctac tggtctgaga actcggcggt gtgctgagtt cggtggtgac ggtagtacag gccctcgcac tcggccggtg gcatgtcccc gcagtactcg tagatgcggc ggtggttgaa ccagtcaacc cattccaggg tggcgacttc gacctggtca acggtgcgcc acggcccctg ggccttgatc agttcggtct tgtaaagacc gttgatcgtc tcggccagcg cattgtcgta ggagttgccg gtggccccaa tcgaggcgtc gatgccggcc tcgagaagcc ggtcggtgaa cgcgatcgac gtgtactggc tgccgcgatc gttgtgatgg atcaacccgg tcagatccgt gatgccgtcg cggccacggg tccagatcgc gtgctcgatc gcatccacca ccaactgtga cgtcatggtc gttgcggtac gccaccccac gatgcggcgg gcgtaagcgt cgatcacgaa cgccacatac acccaccccg accacgtcga cacataggtg aagtcggcta cccacaacat atttggtgca ttaggactga aatgtcgccc aaccaggtca tcgggccgag cggcttgcgg gtcggcgatt gtggtgcgct tgaccttccc tctgcgtgct ccgtgcaggc cgagttcggc catcagccgt tcgacggtgc agcgggccac ctcgacgccc tcacggcggc actgaagcca taccttgcgc gctccgtaga ccgcgtagtt ctcgcggtgc acacgggcga tctcaacttt gagctcctct tcgcggacct ggcgcttgga gggctggctg cgccgggcgc aggcgtcgta gtaggtgtga ggttcccccc gggtggtgga catcgagata gcgggattct tggttccgct ggaaggatgt caccatgtcc cgaacccgcc ggtcgttcac gactgagtac aaggtcgagg ccgctcaccg agtcatcgac tccgggcgca ccatcgccga ggtcgcccgc gaactcggcc tcaatgaagg cctgctgggc cgctgggtcg ccgatgaacg tcgccgtgtt gaggccgccg cagcccgcaa cgacgaaccg ttgaccccgg ccgagcgcac cgaactgacg cgattacggc gccaagtcgc cgagcaagag aaagacatcg cgttcctgaa aaaagcctcg gcgtactttg ccgccaacgg accgaagtag accggttcga gctgatggcc gcagagtgcg ccaccaccgc gatcacccgc atggctcgcc tactggaggt gtcgacttcg ggttactaca aacatgcaca tcgttccact gcaacggaat tgactgatcg ccgccaacgc aaagccgatc tgaccgtgaa gatcatcacc catcaccgcg actccggcgg gacctacggc tcgccgcgga tcaccgctga cttgcgtgcc gcc
[0384] SEQ ID NO: 2 tccttacctt tcttgaaggg tgttcggggc cgtcgcttag gcttcgaatt gcccagggac gtcgggtatg gctttcatgt ggttgctgtg ttggatggcc gaaggagatt ggccgcccgc ggtcccgcga cgactcgacc gctaattgag agatgcgatt ggatcgctgt gtaaggacac gtcggcgtgg tcgtctgctg ggttgatctg gacaatgacg gttacggagg tggttgtggc cgacgacgcg cagcgattgc tctcgcagcg ggtggccaac gacgaggccg cgctgctgga gttgattgcg gcggtgacga cgttggccga tggaggcgag gtcacgtggg cgatcgacct caacgccggc ggcgccgcgt tgctgatcgc cttgctcatc gctgccgggc agcggctgct ttatattccc gggcgcacgg tccatcacgc cgcgggtagt taccgcggcg aaggcaagac cgacgccaaa gacgctgcga tcatcgccga tcaggcccgg atgcgccacg acttgcagcc tctgcgcgcc ggcgatgaca tcgcagtcga gctgcgcatc ctgaccagcc gacgttccga tctggtggct gatcggaccc gggcgatcga accgaatgcg cgcccagctg ctggaatact ttcggcgctg gaacgcgcct tcgactacaa caagagccgt gccgcgctga tcctgcttac tggctaccaa actcccgacg cgctgcgcag cgccggtggc gctcgagtag ccgcgttctt gcgtaaacgc aaggcccgca acgccgatac cgtcgcagcc accgcgctgc aggccgctaa cgcccaacac agcatcgtgc ccggccaaca actggcggcc actgtggtgg cccgcctggc caaggaggtg atggccctcg acaccgaaat cggcgacacc gacgcgatga tcgaggagcg gggcgctgag ttcctcgccg ccaccggcgg ggacatggcc gcattcgcct ccgccgaccg cctcgccggc gtcgccggcc tggcgccggt accacgagat tccggccgca tcagcggaaa cctcaaacgc ccccgacgct acgaccggcg cctgctgcgc gcctgctacc tgtcggcctt ggtcagcatc cgcaccgacc cctcctcgcg cacctactac gaccgaaaac gcaccgaagg aaaacgccac acccaagccg tcctcgccct ggcccgccgc cgcctcaacg tcctgtgggc catgctgcgc gaccacgctg tctaccaccc cgcaaccact accgcggcgg cttgacaacg tcattgagaa t
[0385] SEQ ID NO: 3 tctggagttg cccgtgccta ccgtttcatg tattgcctgt gtcgtcggtt cgcgatgagg ttttcgaccg ctggagcctg gtgaacgcag cgagctcatc ggatcggagt ttctcgatgt gttggcctcg gtgccagacc cgagggaccc acgcggtcgg agttattcgc tgatggcttt gttggcgatc gcggttctgg ccactgccgc gaggatgccg tatgctggtt ttgccacatg ggcggccacc gcttccgatg atgtgttggc ccaattaggg gtccggttcc ggcggcccag tgagaagacc ttccgcgctg ttttgtctcg gctagacccc gccgacctca acgccaggat gggcagttac ttcactgcac acgtggccag cagcgacccc agtggattgg tgccgatcga gttggacggc aagaatgctg cgtggtgctt tacgcgccaa agcgacacca cgcacctcgt gtcggtgttc gcccaccgtg cccgattggt gctcggtcaa ctcgctgtcg ccgagaaaag caatgaaatt ccctgcgtac gtgccctgct cacgctgctg ccggataact tgcggtggct ggtcaccgtg gatgcgatgc atacccaggt cgtcaccgcg aagttgatct gcgccacctt gaagtcgcac tacctgatga tcgtcaagtc caaccaagcc aaaatacttg cccgtatcac cgcgctgccc tgggccgagg tgcccgcagc cgctaccgac gactcccgcg gccacggccg tgtcaagacc cgcaccctgc aaatcatcac cgctgcacga ggaatcggct tcccctacgc aaaacaaatc atccggatca ctcgtgaacg cttgatcacc gccaccgacc agcgcagcgt ggaggtggtc tatgccatct gcagcctgcc gttcgagcac gcccgcccta ctgcgatcat gacctggatg cgtcaacact gcggaatcga gaacagcctg cactggatac gcgacgtcac cttcgacgaa gaccgtcaca ggctacatac tggaaacggc gcacaggtcc tagcaacgcg acgcaacact gcgatcaatc tgcagccctc aacggcgccg acaacatcgc cgaagcctgc cggatcaccg ctttgaccgc caaccgccgc ctagacctcc tcaacccaca attccccagc tccgacgttg ttgattagca ggcttgtgag ctgggttgat gatctttggt gccgcgctat tggggccgca gtgtaggcac gggctatctg gag
[0386] SEQ ID NO: 4
[0387] GCTACTACGGCACGGCGCGCCCCGTAGCGTTACTGAGAAATTGCTGAAAAATGGCTATTGACCAGCTAAGATA
[0388] TCCGGTACGCCCGCGCCGCGGAGAGCGCCGTTGTAGGCCGCGAGCCAACCAGCACCGACTCGAGACGGTGCGC
[0389] CCACACCGCGCGCCACGCGGTTCGAGCCCAACGTCAGTGCACCCTCGCTATACTTCGCCAGCGTGTGCCGTAC
[0390] GTCCGCCGACCACCAGGCCACGACGGCCGACGGCCGGCGGGCACAGGCGATTCACGTTCGCCATCGCAATACC
[0391] CTTGCGGCCGCGCAGGAAAAGGGCCGACGGTGAGTCCCCAGCTTTGCCCCAAGGTGAGCATCGTCTCGACCAC
[0392] TCACAACCAGGCGGGCTACGCCCGTCAGGCCTTCGACAGCTTTCTCGACCAGCAAACCGACTTCCCGGTGGAG
[0393] ATCATCGTCGCCGACGACGCGTCGACCGATGCCACCCCGGCGATCATCCGTGAGTACGCCGAGCGGTACCCGC
[0394] ACGTGTTCCGGCCGATCTTCAGGACCGAAAACCTCGGCCTCAATGGGAACCTGACCGGCGCCCTGTCGGCCGC
[0395] TCGCGGCGAGTACGTCGCGTTGTGCGAGGCGGACGACTACTGGATCGATCCGCTGAAGCTAAGCAAACAGGTC
[0396] GCATTCCTCGACCGGCACCCCAAGACGACGGTGTGCTTCCATCCCGTCCGAGTGATATGGGAGGACGGCCATG
[0397] CCAAGGACTCGAAGTTCCCCCCGGTTCGGGTGCGGGGCAACTTGAGCCTGGATGCGTTGATCTTGATGAACTT
[0398] CATCCAGACCAACTCGGCCGTGTACCGTCGCCTCGAGCGCTACGACGACATTCCTGCCGACGTCATGCCCCTG
[0399] GACTGGTATCTGCACGTCCGGCACGCGGTGCATGGCGACATCGCCATGTTGCCCGACACCATGGCCGTGTATC
[0400] GCCGCCACGCCCAAGGCATGTGGCACAACCAGGTGGTGGACCCGCCAAAGTTCTGGTTGACGCAGGGTCCGGG
[0401] GCATGCGGCGACGTTTGACGCGATGCTCGACCTGTTCCCGGGAGACCCCGCGCGCGAGGAGCTCATCGCCGTC
[0402] ATGGCCGACTGGATCCTTCGCCAGATCGCCAACGTTCCAGGCCCGGAGGGGCGCGCCGCGCTGCAGGAAACCA
[0403] TCGCGCGCCATCCCCGGATCGCCATGCTGGCGCTGCAGCACCGCGGGGCGACACCCGCGCGGCGGCTCAAGAC
[0404] CCAGTGGCGCAAGCTCGCCGCCGCGACGCCGAGCCGCAGGGGGCTCGTGGATGTGTGGCCCTCCCGGCTCCGA
[0405] CGCGGCTGTCGAGCCTGACCATGTCGACAAACCCAGGACCAGCCGAAGGGGCTAACCAAGTGATGGCACAGGA
[0406] ACATTCGGCCGGCGCGGTACAATTCACCGCCCACAACGTTCGCCTCGACGACGGAACCTTGACGATACCGGAG
[0407] TCCTCGCGCACGTTAGACGAATCGTCCTGGTTCATCTCGGCGCGCGGGATTCTGGAAACCGTCTTTCCCGGGG
[0408] ACAAGAGCCACCTACGCCTGGCCGATGTCGGCTGCTTGGAAGGCGGGTACGCGGTCGGGTTCGCGCGCATGGG
[0409] ATTTCAGGTCCTCGGGATCGAGGTTCGCGAGCTGAACATGGCGGCCTGCAACTACATCAAATCGAAGACCAAC
[0410] CTGCCGAATCTCCGGTTCGTCCACGACAACGCCCTCAACATCGCCAACCACGGGCTCTTCGATACCGTCTTCT
[0411] GCTGCGGCCTCTTCTACCACCTGGAGAATCCGAAGCAATACCTGGAAACCCTCTCGTCGGTAACGAACAAGCT GCTGATTCTCCAGACGCACTTCTCGATCATCAACCGGAGCGATAAATGGCTCCGGTTGCCCACGACGGCACGA
[0412] CAATTGACCGATCGGTTGCTGCGGCGGCCGGCGCCGGTGAAGTTCATGCTCTCGGCGCCCACCGAACATGAGG
[0413] GACTTCCCGGTAGGTGGTTTACCGAGTTTTCCGACGACCGCTCGTTTGGCCAGCGCGACACCGCAAAATGGGC
[0414] GTCCTGGGACAATCGCCGGTCATTCTGGATTCAACGCGAGCACCTACTTCAGGCCATCAAAGACGTCGGCGTC
[0415] GACCTGGTGATGGAGGAGTACGACAACTTGGAACCAAGCATCGCCGAGTCGTTGCTCGGAGGTTCCTATGCGG
[0416] CGAATCTTCGAGGCACCTTCATCGGTATCAAGACCCGGTGATCCACAATCGCCGCCAGCAACCTAGGGGAACT
[0417] CGGTGACGTCTGCTCCGACCGTCTCGGTGATAACGATCTCGTTCAACGACCTCGACGGGTTGCAGCGCACGGT
[0418] GAAAAGTGTGCGGGCGCAACGCTACCGGGGACGCATCGAGCACATCGTAATCGACGGTGGCAGCGGCGACGAC
[0419] GTGGTGGCATACCTGTCCGGGTGTGAACCAGGCTTCGCGTATTGGCAGTCCGAGCCCGACGGCGGGCGGTACG
[0420] ACGCGATGAACCAGGGCATCGCGCACGCATCGGGTGATCTGTTGTGGTTCTTGCACTCCGCCGATCGTTTTTC
[0421] CGGGCCCGACGTGGTAGCCCAGGCCGTGGAGGCGCTATCCGGCAAGGGACCGGTGTCCGAATTGTGGGGCTTC
[0422] GGGATGGATCGTCTCGTCGGGCTCGATCGGGTGCGCGGCCCGATACCTTTCAGCCTGCGCAAATTCCTGGCCG
[0423] GCAAGCAGGTTGTTCCGCATCAAGCATCGTTCTTCGGATCATCGCTGGTGGCCAAGATCGGTGGCTACGACCT
[0424] TGATTTCGGGATCGCCGCCGACCAGGAATTCATATTGCGGGCCGCGCTGGTATGCGAGCCGGTCACGATTCGG
[0425] TGTGTGCTGTGCGAGTTCGACACCACGGGCGTCGGCTCGCACCGGGAACCAAGCGCGGTCTTCGGTGATCTGC
[0426] GCCGCATGGGCGACCTTCATCGCCGCTACCCGTTCGGGGGAAGGCGAATATCACATGCCTACCTACGCGGCCG
[0427] GGAGTTCTACGCCTACAACAGTCGATTCTGGGAAAACGTCTTCACGCGAATGTCGAAATAGATTGACGCGCCG
[0428] GCGCGTCAATCGCTGCCCCGGAAGAAGATGCCATCGGCCTGCAGCATTCGACCGTTGCGGGGGTCGGTGAAAC
[0429] CGGGTTGCAATCCCGAGAGCGTAAAGCCCAACGAATCCACGAGATCGAGCGCCTCGCGGATGAGCATGCCACC
[0430] CTCGTACAACGGCTGGAAAGACAGCTCGAGCTGCATGCCGACGCATCGGTCGTGCACCGTTGAATCGCCACCC
[0431] GCGATCACCTGCTTCTCGAATCCTTGAACGTCGATCTTCAAGAACGCAATATCGTTGGGCCGCAGAACGTCTG
[0432] CAGCCACGGAATCGAGTCGATGTATCGGCACCCGTTGGGCGCCCACGTAGTTGGCTGGTGGAAAGGCGTCCTG
[0433] ATGTCGTTTCAACATCGGCAAGACGGAACTGCTGGCGCCCTCGTTGCCGGCGACGTTGATCGAGATGGTTCCA
[0434] TCGACATCGCCCAGCGCACAGCGCCGGCATTCCCACAACGGGTCCGTGGAGGCGCTGCGCTGCAAGACGGCAA
[0435] AGGGCCCGGGCAGCGGCTCGAACGAGACGATGCGGCCCGCGAAGCCCGCGCCGCGCAGACCCCTGGCGTACTG
[0436] CCCCGAATTGGCCCCGACATCGAGCACGGCACTGACCCGATGCGATTGCAGTTGGCGCAAGAAATTGCGTTCC
[0437] CAGTCCAGTTCGGCAAAGTAGCGCGACACCTCGATGCCGTTGCGACGCAAGATGTTCCGAGCGCGACGGGCCA
[0438] GCCTCATTGCCGAACCGTTCCCGCGTGCTCGCGATACCACGCCACCGTCGCCTCGATGCCGTCGCGCAGCGCG
[0439] ATCGAAGGCCGCCATCCCGCCTCCCGTAGCACCGAAACATCCAGCAGTTTGCGTGGTGTTCCGTCCGGTTTGC
[0440] TTGGATCCCAGCGGGTTTCGCCGCTATAGCCTACCGCCGAGGCGACCATCTCGGCGATCTCGCCGATGGTGTG
[0441] GTCGATGCCGGTTCCCACGTTGACATGGGTCGGCCCGTCGAAATGTTCCAGCAGATACAGGCATGCGCTCGCC
[0442] AGGTCGTCGACGTGCAGCAACTCCCGTCGGGGCGTGCCGGTGCCCCAGTTGGTCACGTTGGGCGCGCCACTGG
[0443] CTTTGGCCTCGTCATAGCGGCGGATGAGTGCCGGCAGCAGATGCGAGCCGGACGGCGAAAAGTTGTCGCCTGG
[0444] CCCGTACAGGTTGGTGGGCATCGCCGAGATCCACGGCAGGCCATGTTGGCGGCGCACCGCCTGGACCGCAAGG
[0445] ATGCCGGCGATTTTGGCGATCGCGTACGCGTCGTTGGTCGGCTCCAACGGACCGGTGAGCAGCGCGCTCTCCG
[0446] GGATCGGCTGCGGGGCGAGTTTCGGGTAGATGCACGACGAGCCCAGGAACAGCAGCCGCGGCACCCGCGCCGC
[0447] CACGGCGGCATCCAGCAGGTTGACCTGGATCTGGAGGTTTTCCGACAGGAAATCGGCCGGGTAGGTGTCGTTG
[0448] GCCAGGATGCCGCCGACCCGGGCCGCCGCGTCGATGACGACCTGCGGCCTCGACTCGAGAACGAAGTCGAACG
[0449] TCGCGGCCCGATCCGTCAGATCAAGCTCGGCGCGTGACCGCACCAGCAGGTTGGTGAACCCCGCGCCCGCAAA
[0450] CGTGCGTAGCAGCGCGGACCCGACCAGGCCGCGATGCCCGGCGATGTAGACCCGGGCCGCGCGGTCAAGCGGG
[0451] CCGACCGAGGTGTGCGCGTTCATGTCCGGCCGGCGATCATCGGCTTGTCGATCCACGGCTTGCCTTCGCACTC CAGCGCCGCCATGTCCGCGTCGACCATGATCCGAGCCAACTCGTCAGTGTGCACCGAAGCCCTCCAGCCCAGC
[0452] AATTCGGCAGCCTTGGTCGCGTCGCCGATCAGCGAATCCACCTCGGTGGGCCGCAGATAGCGTTGGTCGAATT
[0453] TCACGTACTGCTGCCAGTCCAAACCGGCATGCTCGAACGCGGCCCGCGCGAACTCACGCACGGTGAAACCGCG
[0454] CCCGGTCGCCAAAACGAAGTCGTCGGGCTCGTCGGTCTGCAGCATCCGCCACATGCCTTCGACGTATTCGGGC
[0455] GCGTACCCCCAGTCGCGGACCGCATCCAGATTGCCCATATAGACCTCGGACTGGATACCGGCCTTGATGCGTG
[0456] CCACGGCCCTGGTGATCTTTCGGGTCACGAACGTCTCACCGCGCCGCGGTGATTCGTGATTGAACAAGATGCC
[0457] GTTAACGGCGAACAATCCGTACGCTTCGCGATAATTGCGGGTCGCCCAGTACGAATAGACCTTGGCGGCGCCA
[0458] TACGGTGACCGCGGGTAGAACGGCGTCAGCTCGTTCTGCGGTGGCGGCGAGGCGCCGAACATCTCCGACGAGG
[0459] ACGCCTGATAGAAGCGGCAGTGCACCCGAGAGAGCCGAACGGCTTCCAGCAGTCGCATGGATCCCATGCCGGT
[0460] GGTGTCACCGGTGTGCACGGGTTCGTCGAAGCTCACCCGCACGTGTGACTGCGCCGCCAGGTTGTACACCTCG
[0461] TCGGGTTCGATGGTGCTCAGCAGGGTCACCAACCGGGTTCCGTCGATCAGGTCACCATAGTGCAGAAACAGCC
[0462] GCGCGCCCGGTTGGTGCGGGTCGACGTAGAGGTGATCGATCCGCGAGGTGTTGAACGTCGAAGCGCGCCGGAT
[0463] GAGCCCGTGAACCTCATACCCCTTGGCCAGCAGCAGTTCGGCGAGATACGAGCCGTCCTGGCCGGTGATTCCG
[0464] GTGATGAGCGCTCGCTTCACTGTCTTCCCGCCTCTGTCGGTCATGCTCAGCCATCACAGCGGGGCGCCGCTGT
[0465] CGCTTCATAGTAGATGTGGGTAGGGAACGCCCGTTCTGCAGCGACCTCCTGGTTGTCGGGGGCGACCAGGAAA
[0466] ATGTGAGGCTAGACTCCACCGCGGCCAAGTTGGTGACCATTGCGCCTGCGGCCGTTTCGCGCGGAACCGAGGA
[0467] GGAGAATCCATACGACGCGACCCCCACGCCACCTCCAATCCCGCACAGCCACGACCAACTTGGGAACAAAACC
[0468] ACAGGTCAGACAGCTGTCGCTGAGAGCCGGGACATCGGGTGTCGCCCGGTGCAGTGACACATGTGACTGTTGC
[0469] GACCCTACGATGTGCCCGACCCTCGGTGCGCACCAATTTGAGCCAAATCAGGTTGCAACGTCTCCTGGAAGGA
[0470] TCGGACCCGAGGACGGAGTGCTCACTGACGAGACGGCGTGATTTGTCGACCTGGGGCACAAATCAGTCGGGTC
[0471] GCCGCGCCAACGCGGCCACATGGATGGCGATTCCCACCGTTGGACCGAACAACAGCGCGATCACGGTGCGCGT
[0472] CTCCAGCGGCATCGGCAGCAGCAGCAACAGCGTCGACGCCACCGTCGCGCTGACCCAGCCCAGCAAATACGCC
[0473] CGGTGCAGTGCGGCCGCGACCGCGGCGGCGCCGGTCAGCGTCAGCATGGCGATAGCTACCGCCGCTGCCGTCA
[0474] ACCAGGCCAGCAACGCCCCGCCAGTTTGGTAGTCGGGGCCGAATCCAACACGCAGCAACCAGGGACCGGTAAG
[0475] CCCTGCGGCCAACATCCCGACCGCACCGATGCCGCCGACGACCAGCGCCGGTGCGATCAGCGCCCGAAGCCGT
[0476] TGGGTGCGCCGGTCGACGAAATGCGCGATCAGGTTGCCTTGCATCGCGCTCAGTGGGACCAGAAGCGGCGCAC
[0477] GCGTCAAGGTCACAGCCAGGATGACCGCTCCGCCCTTTGCCCCTAACTGGTCGGAGGTCACTTTGAGCAACAC
[0478] TGGGAAACCCATTACCAGAATCGCGCTGGCACCCGCGGCGGTTATCGAATGAGCGGCACCGCGCACGAACGTG
[0479] GCGATTCCCCCGGGCGTCAGCAGGCTGGCCGCGCTGCGCGCGGTGGGCGAGGCCATCAGCATGAGCAGCCACG
[0480] CCACCGCTCCCGCGGTGGCGGCCCACAAGTACCCGGCCAGACCCCATCCGATCACAACCGCTGCCGCGGCGAC
[0481] CGCCAACCGGATGACCGCGTCGGTCACCATCAGTGACCCGTACTGTGTCCACCGGTCGACGCCGGCCAGCGCG
[0482] CCCAGCAGGGTCGCCTGCGCGCAGAACCCGGCCACCCCAACGCTGAGTAGCCCCACGGACAGCCAGCGCCCCT
[0483] CGACGAATAGCTGTCGGCTCCACAGCGGTGAGCTACCCGCAATTACGACGGCCGCGACGGTGCCAATCATCCC
[0484] GGCCACCCGCAGCGGATGGGTACGATGGCCCGCAACTATTTGGGTGGAGCGCACCCAGCGGACCTCGCGGGTC
[0485] GTTTCTTGCAGGAGGCCGTGGGTGGCGCCGGTGGCAATGCCGAGCGCCCCCCAAAACACCGCGAATATCGAAA
[0486] AACAAGCCGGGGGTAGGTCGCGGGCCGCCAGATAGATGACCGTGTAGACGCAGGCAACGGCCAACGCGGTCGC
[0487] CGCGCCGACCCGAGCGACGCTGCCCCGCGCGATAGGTCCGGTGGGGGCTGCCGTAGCGCCGACGTCGGTCATC
[0488] TCGACGGCACGGTCGCACATTCCGCGCTCATGCCGTCTCTCGTACATGTCACGTCCACTGGCGGGGAGCTGTG
[0489] TATCACCGCTGGCCAGCAACCGAGGTCGAGAGTACGCATGCCTGGCAACGACTGGATGGGGTCGGTTGTGATC
[0490] CACGCAAGCCCGCTTTTAGCGCCCGCAATCCGCTGATACGCCTCATACACAGCAGGTTGCGAAAGTGCCGCGC
[0491] GAATGCCCGATGTCGCTTGCGCCATGTCATTACCTCTTCGTTAGCCGCACATCCATGATGGGCTGCAGCGTAG CGGGAACATAGCCTGCCAGATGATGCACACGCAATTTCACCGCCGAGCGAATAGCAGCGACCATCCATTGTGC
[0492] CCGGCGACCAGCGAATTCCTTATCCGTCAGCGCGCGTTCCAGCATCCATACCAACATTGCACGGTGGAAGCGC
[0493] AAGGTCAGCGTCGCATCCTTCGCCGCAAAGCGTTTCACCTTGGGAACCGTAATCCAGTTGAGCGAACGCCAGA
[0494] CTCCCTTCGGGTCATCCATGCCCGTATTGCCCTCGATGCGATGTCGCATCACCCGGCATGTCAGCTCTTTGGT
[0495] GAAGAATGTTGGGATATTGAAATGCGGTTCGTACGGGAATACGTAATTCGGGCACAGGAAGTGGTAACTGGCC
[0496] CCCGGTTTCAGCACTTCCGATACCCGCCTGACTGCCTCATCCGGAAGGTCGATGTGCTCCATCACATTCAGCG
[0497] AGAAGGCGAAGTCGAACCGCTTCTCGGAAATAAAGTCTTCCGCCTTGCATGGCGCGATGGTGGGTCGTGCTGC
[0498] AGCCAATTCCAGCACGATGTCGCCAAGCTGTCTGAACTTGCCAAAACCTTCACCCGTCGGCTCGATGGCGGTG
[0499] ATGTCAAATCCCTCCGCCGCCAGTTGACAGCTGAGCAGAAGTACCCCCCCGCCCACTTCCAGCAATGCTGCAC
[0500] CGACAGGCAACCGCGCGAGGTCCTCGGACAGCCAGTCGCGTGCAAATCGGGCCTCGGCCGCCATCGTATCGAA
[0501] CAGTGAACGCAATTCTGGCGCGTGCGCATCAACATGTGAGCGGATACGGGCAAGGAATCCATCCATGCATGCG
[0502] TTCACACGGTTCAGATTATTACTCAACGCAAACACCCATTGCGCGGTCGATCACGCCTCGTACGCTGGCCGGA
[0503] ACGCCCCAATACTGATACCTATCCGGGTGGGCCGGCGCATCAGCGTCTGCGCATCGATCAGCGCCTCGTTGCC
[0504] GACCGCGATATGGTGCAGGATTACGAGTCATGAATGTCTCGCCGTGACGCGGTGATTCGTGATTGAACCAGAT
[0505] GCTGTTGACCGCGAGCAACCCATACAATTCGCGATAATTCCGTGTCGCCCAGCAGAAATAGACCTCGGCCGGG
[0506] CTACCAGCGGCCACATATCCCTTCAGCGGGAGCTTAGCGAGATACGAGCCGTCCGGTCCTGTGATTCCGGTGA
[0507] TGAGCGCTCGCTTCACTGGGTTCCCGCTCCTGCCGGTCGCTCTTCGCCATGGCATAACGTCGGGGCGTGGCTG
[0508] TGGGTTCATCCTAGATGTCGGTGCCCAGCGCCCTTTCGGCAACGACGTCCTGTTGTCGGTTGCCACGAGGAAG
[0509] ATCCGGTCTAGACTGCCCGGCGACCGCGTTGGCAACCATGGCGCTCTGCTACCGTTTCGCGCAGAACCGAGGA
[0510] GAATCCAGATGAAGCGACCCCCGGAGGTGTTGCGCGGTGCCGTGACCGCGAGCCGGGAGCGGCTCTGGGCGAT
[0511] CGGCTCCCAATCCGAGCGCACCCTCATGCTCGGCACCATCCTGCTGGCGTCGGTGATTTCGGCGGCGACGGCG
[0512] TACGCCCTCAGTCAGTGGTACGCGGTCGACGTCTTTTCCACTCTTTTGGTAGTCCCTGGGGACTGTTGGCTTG
[0513] ATTGGGGCATGAATATCGGTCGGCACTGCTTCAGCGACTACGCCATGGTCGCCGCCGCCGGGATTCAACCCAA
[0514] TCCCGCGGACTACCTGATCTCGCTACCCGCCGATTACCAGCCGACCGCGGTTGCTGCATGGGCCCCCGCCCGC
[0515] ATACCGTATGCGATTTTCGGACTACCCAGCCATTGGCTGGGTGCGCCGCGCTTGGGGCTGATCTGTTACCTGG
[0516] TCGCCCTAACGATGGCGGTCATATCTCCCGCCATCTGGGCGGCCCGGGGGGCACGTGGTCTGGAGCGAGTGGT
[0517] CATCTTCGTGACACTGGGCGCCGCGGCCATCCCGGCGTGGGGGGTCATCGATCGAGGCAACTCGACAGGGTTC
[0518] GTGGTACCGATCGCGCTGGCTTACTTCGTGGCGTTGTCCCGACAGCGGTGGGGCCTCGCCACCATCACGGTGA
[0519] TCTTGGCCGTCCTGGTAAAGCCGCAGTTCGTCGTTCTCGGCGTGGTGTTGTTGGCGGCTCGACAATGGCGGTG
[0520] GGCTGGTATCGGGATCACCGGCGTGGTGGTGTCCAATATCGCAGCCTTTCTGTTGTGGCCACGAGGCTTCCCG
[0521] GGGACGATCGCACAGTCGATCCACGGCATCATCAAGTTCAATAGTTCGTTCGGAGGGCTTCGAGACCCGCGGA
[0522] ACGTGTCCTTTGGCAAGGCACTCCTGCTGATCCCCGATAGCATCAAGAACTATCAATCGGGCAAGATCCCAGA
[0523] GGGTTTCCTCACTGGTCCGCGAACGCAGATCGGGTTTGCTGTCCTAGTCATAGTCGTGGTCGCCGTGCTGGCG
[0524] CTCGGACGCCGTATCCCGCCTGTCATGGTGGGGATTGTGTTGCTCGCCACCGCCACCTTCTCCCCCGCGGACG
[0525] TCGCCTTCTACTATCTCGTTTTCGTCTTGCCAATCGCTGCACTGGTAGCCCGAGACCCCAACGGGCCTCCTGG
[0526] TGCTGGGATATTCGACCAACTCGCAGCCCATGGAGACCGCCGCCGCGCGGTCGGCGTCTGCGTGAGTTTGGCC
[0527] GTGGCGCTGAGCATCGTCAACGTCGCGGTCCCGGGCCAGCCGTTCTACGTGCCGCTCTATGGACAGCTGGGAG
[0528] CCAAAGGGGTAGTCGGTACCACGCCACTCGTTTTCACCACGGTGACATGGGCACCGTTCTTGTGGTTGGTCAC
[0529] GTGCGTAGTAATCATCGTCTCCTACGCGCGCAAACCCGCTCGCCCACATGACAGTCACAACGGGCCTACTCGG
[0530] GAGAGCGACCAGGACACCGCTGCCAGCACCACCTCATGCTTACCCAATCCGGTTGAGGAGTCCTCACCACGGG
[0531] GACCCGGCCCAATCTGCCAAAATTACACCCCATAGGCGGAGTCCGAGCTCACATCCGCCCAGGGGCTCAGTGG TTGGTAACCTGCCAACCGTGCAGCCTAACCACAACCCGAACCAGTGCCTACAGAACATGGCGCGCAACGGTTT
[0532] ACACTGATCCACGCACTCAATCGACATGGACCACGGCGCCACAACGAGGTACCACGCCAGCAACCGGAACGCT
[0533] GCCGATCCCGTGGTGCGCCATACCGGGATAGGGCCCTGCAAACACTGATGGTCAACCCGCTAGAAGGCCGGTG
[0534] ACGGGCCTCGACCGAGTGGTATCCTCCCCCCAATCCCGATTCGGTGGCGAGGTTCTCGCCGCCGCGTAGTGCG
[0535] GGTACGAACAAAGCGCGACACCTATCGACATCGCGACGCTGGGGGAAGACCAGGAATCGATCTCGTGAACGGA
[0536] AGCGGATTTGATCATCAAGACAAAACCAGAAACGGATCGGCCGCGATATCTTTTTGCCAGCAACCTAGCCGCA
[0537] GCCAGCCCTATATGATCGGATGCAATTATCTCACAGGAGACGATGCGACGTTCATCGCGCACCGGACGCCCCG
[0538] GGTCGCGGCCCATCCTGGCCTTCCCGAGCACCATATTGAATATGTCGCAGAATCGCTTGAACTCGCTCCAGCG
[0539] GAGCTGTCGCGGGCGCGACGTATTTGTTATTCTAAATTGGAGACACCGCGTTGAAGAAAGTCGCGATTGTTCA
[0540] ATCAAATTACATACCTTGGCGAGGATATTTTGACCTGATTGCATTCGTCGATGAATTCATCATCTATGATGAC
[0541] ATGCAATATACCAAGCGTGATTGGCGAAACAGAAATCGGATCAAAACGAGCCAGGGGTTACAGTGGATAACTG
[0542] TTCCCGTCCAGGTGAAGGGACGTTTCCATCAAAAGATACGTGAGACGCTGATCGACGGCACCGATTGGGCGAA
[0543] AGCGCACTGGCGGGCACTAGAATTCAACTACAGCGCGGCCGCTCATTTTGCGGAGATCGCTGACTGGCTCGCG
[0544] CCGATTTACCTCGAAGAACAGCACACGAATCTTTCCTTACTCAACAGGCGTCTATTGAATGCGATTTGCAGTT
[0545] ATCTCGGTATCAGCACGCGACTGGCAAATTCGTGGGACTACGAATTAGCCGACGGCAAGACCGAGAGACTGGC
[0546] CAACCTCTGCCAACAGGCCGCAGCGACCGAATATGTCTCTGGCCCCTCAGCCCGTTCGTATGTCGATGAGCGC
[0547] GTGTTCGACGAACTTAGCATCCGGGTAACTTGGTTCGATTATGACGGCTACCGCGATTATAAGCAATTGTGGG
[0548] GAGGGTTCGAGCCCGCCGTGTCGATTCTGGATCTGCTCTTTAACGTCGGAGCCGAGGCTCCGGACTATTTGAG
[0549] GTACTGTCGCCAGTGAAATTATCTATCGTCTCCACGCTTCCTTGCTCGGCGAACCGTGCCGGCGGGTTTTTGG
[0550] GTCATTGCCCGCCGCAGCCTCGGCATGCAACTGTTGAAGGTATAGTCTCGGACCCACGCACCGACGCCCACAC
[0551] ACACAAATCGTGAGGCAGCTTCATGGCGGAAGACGCAACGACCATGCTCGCTGACGTGGCCCGTTACTACGCA
[0552] TCGAAACTCGAAGCACACGGCACCCGCGCGGCGTCGATTGGAACGGCGAAGCCGGGCAGGCGTTGCGCTTTGA
[0553] CCAGCTGGTGCGCATTGTCAATGCGGCGGACCCATTTTCGATCAACGATCTAGGCTGTGGCTATGGGGCTCTA
[0554] CTGGACTACCTAGATGCGCGTGGCTTCAAAACTGATTACACCGGCATCGACGTCTCCCCCGAAATGGTGCGCG
[0555] CGGCCGCACTACGTTTCGAAGGTCGGGCGAACGCAGACTTCATCTGCGCGGCGCGCATAGATCGGGAGGCGGA
[0556] CTATAGCGTCGCGAGTGGAATATTCAATGTTCGTCTGAAATCGTTGGACACGGAATGGTGCGCTCACATCGAA
[0557] GCGACGCTCGACATGCTGAATGCCGCGAGTCGCCGTGGCTTCTCTTTTAATTGCCTGACATCTTATTCCGATG
[0558] CATCAAAGATGCGCGACGACCTGTACTATGCTGACCCATGCGCCCTATTTGATCTCTGCAAGCGCAGGTACTC CAAGAG
[0559] SEQ ID NO: 5 agacctcacctatgtgtcga
[0560] SEQ ID NO: 6 tcgctgaaccggatcga
[0561] SEQ ID NO: 7 atggaggtggccatcgtcgtggaagcctacgtggcctttgtcac SEQ ID NO: 8 aagccatctggacccgccaacccctatcgtatggtggat
[0562] SEQ ID NO: 9 aggatcctgcgagcgtag
[0563] SEQ ID NO: 10 aagaaggcgtactcgacctg
[0564] SEQ ID NO: 11 cgcaacgccgataccgt
[0565] SEQ ID NO: 12 cccaggatgacgccgaa
[0566] SEQ ID NO: 13 catcacctccttggccaggcccgctaacgcccaacac
[0567] SEQ ID NO: 14 gcgacaccgacgcgatgattccgggcatgctcagga
[0568] SEQ ID NO: 15 agtggccgccagttgttg
[0569] SEQ ID NO: 16 accgccacgccgaaatc
[0570] SEQ ID NO: 17 gccgctcccaaaaattacca
[0571] SEQ ID NO: 18 gacgctactacggcacgg
[0572] SEQ ID NO: 19 aggccactccaagagtgttgcgtgacgccttcctaaccaga SEQ ID NO: 20 gcgcgggcgtaccggatatgcgccccgtagcgtta
[0573] SEQ ID NO: 21 cttctgcacgactacggct
[0574] SEQ ID NO: 22 agccatttttcagcaatttctcag
[0575] SEQ ID NO: 23
[0576] CCGGTGCCATACGAGCTCTTCCAGGCCCGGCCGATCTGGTC
[0577] SEQ ID NO: 24
[0578] ATGGACGAACACCCCGACGAAATGGAGCAGGGCTCTTCGTCAGC
[0579] SEQ ID NO: 25
[0580] CTTTCGGTAAGACCCATGG
[0581] SEQ ID NO: 26
[0582] TCCTTGGCGGTGTATTGC
[0583] SEQ ID NO: 27
[0584] GGAGCAGCCTCGGGTTCGG
[0585] SEQ ID NO: 28
[0586] GATCCTGTACGGCTACGAGTGG
Claims
Claims1. A method for detecting the presence or absence of mycobacteria in a sample, comprising:(a) contacting the sample with a lysis agent comprising one or more bacteriophages each bound to a solid support, such that if viable mycobacteria are present in the sample the viable mycobacteria are lysed by the lysis agent and a mycobacterial nucleic acid is released;(b) performing an isothermal amplification process to amplify the mycobacterial nucleic acid and thereby providing an amplification product; and(c) detecting the presence or absence of the amplification product, wherein presence of the amplification product indicates the presence of mycobacteria in the sample and absence of the amplification product indicates the absence of mycobacteria in the sample.
2. A method for diagnosing the presence or absence of a mycobacterial infection in a subject, comprising detecting the presence or absence of mycobacteria in a sample obtained from the subject using the method of claim 1, wherein the presence of mycobacteria in the sample indicates the presence of a mycobacterial infection in the subject and absence of mycobacteria in the sample indicates the absence of a mycobacterial infection in the subject.
3. The method according to claim 1 or 2, wherein eukaryotic cells present in the sample are selectively lysed prior to or during step (a).
4. The method according to claim 3, wherein the eukaryotic cells are selectively lysed by contacting the sample with H2O, a composition comprising guanidinium thiocyanate, a composition comprising saponin, a composition comprising sodium cholate, phosphate buffered saline (PBS), or mycobacterial growth medium.
5. The method according to any one of the preceding claims, wherein the lysis agent captures viable mycobacteria on the solid support by means of an interaction between the one or more bacteriophages and the viable mycobacteria.
6. The method according to claim 5, wherein step (a) comprises separating the solid support and any captured viable mycobacteria from the sample prior to release of the mycobacterial nucleic acid.
7. The method according to claim 6, wherein the solid support is a bead, optionally wherein the bead is a magnetic bead or a paramagnetic bead and separation is achieved by or comprises application of a magnetic field.
8. The method according to claim 6, wherein separation is achieved by or comprises filtration, optionally wherein the solid support is a bead.
9. The method according to any one of the preceding claims, wherein there is no step of isolating and / or concentrating any released mycobacterial nucleic acid between step (a) and step (b).
10. The method of any one of the preceding claims, wherein the one or more bacteriophages comprise two or more different bacteriophage species, optionally wherein the lysis agent comprises:(i) two or more different bacteriophage species bound to the same solid support; and / or(ii) two or more different bacteriophage species bound to different solid supports.
11. The method of any one of the preceding claims, wherein the one or more bacteriophages are capable of lysing viable mycobacteria, optionally wherein the one or more bacteriophages comprise D29 and / or TM4.
12. The method according to any one of the preceding claims, wherein the isothermal amplification process comprises loop-mediated isothermal amplification (LAMP) or recombinase polymerase amplification (RPA).
13. The method according to any one of the preceding claims, wherein the presence or absence of the amplification product is detected in step (c) using a nucleic acid stain producing a colorimetric reaction, optionally wherein the nucleic acid stain comprises SYBR green 1, EvaGreen, calcein and / or hydroxynapthol blue.
14. The method according to any one of the preceding claims, wherein presence of the amplification product further indicates one or more characteristics of the mycobacteria present in the sample.
15. The method according to any one of the preceding claims, wherein the one or more characteristics comprise resistance to a treatment, such as isoniazid resistance.
16. The method according to any one of the preceding claims, wherein the mycobacteria comprise:(i) one or more Mycobacterium tuberculosis complex (MTBC) species, optionally Mycobacterium tuberculosis and / or Mycobacterium bovis:(ii) one or more Mycobacterium avium complex (MAC) species, optionally Mycobacterium avium subspecies paratuberculosis,'(iii) Mycobacterium smegmatis:(iv) Mycobacterium ulcerous:(v) Mycobacterium leprae,' and / or(vi) one or more non-tuberculosis mycobacteria (NTM), optionally Mycobacterium absessus complex, Mycobacterium kansasii and / or Mycobacterium marinum.
17. The method according to any one of the preceding claims, wherein the mycobacterial nucleic acid comprises:(i) an insertion sequence, optionally IS6110, IS900 or IS2404;(ii) deletion of an RD4 sequence; or(iii) a 16S rRNA sequence.
18. The method according to any one of the preceding claims, wherein the sample is an animal sample or a human sample.
19. The method according to any one of the preceding claims, wherein:(i) the sample is or is from a body fluid, optionally blood, milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymphatic fluid, or urine, optionally wherein the sample is a bulk milk tank sample;(ii) the sample is or is from a stool sample; or(iii) the sample is or is from a breath sample; or(iii) the sample is a tissue sample, optionally wherein (1) the sample is a fine needle aspirate, a tissue swab or a biopsy and / or (2) the tissue is lung.
20. The method according to claim 19, wherein the sample is or is from blood, cerebrospinal fluid, sputum, or urine.
21. The method according to any one of claims 2 to 20, wherein the subject is a human, optionally wherein the human has or is suspected of having tuberculosis, Crohn’s disease, ulcerative colitis, irritable bowel syndrome, psoriasis, thyroiditis, sarcoidosis, Parkinson’s disease, multiple sclerosis, type 1 diabetes, arthritis, ankylosing spondylitis, Buruli ulcer, leprosy, a non-tuberculosis mycobacteria (NTM) infection, cystic fibrosis, a localized granuloma and / or an ascending lymphangitis, optionally where the ascending lymphangitis resembles sporotrichosis.
22. The method according to any one of claims 2 to 20, wherein the subject is an animal, optionally a ruminant such as a bovine, ovine or caprine.
23. The method according to claim 22, wherein the animal has or is suspected of having tuberculosis or Johne’s disease.
24. A lysis agent capable of lysing viable mycobacteria, comprising two or more different bacteriophage species each bound to a solid support.
25. The lysis agent according to claim 24, wherein the lysis agent comprises (i) two or more different bacteriophage species bound to the same solid support, and / or (ii) two or more different bacteriophage species bound to different solid supports.
26. The lysis agent according to claim 24 or 25, wherein the two or more bacteriophage species are each capable of lysing viable mycobacteria, optionally wherein the two or more bacteriophage species comprise D29 and / or TM4.
27. The lysis agent according to any one of claims 24 to 26, wherein the solid support is a bead, optionally a magnetic bead or a paramagnetic bead.
28. A kit comprising the lysis agent according to any one of claims 24 to 27.
29. The kit according to claim 28, wherein the kit further comprises one or more additional components, wherein the one or more additional components comprise:(i) primer;(ii) DNA polymerase;(iii) reverse transcriptase;(iv) nucleic acid stain;(v) deoxynucleotide triphosphate;(vi) DNA destabiliser; and / or(vii) buffer.
30. The kit according to claim 28 or 29, wherein the kit further comprises instructions for using the kit to perform the method of any one of claims 1 to 23.
31. The kit according to any one of claims 28 to 30, wherein the lysis agent or the one or more additional components are dried.
32. The kit according to claim 31, wherein the lysis agent or the one or more additional components are freeze-dried.
33. The kit according to any one of claims 29 to 32, wherein the lysis agent and the one or more additional components are combined as a reagent mix.
34. Use of the lysis agent according to any one of claims 24 to 27, or the kit according to any one of claims 28 to 33, in a method according to any one of claims 1 to 23.