In situ amplification of RNA

Abstract

The present disclosure generally relates to the amplification of RNA, e.g., for MERFISH or other applications. One set of embodiments is generally directed to a method of synthesizing a nucleic acid. Some embodiments are drawn to systems and methods for in situ amplification of RNA, which may allow genome-scale imaging of RNAs, including short RNAs and RNA isoforms that are differentiated by short sequences. In some embodiments, RNA such as mRNA may be transcribed into cDNA using a reverse transcriptase. The reverse transcriptase can also be used to associate a promoter (for example, a T7 promotor)with the RNA, e.g., by using a template-switching oligonucleotide (TSO). The promotor sequence can then be used to amplify the RNA, e.g., using techniques such as in vitro transcription, which can be performed in situ. Having amplified or increased amounts of RNA in situ may be useful for certain applications, such as MERFISH, as the RNA is easier to detect. Other aspects are generally related to methods for using such techniques, kits involving such techniques, or the like.

Description

[0001] IN SITU AMPLIFICATION OF RNA

[0002] RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 513,612, filed July 14, 2023, entitled “In Situ Amplification of RNA,” by Zhuang, et al., and of U.S. Provisional Patent Application Serial No. 63 / 621,745, filed January 17, 2024, entitled “In Situ Amplification of RNA,” by Zhuang, et al. Each of these is incorporated herein by reference in its entirety.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0005] The contents of the electronic sequence listing (H049870801WO00-SEQ-TC.xml; Size: 14,378 bytes; and Date of Creation: July 9, 2024) is herein incorporated by reference in its entirety.

[0006] FIELD

[0007] The present disclosure generally relates to the amplification of RNA, e.g., for MERFISH or other applications.

[0008] BACKGROUND

[0009] MERFISH is a tool that allows spatially resolved transcriptomic profiling of individual cells (Fig. 1). See, e.g., Int. Pat. Apl. Pub. No. WO 2016 / 018960, incorporated herein by reference in its entirety. MERFISH can detect thousands of RNA species with high spatial resolution in tissues through combinatorial labeling of single RNA molecules and sequential imaging with an error-robust encoding scheme capable of error detection and / or correction. In one embodiment of MERFISH, encoding (or primary) probes with readout sequences first bind to the target RNA in the tissue (Fig. 1A). Each RNA species has a unique barcode, and the encoding probes have a combination of readout sequences unique to each RNA species to create the barcode. Then, fluorescently labeled readout (or secondary) probes bind to the encoding probes in sequential rounds of hybridization (Figs. 1B-C). The fluorescent signal is inactivated between rounds, for example by using chemical cleavage or photobleaching. The presence or absence of a signal in each hybridization round, represented by a bit of “1” or “0,” respectively, is used to assign a unique binary barcode to each RNA species. Thus, in MERFISH, RNA species can be identified, counted, and localized in a single cell using combinatorial labeling and sequential imaging. MERFISH allows imaging of more than 10,000 RNA species (or genes) in individual cells. MERIFSH can also be extended to enable spatially resolved 3D-genome imaging and epigenomic profiling of individual cells. MERFISH has been used to map the spatial distribution of different cell types in various brain regions, for example, the motor cortex (Fig. ID) and the hypothalamus, the whole mouse brain, and human brain regions. See also Int. Pat. Apl. Pub. No. WO 2021 / 138078, incorporated herein by reference in its entirety.

[0010] SUMMARY

[0011] The present disclosure generally relates to the amplification of RNA, e.g., for MERFISH or other applications. The subject matter of the present disclosure involves, in some cases, interrelated products, alternative solutions to a particular problem, and / or a plurality of different uses of one or more systems and / or articles.

[0012] A current limitation of MERFISH and other hybridization-based spatial transcriptomics methods, is detecting short RNA sequences, thereby making it challenging to detect short RNAs and many RNA isoforms since their unique sequence is not sufficiently long. Certain aspects of the present disclosure are thus directed to overcoming these limitations.

[0013] One aspect is generally drawn to a method. In one set of embodiments, the method comprises exposing a primer sequence to a target RNA, wherein the primer sequence is substantially complementary to at least a portion of the target RNA; using reverse transcriptase to synthesize a first nucleic acid portion comprising a portion substantially complementary to at least a portion of the target RNA, wherein the first nucleic acid portion is attached to the primer sequence; and using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand.

[0014] The method, in another set of embodiments, comprises exposing RNA contained within a sample to transcription reagents capable of transcribing the RNA into cDNA; and exposing the cDNA within the sample to amplification reagents capable of amplifying the cDNA within the sample.

[0015] In yet another set of embodiments, the method comprises reverse transcribing a plurality of RNA molecules into cDNA within a sample; and amplifying the cDNA within the sample.

[0016] In still another set of embodiments, the method comprises exposing a primer sequence to a poly-A tail of an RNA comprising the poly-A tail, wherein the RNA is within a sample; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the RNA, wherein the first nucleic acid portion is attached to the primer sequence; using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand; amplifying the DNA strand using the promoter sequence to produce amplified RNA; binding nucleic acid probes to at least some of the amplified RNA strands; and determining the nucleic acid probes within the sample.

[0017] In another set of embodiments, the method comprises exposing RNA within a sample to a polyadenylation enzyme to produce RNA comprising a poly-A tail; exposing a primer sequence to the poly-A tail; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the RNA, wherein the first nucleic acid portion is attached to the primer sequence; using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand; amplifying the DNA strand using the promoter sequence to produce amplified RNA; binding nucleic acid probes to at least some of the amplified RNA strands; and determining the nucleic acid probes within the sample.

[0018] In yet another set of embodiments, the method comprises exposing a primer sequence to a poly-A tail of an RNA comprising the poly-A tail, wherein the RNA is within a sample; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the RNA, wherein the first nucleic acid portion is attached to the primer sequence; using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand; and amplifying the DNA strand using the promoter sequence to produce amplified RNA.

[0019] In still another set of embodiments, the method comprises exposing RNA within a sample to a polyadenylation enzyme to produce RNA comprising a poly-A tail; exposing a primer sequence to the poly-A tail; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the RNA, wherein the first nucleic acid portion is attached to the primer sequence; using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand; and amplifying the DNA strand using the promoter sequence to produce amplified RNA.

[0020] In one set of embodiments, the method is a method of synthesizing a nucleic acid. In some embodiments, the method comprises binding a primer to a poly-A tail of an mRNA; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the mRNA, wherein the first nucleic acid portion is attached to the primer; using the reverse transcriptase to synthesize a second nucleic acid portion not complementary to the mRNA, wherein the second nucleic acid portion is attached to the first nucleic acid portion; annealing the second nucleic acid portion to a template oligonucleotide comprising a promoter; and using the reverse transcriptase to synthesize a third nucleic acid portion substantially complementary to the template oligonucleotide, wherein the third nucleic acid portion is attached to the second nucleic acid portion.

[0021] The method, in another set of embodiments, is a method of synthesizing a nucleic acid in situ. In some embodiments, the method comprises binding a primer to a poly-A tail of an mRNA; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the mRNA, wherein the first nucleic acid portion is attached to the primer; using the reverse transcriptase to synthesize a second nucleic acid portion not complementary to the mRNA, wherein the second nucleic acid portion is attached to the first nucleic acid portion; annealing the second nucleic acid portion to a template oligonucleotide comprising a promoter; and using the reverse transcriptase to synthesize a third nucleic acid portion substantially complementary to the template oligonucleotide, wherein the third nucleic acid portion is attached to the second nucleic acid portion.

[0022] Other advantages and novel features of the present disclosure will become apparent from the following detailed description of various non-limiting embodiments of the disclosure when considered in conjunction with the accompanying figures.

[0023] BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Non-limiting embodiments of the present disclosure will be described by way of example with reference to the accompanying figures, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, not every component is labeled in every figure, nor is every component of each embodiment of the disclosure shown where illustration is not necessary to allow those of ordinary skill in the art to understand the disclosure. In the figures: Figs. 1A-1D illustrate multiplexed error-robust fluorescence in situ hybridization or MERFISH, in one embodiment;

[0025] Figs. 2A-2D illustrate RNA molecules amplified in situ, in another embodiment;

[0026] Figs. 3A-3I illustrate MERFISH with in situ RNA amplification using 92 probes, in yet another embodiment;

[0027] Figs. 4A-4C illustrate MERFISH measurements using eight probes per gene with amplification, in still another embodiment;

[0028] Figs. 5A-5C illustrate an example of assay optimization, in yet another embodiment;

[0029] Figs. 6A-6G schematically illustrate nucleic acid molecules amplified in situ, in accordance with another embodiment;

[0030] Figs. 7A-7B illustrate MERFISH with in situ RNA amplification, in yet another embodiment;

[0031] Figs. 8A-8D illustrate MERFISH with in situ RNA amplification with probes targeting the 3’ end and the 5’ end of transcript, in still another embodiment;

[0032] Figs. 9A-9F illustrate MERFISH with in situ RNA amplification with six and four probes per gene, in yet other embodiments;

[0033] Fig. 10 illustrates MERFISH with in situ RNA amplification for 4,425 genes using six probes per gene and in- situ RNA amplification, in still another embodiment; and

[0034] Fig. 11 illustrates MERFISH with in situ RNA amplification, with and without expansion microscopy, in another embodiment.

[0035] BRIEF DESCRIPTION OF THE SEQUENCES

[0036] SEQ ID NO: 1 is / 5Biosg / TAATACGACTCACTATAGGGAAATArGrG+G (TSO sequence 1, +G indicating a locked nucleic acid);

[0037] SEQ ID NO: 2 is / 5Biosg / TAATACGACTCACTATAGGGAGArGrG+G (TSO sequence 2, +G indicating a locked nucleic acid);

[0038] SEQ ID NO: 3 is T(30)VN (V = A or G or C, N = A or G or C or T);

[0039] SEQ ID NO: 4 is / 5Biosg / TAATACGACTCACTATAGGGAAATA rNrG+G;

[0040] SEQ ID NO: 5 is / 5Biosg / TAATACGACTCACTATAGGGAAATA rGrG+G;

[0041] SEQ ID NO: 6 is / 5Biosg / TAATACGACTCACTATAGGGAGA rGrG+G;

[0042] SEQ ID NO: 7 is / 5Biosg / TAATACGACTCACTATAGGGAGA rNrG+G;

[0043] SEQ ID NO: 8 isTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN;

[0044] SEQ ID NO: 9 is

[0045] TTACACTCCATCCACTCAATT+TT+TT+TT+TT+TT+TT+TT+TT+TT+TTTTT VN; and SEQ ID NO: 10 is TTACACTCCATCCACTCAATT+TT+TT+TT+TT+TT+TT+TT+TT+TT+TTTTT.

[0046] DETAILED DESCRIPTION

[0047] The present disclosure generally relates to the amplification of RNA, e.g., for MERFISH or other applications. One set of embodiments is generally directed to a method of synthesizing a nucleic acid. Some embodiments are drawn to systems and methods for in situ amplification of RNA, which may allow genome- scale imaging of RNAs, including short RNAs and RNA isoforms that are differentiated by short sequences. In some embodiments, RNA such as mRNA may be transcribed into cDNA using a reverse transcriptase. The reverse transcriptase can also be used to associate a promoter (for example, a T7 promotor) with the RNA, e.g., by using a template- switching oligonucleotide (TSO). The promotor sequence can then be used to amplify the RNA, e.g., using techniques such as in vitro transcription, which can be performed in situ. Having amplified or increased amounts of RNA in situ may be useful for certain applications, such as MERFISH, as the RNA is easier to detect. Other aspects are generally related to methods for using such techniques, kits involving such techniques, or the like.

[0048] Some embodiments are generally directed to systems and methods to detect short RNA sequences. In MERFISH, the target RNAs may be first stained with encoding probes and then detected using fluorescently labeled readout probes (Fig. 1A). Since detection of short RNA sequence involves using fewer encoding probes and hence reducing the signal, an approach for signal amplification is needed, e.g., for use with MERFISH or other applications. For example, it can be difficult to detect nucleic acid in situ within a cell, e.g., at sites within the cell where the nucleic acids are located, due to the small size of the cells, as well as the very small concentrations of nucleic acids that may be present. In some cases, for instance, only a single nucleic acid molecule may be present at a particular site within the cell, making detection of that molecule a significant challenge.

[0049] Thus, in accordance with certain aspects of the present disclosure, detection of such molecules in situ within a cell may be improved by increasing the number of such molecules within the cell to be detected. If more molecules are present at a given location within a cell, then there would be more molecules, for example, for signaling entities to bind to, thereby increasing the observed signal produced by those signaling entities within the cell. Thus, in accordance with certain embodiments, amplification of nucleic acids may occur in situ or within a cell. However, while others have previously suggested amplifying nucleic acids using a variety of mechanisms, those amplification reactions typically occur in controlled and normally homogenous environments, e.g., in test tubes, microwell plates, or other in vitro settings. In contrast, cells are small yet highly complicated and structured environments, and it accordingly can be difficult to deliver reagents into and / or out of cells, e.g., without damaging the cells or distorting their internal structures. Accordingly, most techniques for in vitro amplification of nucleic acids cannot be easily adapted for in situ applications. However, as discussed herein, certain embodiments are directed to the amplification of nucleic acid such as RNA within cells, i.e., where the amplification occurs in situ or in vivo.

[0050] One example of such an approach is now described with reference to Fig. 6. It should be understood, however, that this is by way of example only, and other methods of amplifying nucleic acids such as RNA are discussed in more detail herein. In Fig. 6, target nucleic acid 20 within a cell environment 10 is to be amplified. The nucleic acid may be located anywhere in the cell, e.g., in the nucleus or in the cytoplasm, etc. As an example, a target nucleic acid within a cell may be RNA, such as mRNA, that is positioned at a specific location within a cell. In some embodiments, it is desired to determine where the target nucleic acid is located within cell (or even whether it is present or not within cell), and thus, by amplifying the amount of target nucleic acid present in situ within the cell, it may become easier to detect the target nucleic acid within the cell, for instance, using FISH, MERFISH, fluorescence labeling, or other established techniques for determining nucleic acids that are known to those of ordinary skill in the art.

[0051] In Fig. 6A, target nucleic acid 20 is shown positioned within a cell. The target nucleic acid may be, for example, mRNA having a poly-A tail. In some cases, e.g., if other types of RNAs or DNAs are to be determined, the nucleic acid may be exposed to an enzyme, such as a polyadenylation enzyme (not shown in Fig. 6A), which is capable of adding a poly-A tail to the nucleic acid. In Fig. 6A, for example, the poly-A tail is shown as region 25 of target nucleic acid 20.

[0052] In Fig. 6B, a primer sequence 30 is added to the cell and allowed to bind or hybridize (e.g., noncovalently) to poly-A tail 25. The primer sequence may comprise a reverse transcriptase (RT) primer sequence (for example, a sequence rich in T’s) that is able to recognize or hybridize to the poly-A tail, e.g., as being substantially complementary. For instance, the primer may comprise a sequence of at least 7 consecutive T’s, at least 10 consecutive T’s, at least 50 consecutive T’s, etc.

[0053] In Fig. 6C, target nucleic acid 20 is exposed to a reverse transcriptase (not shown), which is able to recognize the RT primer on the primer sequence. Additional mononucleotides may also be present (not shown) which allows the reverse transcriptase to synthesize cDNA 40 (complementary DNA) using target nucleic acid 20 as a template, attached to and extending from primer sequence 30. In some cases, the reverse transcriptase may also add a few non-templated nucleotides at the 5’ end of the cDNA, shown as sequence 45 in Fig. 6C. For instance, these may be added once the reverse transcriptase has gone past the end of target nucleic acid 20, as shown in this figure. In some cases, the non-templated nucleotides at the 5’ end of the cDNA may include one or more C’s.

[0054] In Fig. 6D, using non-templated nucleotides 45, sequence 50 comprising a promoter may be added, e.g., to the end of target nucleic acid 20, for example, by a reverse transcriptase. The promoter may be useful, for example, for allowing the target nucleic acid sequence to be amplified (e.g., resulting in a lot of copies), as discussed below. The promoter sequence may be a T7 promoter, or other promoter such as those disclosed herein. The promoter may be part of a template switch oligonucleotide (TSO) sequence in some embodiments, which can hybridize to non-templated nucleotides 45. In some cases, as an example, the TSO sequence may comprise one or more G’s that can recognize non-templated nucleotides that include one or more C’s. The reverse transcriptase may add sequence 50 to the end of target nucleic acid 20 based on non-templated nucleotides 45. As shown in Fig. 6D, sequence 50 may be attached to and extending from target nucleic acid 20.

[0055] In Fig. 6E, the cDNA strand has been further extended to compliment sequence 50, e.g., by a reverse transcriptase. The additional complimentary sequence 60 may be attached to and extending from sequence 50 comprising the promoter. Thus, the target nucleic acid 20 has been extended to further include a promoter, such as a T7 promoter, and the reverse strand comprises a reverse transcriptase primer, cDNA substantially complementary to the target nucleic acid, and the other part of the T7 promoter (e.g., a double-stranded T7 promoter).

[0056] In Fig. 6F, the promotor sequence is used to amplify or make multiple copies of target nucleic acid 20. As noted above, this may be performed in situ within the cell. A variety of amplification techniques may be used to amplify the target nucleic acid. For example, if the promoter is a T7 promoter, then a T7 RNA polymerase may be used. The amplification reagents may be added to the cell, e.g., after extending target nucleic acid 20 to further include a promoter. The reagents may include a suitable polymerase (for example, a T7 RNA polymerase), suitable mononucleotides, etc. In some cases, such techniques may be used to produce a plurality of copies of the target nucleic acid 20, e.g., positioned at or near the original location of the target nucleic acid 20 within the cell, i.e., the amplification of the target nucleic acid may occur in situ. The amplified target nucleic acid may be determined, qualitatively and / or quantitatively, in situ within the cell, in certain embodiments. It is believed that more copies of a target nucleic acid may allow more signaling entities to recognize and bind the target nucleic acid at a specific location, which may allow an increase in the signal that is observed due to the signaling entities. For example, as is shown schematically in Fig. 6G, a signaling entity 70 has been added that is able to recognize a specific location on target nucleic acid 20. Because of the presence of multiple copies of target nucleic acid 20, multiple copies of signaling entity 70 are able to bind in situ, typically at or near the site of the original target nucleic acid thereby increasing the strength of the signal produced by the signaling entity.

[0057] A variety of techniques may be used for in situ determination, such as MERFISH or multiplexed error-robust fluorescence in situ hybridization. Other examples include FISH, fluorescence labeling, or the like. Non-limiting examples of such techniques, including but not limited to MERFISH, are disclosed in, for example, US Pat. No. 11,098,303 or Int. Pat. Apl. Pub. No. WO 2016 / 018960, each incorporated herein by reference in its entirety. In addition, techniques for determining target nucleic acids within a cell or in situ may be combined with techniques for amplifying signaling entities in some embodiments, for example, such as those disclosed in Int. Pat. Apl. Pub. No. WO 2020 / 123742 or U.S. Pat. Apl. Pub. No. 2022 / 0064697, each incorporated herein by reference in its entirety.

[0058] The above discussion is a non-limiting example of one embodiment of the present disclosure that can be used to produce for the amplification of RNA, e.g., in situ. However, other embodiments are also possible. Accordingly, more generally, various aspects are directed to various systems and methods for the amplification of RNA, e.g., for MERFISH or other applications.

[0059] Thus, one set of embodiments is generally directed to determining a sample, which may include a cell culture, a suspension of cells, a biological tissue, an organ, a biopsy, an organism, a biological specimen, or the like, in accordance with certain aspects. The sample can also be cell-free but nevertheless contain nucleic acids in some cases. If the sample contains a cell, the cell may be a human cell, or any other suitable cell, e.g., a mammalian cell, a fish cell, an insect cell, a plant cell, or the like. In some cases, only a single cell is student, although more than one cell may be present in other cases. If more than one cell is present, the cells may be of the same or different types.

[0060] In certain cases, a cell may be fixed, e.g., to preserve the positions of the nucleic acids or other targets within the cell. Techniques for fixing cells are known to those of ordinary skill in the art. As non-limiting examples, a cell may be fixed using chemicals such as formaldehyde, paraformaldehyde, glutaraldehyde, ethanol, methanol, acetone, acetic acid, glyoxal, methacam, or the like. In one embodiment, a cell may be fixed using HEPES- glutamic acid buffer-mediated organic solvent (HOPE).

[0061] There are several different approaches to amplify the signal that are contemplated herein, which include enzymatic and non-enzymatic approaches. Enzymatic approaches typically rely on several enzymatic steps, such as ligation followed by amplification. The advantage of enzymatic approaches is that the signal amplification can be very high, allowing many fluorophores to be detected. However, there are several disadvantages including low efficiency of certain enzymes, which leads to false-negatives and lower detection efficiency) and high background signals, which leads to false-positives. Enzymatic approaches can be used for spatially resolved single-cell transcriptomics measurements. For example, by combining branched DNA amplification with MERFISH, it can be shown that RNAs can be detected with 16 encoding probes, which in principle allows the detection of RNAs with <200 nt length using an overlapping encoding probe design. As a non-limiting example, in some embodiments, RNA molecules can be amplified in situ using a two-step enzymatic amplification approach (see, e.g., Fig. 2A). For example, in one embodiment, reverse transcription (RT) with template switching may be used.

[0062] In one set of embodiments, nucleic acids within a cell may be determined, e.g., after fixing the cell or otherwise preserving the positions of the nucleic acids or other targets within the cell, e.g., in situ. In some cases, at least some of the nucleic acids may be fixed at specific sites within the cell, e.g., where such nucleic acids are normally or endogenously found. The determination of the nucleic acids may be qualitative and / or quantitative. In addition, in some embodiments, expansion microscopy techniques may be used, e.g., to improve determination of the nucleic acids within a cell or other sample.

[0063] Examples of nucleic acids that may be determined in a cell include DNA (for example, genomic DNA), RNA, or other nucleic acids that are present within a cell (or other sample). The nucleic acids may be located anywhere within the cell, e.g., in the nucleus, in the cytoplasm, in the mitochondria, attached to specific organelles, or the like. The nucleic acids may be endogenous to the cell, or added to the cell. For instance, the nucleic acid may be viral, or artificially created. In some cases, the nucleic acid to be determined may be expressed by the cell. The nucleic acid is RNA in some embodiments. The RNA may be coding and / or non-coding RNA. For example, the RNA may encode a protein. Non-limiting examples of RNA that may be studied within the cell include mRNA, siRNA, rRNA, miRNA, tRNA, IncRNA, snoRNAs, snRNAs, exRNAs, piRNAs, or the like. In some cases, a significant portion of the nucleic acid within the cell may be studied. For instance, in some cases, enough of the RNA present within a cell may be determined so as to produce a partial or complete transcriptome of the cell. In some cases, at least 4 types of mRNAs are determined within a cell, and in some cases, at least 3, at least 4, at least 7, at least 8, at least 12, at least 14, at least 15, at least 16, at least 22, at least 30, at least 31, at least 32, at least 50, at least 63, at least 64, at least 72, at least 75, at least 100, at least 127, at least 128, at least 140, at least 255, at least 256, at least 500, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 4,000, at least 5,000, at least 7,500, at least 10,000, at least 12,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 40,000, at least 50,000, at least 75,000, or at least 100,000 types of mRNAs may be determined within a cell.

[0064] In some cases, the transcriptome of a cell may be determined. It should be understood that the transcriptome generally encompasses all RNA molecules produced within a cell, not just mRNA. Thus, for instance, the transcriptome may also include rRNA, tRNA, siRNA, etc. in certain instances. In some embodiments, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the transcriptome of a cell may be determined.

[0065] In some cases, the nucleic acid within the cell may include a poly-A tail. The poly-A tail may have at least 7, at least 10, at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, or at least 250 consecutive A’s in it. In some cases, the poly-A tail may have no more than 300, no more than 275, no more than 250, no more than 200, no more than 150, no more than 100, or no more than 50 consecutive A’s in it. In some cases, the poly-A tail may have consecutive A’s of between any of these ranges, e.g., the poly-A tail may have between 150 and 300 consecutive A’s, between 225 and 275 consecutive A’s, between 50 and 100 consecutive A’s, etc.

[0066] In one embodiment, the nucleic acid may be an mRNA having a poly-A tail. In other embodiments, however, the nucleic acid may be other RNAs, e.g., including any of those disclosed herein. For instance, in some embodiments, polyadenylation of RNA may be used to improve template efficiency of reverse transcription, e.g., to determine RNAs that do not have a poly-A-tail, to determine samples that have fragmented or degraded RNA, or the like.

[0067] Thus, in certain cases, nucleic acids within a cell may be modified to include a poly-A tail. For instance, in some embodiments, a cell or other sample may be exposed to a polyadenylation enzyme, e.g., in situ, to a poly-A tail on the nucleic acid. One non-limiting example of a polyadenylation enzyme is polynucleotide adenylyltransferase. Various polyadenylation enzymes such as polynucleotide adenylyltransferases can be obtained commercially. The polyadenylation enzyme may be added to a cell or other sample, and in some cases, along with ATP or adenosine triphosphate.

[0068] In addition, in some embodiments, a primer sequence can be added using T4 RNA ligase. In some embodiments, a primer sequence may be ligated to the RNA at the 3’ end, and a complementary sequence may be added to primer the RT reaction.

[0069] The primer may be a gene-specific primer, in accordance with one embodiment. In some cases, the primer may be a random primer, e.g., a random pentamer primer, a random hexamer primer, a random heptamer primer, etc. In some cases, the random primer may be an 8-mer, a 9-mer, a 10-mer, or a higher-order primer. In one embodiment, the primer sequence is T(30)VN (SEQ ID NO: 3). In another embodiment, however, the primer sequence is a sequence that is not T(30)VN (SEQ ID NO: 3).

[0070] In addition, in certain embodiments, the primer may include an LNA, or a locked nucleic acid. In some cases, the LNA may be a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2’ oxygen and 4, carbon, thereby “locking” the nucleic acid conformation.

[0071] In one set of embodiments, the poly-A tail of the nucleic acid may be exposed to a sequence comprising a primer, such as a reverse transcriptase (RT) primer. This may be used, in accordance with certain embodiments, to allow for reverse transcription with template switching, as discussed herein. In some cases, as shown in Fig. 2A, a primer binds to the poly-A tail of the mRNA.

[0072] In certain embodiments, the sequence may comprise a primer that is able to recognize the poly-A tail. Such primers are available commercially from a variety of sources. In some cases, the primer may be substantially rich in T’s, which may be able to hybridize the A’s in the poly-A tail. For instance, the primer may be at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% T’s. In some embodiments, the primer may have at least 7, at least 10, at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, or at least 250 consecutive T’s in it. In some cases, the primer may have no more than 300, no more than 275, no more than 250, no more than 200, no more than 150, no more than 100, or no more than 50 consecutive T’s in it. In some cases, the primer may have consecutive T’s of between any of these ranges, e.g., the primer may have between 150 and 300 consecutive T’s, between 225 and 275 consecutive T’s, between 50 and 100 consecutive T’s, etc. Typically, a primer is a nucleic acid (e.g., DNA or RNA) that serves as a starting point for nucleic acid synthesis, allowing polymerase enzymes such as nucleic acid polymerase to extend the primer and replicate the complementary strand. A primer may be complementary to and to hybridize to a target nucleic acid. In some embodiments, the primer is a synthetic primer. In some embodiments, a primer is a non-naturally-occurring primer. A primer typically has a length of 10 to 50 nucleotides. For example, a primer may have a length of 10 to 40, 10 to 30, 10 to 20, 25 to 50, 15 to 40, 15 to 30, 20 to 50, 20 to 40, or 20 to 30 nucleotides. In some embodiments, a primer has a length of 18 to 24 nucleotides.

[0073] After binding or hybridization of the primer to the poly-A tail of the nucleic acid target, in one set of embodiments, the primers may be used as a primer for an enzyme such as reverse transcriptase. In some cases, the reverse transcription may occur with template switching, where a first template (e.g., the nucleic acid target) is replaced with a second template (e.g., a sequence containing a promoter), such as is discussed below, e.g., during transcription. This may be useful, for example for attaching a sequence comprising a promoter to the nucleic acid target, for use in amplification of the nucleic acid target or the like.

[0074] Thus, in some cases, reverse transcription may be performed using an RT enzyme such as reverse transcriptase. The reverse transcriptase may be a viral reverse transcriptase, e.g., M-MLV reverse transcriptase, AMV reverse transcriptase, or the like. A variety of reverse transcriptase enzymes are commercially available. Those of ordinary skill in the art will be aware of suitable conditions for causing reverse transcription to occur.

[0075] The reverse transcriptase may be able to recognize or hybridize to the RT primer on the primer sequence, thereby allowing reverse transcription to occur. In some cases, a reverse transcriptase may be added along with mononucleotides (e.g., dNTPs or deoxyribose nucleoside triphosphates), which allows the reverse transcriptase to synthesize DNA (e.g., cDNA or complementary DNA) using the target nucleic acid as a template. In some cases, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the RNA molecules within a sample may be reverse transcribed into cDNA.

[0076] The reverse transcriptase enzyme may synthesize complementary DNA (cDNA) and optionally, add a few non-templated nucleotides at the 5’ end of the mRNA template, in accordance with one set of embodiments. These may be added once the reverse transcriptase has gone past the end of the target nucleic acid. For example, the reverse transcriptase enzyme may add 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides that are not complementary. In some cases, these may be attached to an end of the cDNA sequence.

[0077] In some cases, the non-templated nucleotides at the 5’ end of the cDNA may include one or more C’s. Without wishing to be bound by any theory, it is believed that some types of reverse transcriptase enzyme, once the target strand has ended, will begin adding one or more C’s to the cDNA strand, e.g., in the absence of any target strand. Accordingly, the cDNA strand may, in certain embodiments, contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more C’s on the end of the cDNA strand.

[0078] The non-templated nucleotides then may be annealed or hybridized in one set of embodiments to a template oligonucleotide, e.g., comprising a promoter. In some cases, the template oligonucleotide comprising a promoter may be a template switching oligonucleotide (TSO), for example, comprising a T7 promoter sequence. Besides the T7 promoter, other suitable promoters that may be used include, but are not limited to, T3 promoters or SP6 promoters. In addition, in some embodiments, more than one promoter may be added.

[0079] The template oligonucleotide or TSO may have any length. For example, the template oligonucleotide or TSO may have a length of at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides. In some cases, the length may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, be no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides. Combinations of any of these are also possible, e.g., the length may be between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0080] Thus, in certain embodiments, the non-templated nucleotides at the end of the cDNA are hybridized to a template switch oligonucleotide (TSO) sequence, for example, if the non- templated nucleotides comprise one or more C’s and the TSO sequence comprises one, two, three, or more consecutive G’s. The TSO may include a promoter, such as a T7 promoter. As mentioned, other non-limiting examples of promoters include T3 promoters or SP6 promoters. Accordingly, in some cases, the TSO may be an oligonucleotide sequence that is able to hybridize to the untemplated C nucleotides added by the reverse transcriptase during reverse transcription. In certain embodiments, the TSO may be useful for cDNA amplification, e.g., due to the presence of the promoter sequence.

[0081] Other TSO sequences are also possible in some embodiments. For example, the TSO sequence may comprise one, two, three, four or more consecutive A’s, T’s, C’s or G’s, in various embodiments. In some cases, the template switching oligonucleotide sequence may comprise a sequence rNrG+G, wherein N is A, C, G, or T; +G is a locked nucleic acid; and r is any suitable integer, e.g., 1, 2, 3, 4, 5, 6, or more. Other locked nucleic acids may also be used in other embodiments within the TSO. For instance, the template switching oligonucleotide sequence may comprise a sequence rNrX+X, wherein N and X are each independently any suitable nucleotide (with the + indicating a locked nucleotide), and r is any suitable integer, e.g., 1, 2, 3, 4, 5, 6, or more.

[0082] For instance, in one set of embodiments, this may lead the reverse transcriptase enzyme to switch templates from the target nucleic acid to the TSO or other template oligonucleotide, e.g., during synthesis. The resulting cDNA that is produced may have a promoter sequence such as a T7 promoter sequence. The reverse transcriptase may then be used the TSO as a second template, producing a sequence on the cDNA that is substantially complementary to the sequence of the TSO or other template oligonucleotide. Thus, the promoter sequence may be one that, when transcribed (e.g., by the reverse transcriptase), produces a double- stranded promoter sequence. For example, the promotor sequence may be a double- stranded T7 promoter (for example, as shown in Fig. 2A).

[0083] In one set of embodiments, amplified nucleic acids may be produced, e.g., using the promoter, to initiate amplification. The sequence that is to be amplified may include, for example, the sequence comprising the TSO (e.g., comprising a promoter) and the target nucleic acid sequence, e.g., as discussed above. The target nucleic acid may be amplified, for example, by exposing the target nucleic acid to one or more polymerases, for example, in the presence of mononucleotides (e.g., dNTPs or deoxyribose nucleoside triphosphates), which allows the polymerase to synthesize nucleic acids (e.g., DNA or RNA) using the target nucleic acid as a template.

[0084] For example, in some embodiments, nucleic acids may be produced or amplified using an RNA polymerase such as T7 RNA polymerase, or using a DNA polymerase such as T7 DNA polymerase. The amplification reaction may be facilitated, in certain embodiments, by a promoter (e.g., a T7 promoter). This may result in generation of many copies of the target nucleic acid, e.g., downstream of the promoter. A variety of RNA polymerases are available commercially, including T7, T3, or SP6 RNA polymerases. Other non-limiting examples of RNA polymerases include RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, or RNA polymerase V. The RNA polymerase may arise from any suitable source, e.g., bacteria, viruses, or eukaryotes.

[0085] Similarly, a variety of DNA polymerases are available commercially, including T7 DNA polymerase. Other examples of DNA polymerases include DNA polymerase I, DNA polymerase II, DNA polymerase III, DNA polymerase IV, DNA polymerase V, or DNA polymerases alpha, beta, lambda, gamma, sigma, mu, delta, epsilon, eta, iota, kappa, xi, theta, or Revl. Another non-limiting example is TdT.

[0086] In some embodiments, more than one polymerase may be used. In addition, as previously discussed, in some embodiments, the oligonucleotides may include promoter sequences, such as one or more of T7, T3, or SP6 promoter sequences, that can be used to facilitate the transcription process. Those of ordinary skill in the art will be aware of suitable conditions for causing transcription using polymerases such as DNA or RNA polymerases.

[0087] The amount of nucleic acid production can be controlled in some embodiments by controlling the amount and / or concentration of nucleotides and / or cofactors that are present as well as the duration of the transcription reaction.

[0088] In some embodiments, multiple copies of DNA may be produced from each target nucleic acid. In addition, optionally, RNA may then be removed or selectively degraded, relative to the DNA, for example, through alkaline hydrolysis, enzymatic digestion, or other techniques.

[0089] In one set of embodiments, relatively large quantities or masses of oligonucleotides can be produced as is discussed herein, e.g., at least about 10'3pmol, at least about 10'2pmol, at least about 10'1pmol, at least about 10° pmol, at least about 101pmol, at least about 102pmol, at least about 103pmol, etc.

[0090] In some cases, at least about 100, at least about 300, at least about 500, at least about 1,000, at least about 3,000, at least about 5,000, at least about 10,000, at least about 30,000, at least about 50,000 at least about 100,000, at least about 300,000, at least about 500,000, at least about 1,000,000 copies, at least about 3,000,000 copies, at least about 5,000,000 copies, at least about 10,000,000 copies, at least about 30,000,000 copies, at least about 50,000,000 copies, or at least about 100,000,000 copies of the oligonucleotide may be produced.

[0091] Determination of the amplified nucleic acids may occur in situ using any suitable technique, qualitatively and / or quantitatively, in accordance with one set of embodiments. For instance, in one embodiment, MERFISH or multiplexed error-robust fluorescence in situ hybridization may be used. See, for example, US Pat. No. 11,098,303 or Int. Pat. Apl. Pub. No. WO 2016 / 018960, each incorporated herein by reference in its entirety. Other example techniques include fluorescence in situ hybridization (FISH), fluorescence labeling (e.g., of nucleic acid probes), Y-branched probe in situ hybridization (Yn-situ), switchable fluorescent oligonucleotide (SFO) techniques, RNAScope, or the like. Still other examples include hybridization chain reactions, branched DNA. In some cases, sequencing can also be used as a readout. In addition, in some cases, sequencing-based spatial transcriptomics that in situ amplification of RNA techniques such as those described herein can be used to enhance include, but are not limited to, Visium Spatial Gene Expression or droplet-based single-cell RNA sequencing. Other non-limiting examples include radioactive ISH of ribosomal RNA (rRNA), radioactive ISH of goblin mRNAs, FISH of rRNA, immunological FISH with biotin-labeled probe, FISH of actin mRNA, Drosophila enhancer trap, WM ISH in Drosophila, ES cell enhancer and gene trap in mice, in situ reporter in C. elegans, or the like.

[0092] These may optionally be varied using a variety of different techniques, according to various aspects. See, e.g., Fig. 5. For example, in one set of embodiments, 5’ mRNA capping may be used to improve template switching efficiency. In another set of embodiments, single-stranded binding proteins may be used to improve T7 amplification efficiency. In yet another set of embodiments, capped TSO may be used to prevent further template switching, which can reduce background spots. In still another set of embodiments, locked nucleic acids (LNA) may be incorporated into the T7 amplification step to improve probe binding affinity. In yet another set of embodiments, protein digestion may be used prior to reverse transcription to improve efficiency of reverse transcription. In still another set of embodiments, polyadenylation of RNA may be used to improve template efficiency of reverse transcription, to image RNAs that do not have a poly-A-tail, and / or to image samples that have fragmented or degraded RNA. In yet another set of embodiments, probes may be anchored into a gel matrix using alkylating agents, such as Melpha-X and Label-X, to improve the performance of MERFISH over multiple rounds of hybridization and imaging. See also Int. Pat. Apl. Pub. No. WO 2018 / 089445, incorporated herein by reference in its entirety. In still another set of embodiments, multiple rounds of amplification via repeating the RT and T7 amplification steps may be used to further enhance the signal (Fig. 5C).

[0093] In addition, in certain embodiments, in situ amplification techniques such as those described herein may allow for the detection of short RNA sequences, such as RNA isoforms that differ by short sequences, as well as short genes and non-coding RNAs including microRNAs (miRNAs). This may be useful, for example, to increase the genomic coverage of spatially resolved single-cell transcriptomics measurements. These amplification techniques could also help to reduce the cost of spatial transcriptomics measurements in some cases, because a smaller number of oligonucleotide probes would be needed with this amplification method. This method may also allow the detection of RNA editing, such as A- to-I editing events, in a multiplexed manner in certain embodiments. Additional applications include, but are not limited to detection of single-nucleotide variations for various applications, such as cancer research and lineage tracing.

[0094] In some cases, the techniques described herein could be applied to multiplexed protein imaging. For protein detection, antibodies can be tagged with oligonucleotide barcodes that can then be amplified in situ. Endogenous RNAs can also be amplified and detected simultaneously for integrated transcriptomics and proteomics.

[0095] In some cases, the techniques described herein could be used for detection of artificial nucleic acid barcodes that are introduced into cells, for example for imaging-based genetic screening, lineage tracing, neuronal projection mapping, or connectivity mapping.

[0096] In some cases, two nucleic acids that are substantially complementary may differ by no more than 5, 4, 3, 2, or 1 nucleotides. In some cases, the two nucleic acids may have identical nucleic acid sequences.

[0097] The following are incorporated herein by reference in their entireties: Int. Pat. Apl. Pub. Nos. WO 2016 / 018960, WO 2016 / 018963, WO 2018 / 089445, WO 2018 / 218150, WO 2018 / 089438, WO 2020 / 123742, WO 2020 / 214885, WO 2021 / 102122, and WO 2021 / 138078. In addition, U.S. Ser. No. 63 / 513,612 is incorporated herein by reference. Furthermore, U.S. Provisional Patent Application Serial No. 63 / 513,612, filed July 14, 2023, entitled “In Situ Amplification of RNA,” by Zhuang, et al., and U.S. Provisional Patent Application Serial No. 63 / 621,745, filed January 17, 2024, entitled “In Situ Amplification of RNA,” by Zhuang, et al. are each incorporated herein by reference in its entirety.

[0098] The following examples are intended to illustrate certain embodiments of the present disclosure, but do not exemplify the full scope of the disclosure.

[0099] EXAMPLE 1

[0100] This example illustrates one embodiment demonstrating amplification of RNA. In this example, a cell-type specific gene (Sst) was selected and the signal detected using singlemolecule FISH (smFISH) without amplification and with an embodiment of the amplification methods described herein. In situ RNA amplification provides brighter signal than unamplified smFISH (Fig. 2B). A second gene (Slcl7a7) was also selected and a 100 bp segment was detected using four probes with an embodiment of the amplification methods described herein (Fig. 2C). Additionally, five exons of the Vip gene were detected using sequential rounds of hybridization and signal cleavage (Fig. 2D). To determine whether this was compatible with MERFISH, a 92-probe per gene library for -250 genes was used, which was previously used to classify cell types in the mouse primary motor cortex (MOp). These -250 genes were measured in the mouse MOp and compared to the previously published results without amplification (Fig. 3). The probe number was then reduced to eight probes per gene for these -250 genes and measured in the mouse MOp using MERFISH with the amplification method described here (Fig. 4).

[0101] Fig. 2 shows in situ RNA amplification using reverse transcription and transcription. In the example of Fig. 2A, the first step is reverse transcription (RT) with template switching. In this step, a primer binds to the poly-A tail of the mRNA. The RT enzyme synthesizes complementary cDNA and adds a few non-templated nucleotides at the 5’ end of the mRNA template. The non-templated nucleotides then anneal to a template switching oligo (TSO) with a T7 promoter sequence, leading the RT enzyme to switch templates from the mRNA to the TSO. The resulting cDNA has a T7 promoter sequence, which is complementary to the sequence on the TSO, attached to the 3' end. The second step is generation of RNA amplicons using T7 RNA polymerase. This step is facilitated by the presence of the double stranded T7 promoter region.

[0102] Fig. 2B shows the detection of Sst in mouse brain tissues using 30, 5, and 1 probes with and without amplification. Asterisk indicates enhanced contrast. Fig. 2C shows the detection of a 100 bp segment of Slcl7a7 in mouse brain tissue with amplification using two different channels to confirm colocalization. Fig. 2D shows the detection oiVip exons using two probes per exon with amplification. Sequential rounds of hybridization were used to detect different exons. Control images confirm that the signal has been cleaved between hybridization rounds.

[0103] Fig. 3 shows MERFISH with in situ RNA amplification using 92 probes using methacam fixation (Figs. 3A, 3D, and 3G), glyoxal fixation (Figs. 3B, 3E, and 3H), and formaldehyde fixation (Figs. 3C, 3F, and 31). Figs. 3A-3C show the correlation between MERFISH data with amplification and MERFISH data without amplification. Each dot is the RNA counts per cell measured for each imaged gene. Figs. 3D-3F show the cortical layer structure in mouse brains determined using MERFISH data with amplification. The images show transcriptionally distinct cell clusters in different colors, with each cell color-coded or shaded by its cluster identity. Figs. 3G-3I shows correspondence between cell types determined using MERFISH data with amplification and those determined with the published MERFISH data without amplification.

[0104] Fig. 4 shows MERFISH measurements of the MOp using eight probes per gene with amplification. Fig. 4A shows correlation between amplified, eight-probe MERFISH data and unamplified, 92-probe MERFISH. Each dot is the RNA counts per cell measured for each imaged gene. Fig. 4B shows the cortical layer structure in mouse brains determined from the amplified, eight-probe MERFISH data. Fig. 4C shows the correspondence between cell types determined using amplified, eight-probe MERFISH data and those determined with the published 92-probe MERFISH data without amplification.

[0105] Fig 5 shows assay optimization. Fig. 5A shows smFISH of Sst using RNA amplification with (1) 5’ mRNA capping, which can enhance template- switching efficiency, (2) single-stranded binding proteins (SSB), which can improve T7 amplification, and (3) capped TSO, which prevents additional template switching from occurring. Fig. 5B shows smFISH of Sst using combination of TSO sequences (TSO sequence 1: / 5Biosg / TAATACGACTCACTATAGGGAAATArGrG+G (SEQ ID NO.: 1), TSO sequence 2: / 5Biosg / TAATACGACTCACTATAGGGAGArGrG+G (SEQ ID NO.: 2)) and enzymes from different vendors (T7 1: ThermoFisher, T7 2: New England Biolabs). Fig. 5C shows a signal of one round of RT-T7 amplification (top) and two rounds of RT-T7 amplification. Representative images from the same round of an eight-probe MERFISH experiment. For the experiments in Figs. 2, and 3, uncapped TSO sequence were used (generally the same sequences as above, except without the biotin ( / 5Biosg / ) cap). The RT primer sequence was T(30)VN (V = A or G or C, N = A or G or C or T) (SEQ ID NO: 3).

[0106] Other sequences that can be used include, but are not limited to, / 5Blosg / FAATACGACTCACTATAGGG AATA rNrG+G (SEQ ID NO: 4), / 5Biosg / TAATACGACTCACTATAGGGAAAT rGrG+G (SEQ ID NO: 5), / 5Biosg / TAATACGACTCACTATAGGGAGA rGrG+G (SEQ ID NO: 6), or / 5Biosg / TAATACGACTCACTATAGGGAGA rNrG+G (SEQ ID NO: 7) (with and without the biotin or / 5Bisog / cap). Other RT primer sequences that could be used include, but are not limited to,TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQID N0: 8)TTACACTCCATCCACTCAATT+TT+TT+TT+TT+TT+TT+TT+TT+TT+TTTTT VN (SEQ ID NO: 9), or TTACACTCCATCCACTCAATT+TT+TT+TT+TT+TT+TT+TT+TT+TT+TTTTT (SEQ ID NO: 10). Fig. 7 shows MERFISH with in situ RNA amplification using 92 probes per gene. Fig. 7A shows correlation between MERFISH data with amplification and MERFISH data without amplification. Each dot is the RNA counts per cell measured for each imaged gene. Fig. 7B shows correspondence between cell types determined using MERFISH data with amplification and those determined with the published MERFISH data without amplification.

[0107] Fig. 8 shows MERFISH with in situ RNA amplification with probes targeting the 3’ end and the 5’ end of transcript. Fig. 8 A shows correlation between MERFISH data with amplification using 12 probes per gene targeting the 5’ end of the transcript and published MERFISH data without amplification using 92 probes per gene. Each dot is the RNA counts per cell measured for each imaged gene. Fig. 8B shows correspondence between cell types determined using MERFISH data with amplification using 12 probes per gene targeting the 5’ end of the transcript and those determined with the published MERFISH data without amplification. Fig. 8C shows correlation between MERFISH data with amplification using 12 probes per gene targeting the 3’ end of the transcript and published MERFISH data without amplification using 92 probes per gene. Each dot is the RNA counts per cell measured for each imaged gene. Fig. 8D shows correspondence between cell types determined using MERFISH data with amplification using 12 probes per gene targeting the 3’ end of the transcript and those determined with the published MERFISH data without amplification.

[0108] Fig. 9 shows MERFISH with in situ RNA amplification with six and four probes per gene. Fig. 9A shows correlation between MERFISH data with amplification using six probes per gene and the published MERFISH data without amplification using 92 probes per gene. Each dot is the RNA counts per cell measured for each imaged gene. Fig. 9B shows the cortical layer structure in mouse brains determined using MERFISH data with amplification. The images show transcriptionally distinct cell clusters in different colors, with each cell color-coded or shaded by its cluster identity. Fig. 9C shows correspondence between cell types determined using MERFISH data with amplification using six probes per gene and those determined with the published MERFISH data without amplification using 92 probes per gene. Fig. 9D shows correlation between MERFISH data with amplification using four probes per gene and the published MERFISH data without amplification using 92 probes per gene. Each dot is the RNA counts per cell measured for each imaged gene. Fig. 9E shows the cortical layer structure in mouse brains determined using MERFISH data with amplification. The images show transcriptionally distinct cell clusters in different colors, with each cell color-coded or shaded by its cluster identity. Fig. 9F shows correspondence between cell types determined using MERFISH data with amplification using four probes per gene and those determined with the published MERFISH data without amplification using 92 probes per gene.

[0109] Fig. 10 shows MERFISH with in situ RNA amplification for 4,425 genes using six probes per gene and in-situ RNA amplification. Correlation between 4,425 gene MERFISH data with amplification using six probes per gene and RNA sequencing data.

[0110] Fig. 11 shows MERFISH with in situ RNA amplification, with and without expansion microscopy. Correlation is between MERFISH data with amplification, with and without expansion using six probes per gene. Each dot is the RNA counts per cell measured for each imaged gene.

[0111] A challenge with imaging a large number of genes is the high density of RNA molecules, which prevents neighboring RNA molecules from being resolved from each other using MERFISH. To overcome this challenge, expansion microscopy can be used following in-situ RNA amplification to physically separate RNA molecules in an expandable gel for imaging a large number of genes.

[0112] For the data shown in Figs. 7-11, adult C57BL / 6J male mice aged 14 weeks were euthanized with CO2. Their brains were harvested and frozen in optimal cutting temperature compound (Tissue-Tek O.C.T.) and stored at -80 °C until sectioning. Frozen brains were sectioned on a cryostat (Leica CM3050 S). Coronal, 10-micrometer- thick slices were sectioned and placed onto coverslips. Brain samples were fixed with glyoxal and amplified using in-situ RNA amplification, as shown in Fig. 2A. RT primer SEQ ID NO: 10 and TSO SEQ ID NO: 1 were used. Following in-situ RNA amplification, MERFISH probes were hybridized, and the samples were imaged using MERFISH. For Figs. 7-9, MERFISH probes targeted 242 genes described in Zhang, Meng, el al., '‘Spatially resolved cell atlas of the mouse primary motor cortex by MERFISH,” Nature, 598(787$?): 137- 143, 2021. In Fig. 11, samples were expanded prior to imaging. See generally Xia, Chenglong, et al. “Spatial transcriptome profiling by MERFISH reveals subcellular RNA compartmentalization and cell cycle-dependent gene expression,” Proc. Natl. Acad. Set. USA, 116(39):19490-19499, 2019.

[0113] While several embodiments of the present disclosure have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the present disclosure. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the teachings of the present disclosure is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the disclosure may be practiced otherwise than as specifically described and claimed. The present disclosure is directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the scope of the present disclosure.

[0114] In cases where the present specification and a document incorporated by reference include conflicting and / or inconsistent disclosure, the present specification shall control. If two or more documents incorporated by reference include conflicting and / or inconsistent disclosure with respect to each other, then the document having the later effective date shall control.

[0115] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0116] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.”

[0117] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0118] When the word “about” is used herein in reference to a number, it should be understood that still another embodiment of the disclosure includes that number not modified by the presence of the word “about.”

[0119] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0120] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Claims

CLAIMSWhat is claimed is:

1. A method, comprising: exposing a primer sequence to a target RNA, wherein the primer sequence is substantially complementary to at least a portion of the target RNA; using reverse transcriptase to synthesize a first nucleic acid portion comprising a portion substantially complementary to at least a portion of the target RNA, wherein the first nucleic acid portion is attached to the primer sequence; and using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand.

2. The method of claim 1, wherein the target RNA is in vitro.

3. The method of any one of claims 1 or 2, wherein the method occurs within a cell.

4. The method of claim 3, wherein the cell is fixed.

5. The method of any one of claims 1-4, wherein the method occurs with a tissue.

6. The method of any one of claims 1-5, wherein the method occurs with an organ.

7. The method of any one of claims 1-6, wherein the target RNA comprises a poly-A tail.

8. The method of claim 7, comprising exposing the primer sequence to the poly-A tail of the target RNA.

9. The method of any one of claims 7 or 8, wherein the primer sequence is substantially complementary to the poly-A tail.

10. The method of any one of claims 7-9, wherein the primer sequence comprises a sequence substantially complementary to at least 7 consecutive A’s of the poly-A tail.

11. The method of any one of claims 7-10, wherein the primer sequence comprises a sequence substantially complementary to at least 25 consecutive A’s of the poly-A tail.

12. The method of any one of claims 7-11, wherein the primer sequence comprises a sequence substantially complementary to at least 50 consecutive A’s of the poly-A tail.

13. The method of any one of claims 1-12, wherein the primer sequence is T(30)VN (SEQ ID NO: 3).

14. The method of any one of claims 1-12, wherein the primer sequence is not T(30)VN (SEQ ID NO: 3).

15. The method of any one of claims 1-14, wherein the primer sequence comprises a gene- specific primer.

16. The method of any one of claims 1-15, wherein the primer sequence comprises a random hexamer primer.

17. The method of any one of claims 1-16, wherein the primer sequence comprises a reverse transcriptase primer.

18. The method of any one of claims 1-17, wherein the primer sequence is an oligo-dT primer.

19. The method of any one of claims 1-18, wherein the primer sequence comprises at least 7 consecutive T’s.

20. The method of any one of claims 1-19, wherein the primer sequence comprises at least 10 consecutive T’s.

21. The method of any one of claims 1-20, wherein the primer sequence comprises an LNA.

22. The method of any one of claims 1-21, wherein the reverse transcriptase is a viral reverse transcriptase.

23. The method of any one of claims 1-22, wherein the reverse transcriptase is M-MLV reverse transcriptase.

24. The method of any one of claims 1-23, wherein the reverse transcriptase is AMV reverse transcriptase.

25. The method of any one of claims 1-24, wherein the first nucleic acid portion is covalently bound to the primer sequence.

26. The method of any one of claims 1-25, wherein the second nucleic acid portion is covalently bound to the first nucleic acid portion.

27. The method of any one of claims 1-26, wherein the first nucleic acid portion further comprises a non-templated portion.

28. The method of any one of claims 1-27, comprising exposing the non-templated portion to a template- switching oligonucleotide.

29. The method of claim 28, wherein using the reverse transcriptase to synthesize the second nucleic acid portion comprises exposing the reverse transcriptase to the template switching oligonucleotide sequence.

30. The method of any one of claims 28 or 29, wherein the template- switching oligonucleotide comprises the promoter sequence.

31. The method of any one of claims 28-30, wherein the template switching oligonucleotide sequence comprises 3 consecutive riboguanosines.

32. The method of any one of claims 28-31, wherein the template switching oligonucleotide sequence comprises a locked nucleic acid.

33. The method of any one of claims 28-32, wherein the template switching oligonucleotide sequence comprises a sequence rNrG+G, wherein N is A, C, G, or T; +G is a locked nucleic acid; and r is 1, 2, 3, 4, or 5.

34. The method of any one of claims 1-33, wherein the promoter sequence comprises a T7 promoter.

35. The method of any one of claims 1-34, wherein the promoter sequence comprises a T3 promoter.

36. The method of any one of claims 1-35, wherein the promoter sequence comprises a SP6 promoter.

37. The method of any one of claims 1-36, further comprising using a polymerase to synthesize a product nucleic acid that is substantially complementary to at least a portion of the DNA strand.

38. The method of claim 37, wherein the product nucleic acid is DNA.

39. The method of claim 37, wherein the product nucleic acid is RNA.

40. The method of any one of claims 1-39, further comprising amplifying the DNA strand to produce amplified nucleic acid.

41. The method of claim 40, wherein the amplified nucleic acid is DNA.

42. The method of claim 40, wherein the amplified nucleic acid is RNA.

43. The method of any one of claims 40-42, comprising producing at least 10 copies of the amplified nucleic acid.

44. The method of any one of claims 40-43, comprising producing at least 50 copies of the amplified nucleic acid.

45. The method of any one of claims 40-44, further comprising amplifying the DNA strand using a polymerase.

46. The method of claim 45, wherein the polymerase comprises an RNA polymerase.

47. The method of any one of claims 45 or 46, wherein the polymerase comprises a T7 RNA polymerase.

48. The method of any one of claims 40-47, further comprising binding a nucleic acid probe to at least some of the amplified nucleic acid.

49. The method of claim 48, further comprising determining the bound nucleic acid probe.

50. The method of any one of claims 40-49, further comprising determining the amplified nucleic acid using imaging.

51. The method of any one of claims 40-50, further comprising determining the amplified nucleic acid using fluorescence in situ hybridization.

52. The method of any one of claims 40-51, further comprising determining the amplified nucleic acid using multiplexed fluorescence in situ hybridization.

53. The method of any one of claims 40-52, further comprising determining the amplified nucleic acid using MERFISH.

54. The method of any one of claims 40-53, further comprising determining the amplified nucleic acid using MERFISH and expansion microscopy.

55. The method of any one of claims 40-54, further comprising binding determining the amplified nucleic acid using sequencing.

56. The method of any one of claims 40-55, further comprising binding determining the amplified nucleic acid using in situ sequencing.

57. The method of any one of claims 40-56, further comprising binding determining the amplified nucleic acid using in situ sequencing and expansion microscopy.

58. The method of any one of claims 1-57, further comprising exposing RNA to a polyadenylation enzyme to produce the RNA comprising the poly-A tail.

59. The method of any one of claims 1-58, wherein the target RNA is mRNA.

60. The method of any one of claims 1-59, wherein the target RNA is pre-mRNA.

61. The method of any one of claims 1-60, wherein the target RNA is miRNA.

62. The method of any one of claims 1-61, wherein the target RNA is rRNA.

63. The method of any one of claims 1-62, wherein the target RNA is tRNA.

64. The method of any one of claims 1-63, wherein the target RNA is synthetic RNA.

65. The method of any one of claims 1-64, wherein the polyadenylation enzyme is polynucleotide adenylyltransferase.

66. A method, comprising: exposing RNA contained within a sample to transcription reagents capable of transcribing the RNA into cDNA; and exposing the cDNA within the sample to amplification reagents capable of amplifying the cDNA within the sample.

67. The method of claim 66, wherein the transcription reagents comprise reverse transcriptase, DNA mononucelotides, and a primer sequence comprising a reverse transcriptase primer.

68. The method of any one of claims 66 or 67, wherein the transcription reagents further comprise a polyadenylation enzyme.

69. The method of any one of claims 66-68, wherein the amplification reagents comprise RNA polymerase and RNA mononucleotides.

70. The method of any one of claims 66-69, wherein the sample comprises a cell.

71. The method of any one of claims 66-70, wherein the sample comprises a tissue.

72. The method of any one of claims 66-71, wherein the sample comprises an organ.

73. A method, comprising: reverse transcribing a plurality of RNA molecules into cDNA within a sample; and amplifying the cDNA within the sample.

74. The method of claim 73, comprising reverse transcribing at least 1% of the plurality of RNA molecules within the sample into cDNA.

75. The method of any one of claims 73 or 74, comprising reverse transcribing at least 10% of the plurality of RNA molecules within the sample into cDNA.

76. The method of any one of claims 73-75, comprising reverse transcribing at least 20% of the plurality of RNA molecules within the sample into cDNA.

77. The method of any one of claims 73-76, comprising reverse transcribing at least 30% of the plurality of RNA molecules within the sample into cDNA.

78. The method of any one of claims 73-77, comprising reverse transcribing at least 40% of the plurality of RNA molecules within the sample into cDNA.

79. The method of any one of claims 73-78, comprising reverse transcribing at least 50% of the plurality of RNA molecules within the sample into cDNA.

80. The method of any one of claims 73-79, comprising reverse transcribing at least 60% of the plurality of RNA molecules within the sample into cDNA.

81. The method of any one of claims 73-80, comprising reverse transcribing at least 70% of the plurality of RNA molecules within the sample into cDNA.

82. The method of any one of claims 73-81, comprising reverse transcribing at least 80% of the plurality of RNA molecules within the sample into cDNA.

83. The method of any one of claims 73-82, comprising reverse transcribing at least 90% of the plurality of RNA molecules within the sample into cDNA.

84. The method of any one of claims 73-83, comprising amplifying the cDNA to produce RNA within the sample.

85. The method of any one of claims 73-84, wherein the sample comprises a cell.

86. The method of any one of claims 73-85, wherein the sample comprises a tissue.

87. The method of any one of claims 73-86, wherein the sample comprises an organ.

88. A method, comprising: exposing a primer sequence to a poly-A tail of an RNA comprising the poly-A tail, wherein the RNA is within a sample; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the RNA, wherein the first nucleic acid portion is attached to the primer sequence; using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand; and amplifying the DNA strand using the promoter sequence to produce amplified RNA.

89. The method of claim 88, further comprising binding nucleic acid probes to at least some of the amplified RNA strands.

90. The method of any one of claims 88 or 89, further comprising determining the nucleic acid probes within the sample.

91. The method of any one of claims 88-90, comprising amplifying the DNA strand using a polymerase.

92. The method of claim 91, wherein the polymerase is RNA polymerase.

93. The method of any one of claims 88-92, wherein the sample comprises a cell.

94. The method of any one of claims 88-93, wherein the sample comprises a tissue.

95. The method of any one of claims 88-94, wherein the sample comprises an organ.

96. The method of any one of claims 88-95, wherein determining the nucleic acid probes within the sample comprises determining the nucleic acid probes within the sample using microscopy.

97. The method of claim 96, comprising determining the nucleic acid probes within the sample using fluorescence microscopy.

98. The method of any one of claims 96 or 97, comprising determining the nucleic acid probes within the sample using expansion microscopy.

99. The method of any one of claims 88-98, further comprising determining the amplified RNA within the sample using fluorescence in situ hybridization.

100. The method of any one of claims 88-99, further comprising determining the amplified RNA within the sample using multiplexed fluorescence in situ hybridization.

101. The method of any one of claims 88-100, further comprising determining the amplified RNA within the sample using MERFISH.

102. The method of any one of claims 88-101, further comprising determining the amplified RNA within the sample using MERFISH and expansion microscopy.

103. The method of any one of claims 88-102, further comprising determining the amplified RNA within the sample using in situ sequencing.

104. The method of any one of claims 88-103, further comprising determining the amplified RNA within the sample using in situ sequencing and expansion microscopy.

105. A method, comprising: exposing RNA within a sample to a polyadenylation enzyme to produce RNA comprising a poly-A tail; exposing a primer sequence to the poly-A tail; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the RNA, wherein the first nucleic acid portion is attached to the primer sequence; using the reverse transcriptase to synthesize a second nucleic acid portion containing a promoter sequence, wherein the second nucleic acid portion is attached to the first nucleic acid portion, and wherein the primer sequence, the first nucleic acid portion, and the second nucleic acid portion defines a DNA strand; and amplifying the DNA strand using the promoter sequence to produce amplified RNA.

106. The method of claim 105, further comprising binding nucleic acid probes to at least some of the amplified RNA strands.

107. The method of any one of claims 105 or 106, further comprising determining the nucleic acid probes within the sample.

108. The method of any one of claims 105-107, comprising amplifying the DNA strand using a polymerase.

109. The method of claim 108, wherein the polymerase is RNA polymerase.

110. The method of any one of claims 105-109, wherein the sample comprises a cell.

111. The method of any one of claims 105-110, wherein the sample comprises a tissue.

112. The method of any one of claims 105-111, wherein the sample comprises an organ.

113. The method of any one of claims 105-112, wherein determining the nucleic acid probes within the sample comprises determining the nucleic acid probes within the sample using microscopy.

114. The method of claim 113, comprising determining the nucleic acid probes within the sample using fluorescence microscopy.

115. The method of any one of claims 113 or 114, comprising determining the nucleic acid probes within the sample using expansion microscopy.

116. The method of any one of claims 113-115, further comprising determining the amplified RNA within the sample using fluorescence in situ hybridization.

117. The method of any one of claims 113-116, further comprising determining the amplified RNA within the sample using multiplexed fluorescence in situ hybridization.

118. The method of any one of claims 113-117, further comprising determining the amplified RNA within the sample using MERFISH.

119. The method of any one of claims 113-118, further comprising determining the amplified RNA within the sample using MERFISH and expansion microscopy.

120. The method of any one of claims 113-119, further comprising determining the amplified RNA within the sample using in situ sequencing.

121. The method of any one of claims 113-120, further comprising determining the amplified RNA within the sample using in situ sequencing and expansion microscopy.

122. A method of synthesizing a nucleic acid, comprising: binding a primer to a poly-A tail of an mRNA; using reverse transcriptase to synthesize a first nucleic acid portion substantially complementary to at least a portion of the mRNA, wherein the first nucleic acid portion is attached to the primer; using the reverse transcriptase to synthesize a second nucleic acid portion not complementary to the mRNA, wherein the second nucleic acid portion is attached to the first nucleic acid portion; annealing the second nucleic acid portion to a template oligonucleotide comprising a promoter; and using the reverse transcriptase to synthesize a third nucleic acid portion substantially complementary to the template oligonucleotide, wherein the third nucleic acid portion is attached to the second nucleic acid portion.

123. The method of claim 122, wherein the promoter comprises a T7 promoter.

124. The method of any one of claims 122 or 123, wherein the promoter sequence comprises a T3 promoter.

125. The method of any one of claims 122-124, wherein the promoter sequence comprises a SP6 promoter.

126. The method of any one of claims 122-125, further comprising generating an RNA amplicon using a polymerase.

127. The method of claim 126, wherein the polymerase is a T7 RNA polymerase.

128. A method of synthesizing a nucleic acid in situ, comprising: binding a primer to a poly-A tail of an mRNA; using reverse transcriptase to synthesize a first nucleic acid portionsubstantially complementary to at least a portion of the mRNA, wherein the first nucleic acid portion is attached to the primer; using the reverse transcriptase to synthesize a second nucleic acid portion not complementary to the mRNA, wherein the second nucleic acid portion is attached to the first nucleic acid portion; annealing the second nucleic acid portion to a template oligonucleotide comprising a promoter; and using the reverse transcriptase to synthesize a third nucleic acid portion substantially complementary to the template oligonucleotide, wherein the third nucleic acid portion is attached to the second nucleic acid portion.

129. The method of claim 128, wherein the promoter comprises a T7 promoter.

130. The method of any one of claims 128 or 129, further comprising generating an RNA amplicon using a polymerase.

131. The method of claim 130, wherein the polymerase comprises a T7 RNA polymerase.

132. The method of any one of claims 128-131, wherein the method occurs within a cell.

133. The method of claim 132, wherein the cell is fixed.

134. The method of any one of claims 128-133, the mRNA is a target RNA.

135. The method of claim 134, comprising exposing the primer sequence to the poly-A tail of the target RNA.

136. The method of any one of claims 134 or 135, wherein the primer sequence is substantially complementary to the poly-A tail.

137. The method of any one of claims 134-136, wherein the primer sequence comprises a sequence substantially complementary to at least 7 consecutive A’s of the poly-A tail.

138. The method of any one of claims 134-137, wherein the primer sequence comprises a sequence substantially complementary to at least 25 consecutive A’s of the poly-A tail.

139. The method of any one of claims 134-138, wherein the primer sequence comprises a sequence substantially complementary to at least 50 consecutive A’s of the poly-A tail.

140. The method of any one of claims 128-139, wherein the primer is a random hexamer primer.

141. The method of any one of claims 128-140, wherein the primer sequence comprises a reverse transcriptase primer.

142. The method of any one of claims 128-141, wherein the primer is an oligo-dT primer.

143. The method of any one of claims 128-142, wherein the primer sequence comprises at least 7 consecutive T’s.

144. The method of any one of claims 128-143, wherein the primer sequence comprises at least 10 consecutive T’s.

145. The method of any one of claims 128-144, wherein the reverse transcriptase is a viral reverse transcriptase.

146. The method of any one of claims 128-145, wherein the reverse transcriptase is M- MLV reverse transcriptase.

147. The method of any one of claims 128-146, wherein the reverse transcriptase is AMV reverse transcriptase.

148. The method of any one of claims 128-147, wherein the first nucleic acid portion is covalently bound to the primer sequence.

149. The method of any one of claims 128-148, wherein the second nucleic acid portion is covalently bound to the first nucleic acid portion.

150. The method of any one of claims 128-149, wherein the first nucleic acid portion further comprises a non-templated portion.

151. The method of any one of claims 128-150, comprising exposing the non-templated portion to a template- switching oligonucleotide.

152. The method of claim 151, wherein using the reverse transcriptase to synthesize the second nucleic acid portion comprises exposing the reverse transcriptase to the template switching oligonucleotide sequence.

153. The method of any one of claims 151 or 152, wherein the template- switching oligonucleotide comprises the promoter sequence.

154. The method of any one of claims 151-153, wherein the template switching oligonucleotide sequence comprises 3 consecutive riboguanosines.

155. The method of any one of claims 151-154, wherein the template switching oligonucleotide sequence comprises a locked nucleic acid.

156. The method of any one of claims 128-155, wherein the promoter sequence comprises a T3 promoter.

157. The method of any one of claims 128-156, wherein the promoter sequence comprises a SP6 promoter.

158. The method of any one of claims 128-157, further comprising using a polymerase to synthesize a product nucleic acid that is substantially complementary to at least a portion of the DNA strand.

159. The method of claim 158, wherein the product nucleic acid is DNA.

160. The method of claim 158, wherein the product nucleic acid is RNA.

161. The method of any one of claims 128-160, further comprising amplifying the DNA strand to produce amplified nucleic acid.

162. The method of claim 161, wherein the amplified nucleic acid is DNA.

163. The method of claim 161, wherein the amplified nucleic acid is RNA.

164. The method of any one of claims 161-163, comprising producing at least 10 copies of the amplified nucleic acid.

165. The method of any one of claims 161-164, comprising producing at least 50 copies of the amplified nucleic acid.

166. The method of any one of claims 161-165, further comprising amplifying the DNA strand using a polymerase.

167. The method of claim 166, wherein the polymerase comprises an RNA polymerase.

168. The method of claims 166 or 167, wherein the polymerase comprises a T7 RNA polymerase.

169. The method of any one of claims 161-168, further comprising binding a nucleic acid probe to at least some of the amplified nucleic acid.

170. The method of claim 159, further comprising determining the bound nucleic acid probe.

171. The method of claim 170, further comprising determining the amplified nucleic acid using sequencing.

172. The method of any one of claims 170 or 171, wherein the determining is by fluorescent in situ hybridization.

173. The method of any one of claims 170-172, further comprising determining the amplified nucleic acid is by fluorescent in situ hybridization.

174. The method of any one of claims 170-173, wherein the determining is by multiplexed fluorescent in-situ hybridization.

175. The method of any one of claims 170-174, wherein the determining is by multiplexed fluorescent in-situ hybridization with error correction.

176. The method of any one of claims 170-175, wherein the determining is by MERFISH.

177. The method of any one of claims 161-176, further comprising determining the amplified nucleic acid using sequencing.

178. The method of any one of claims 161-177, further comprising determining the amplified nucleic acid using in situ sequencing.

179. The method of any one of claims 161-178, further comprising determining the amplified nucleic acid using in situ sequencing and expansion microscopy.

180. The method of any one of claims 128-179, wherein the method occurs within a tissue.

181. The method of any one of claims 128-180, wherein the method occurs within an organ.

Images