Sting inhibitors and methods of using thereof
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF MASSACHUSETTS
- Filing Date
- 2024-08-02
- Publication Date
- 2026-06-10
AI Technical Summary
Current treatments for various diseases and conditions such as type I interferonopathies, Sjögren’s syndrome, nonalcoholic fatty liver disease, and inflammatory responses to gene therapy lack effective therapeutic options.
Administration of a therapeutically effective amount of a compound of Formula (I) or its pharmaceutically acceptable salt, which is designed to inhibit specific biological pathways implicated in these conditions.
The compound effectively treats or prevents the mentioned diseases and conditions by targeting specific biological pathways, thereby providing a novel therapeutic approach.
Smart Images

Figure IMGF000003_0001 
Figure IMGF000005_0001 
Figure IMGF000006_0001
Abstract
Description
[0001] Attorney Docket No.11579-014WO1 WHAT IS CLAIMED IS: 1. A method of treating or preventing a disease or condition selected from: a type I interferonopathy selected from Aicardi–Goutieres syndrome (AGS), STING- associated vasculopathy with onset in infancy (SAVI), and inherited DNase deficiency; Sjögren’s syndrome, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, acute kidney injury, diabetes, and inflammatory response to gene therapy, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I): (I), or a pharmaceutically acceptable salt thereof, wherein: R1, R2, R3, R4, and R5are each independently selected from H, NO2, CN, halo, C1-6alkyl, C1-4haloalkyl, C2-6alkenyl, C2-6alkynyl, ORa1, C(O)ORa1, C(O)Rb1, C(O)NRc1Rd1, NRc1Rd1, NRc1C(O)Rb1, NRc1C(O)ORa1, NRc1S(O)2Rb1, S(O)2Rb1, S(O)2NRc1Rd1, C6-10 aryl, and –N=N- C6-10aryl, wherein each of said C6-10aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R1and R2, together with the carbon atoms to which they are attached, form a pyrrolidin-2-one ring, which is optionally substituted with 1 or 2 substituents independently selected from R9a; or R2and R3, together with the carbon atoms to which they are attached, form a phenyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; each R9ais independently selected from C1-6alkyl, C3-5cycloalkyl, C1-6alkylene- C3-5 cycloalkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; Attorney Docket No.11579-014WO1 each R9bis independently selected from NO2, CN, halo, C1-6alkyl, C1-4haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORa1, C(O)ORa1, C(O)Rb1, C(O)NRc1Rd1, NRc1Rd1, NRc1C(O)Rb1, NRc1C(O)ORa1, NRc1S(O)2Rb1, S(O)2Rb1, and S(O)2NRc1Rd1; X is selected from O and NR8; R8is selected from H, OH, CN, C1-6 alkyl, C1-4 haloalkyl, C1-6 alkoxy, and C1-4 haloalkoxy; R6and R7are each independently selected from H, C1-6alkyl, C1-4haloalkyl, C2-6alkenyl, and C2-6 alkynyl; or R6and R7, together with the N atom to which they are attached from a 5-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R7and R8, together with the N atoms to which they are attached form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; and each Ra1, Rb1, Rc1, and Rd1is independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl. 2. The method of claim 1, wherein the disease or condition is selected from a type I interferonopathy selected from Aicardi–Goutieres syndrome (AGS), STING- associated vasculopathy with onset in infancy (SAVI), and inherited DNase deficiency, and Sjögren’s syndrome. 3. The method of is selected from nonalcoholic fatty liver (NASH), chronic obstructive (SLE), amyotrophic lateral macular degeneration, and acute kidney injury. 4. The method of is diabetes. 5. The method of is inflammatory response to gene therapy. 6. The method of any one of claims 1-5, wherein R1, R2, R3, R4, and R5are each independently selected from halo, C1-6alkyl, C2-6alkynyl, ORa1, C(O)ORa1, C6-10 Attorney Docket No.11579-014WO1 aryl, and –N=N- C6-10aryl, wherein each of said C6-10aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b. 7. The method of any one of claims 1-6, wherein R9bis selected from halo, C1-6alkyl, ORa1, and NRc1Rd1. 8. The method of any one of claims 1-7, wherein R6and R7are each independently selected from H, C1-6 alkyl, and C1-4 haloalkyl. 9. The method of any one of claims 1-8, wherein X is O. 10. The method of any one of claims 1-8, wherein X is NR8. 11. The method of claim 10, wherein R8is selected from H, C1-6 alkyl, and C1-4haloalkyl. 12. The method of any one of claims 1-11, wherein each Ra1, Rc1, and Rd1is independently selected from H and C1-6 alkyl. 13. The method of claim 1, wherein the compound of Formula (I) has formula: , or a pharmaceutically acceptable salt thereof. 14. The method of claim 1, wherein the compound of Formula (I) has formula: , or a pharmaceutically acceptable salt thereof. 186 Attorney Docket No.11579-014WO1 15. The method of claim 1, wherein the compound of Formula (I) has formula: , or a pharmaceutically acceptable salt thereof. 16. The method of claim 15, wherein R9ais selected from C1-6 alkyl, C3-5 cycloalkyl, and C1-6alkylene-C3-5cycloalkyl. 17. The method of claim 1, wherein the compound of Formula (I) has formula: , or a pharmaceutically 18. The method of of Formula (I) has formula: , 187 Attorney Docket No.11579-014WO1 or a pharmaceutically acceptable salt thereof. 19. The method Formula (I) has formula: , or a pharmaceutically 20. The method Formula (I) has formula: , or a pharmaceutically 21. The (I) is selected from any one of the acceptable salt thereof. 22. The (I) is selected from any one of the compounds listed in Table 2 and Table E1, or a pharmaceutically acceptable salt thereof. 23. A compound selected from any one of the compounds listed in Table 2 and Table E1, or a pharmaceutically acceptable salt thereof. 188 Attorney Docket No.11579-014WO1 24. A compound of Formula (II): HN 0-3(II), or a pharmaceutically acceptable salt thereof, wherein: R1is selected4C(O)ORa1; each R2is C2-6 alkenyl, C2-6alkynyl, ORa1, C (O)Rb1, NRc1C(O)ORa1, NRc1S wherein said C6-10aryl is optionally selected from R6; R3and R4are C1-6 alkylene-C6-12 aryl, C1-4haloalkyl, C2-C6-12aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6; or R3and R4, together with the N atom to which they are attached from a 5-7 membered 2, or 3 substituents X is selected R5is selected and C1-4haloalkoxy; or R4and R5, form a benzimidazole ring, independently selected from R6; each R6is independently selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORa1, C(O)ORa1, C(O)Rb1, C(O)NRc1Rd1, NRc1Rd1, NRc1C(O)Rb1, NRc1C(O)ORa1, NRc1S(O)2Rb1, S(O)2Rb1, and S(O)2NRc1Rd1; and each Ra1, Rb1, Rc1, and Rd1is independently selected from H, C1-6alkyl, C1-4haloalkyl, C2-6 alkenyl, and C2-6 alkynyl. 189 Attorney Docket No.11579-014WO1 25. The compound of claim 24, wherein R1is selected from H, C1-6alkyl, and C1-4 haloalkyl. 26. The compound of claim 24 or 25, wherein R2is selected from halo, C1-6 alkyl, C2-6alkynyl, ORa1, C(O)ORa1, and C6-10aryl, wherein said C6-10aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6. 27. The compound of any one of claims 24-26, wherein R3is selected from H and C1-6alkyl. 28. The compound of R4is selected from H, C1-6 alkyl, and C1-6 alkylene- alkylene-C6-12 aryl is optionally substituted with 1, selected from R6. 29. The compound of X is O. 30. The compound of of Formula (II) has formula: , or a pharmaceutically acceptable salt thereof. 31. The compound of claim 30, wherein the compound of Formula (II) has formula: 190 Attorney Docket No.11579-014WO1 , or a pharmaceutically acceptable salt thereof. 32. The compound of claim 29, wherein the compound of Formula (II) has formula: HN Cl NH (R6)0-3or a pharmaceutically 33. The X is NR5. 34. The from H, C1-6 alkyl, and C1-4haloalkyl. 35. The compound of claim 33, wherein the compound of Formula (II) has formula: 191 Attorney Docket No.11579-014WO1 or a pharmaceutically 36. The R6is selected from halo, C1-6alkyl, ORa1, 37. The compound of any one of claims 24-35, wherein Ra1, Rb1, Rc1, and Rd1are independently selected from H and C1-6alkyl. 38. The compound of Formula (II) is selected from any one of in Table 3, or a pharmaceutically 39. A compound of (III), or a pharmaceutically acceptable salt thereof, wherein: W is a warhead of the following moieties (i)-(xii): (iii); (iv); (v); (vi); Attorney Docket No.11579-014WO1 (vii); (viii); (ix), (x); (xi); (xii); wherein: each RA, H and methyl; each RDis and NO2; each Y1is n is 1 or 2; X is Cl or each Y is independently selected from O and S; provided if W is a moiety of formula (xii), then L comprises at least one optionally substituted phenylene moiety; L is C1-3alkylene-, and - substituted with CN, C1-6 alkyl, C1-4 R1, R2, CN, halo, C1-6 alkyl, C1-4 C(O)NRc1Rd1, S(O)2NRc1Rd1, C6-12 aryl, wherein with 1, 2, or 3 each R124haloalkyl, C2-6alkenyl, C2-6 NRc1C(O)Rb1, NRc1C(O)ORa1, NRc1S(O)2Rb1, S(O)2Rb1, and S(O)2NRc1Rd1; Attorney Docket No.11579-014WO1 R6is selected from C1-6alkyl, C1-6alkylene-C6-12aryl, C3-6cycloalkyl, C3-6cycloalkenyl, C1-6 alkylene-C3-6 cycloalkyl, C1-6 alkylene-C3-6 cycloalkenyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; R7is selected from C1-6alkyl, C1-6alkylene-C6-12aryl, C3-6cycloalkyl, C3-6cycloalkenyl, C1-6 alkylene-C3-6 cycloalkyl, C1-6 alkylene-C3-6 cycloalkenyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; R8, R9, R10, and R11are each independently selected from NO2, CN, halo, C1-6alkyl, C6-12 aryloxy, C6-12 aryl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORa1, C(O)ORa1, C(O)Rb1, C(O)NRc1Rd1, NRc1Rd1, NRc1C(O)Rb1, NRc1C(O)ORa1, NRc1S(O)2Rb1, S(O)2Rb1, and S(O)2NRc1Rd1, wherein said C6-12aryloxy and C6-12aryl are each optionally substituted with 1, 2, or 3 substituents independently selected from R12; and each Ra1, Rb1, Rc1, and Rd1is independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl. 40. The compound of claim 39, wherein the warhead functional group is selected from any one of the moieties (i)-(xi). 41. The compound of claim 40, wherein L is –C3-6 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, C1-4 haloalkyl, C1-6 alkoxy, and C1-4 haloalkoxy. 42. The compound of claim 39, wherien L is –C4-6 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6alkyl, C1-4haloalkyl, C1-6alkoxy, and C1-4haloalkoxy. 43. The compound of claim 39, wherein L is -C1-3 alkylene-phenylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6alkyl, C1-4haloalkyl, C1-6alkoxy, and C1-4haloalkoxy. 44. The compound of claim 39, wherein L is -phenylene-C1-3 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6alkyl, C1-4haloalkyl, C1-6alkoxy, and C1-4haloalkoxy. 45. The compound of claim 39, wherein L is -C1-3 alkylene-phenylene-C1-3 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6alkyl, C1-4haloalkyl, C1-6alkoxy, and C1-4haloalkoxy. 194 Attorney Docket No.11579-014WO1 46. The compound of any one of claims 42-45, wherein the warhead functional group is a moiety of formula (xii). 47. The compound of any one of claims 42-45, wherein the warhead functional groups is a moiety of any one of the formulae (i)-(xi). 48. The compound of any one of claims 39-47, wherein R1, R2, R3, R4, and R5are each independently selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORa1, C(O)ORa1, C6-10aryl, C6-12aryloxy, C2-6alkenylene-C6-12aryl, and C2-6alkynylene-C6-12 aryl, wherein each of said C6-10 aryl and C6-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12. 49. The compound of any one of claims 39-48, wherein R6is selected from C1-6alkyl, C3-6cycloalkyl, and C1-6alkylene-C3-6cycloalkyl. 50. The compound of any one of claims 39-49, wherein R7is selected from C1-6 alkyl, C3-6 cycloalkyl, and C1-6 alkylene-C3-6 cycloalkyl. 51. The compound of any one of claims 39-50, wherein R8, R9, R10, and R11are each independently selected from halo, C1-6 alkyl, C6-12 aryloxy, C1-4 haloalkyl, ORa1, C(O)ORa1, C(O)NRc1Rd1, and NRc1Rd1, wherein said C6-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12. 52. The compound of any one of claims 39-51, wherein R12is selected from NO2, halo, C1-6 alkyl, ORa1, and NRc1Rd1. 53. The compound of any one of claims 39-52, wherein Ra1, Rb1, Rc1, and Rd1is independently selected from H and C1-6alkyl. 54. The compound of claim 39, wherein the compound of Formula (III) is selected from any one of the following compounds, or a pharmaceutically acceptable salt thereof: 195 Attorney Docket No.11579-014WO1 196 Attorney Docket No.11579-014WO1 is structure of Attorney Docket No.11579-014WO1 56. A pharmaceutical composition comprising a compound of any one of claims 23-55, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. 57. A method of treating or preventing a disease or condition in which a PAD enzyme is implicated, the method comprising administering to a subject in need thereof a therapeutically of any one of claims 23-55, or a pharmaceutically 58. The method or condition is selected from an immune system disease or disorder, and an autoimmune disease or 59. The method or condition is selected from rheumatoid arthritis, juvenile idiopathic arthritis, disease, multiple sclerosis, inflammatory rhinitis, Crohn’s disease, colitis, ulcerative colitis, spinal cord injury, and atherosclerosis. 60. The method of claim 57, wherein the disease or condition is cancer. 61. The method of claim 60, wherein the cancer is selected from carcinoma, lymphoma, sarcoma, blastoma, leukemia, squamous cell carcinoma, lung cancer, pancreatic cancer, cervical cancer, bladder cancer, hepatoma, breast cancer, colon carcinoma, and head and neck cancer. 62. The method of claim 57, wherein the disease or condition is diabetes. 198 Attorney Docket No.11579-014WO1 63. A method of treating or preventing a disease or conditions in which a STING pathway is implicated, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of claims 24-55, or a pharmaceutically acceptable salt thereof. 64. The method of claim 63, wherein the disease or condition is selected from: Aicardi–Goutieres syndrome (AGS), STING-associated vasculopathy with onset in infancy (SAVI), type I interferonopathy due to inherited DNase deficiency, Sjögren’s syndrome, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, acute kidney injury, and inflammatory response to gene therapy. 65. The method of claim 64, wherein the disease or condition is selected from Aicardi–Goutieres syndrome (AGS), STING-associated vasculopathy with onset in infancy (SAVI), type I interferonopathy due to inherited DNase deficiency, and Sjögren’s syndrome. 66. The method of claim 64, wherein the disease or condition is selected from nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, and acute kidney injury. 67. The method of claim 64, wherein the disease of condition is inflammatory response to gene therapy. 199 pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, and acute kidney injury.
[0002] In some embodiments, the disease of condition is inflammatory response to gene therapy.
[0003] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. Methods and materials are described herein for use in the present application; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0004] Other features and advantages of the present application will be apparent from the following detailed description and figures, and from the claims.
[0005] DESCRIPTION OF DRAWINGS
[0006] FIG. 1A contains bar graphs showing that BB-Cl-amidine inhibits STING activation.
[0007] FIG. IB contains images showing that BB-Cl-amidine inhibits phosphorylation of IRF3, TBK1, and STATE
[0008] FIG. 2 contains an image showing that BB-Cl-amidine inhibits STING agonist induced mRNA transcriptional program.
[0009] FIG. 3 contains a bar graph showing that BB-Cl-Amidine inhibits STING activation in vivo.
[0010] FIG. 4 shows that orally delivered BB-Cl-Amidine protects against experimental AGS. Survival analysis (top line plot) and heart pathology of TREXD18N / D18N mice administered a vehicle mouse diet or a BB-Cl-amidine embedded diet (20 mg / kg / day) (lower bar graph).
[0011] FIG. 5 contains a bar graph showing INFP levels after treatment with exemplified compounds.
[0012] FIG. 6 contains a bar graph showing INFP levels after treatment with exemplified compounds, alone or in the presence of the STING agonist diABZI.
[0013] FIG. 7 shows that BB-Cl-amidinc inhibits STING dependent signaling. (A) Structure of BB-Cl-amidine. (B-C) ELISA analysis of TNF-oc and IFN-P in conditioned medium from BMDMs pre-treated with vehicle control (DMSO) or BB-Cl-amidine 1 pM for 1 h followed by treatment with the indicated ligands for 24 h. (D) ELISA analysis of IFN-P in conditioned medium from BMDMs pre-treated with vehicle control (DMSO) or BB-Cl-amidine 1 pM for 1 h followed by infection with HSV1 (MOI 10) or Sendai virus 20 (20 Units) for 24 h. (E) qPCR analysis of Ifnfi expression in BMDMs pre-treated with the indicated concentrations of BB-Cl-amidine followed by treatment with diABZI-4 for 2 h. (F) ELISA analysis of IFNP from BMDMs pre-treated with the indicated concentrations of BB-Cl-amidine followed by treatment with diABZI-4500nM for 24 h. (G) Immunoblot analysis of phosphorylated STING, IRF3, TBK1, STAT1, P65 and LC3 conversion in whole cell lysates from BMDMs pre-treated with the indicated concentrations of BB-Cl- amidine for 1 h followed by treatment with diABZI-4 for 1 h. (H) ELISA analysis of IFN in human primary monocytes pre-treated with BB-Cl-amidine 1 pM followed by treatment with 500nM diABZI-4 for 2 h. B,C and G representative data. D-F, H pooled data from 3 independent experiments. I, vehicle (n=3), diABZI-4 (n=3), diABZL4+ BB-Cl-amidine (n=9). **, PcO.Ol. Error bars show means ± SEM.
[0014] FIG. 8 shows transcriptome analysis of BB-Cl-amidine induced STING inhibition. (A) Heat-map analysis of top 50 expression changes in genes calculated from log (FPKM+1) values from RNA sequencing analysis on RNA extracted from BMDMs pretreated with vehicle control (DMSO) or BB-Cl-amidine 1 pM followed by treatment with diABZI-4 for 2 or 6 h. (B-C) Log2 fold change in vehicle control (DMSO) versus diABZI-4 treated cells (left panel) and BB-Cl-amidine treated cells versus diABZI-4 treated cells (right panels) for 2 h (B) or 6 h (C). Data is the average of 2 replicates sequenced from each of the indicated samples.
[0015] FIG. 9 shows BB-Cl-amidine inhibits STING signaling independent of PADs. (A) qPCR analysis of lfn(3 expression in WT and Padi4- / " BMDMs treated with diABZI-4 for 2 h. (B) Immunoblot analysis of phosphorylated IRF3, STING and PAD4 in whole cell lysates from WT and Padi4' / _BMDMs treated with diABZI-4 for the indicated times. (C- D) qPCR analysis of Ifn(3 (C) and CxclO (D) expression in BMDMs pre-treated with 1 pM BB-Cl-amidine for 1 h followed by treatment with diABZI-4 for 2 h. (E) Immunoblot analysis of phosphorylated IRF3, PAD4 and |3-actin in whole cell lysates from WT and Padi4' / _BMDMs pre-treated with 1 |iM BB-Cl-amidine for 1 h followed by treatment with diABZI-4 for 1 h. (F-G) qPCR analysis of Ifn / 3 (F) and CxclO (G) expression in WT, Padi2‘ '■ and Padi2 / 4‘ / _BMDMs treated with diABZI-4 for 2 h. **, PcO.OOE Error bars show means ± SEM.
[0016] FIG. 10 shows BB-Cl-amidine directly targets STING. (A-B) Structure of BB-C1- Yne and BB-F-Yne alkyne probes. (C) EEISA analysis of IFN-|3 in conditioned medium from BMDMs pre-treated with vehicle control (DMSO), BB-Cl-amidine 1 pM, BB-C1- Yne 1 M or BB-F-Yne 1 pM for 1 h followed by treatment with 500 nM diABZI-4 for 24 h. (D) EOG 10 fold change enrichment of proteins from copper-clicked lysates from cells treated with BB-Cl-Yne 1 pM for 1 h. (E) Representative mass spectrometry spectra of STING identified from streptavidin pull downs of clicked lysates from cells treated with BB-Cl--Yne or cells co-treated with BB-Cl-amidine and BB-Cl-Yne. (F) Peptide coverage analysis of peptides identified in streptavidin bead pull downs from clicked lysates cells treated with BB-Cl-Yne or cells co-treated with BB-Cl-amidine and BB- Cl-Yne. (G) Immunoblot of STING and strep-IR-dye in streptavidin bead pull downs and input from clicked lysates of cells treated with or without BB-Cl-Yne and BB-Cl- amidine. C, pooled data from 2 independent experiments performed in triplicate. D-E, performed in triplicate. G, representative data of two independent experiments.
[0017] FIG. 11 shows BB-Cl-amidine alleviates STING dependent experimental AGS. (A- C) Survival analysis (A), spleen weight (B) and heart:body weight ratio (C) of TrexD18N / D18Nmice administered a control diet or BB-Cl-amidine embedded diet. (D) Representative H&E staining of tissue sections from hearts of WT and TrexlD18N / D18N mice administered a control diet or BB-Cl-amidine embedded diet. (E) Pathology scoring of heart sections from (D). (F) Trichrome staining of tissue sections from hearts of WT and TrexlD18N / D18Nmice administered a control diet or BB-Cl-amidine embedded diet. A, vehicle (n=10) BB-Cl-amidine (n=17), data representative of pooled mice from two independent experiments. B, C WT vehicle (n=5), WT BB-Cl-amidine (n=5), TrexlD18N / D18vehicle (n=6), Trex 1D18N / D18NBB-Cl-amidine (n=9). D, representative images. E, WT vehicle (n=3), WT BB-Cl-amidine (n=3), Trex 1D18N / D18Nvehicle (n=4), TrexlD18N / D18NBB-Cl-amidine (n=6). *, P<Q.Q5, two-way ANOVA. Error bars show means ± SEM.
[0018] FIG. 12 shows BB-Cl-amidine impairs STING oligomerization via the modification of Cysl48. (A) Representative mass spectrometry spectra of STING modified by BB-Cl-amidine identified in tryptic digests from recombinant STING 10 |lg incubated with BB-Cl-amidine 10 pM for 1 h at 37° C. (B) Immunoblot analysis of STING in native and reduced fractions from lysates of HEK293T cells expressing WT murine STING or a murine STING-C147S mutant and treated with diABZI-4 for 15 min. (C) Immunoblot analysis of STING in native and reduced fractions of lysates from BMDMs pre-treated with the indicated concentrations of BB-Cl-amidine followed by treatment with diABZI-4. (D) Immunoblot analysis of STING in native and reduced fractions of lysates from WT and Padi4‘ / _BMDMs treated with 500 nM diABZI for the indicated times.
[0019] FIG. 13 shows BB-Cl-amidine binds to STING. (A-B) Sequence coverage of STING from analysis of peptides identified in streptavidin bead pull downs from clicked lysates of BMDMs treated with BB-Cl-Yne (A) or BMDMs co-treated with BB-Cl- amidine and BB-Cl-Yne (B). Representative of 3 independent replicates.
[0020] FIG. 14 shows IRF3 deficiency protects against experimental AGS in TrexlD18N / D18N mice. (A-C) Survival analysis of WT (n=20), TrexlD18N / D18(n=20), mice (n=20). (B) Spleen weights WT (n=5), Trev7D18N / D18(n=6), mice (n-17) (C) EEISA analysis of serum CxcllO in WT (n=10), , TreWD18N / D18N / Irf3’ / ‘ mice (n=9). (D) Representative H&E staining of tissue sections from hearts (E) and pathology evaluation of heart sections from WT (n=5) and TreWD18N / D18N(n=9) and TrexD18N / D18N / Z 3-z- mice (n=9). *, P<0.05, **, P<0.01. two- way ANOVA. Error bars show means ± SEM.
[0021] FIG. 15 shows STING deficiency and cGAMP binding blockade protects against experimental AGS in TrexlD18N / D18N mice. (A) Survival analysis of WT (n=10), D) Representative H&E staining and pathology scoring of tissue sections from hearts of TrcxlD18N / D18N / STINGR237A / R237An=4) mice., ***, P<0.001. two-way ANOVA. Error bars show means ± SEM.
[0022] FIG. 16 shows representative mass spectrometry spectra of STING modified by BB-Cl-amidine AT Cys206(A), Cys257(B) and Cys309(C) identified in tryptic digests from recombinant STING 10 |ig incubated with BB-Cl-amidine 10 |1M for 1 h at 37° C.
[0023] FIG. 17 shows domain organization of STING (A) and the chemical structures of recently reported STING inhibitors (B). Nitrofuran derivatives and H-151 are covalent inhibitors whereas SN011, is a non-covalent STING inhibitor that targets the cyclic dinucleotide binding pocket of murine STING.
[0024] FIG. 18 shows BB-Cl-amidine derivative library screen. (A) Chemical structures of BB-Cl-amidine and 18 compounds that showed significant inhibition of STING signaling. (B) ELISA analysis of IFN-P in conditioned medium from BMDMs pre-treated with vehicle control (DMSO) or the inhibitor library treated at 5 |1M for each compound for 1 h followed by treatment with diABZI for 24 h. 12 hits below the cut-off value are highlighted in orange; 6 additional compounds close to the cut-off value are highlighted in pink. (C) ELISA analysis of IFN-P from BMDMs pre-treated with vehicle control (DMSO) or the indicated compounds identified in (A) treated at 1 |1M for 1 h followed by treatment with diABZI for 24 h.
[0025] FIG. 19 shows the proteome-wide selectivity of BB-Cl-amidine and H-151. (A) Chemical structures of BB-Cl-amidine and H-151 and their alkyne derivatives, i.e. BB-CL yne and H-151-yne. (B) EC50 of compounds in THP1 dual cells as a measure of STING inhibition (n=3). (C) STING labelling workflow by clickable probes. (D and E) H-15 l-yne & BB-Cl-yne labeled proteins visualized: (D) before pulldown on streptavidin agarose using IRDye 800CW streptavidin (anti- streptavidin). A stain-free gel image of the SDS- PAGE gel before transfer is included to show equal protein loading. (E) After pulldown using an anti-STING antibody. The input control image is on the right.
[0026] FIG. 20 shows Structure- Activity Relationship (SAR) studies. (A) Scheme showing modifications on the biphenyl benzimidazole scaffold. (B) EC50 of BB-Cl-amidine analogs (n=3). (C) Comparison of the activity in THP1 dual cells between BB-Cl-amidine and LB 111. (D) Comparison of activity in THP1 dual cells between BB-Cl-amidine, LB082, and LB231. (E) Comparison of activity in THP1 dual cells between BB-Cl-amidine, LB237, LB246 and LB265. (F) Comparison of activity in THP1 dual cells between BB- Cl-amidine, LB095, and LB225. (G) Comparison of activity in THP1 dual cells between BB-Cl-amidine, LB269, and LB270. (H) Comparison of activity in THP1 dual cells between BB-Cl-amidine, LB244, LB409, LB365 and LB259.
[0027] FIG. 21 shows proteome-wide reactivity of hit compounds. (A) Chemical structure of alkyne derivatives LB346, BB-Cl-yne, LB298, LB295, and LB299. (B) Comparison of EC50 values between parent compounds (BB-Cl-amidine, LB265, LB244, LB246, and LB270) and their alkyne derivatives in THP1 dual cells (n=3). (C-D) Cells were treated with alkyne-based probes and then clicked to biotin-azide. Protein labelling was visualized directly with IRDye 800CW streptavidin (anti-streptavidin) or after enrichment on streptavidin agarose using an anti-STING antibody (White arrow indicates selective STING labeling). (E) Proposed mechanism of inactivation. Volcano plot indicating the proteins that were enriched from HEK-STING cells treated with (F) LB295 or (G) BB-Cl- yne (arrow indicates STING enrichment).
[0028] FIG. 22 shows LB244 inhibits STING activation and signaling in mice in vitro and in vivo. (A-B) qPCR analysis of Ijn / 3 and 1L6 expression in BMDMs pre-treated with LB244 followed by treatment with diABZI (500nM) for 2 h. (C) Immunoblot analysis of phosphorylated IRF3, TBK1, as well as total STING in whole cell lysates from BMDMs pre-treated with LB244 (IpM) for 1 h followed by treatment with diABZI for 1 h. (D) Immunoblot analysis of STING in native and reduced fractions of lysates from BMDMs pre-treated with LB 244 followed by treatment with diABZI. (E-G) C57B16 mice were pretreated with 5 mg / kg LB244 followed by diABZI (cone. 0.5mg / kg). IFN0, IL6, and CXCL10 levels were measured in serum 3 hours later (vehicle (n=5), diABZI (n=5), diABZI+ LB244 (n=5). **, P<0.01. Error bars show means ± SEM.
[0029] FIG. 23 shows Efficacy of LB244 in primary cells. (A) LB 244 blocks the STING- dependent induction of IFN[3 in primary human monocytes. (B) H- 151 does not inhibit the STING-dependent induction of IFN[ in primary human monocytes. (C) Comparison of the EC50 of LB244 measured in THP1 R232 and HAQ cells. Error bars represent SD; ****p < 0.0001 as determined by unpaired t test. (D) Comparison of the EC50 of BB-Cl-amidine measured in THP1 R232 and HAQ cells. Error bars represent SD; p — ns as determined by unpaired t test. (E) Comparison of the EC50 of H-151 measured in THP1 R232 and HAQ cells. Error bars represent SD; **p < 0.05 as determined by unpaired t test.
[0030] FIG. 24 shows (A) Cytotoxicity of LB 244 measured in THP1 dual cells over a range of concentrations (40-0.025 pM) in a MTT viability assay (n=3). (B) Cytotoxicity of BB- Cl-amidine measured in THP1 dual cells over a range of cone. (40-0.025 pM) in a MTT viability assay (n=3). (C) Comparing potencies (kinact / KI) of LB244 and BB-Cl-amidine for the inhibition of PADsl-4. (D) Stability of LB244 in PBS in the absence and presence of DTT as measured by LC-MS analysis.
[0031] FIG. 25 shows the proteome wide selectivity of (A) H-151-yne, (B) BB-Cl-yne and (C) LB295. White arrow indicates the STING band. Cells were treated with a range of concentrations of the alkyne containing probe and then clicked to biotin-azide prior to SDS-PAGE and western blotting. Promiscuity was visualized using IRDye 800CW streptavidin (anti-streptavidin, stain-free gel image to show equal loading).
[0032] FIG. 26 shows dose response curves for the inhibition of STING signalling in THP1 Dual cells. Plots for those compounds in FIG. 20 showing IC50 values < 5 pM are depicted as well as LB588 which lacks the reactive nitro group present in LB244.
[0033] FIG. 27 shows the selectivity of LB295. (A) Competition assays with free compound (LB244). HEK-STING cells were pretreated with various concentrations of LB244 for 1 h, followed by treatment of LB295 (2.5 pM). Cells were lysed, probe labeled proteins clicked to biotin-azide, enriched on streptavidin agarose and then analyzed by western blotting to detect the enrichment of STING. (B) HEK-293T cells before (HEK- 293T) and after (HEK-STING) transfection with a STING expression construct (i.e., pUNOl-hSTING plasmid). Cells were treated with LB295 (2.5 pM) for 4 h and then processed as above.
[0034] FIG. 28 shows LB244 inhibits STING activation via modification of C292A. (A) HEK293T cells expressing wild type or mutant STING were incubated with LB295 (5 pM) for 1 h and then clicked to biotin-azide. Protein labelling was visualized after enrichment on streptavidin agarose using an anti-STING antibody. C64S, C206S & C309A failed to express the protein in significant quantity. (B) LB244 dose-dependent pIRF3 response for wild-type STING versus the C292A mutant upon induction of STING signaling with diABZI (100 nM); (C) Quantification of the pIRF3 response. Data were plotted for two individual replicates. (D) Cryo-EM structure of STING bound to cGAMP (PDBID:7SII) show that C292 is positioned on a C-tcrminal helix adjacent to the extreme N-terminus of the protein. The relative distance of Cys 292 to cGAMP is between 13.5 A - 14.5 A.
[0035] FIG. 29A-29H illustrate a mouse model for Cre recombinase-dependent STING V154M expression. (FIG. 29A) Diagram of the STING V154M conditional knock-in (CKI); (FIG. 29B) Tail DNA from a STINGCKI / WTmouse and a STINGCKI / WTX CMV-Cre mouse was PCR-amplified using primers indicated in (FIG. 29A). STING WT allele gives a 596bp fragment, STING CKI allele gives a 774bp fragment, and upon deletion of the gene trap from the CKI allele, a 636bp fragment is generated; (FIG. 29C) STING expression by CD45+immune cells from the blood of mice inheriting the indicated STING alleles as assessed by flow cytometry; (FIG. 29D-FIG. 29H) 8-week-old age-, sex-, and littermate-matched CKI (n=13-23, white) and CKI x CMV-Cre mice (n=16-29, red) and 12-week-old age-, sex-, and littermate-matched WT (n=6, gray) and VM mice (n=10, pink) were evaluated by the following measures. Data shown represent at least two independent experiments. Bar graphs represent mean ± SD; (FIG. 29D) Representative 4x field H&E-stained lungs. Images are representative of at least two independent experiments; (FIG. 29E) Immunofluorescence staining for DAPI (gray), CD3 (cyan), EYVE1 (yellow), and B220 (magenta) on CKI x CMV-Cre mouse lung. 200pm bars are shown in (29D-29E) for scale. Images are representative of at least two independent experiments; (FIG. 29F) Percentage of EV immune cells among live CD45+lung cells, and total counts of CD45+lung EV cells; (FIG. 29G) Percentage of CD69+EV CD3+T cells in the lung; (FIG. 29H) Body weight from mice, normalized as the fold change relative to the mean body weight of sex-matched CKI and WT controls, and spleen weight.
[0036] FIG. 30 illustrates that lung stromal tissues express STING. Immunofluorescent staining of lungs from STINGKO / KO, STINGVM / WT, and STINGWT / WTmice stained for DAPI (gray), EYVE1 (yellow), PDPN (magenta), and STING (cyan). 3x magnified view is shown from the highlighted portion of each image and is shown to the right. Examples of LYVEDPDPN’ blood vessels (BV), EYVE1+PDPN+lymphatic vessels (EV), EYVEF PDPN" conducting airway (CA), EYVE1‘PDPN+respiratory airway (RA), and morphologically apparent tertiary lymphoid organs (TLO) are annotated by white text. A 200pm bar is shown for scale. Images represent data from one experiment.
[0037] FIG. 31A-31F show that Tie2-Cre targeted expression of STING VM was sufficient to initiate immune recruitment to the lung. (FIG. 31 A) CD45+immune and CD45' non-hematopoietic cells from the lungs of 12 week-old CKI YFP (n=8, white), CKI x Nkx2.1-Cre x YFP (n=3, purple), CKI x PDGFRa-Cre x YFP (n=4, blue), CKI x Tie2-Cre x YFP (n=4, green), and CKI x CMV-Cre x YFP (n=4, red) mice were evaluated for the percentage of YFP+cells within the EPCAM+CD31 CD140a’ epithelial, CD 140a+EPCAM‘CD31’ fibroblast, and CD31+EPCAM-CD140a endothelial cell compartments. Data is from one experiment; (FIG. 3 IB- FIG. 3 IF) 8-week-old CKI x Nkx2.1-Cre (n=9, purple), CKI x PDGFRa-Cre (n=6, blue), and CKI x Tie2-Cre (n=8, green) mice were compared to, sex and littermate matched control CKI mice (no additional Cre genes) (n=3, n=3, n=8, respectively). Data shown represent at least two independent experiments. Bai- graphs represent mean ± SD; (FIG. 3 IB) Percentage of lung EV immune cells within the total CD45+lung population, and total number of CD45+EV immune cells; (FIG. 31C) Percentage of CD69+lung EV T cells; (FIG. 31D, FIG. 3 IE) Representative lOx field H&E stain on lungs from CKI and CKI x Tie2-Cre mice; Immunofluorescence staining of CKI Tie2-Cre mouse lung: DAPI (gray), CD3 (cyan), LYVE1 (yellow), and B220 (magenta). 200pm bars shown for scale. Images are representative of at least two independent experiments; (FIG. 3 IF) Body weight normalized as the fold change compared to the mean body weight of sex-matched CKI control mice; spleen weight.
[0038] FIG. 32A-32H show the targeted expression of STING VM in T cells and LTi induces lymphopenia and lymph node agenesis, but not ILD. (FIG. 32A) CD45+splenic immune cells from 12 week-old CKI x YFP (n=7, white), CKI x Rorc-Cre x YFP (n=3, teal), and CKI x LysM-Cre x YFP (n=3, brown) mice were evaluated for the percentage of YFP+cells within B220+B cells, CD3+T cells, CD1 lb+and / or CD1 lc+myeloid cells, CD1 lb+Ly6G+neutrophils, CD1 lb+Ly6G Ly6C+monocytes, and CD1 lc+MHCII+dendritic cells. Data is from one experiment; (FIG. 32B- FIG. 32H) 8-week-old CKI x Rorc-Cre (n=8, teal) and CKI x LysM-Cre (n=7, brown) mice were compared to age-, and sex-matched control CKI mice (n-5. n-5. respectively). Data shown represent at least two independent experiments. Bar graphs represent mean ± SD; (FIG. 32B) Percentage of CD3+T cells and CD1 lb+and / or CD1 lc+myeloid cells within the total CD45+splenocyte population; (FIG. 32C) Percentage of CD69+activated T cells; (FIG. 32D) Percentage of Ly6G+neutrophils and Ly6C+Ly6G" monocytes within the splenic myeloid subset; (FIG. 32E Percentage of lung EV immune cells within total number of CD45+lung cells and total number of EV immune cells; (FIG. 32F) Mean number of inguinal lymph nodes in CKI controls compared to the indicated strains. An additional cohort of CKI x CMV-Cre mice (n=27, red) and their matched CKI controls (n=18, white) are included; (FIG. 32G) Percentage of CD69+and PD-1+cell within EV T cell compartment; (FIG. 32H) Percentage of CDl lb+Ly6Chlinflammatory monocytes within lung EV myeloid compartment, and percentage of CD86+cells within the lung EV monocyte compartment.
[0039] FIG. 33A-33F show that endothelial specific expression of the STING VM mutation was sufficient to initiate immune recruitment to the lung. (FIG. 33A) CKI x YFP (n=9, white), CKIx Cdh5-CreERT2x YFP (n=l l, yellow), and CKIx CAGG- CreER™ x YFP (n=8, orange) mice were treated with tamoxifen P0-P2 and CD31+ LECs and CD45+ lung cells were evaluated for YFP expression at 5-7-weeks of age. 8-week- old sex and littermate-controlled STINGCKIx YFP (n=4, white) and STINGCKIx Tie2- Cre x YFP (n=5, green) mice were similarly assessed; (FIG. 33B) Representative 4x field H&E histology of lung sections from CKI x Cdh5-CreERT2(2 mice top row: left shows modest immune aggregate formation, right shows more extensive immune aggregate formation), CKI controls, and CKI x CAGG-CreER™ mice. Images are representative of at least two independent experiments; (FIG. 33C) Immunofluorescence staining of mouse lungs from indicated strains: for DAPI (gray), CD3 (cyan), LYVE1 (yellow), and B220 (magenta). Images are representative of at least two independent experiments; (FIG. 33D) Percentage of lung EV immune cells within total CD45+lung populations, and total number of EV immune cells; (FIG. 33E) Percentage of CD69+EV T cells; (FIG. 33F) Body weight, normalized as the fold change compared to the mean body weight of sex- matched CKI control mice, and spleen weight. (FIG. 33A, FIG. 33D- FIG. 33F) Data shown represent at least two independent experiments. Bar graphs represent mean ± SD.
[0040] FIG. 34A-34E show that lung inflammation was enhanced by non-endothelial expression of STING VM. (FIG. 34A) 6-week-old sex- and littermate-matched tamoxifen treated CKI (n=9), CKI x Cdh5-CrcERT2(n=l 1), and CKI x CAGG-CrcER™ (n=8) mice were evaluated for the percentage of PD-1+EV T cells, and percentage of CD86+CD19+lung EV B cells; (FIG. 34B) Percentage of CDl lb+Ly6G‘Ly6Chlinflammatory monocytes (IM) within the CD1 lb+and / or CD1 lc+EV myeloid cells, and percentage of CD86+CDl lb+Ly6C+lung EV monocytes; (FIG. 34C) Percentage of MHCII+LECs, and percentage of VCAM1+LECs; (FIG. 34D) Percentage of ICAM1+and VCAM1+in CD31'CD140a+lung fibroblasts; (FIG. 34E). Immunofluorescence staining of mouse lungs for DAPI (gray), VCAM-1 (cyan), LYVE1 (yellow), and PDPN (magenta). 12- week old STINGWT / WTand STINGVM / WTare also included. A 200pm bar is shown for scale. Images are representative of at least two independent experiments. (FIG. 34A- FIG. 34D) Data shown represent at least two independent experiments. Bar graphs represent mean ± SD.
[0041] FIG. 35A-35D illustrates that endothelial-directed VM showed a transcriptional signature in lung parenchyma and stroma significant for chemokine production. RNAseq was performed on lung parenchymal and stromal cells from 6-8-week-old sex- and littermate-matched STINGWT / WT(WT, n=5), STINGVM / WT(VM, n=5) and tamoxifen treated STINGCKI / WT(CKI, n=5), STINGCKI / WTCAGG-CreER™ (CKI x CAGG, n=5), and STINGCKI / WTCdh5-CreERT2(CKI x Cdh5, n=5). Data shown is from one experiment. (FIG. 35A) PCA plot using the top 1000 most varied genes; (FIG. 35B) Volcano plots comparing the following groups: WT vs VM (left), CKI vs CKI x CAGG (middle), and CKI vs CKI x Cdh5 (right). Differentially expressed genes (DEGs) are identified as having a padj < 0.05, and either a fold change (FC) >2 (red) or <2 (blue). A subset of selected genes are labelled in green which represent a basic SAVI transcriptional signature - Isgl5, Cxcl9, CxcllO, Ccl5, and H2dma', (FIG. 35C) A dot plot showing enrichment for GO:BP terms in upregulated DEGs across our comparison groups. Statistical significance is shown as color, and the fraction of genes in each term identified as upregulated DEGs (Gene Ratio) is shown as size; (FIG. 35D) A heatmap of genes relating to themes identified from a GSEA leading edge analysis. Genes selected contribute to >3 signatures related to the identified theme and have a FC>2 and padj<0.1. Gene expression is shown as Log2 transformed fold change (Log2FC) of individual mice expressing the VM allele normalized by the mean expression level in their littermate control group, with VM normalized by WT littermates, and CKI x CAGG and CKI x Cdh5 normalized by CKI littermates. Rows (genes) have been organized by hierarchical clustering on expression data across the three comparisons, with a dendrogram shown on the left side of each thematic plot.
[0042] FIG. 36 schematically illustrates the role of STING activation in lung pathology.
[0043] FIG. 37 is a diagram of the long single stranded oligonucleotide used to generate CKI mice.
[0044] DETAILED DESCRIPTION
[0045] In one general aspect, the present disclosure provides methods of inhibiting PAD enzymes (e.g., PAD1, PAD2, PAD3, and / or PAD4) using compounds of any one of the Formulae disclosed herein. In some embodiments, the compounds is a selective inhibitor of a PAD enzyme isoform. In other embodiments, the compound is a pan-inhibitor of all PAD isoforms. In another general aspect, the present disclosure provides methods of inhibiting and / or antagonizing STING pathway using compounds of any one of the Formulae disclosed herein. As such, without being bound by any theory, the compounds of the present disclosure are useful in treating or preventing various conditions in which PAD and / or STING are implicated. Suitable examples of such conditions include inflammatory conditions, immune conditions, and rare genetic disorders. Certain embodiments, of the compounds, methods of their use, and pharmaceutical compositions comprising such compounds, are described herein.
[0046] In some embodiments, the present disclosure provides a compound of Formula (I): or a pharmaceutically acceptable salt thereof, wherein: R^ R2, R3, R4, and R5are each independently selected from H, NO2, CN, halo, Ci- 6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRelRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRclRdl, C6-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R1and R2, together with the carbon atoms to which they are attached, form a pyrrolidin-2-one ring, which is optionally substituted with 1 or 2 substituents independently selected from R9a; or R2and R3, together with the carbon atoms to which they are attached, form a phenyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; each R9ais independently selected from Ci-6 alkyl, C3-5 cycloalkyl, Ci-6 alkylene- C3-5 cycloalkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; each R9bis independently selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl;
[0047] X is selected from O and NR8;
[0048] R8is selected from H, OH, CN, C1-6 alkyl, C1-4 haloalkyl, C1-6 alkoxy, and C1-4 haloalkoxy;
[0049] R6and R7are each independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2.6 alkenyl, and C2-6 alkynyl; or R6and R7, together with the N atom to which they are attached from a 5-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R7and R8, together with the N atoms to which they are attached form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl.
[0050] In some embodiments, the present disclosure provides a method of treating or preventing various conditions in which PAD and / or STING are implicated, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I): or a pharmaceutically acceptable salt thereof, wherein:
[0051] R1, R2, R3, R4, and R5are each independently selected from NO2, CN, halo, C1-6 alkyl, C M haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRelRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRelRdl, C6-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R1and R2, together with the carbon atoms to which they are attached, form a pyrrolidin-2-one ring, which is optionally substituted with 1 or 2 substituents independently selected from R9a; or R2and R3, together with the carbon atoms to which they are attached, form a phenyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; each R9ais independently selected from C1-6 alkyl, C3-5 cycloalkyl, Ci-6 alkylene- C3-5 cycloalkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; each R9bis independently selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2.6alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl;
[0052] X is selected from O and NR8;
[0053] R8is selected from H, OH, CN, C1-6 alkyl, C1-4 haloalkyl, C1-6 alkoxy, and C1-4 haloalkoxy;
[0054] R6and R7are each independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; or R6and R7, together with the N atom to which they are attached from a 5-7 membered hctcrocycloalkyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R7and R8, together with the N atoms to which they are attached form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, Ci-6 alkyl, CM haloalkyl, C2-6 alkenyl, and C2-6 alkynyl.
[0055] In some embodiments, R1, R2, R3, R4, and R5are each independently selected from H, halo, C1-6 alkyl, CM haloalkyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)NRclRdl, NRclRdl, NRelS(O)2Rbl, S(O)2NRclRdl, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said CMO aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0056] In some embodiments, R1, R2, R3, R4, and R5are each independently selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-ioaryl, and -N=N- Ce-ioaryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0057] In some embodiments, R1is selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0058] In some embodiments, R1is selected from H, halo, ORal, and C(O)ORal.
[0059] In some embodiments, R1, R2, R3, R4, and R5are each independently selected from halo, C1-6 alkyl, CM haloalkyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)NRelRdl, NRclRdl, NRclS(O)2Rbl, S(O)2NRclRdl, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0060] In some embodiments, R1, R2, R3, R4, and R5are each independently selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0061] In some embodiments, R1is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b. In some embodiments, R1is selected from halo, ORal, and C(O)ORal.
[0062] In some embodiments, R1is H.
[0063] In some embodiments, R1is halo. In some embodiments, R1is ORal. In some embodiments, R1is C(O)ORal.
[0064] In some embodiments, R2is selected from H, halo, Ci-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0065] In some embodiments, R2is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, C6-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0066] In some embodiments, R2is selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, C6-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0067] In some embodiments, R2is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0068] In some embodiments, R2is H.
[0069] In some embodiments, R2is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, and C(O)ORal. In some embodiments, R2is selected from halo and C1-6 alkyl. In some embodiments, R2is halo. In some embodiments, R2is C1-6 alkyl.
[0070] In some embodiments, R3is selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0071] In some embodiments, R3is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0072] In some embodiments, R3is selected from halo, C2-6 alkynyl, and CMO aryl, and - N=N-Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0073] In some embodiments, R3is H. In some embodiments, R3is halo. In some embodiments, R3is C2-6 alkynyl. In some embodiments, R3is Ce-io aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R9b. In some embodiments, R3is -N=N-Ce-io aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0074] In some embodiments, R4is selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said CMO aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0075] In some embodiments, R4is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, C6-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0076] In some embodiments, R4is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, and C(O)ORal. In some embodiments, R4is selected from halo and Ci-6 alkyl.
[0077] In some embodiments, R4is H.
[0078] In some embodiments, R4is halo. In some embodiments, R4is Ci-6 alkyl.
[0079] In some embodiments, R5is selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, C6-10 aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0080] In some embodiments, R5is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, C6-io aryl, and -N=N- C6-10 aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0081] In some embodiments, R5is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, and C(O)ORal. In some embodiments, R5is selected from halo and C1-6 alkyl.
[0082] In some embodiments, R5is H.
[0083] In some embodiments, R5is halo. In some embodiments, R5is C1-6 alkyl.
[0084] In some embodiments, R9ais selected from C1-6 alkyl, C3-5 cycloalkyl, and C1-6 alkylene-Ca-5 cycloalkyl. In some embodiments, R9ais selected from C1-6 alkyl and C3-5 cycloalkyl. In some embodiments, R9ais C1-6 alkyl. In some embodiments, R9ais C3-5 cycloalkyl. In some embodiments, R9ais C1-6 alkylcnc-C?.' cycloalkyl.
[0085] In some embodiments, R9bis selected from halo, C1-6 alkyl, CM haloalkyl, ORal, NRelRdl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl.
[0086] In some embodiments, R9bis selected from halo, Ci-6 alkyl, ORal, and NRclRdl. In some embodiments, R9bis selected from halo, Ci-6 alkyl, OH, Ci-6 alkoxy, and amino, Ci-6 alkylamino, and di(Ci-6 alkyl)amino. In some embodiments, R9bis selected from halo and Ci-6 alkoxy. In some embodiments, R9bis halo. In some embodiments, R9bis Ci-6 alkoxy.
[0087] In some embodiments, X is O.
[0088] In some embodiments, X is NR8.
[0089] In some embodiments, R8is H. In some embodiments, R8is selected from Ci-6 alkyl and Ci-4 haloalkyl. In some embodiments, R8is OH.
[0090] In some embodiments, R6and R7are each independently selected from H, Ci-6 alkyl, and C1-4 haloalkyl. In some embodiments, R6is selected from H and Ci-6 alkyl. In some embodiments, R7is selected from H and Ci-6 alkyl. In some embodiments, R6is H. In some embodiments, R6is Ci-6 alkyl.
[0091] In some embodiments, R7and R8, together with the N atoms to which they are attached, form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
[0092] In some embodiments, each Ral, Rbl, Rcl, and Rdlis independently selected from H and C1-6 alkyl. In some embodiments, Ralis selected from H and Ci -6 alkyl. In some embodiments, Ralis H. In some embodiments, Ralis Ci-6 alkyl.
[0093] In some embodiments:
[0094] R^ R2, R3, R4, and R5are each independently selected from H, halo, Ci-6 alkyl, C2- 6 alkynyl, ORal, C(O)ORal, Ce-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b;
[0095] R9ais selected from Ci-6 alkyl and C3-5 cycloalkyl;
[0096] R9bis selected from halo, C1-6 alkyl, ORal, and NRclRdl;
[0097] R6and R7are each independently selected from H, C1-6 alkyl, and C1-4 haloalkyl; or R7and R8, together with the N atoms to which they are attached, form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; and each Ral, Rcl, and Rdlis independently selected from H and C1-6 alkyl.
[0098] In some embodiments: R1, R2, R3, R4, and R5are each independently selected from halo, Ci-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-ioaryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b;
[0099] R9ais selected from Ci-6 alkyl and C3-5 cycloalkyl; R9bis selected from halo, C1-6 alkyl, ORal, and NRclRdl;
[0100] R6and R7are each independently selected from H, C1-6 alkyl, and C1-4 haloalkyl; or R7and R8, together with the N atoms to which they are attached, form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; and each Ral, Rcl, and Rdlis independently selected from H and C1-6 alkyl.
[0101] In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.
[0102] In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.
[0103] In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.
[0104] In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.
[0105] In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.
[0106] In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.
[0107] In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.
[0108] In some embodiments, the compound of Formula (I) is selected from any one of the compounds listed in Table 1, or a pharmaceutically acceptable salt thereof.
[0109] In some embodiments, the compound of Formula (I) is selected from any one of the compounds listed in Table 2, or a pharmaceutically acceptable salt thereof.
[0110]
[0111] In some embodiments, the present disclosure provides any one of the compounds listed in Table 2, or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides any one of the compounds listed in Table El, or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides a compound of Formula (II): or a pharmaceutically acceptable salt thereof, wherein:
[0112] R1is selected from H, halo, Ci-6 alkyl, Ci-4 haloalkyl, ORal, and C(O)ORal; each R2is selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRelC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRelRdl, and Ce-ioaryl, wherein said C6-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6;
[0113] R3and R4are each independently selected from H, C1-6 alkyl, C1-6 alkylene-Ce-12 aryl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; wherein said C1-6 alkylene-Ce-12 aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6; or R3and R4, together with the N atom to which they are attached from a 5-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R6;
[0114] X is selected from O and NR5;
[0115] R5is selected from H, OH, CN, Ci-6 alkyl, C1-4 haloalkyl, Ci-6 alkoxy, and C1-4 haloalkoxy; or R4and R5, together with the N atoms to which they are attached form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R6; each R6is independently selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl. In some embodiments, R1is selected from H, Ci-6 alkyl, and C1-4 haloalkyl.
[0116] In some embodiments, R1is ORal. In some embodiments, R1is C1-6 alkoxy.
[0117] In some embodiments, R1is C(O)ORal.
[0118] In some embodiments, R2is selected from halo, Ci-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, and C6-10 aryl, wherein said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6.
[0119] In some embodiments, R2is selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, and C(O)ORal. In some embodiments, R2is selected from halo and C1-6 alkyl. In some embodiments, R2is halo. In some embodiments, R2is C1-6 alkyl. In some embodiments, R2is Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6.
[0120] In some embodiments, R3is H. In some embodiments, R3is Ci-6 alkyl.
[0121] In some embodiments, R3is H and R4is selected from H, C1-6 alkyl, and C1-6 alkylene-Ce-12 aryl, wherein said C1-6 alkylene-Ce-12 aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6.
[0122] In some embodiments, R4is C1-6 alkylene-Ce-12 aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R6.
[0123] In some embodiments, R3and R4, together with the N atom to which they are attached, from a 5-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R6.
[0124] In some embodiments, X is O.
[0125] In some embodiments, X is NR5.
[0126] In some embodiments, R5is selected from H, Ci-6 alkyl, and C1-4 haloalkyl. In some embodiments, R5is OH.
[0127] In some embodiments, R4and R5, together with the N atoms to which they are attached, form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R6.
[0128] In some embodiments, R6is selected from halo, C1-6 alkyl, C1-4 haloalkyl, ORal, C(O)ORal, C(O)NRclRdl, NRclRdl, NRclC(O)ORal, NRclS(O)2Rbl, and S(O)2NRclRdl.
[0129] In some embodiments, R6is selected from halo, C1-6 alkyl, ORal, and NRclRdl. In some embodiments, each Ral, Rbl, Rcl, and Rdlis independently selected from H and Ci-6 alkyl. In some embodiments, Ralis selected from H and Ci-6 alkyl. In some embodiments, Ralis H. In some embodiments, Ralis Ci-6 alkyl.
[0130] In some embodiment, the compound of Formula (II) has formula: or a pharmaceutically acceptable salt thereof.
[0131] In some embodiment, the compound of Formula (II) has formula: or a pharmaceutically acceptable salt thereof. In some embodiment, the compound of Formula (II) has formula: or a pharmaceutically acceptable salt thereof.
[0132] In some embodiment, the compound of Formula (II) has formula: or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (II) is selected from any one of the compounds listed in Table 3, or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides any one of the compounds of Formula (II) listed in Table El, or a pharmaceutically acceptable salt thereof.
[0133]
[0134] In some embodiments, the present disclosure provides a compound of
[0135] Formula (111): or a pharmaceutically acceptable salt thereof, wherein: W is a warhead functional group selected from any one of the following moieties
[0136] (i)-(xii): wherein: each RA, RB, and Rcare independently selected from H and methyl; each RDis independently selected from H, methyl, halo, and NO2; each Y1is independently selected from O and NH; n is 1 or 2;
[0137] X is Cl or F; and each Y is independently selected from O and S; provided if W is a moiety of formula (xii), then L comprises at least one optionally substituted phenylene moiety;
[0138] L is selected from -C3-6 alkylene-, -C1-3 alkylene-phenylene-, -phenylene-Ci-3 alkylene-, and -C1-3 alky lene-phenylene-C 1-3 alkylene-, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, C1-4 haloalkyl, Ci-6 alkoxy, and C1-4 haloalkoxy;
[0139] R1, R2, R3, R4, and R5are each independently selected from H, NO2, CN, halo, Ci- 6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRclRdl, C6-io aryl, C6-12 aryloxy, C2-6 alkenylene-C6-i2 aryl, and C2-6 alkynylene-C6-i2 aryl, wherein each of said Ce-io aryl and C6-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12; each R12is independently selected from NO2, CN, halo, C1-6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl;
[0140] R6is selected from C1-6 alkyl, C1-6 alkylene-Ce-12 aryl, C3-6 cycloalkyl, C3-6 cycloalkenyl, Ci-6 alkylene-C -6 cycloalkyl, Ci-6 alkylene-Ca-6 cycloalkenyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; R7is selected from Ci-6 alkyl, Ci-6 alkylene-Ce-n aryl, C3-6 cycloalkyl, C3-6 cycloalkcnyl, C1-6 alkylcnc-C3-6 cycloalkyl, C1-6 alkylcnc-C3-6 cycloalkcnyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl;
[0141] R8, R9, R10, and R11are each independently selected from NO2, CN, halo, Ci-6 alkyl, C6-12 aryloxy, C6-12 aryl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal,
[0142] C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl, wherein said C6-12 aryloxy and Ce-12 aryl are each optionally substituted with 1, 2, or 3 substituents independently selected from R12; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl.
[0143] In some embodiments, the present disclosure provides a compound of Formula (III): or a pharmaceutically acceptable salt thereof, wherein:
[0144] W is a warhead functional group selected from any one of the following moieties (i)-(xii): wherein: each RA, RB, and Rcare independently selected from H and methyl; each RDis independently selected from H, methyl, halo, and NO2; each Y1is independently selected from O and NH; n is 1 or 2;
[0145] X is Cl or F; and each Y is independently selected from O and S; provided if W is a moiety of formula (xii), then L comprises at least one optionally substituted phenylene moiety;
[0146] L is selected from -C3-6 alkylene-, -C1-3 alkylene-phenylene-, -phenylene-Ci-3 alkylene-, and -C1-3 alky lene-phenylene-C 1-3 alkylene-, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, C1-4 haloalkyl, Ci-6 alkoxy, and C1-4 haloalkoxy;
[0147] R1, R2, R3, R4, and R5are each independently selected from NO2, CN, halo, C1-6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRclRdl, C6-io aryl, C6-12 aryloxy, C2-6 alkenylene-C6-i2 aryl, and C2-6 alkynylene-C6-i2 aryl, wherein each of said Ce-io aryl and C6-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12; each R12is independently selected from NO2, CN, halo, C1-6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl;
[0148] R6is selected from C1-6 alkyl, C1-6 alkylene-Ce-12 aryl, C3-6 cycloalkyl, C3-6 cycloalkenyl, Ci-6 alkylene-C -6 cycloalkyl, Ci-6 alkylene-Ca-6 cycloalkenyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; R7is selected from Ci-6 alkyl, Ci-6 alkylene-Ce-n aryl, C3-6 cycloalkyl, C3-6 cycloalkcnyl, C1-6 alkylcnc-C3-6 cycloalkyl, C1-6 alkylcnc-C3-6 cycloalkcnyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl;
[0149] R8, R9, R10, and R11are each independently selected from NO2, CN, halo, Ci-6 alkyl, C6-12 aryloxy, C6-12 aryl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl, wherein said C6-12 aryloxy and Ce-12 aryl are each optionally substituted with 1, 2, or 3 substituents independently selected from R12; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl.
[0150] In some embodiments, the warhead functional group is selected from any one of the moieties (i)-(xi). In some embodiments, the warhead functional group is a moiety (i). In some embodiments, the warhead functional group is a moiety (ii). In some embodiments, the warhead functional group is a moiety (iii). In some embodiments, the warhead functional group is a moiety (iv). In some embodiments, the warhead functional group is a moiety (v). In some embodiments, the warhead functional group is a moiety (vi). In some embodiments, the warhead functional group is a moiety (vii). In some embodiments, the warhead functional group is a moiety (viii). In some embodiments, the warhead functional group is a moiety (ix). In some embodiments, the warhead functional group is a moiety (x). In some embodiments, the warhead functional group is a moiety (xi).
[0151] In some embodiments, Y1is O.
[0152] In some embodiments, Y1is NH.
[0153] In some embodiments of Formula (III), L comprises at least one phenylene, optionally substituted as specified above, and the warhead functional group is a moiety of formula (xii), wherein X is Cl.
[0154] In some embodiments of Formula (III), L comprises at least one phenylene, optionally substituted as specified above, and the warhead functional group is a moiety of formula (xii), wherein X is F.
[0155] In some embodiments, RA, RB, and Rcare each H.
[0156] In some embodiments, at least one of RA, RB, and Rcis methyl. In some embodiments RDis H. In some embodiments, RDis methyl. In some embodiments, RDis halo. . In some embodiments, RDis chloro. In some embodiments, RDis NO2.
[0157] In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, X is Cl. In some embodiments, X is F.
[0158] In some embodiments, Y is O. In some embodiments, Y is S.
[0159] In some embodiments, W is a warhead functional group selected from any one of the following moieties (i)-(xii): wherein RA, RB, Rc, RD, Y, and X are as described herein.
[0160] In some embodiments, W is a warhead functional group selected from any one of the following moieties (i)-(xii): wherein RA, RB, Rc, RD, Y, and X are as described herein.
[0161] In some embodiments, L is -C3-6 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, C M haloalkyl, C1-6 alkoxy, and C haloalkoxy. In some embodiments, L is propylene, and W is a moeity of any one of formulae (i)-(xi). In some embodiments, L is butylene, and W is a moeity of any one of formulae (i)-(xi).
[0162] In some embodiments, L is -C4-6 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, CM haloalkyl, C1-6 alkoxy, and CM haloalkoxy. In some embodiments, L is -C4-6 alkylene- (e.g., butylene, pentylene, or hexylene).
[0163] In some embodiments, L is -C1-3 alkylene-phenylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, CM haloalkyl, C1-6 alkoxy, and CM haloalkoxy.
[0164] In some embodiments, L is -phenylene-Ci-3 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, Ci-6 alkyl, CM haloalkyl, C1-6 alkoxy, and C haloalkoxy.
[0165] In some embodiments, L is -C1-3 alky lene-phenylene-C 1-3 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, CM haloalkyl, Ci-6 alkoxy, and CM haloalkoxy.
[0166] In some embodiments, R1, R2, R3, R4, and R5are each independently selected from H, NO2, CN, halo, C1-6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, C6-12 aryloxy, C2-6 alkenylene-C6-i2 aryl, and C2-6 alkynylene-C6-i2 aryl, wherein each of said Ce-io aryl and Ce-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12. In some embodiments, R1, R2, R3, R4, and R5are each independently selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C6- 10 aryl, Ce-12 aryloxy, C2-6 alkenylene-Ce-12 aryl, and C2-6 alkynylene-Ce-12 aryl, wherein each of said Ce-io aryl and Ce-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0167] In some embodiments, R1, R2, R3, R4, and R5are each independently selected from H, halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-ioaryl, Ce-12 aryloxy, C2-6 alkenylene- Ce-12 aryl, and C2-6 alkynylene-Ce-12 aryl, wherein each of said Ce-io aryl and Ce-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0168] In some embodiments, R1, R2, R3, R4, and R5are each independently selected from halo, C1-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, Ce-12 aryloxy, C2-6 alkenylene-Ce- 12 aryl, and C2-6 alkynylene-Ce-12 aryl, wherein each of said Ce-io aryl and Ce-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0169] In some embodiments, R1is selected from H, NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0170] In some embodiments, R1is selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-e alkynyl, ORal, and C(O)ORal.
[0171] In some embodiments, R1is H.
[0172] In some embodiments, R1is Ce-12 aryloxy, optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0173] In some embodiments, R2is selected from H, NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0174] In some embodiments, R2is selected from NO2, CN, halo, Ci-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0175] In some embodiments, R2is H.
[0176] In some embodiments, R3is selected from H, NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0177] In some embodiments, R3is selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0178] In some embodiments, R3is selected from Ce-ioaryl, C6-12 aryloxy, C2-6 alkenylene- C6-12 aryl, and C2-6 alkynylene-Ce-12 aryl, wherein each of said Ce-io ryl and Ce-12 aryloxy is optionally substituted with 1 , 2, or 3 substituents independently selected from R12. In some embodiments, R3is phenyl.
[0179] In some embodiments, R3is Ce-12 aryloxy, optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0180] In some embodiments, R3is C2-6 alkenylene-Ce-12 aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0181] In some embodiments, R3is C2-6 alkynylene-Ce-12 aryl, optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0182] In some embodiments, R4is selected from H, NO2, CN, halo, C1-6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0183] In some embodiments, R4is selected from NO2, CN, halo, C1-6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0184] In some embodiments, R4is H.
[0185] In some embodiments, R5is selected from H, NO2, CN, halo, C1-6 alkyl, C haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0186] In some embodiments, R5is selected from NO2, CN, halo, C1-6 alkyl, C haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, and C(O)ORal.
[0187] In some embodiments, R5is H.
[0188] In some embodiments, R12is selected from NO2, CN, halo, Ci-6 alkyl, CM haloalkyl, ORal, C(O)ORal, C(O)NRclRdl, NRclRdl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl.
[0189] In some embodiments, R12is selected from NO2, halo, C1-6 alkyl, ORal, and NRclRdl.
[0190] In some embodiments, R6is selected from C1-6 alkyl, C3-6 cycloalkyl, CM alkylene- C3-6 cycloalkyl, C1-6 alkylene-Ce-12 aryl, C3-6 cycloalkenyl, and C1-6 alkylene-C3-6 cycloalkenyl.
[0191] In some embodiments, R6is selected from C1-6 alkyl, C3-6 cycloalkyl, and C1-6 alkylene-C3-6 cycloalkyl. In some embodiments, R6is CM alkyl. In some embodiments, R6is C1-6 alkylene-C6-i2 aryl. In some embodiments, R6is C3-6 cycloalkyl. In some embodiments, R6is C3-6 cycloalkenyl. In some embodiments, R6is CM alkylene-C3-6 cycloalkyl. In some embodiments, R6is C alkylene-C3-6 cycloalkenyl. In some embodiments, R6is C haloalkyl. In some embodiments, R6is C2-6 alkenyl. In some embodiments, R6is C2-6 alkynyl.
[0192] In some embodiments, R7is selected from C1-6 alkyl, C3-6 cycloalkyl, C1-6 alkylene- C3-6 cycloalkyl, Ci-6 alkylene-Ce-12 aryl, C3-6 cycloalkenyl, and Ci-6 alkylene-C -6 cycloalkenyl.
[0193] In some embodiments, R7is selected from C1-6 alkyl, C3-6 cycloalkyl, and C1-6 alkylene-C3-6 cycloalkyl. In some embodiments, R7is C1-6 alkyl. In some embodiments, R7is C1-6 alkylene-C6-i2 aryl. In some embodiments, R7is C3-6 cycloalkyl. In some embodiments, R7is C3-6 cycloalkenyl. In some embodiments, R7is C1-6 alkylene-C3-6 cycloalkyl. In some embodiments, R7is C1-6 alkylene-C3-6 cycloalkenyl. In some embodiments, R7is CM haloalkyl. In some embodiments, R6is C2-6 alkenyl. In some embodiments, R6is C2-6 alkynyl.
[0194] In some embodiments, R8, R9, R10, and R11are each independently selected from halo, C1-6 alkyl, C6-n aryloxy, CM haloalkyl, ORal, C(O)ORal, C(O)NRclRdl, and NRclRdl, wherein said Ce-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0195] In some embodiments, at least one of R8, R9, R10, and R11is C6-12 aryloxy, optionally substituted with 1, 2, or 3 substituents independently selected from R12.
[0196] In some embodiments, R8, R9, R10, and R11are each independently selected from halo, C1-6 alkyl, and C1-6 alkoxy.
[0197] In some embodiments, each Ral, Rbl, Rcl, and Rdlis independently selected from H and C1-6 alkyl. In some embodiments, Ralis selected from H and C1-6 alkyl. In some embodiments, Ralis H. In some embodiments, Ralis Ci-6 alkyl.
[0198] In some embodiments, the compound of Formula (III) is selected from any one of the compounds in FIG. 20, or a pharmaceutically acceptable salt thereof. In some
[0199] embodiments, the compound of Formula (III) is selected from any one of the following compounds, or a pharmaceutically acceptable salt thereof:
[0200]
[0201] Pharmaceutically acceptable salts
[0202] In some embodiments, a salt of a compound of Formulae I, II, or III is formed between an acid and a basic group of the compound, such as an amino functional group, or a base and an acidic group of the compound, such as a carboxyl functional group. According to another embodiment, the compound is a pharmaceutically acceptable acid addition salt.
[0203] In some embodiments, acids commonly employed to form pharmaceutically acceptable salts of the compounds of Formulae I, II, or III include inorganic acids such as hydrogen bisulfide, hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid and phosphoric acid, as well as organic acids such as para-toluenesulfonic acid, salicylic acid, tartaric acid, bitartaric acid, ascorbic acid, maleic acid, besylic acid, fumaric acid, gluconic acid, glucuronic acid, formic acid, glutamic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, lactic acid, oxalic acid, para-bromophenylsulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid and acetic acid, as well as related inorganic and organic acids. Such pharmaceutically acceptable salts thus include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne- 1 ,4- dioate, hexyne-l,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, sulfonate, xylene sulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, -hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, propanesulfonate, naphthalene- 1- sulfonate, naphthalene-2- sulfonate, mandelate and other salts. In one embodiment, pharmaceutically acceptable acid addition salts include those formed with mineral acids such as hydrochloric acid and hydrobromic acid, and especially those formed with organic acids such as maleic acid.
[0204] In some embodiments, bases commonly employed to form pharmaceutically acceptable salts of the compounds of Formulae I, II, or III include hydroxides of alkali metals, including sodium, potassium, and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia, organic amines such as unsubstituted or hydroxyl-substituted mono-, di-, or trialkylamines, dicyclohexylamine; tributyl amine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-OH-(Cl-C6)-alkylamine), such as N,N- dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D- glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids such as arginine, lysine, and the like.
[0205] In some embodiments, the compounds of Formulae I, II, or III, or pharmaceutically acceptable salts thereof, are substantially isolated.
[0206] Definitions
[0207] As used herein, the term "about" means plus or minus 10% of the indicated value or range. At various places in the present specification, substituents of compounds of the invention arc disclosed in groups or in ranges. It is specifically intended that the invention include each and every individual subcombination of the members of such groups and ranges. For example, the term “Ci-6 alkyl” is specifically intended to individually disclose methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl, and Ce alkyl.
[0208] At various places in the present specification various aryl, heteroaryl, cycloalkyl, and heterocycloalkyl rings are described. Unless otherwise specified, these rings can be attached to the rest of the molecule at any ring member as permitted by valency. For example, the term “a pyridine ring” or “pyridinyl” may refer to a pyridin-2-yl, pyridin-3- yl, or pyridin-4-yl ring.
[0209] It is further appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the invention which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable subcombination.
[0210] The term “aromatic” refers to a carbocycle or heterocycle having one or more polyunsaturated rings having aromatic character (i.e., having (4n + 2) delocalized n (pi) electrons where n is an integer).
[0211] The term “n-membered” where n is an integer typically describes the number of ring-forming atoms in a moiety where the number of ring-forming atoms is n. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaryl ring, pyridyl is an example of a 6-membered heteroaryl ring, and 1,2,3,4-tetrahydro-naphthalene is an example of a 10-membered cycloalkyl group.
[0212] As used herein, the phrase “optionally substituted” means unsubstituted or substituted. The substituents are independently selected, and substitution may be at any chemically accessible position. As used herein, the term “substituted” means that a hydrogen atom is removed and replaced by a substituent. A single divalent substituent, e.g., oxo, can replace two hydrogen atoms. It is to be understood that substitution at a given atom is limited by valency. Throughout the definitions, the term “Cn.m” indicates a range which includes the endpoints, wherein n and m arc integers and indicate the number of carbons. Examples include CM, Ci-6, and the like.
[0213] As used herein, the term “Cn-malkyl”, employed alone or in combination with other terms, refers to a saturated hydrocarbon group that may be straight-chain or branched, having n to m carbons. Examples of alkyl moieties include, but are not limited to, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl; higher homologs such as 2-methyl-l -butyl, ^-pentyl, 3-pentyl, u-hexyl, 1,2,2- trimethylpropyl, and the like. In some embodiments, the alkyl group contains from 1 to 6 carbon atoms, from 1 to 4 carbon atoms, from 1 to 3 carbon atoms, or 1 to 2 carbon atoms.
[0214] As used herein, the term “Cn-m haloalkyl”, employed alone or in combination with other terms, refers to an alkyl group having from one halogen atom to 2s+ 1 halogen atoms which may be the same or different, where “s” is the number of carbon atoms in the alkyl group, wherein the alkyl group has n to m carbon atoms. In some embodiments, the haloalkyl group is fluorinated only. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0215] As used herein, “Cn-malkenyl” refers to an alkyl group having one or more double carbon-carbon bonds and having n to m carbons. Example alkenyl groups include, but are not limited to, ethenyl, n-propenyl, isopropenyl, n-butenyl, .sec-butcnyl, and the like. In some embodiments, the alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.
[0216] As used herein, “Cn-m alkynyl” refers to an alkyl group having one or more triple carbon-carbon bonds and having n to m carbons. Example alkynyl groups include, but are not limited to, ethynyl, propyn-l-yl, propyn-2-yl, and the like. In some embodiments, the alkynyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.
[0217] As used herein, the term “Cn-malkylene”, employed alone or in combination with other terms, refers to a divalent alkyl linking group having n to m carbons. Examples of alkylene groups include, but a e not limited to, ethan- 1,1 -diyl, ethan-l,2-diyl, propan- 1,1,- diyl, propan- 1,3-diyl, propan- 1,2-diyl, butan-l,4-diyl, butan-l,3-diyl, butan-l,2-diyl, 2- methyl-propan-l,3-diyl, and the like. In some embodiments, the alkylene moiety contains 2 to 6, 2 to 4, 2 to 3, 1 to 6, 1 to 4, or 1 to 2 carbon atoms. As used herein, the term “Cn-m alkoxy”, employed alone or in combination with other terms, refers to a group of formula -O-alkyl, wherein the alkyl group has n to m carbons. Example alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), butoxy (e.g., n-butoxy and tert-butoxy), and the like. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0218] As used herein, “Cn-m haloalkoxy” refers to a group of formula -O-haloalkyl having n to m carbon atoms. An example haloalkoxy group is OCF3. In some embodiments, the haloalkoxy group is fluorinated only. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0219] As used herein, the term “amino” refers to a group of formula -NH2.
[0220] As used herein, the term “Cn-malkylamino” refers to a group of formula -NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkylamino groups include, but are not limited to, N-methylamino, N-ethylamino, N-propylamino (e.g., N-(n-propyl)amino and N-isopropylamino), N-butylamino (e.g., N-( / 7-butyl)amino and N-(tert-butyl)amino), and the like.
[0221] As used herein, the term “di(Cn-m-alkyl)amino” refers to a group of formula - N(alkyl)2, wherein the two alkyl groups each has, independently, n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.
[0222] As used herein, “halo” refers to F, Cl, Br, or I. In some embodiments, a halo is F, Cl, or Br.
[0223] As used herein, the term "aryl," employed alone or in combination with other terms, refers to an aromatic hydrocarbon group, which may be monocyclic or polycyclic (e.g., having 2, 3 or 4 fused rings). The term "Cn-m aryl" refers to an aryl group having from n to m ring carbon atoms. Aryl groups include, e.g., phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl, and the like. In some embodiments, aryl groups have from 6 to 10 carbon atoms. In some embodiments, the aryl group is phenyl or naphtyl.
[0224] As used herein, “cycloalkyl” refers to non-aromatic cyclic hydrocarbons including cyclized alkyl and / or alkenyl groups. Cycloalkyl groups can include mono- or polycyclic (e.g., having 2, 3 or 4 fused rings) groups and spirocycles. Ring-forming carbon atoms of a cycloalkyl group can be optionally substituted by 1 or 2 independently selected oxo or sulfide groups (c.g., C(O) or C(S)). Also included in the definition of cycloalkyl arc moieties that have one or more aromatic rings fused (i.e., having a bond in common with) to the cycloalkyl ring, for example, benzo or thienyl derivatives of cyclopentane, cyclohexane, and the like. A cycloalkyl group containing a fused aromatic ring can be attached through any ring-forming atom including a ring-forming atom of the fused aromatic ring. Cycloalkyl groups can have 3, 4, 5, 6, 7, 8, 9, or 10 ring-forming carbons (C3-10). In some embodiments, the cycloalkyl is a C3-10 monocyclic or bicyclic cyclocalkyl. In some embodiments, the cycloalkyl is a C3-7 monocyclic cyclocalkyl. Example cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbomyl, norpinyl, norcarnyl, adamantyl, and the like. In some embodiments, cycloalkyl is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.
[0225] As used herein, “heterocycloalkyl” refers to non-aromatic monocyclic or polycyclic heterocycles having one or more ring-forming heteroatoms selected from O, N, or S. Included in heterocycloalkyl are monocyclic 4-, 5-, 6-, 7-, 8-, 9- or 10-membered heterocycloalkyl groups. Heterocycloalkyl groups can also include spirocycles. Example heterocycloalkyl groups include pyrrolidin-2-one, l,3-isoxazolidin-2-one, pyranyl, tetrahydropuran, oxetanyl, azetidinyl, morpholino, thiomorpholino, piperazinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, azepanyl, benzazapene, and the like. Ring-forming carbon atoms and heteroatoms of a heterocycloalkyl group can be optionally substituted by 1 or 2 independently selected oxo or sulfido groups (e.g., C(O), S(O), C(S), or S(O)2, etc.). The heterocycloalkyl group can be attached through a ring-forming carbon atom or a ring-forming heteroatom. In some embodiments, the heterocycloalkyl group contains 0 to 3 double bonds. In some embodiments, the heterocycloalkyl group contains 0 to 2 double bonds. Also included in the definition of heterocycloalkyl are moieties that have one or more aromatic rings fused (i.e., having a bond in common with) to the cycloalkyl ring, for example, benzo or thienyl derivatives of piperidine, morpholine, azepine, etc. A heterocycloalkyl group containing a fused aromatic ring can be attached through any ring-forming atom including a ring- forming atom of the fused aromatic ring. In some embodiments, the heterocycloalkyl is a monocyclic 4-6 membered hctcrocycloalkyl having 1 or 2 hctcroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members. In some embodiments, the heterocycloalkyl is a monocyclic or bicyclic 4-10 membered heterocycloalkyl having 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members.
[0226] At certain places, the definitions or embodiments refer to specific rings (e.g., an azetidine ring, a pyridine ring, etc.). Unless otherwise indicated, these rings can be attached to any ring member provided that the valency of the atom is not exceeded. For example, an azetidine ring may be attached at any position of the ring, whereas a pyridin-3-yl ring is attached at the 3-position.
[0227] The term “compound” as used herein is meant to include all stereoisomers, geometric isomers, tautomers, and isotopes of the structures depicted. Compounds herein identified by name or structure as one particular tautomeric form are intended to include other tautomeric forms unless otherwise specified.
[0228] The compounds described herein can be asymmetric (e.g., having one or more stereocenters). All stereoisomers, such as enantiomers and diastereomers, are intended unless otherwise indicated. Compounds of the present invention that contain asymmetrically substituted carbon atoms can be isolated in optically active or racemic forms. Methods on how to prepare optically active forms from optically inactive starting materials are known in the art, such as by resolution of racemic mixtures or by stereoselective synthesis. Many geometric isomers of olefins, C=N double bonds, N=N double bonds, and the like can also be present in the compounds described herein, and all such stable isomers are contemplated in the present invention. Cis and trans geometric isomers of the compounds of the present invention are described and may be isolated as a mixture of isomers or as separated isomeric forms. In some embodiments, the compound has the ^-configuration. In some embodiments, the compound has the ( J-configuration.
[0229] Compounds provided herein also include tautomeric forms. Tautomeric forms result from the swapping of a single bond with an adjacent double bond together with the concomitant migration of a proton. Tautomeric forms include prototropic tautomers which are isomeric protonation states having the same empirical formula and total charge. Example prototropic tautomers include ketone - enol pairs, amide - imidic acid pairs, lactam - lactim pairs, enamine - imine pairs, and annular forms where a proton can occupy two or more positions of a heterocyclic system, for example, 1H- and 3H-imidazole, 1H-, 2H- and 4H- 1,2,4-triazole, 1H- and 2H- isoindole, and 1H- and 2H-pyrazole. Tautomeric forms can be in equilibrium or sterically locked into one form by appropriate substitution.
[0230] As used herein, the term “cell” is meant to refer to a cell that is in vitro, ex vivo or in vivo. In some embodiments, an ex vivo cell can be part of a tissue sample excised from an organism such as a mammal. In some embodiments, an in vitro cell can be a cell in a cell culture. In some embodiments, an in vivo cell is a cell living in an organism such as a mammal.
[0231] As used herein, the term “contacting” refers to the bringing together of indicated moieties in an in vitro system or an in vivo system. For example, “contacting” the STING with a compound of the invention includes the administration of a compound of the present invention to an individual or patient, such as a human, having STING, as well as, for example, introducing a compound of the invention into a sample containing a cellular or purified preparation containing the STING.
[0232] As used herein, the term “individual”, “patient”, or “subject” used interchangeably, refers to any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans.
[0233] As used herein, the phrase “effective amount” or “therapeutically effective amount” refers to the amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal, individual or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.
[0234] As used herein the term “treating” or “treatment” refers to 1) inhibiting the disease; for example, inhibiting a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (z.e., arresting further development of the pathology and / or symptomatology), or 2) ameliorating the disease; for example, ameliorating a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., reversing the pathology and / or symptomatology). As used herein, the term “preventing” or “prevention” of a disease, condition or disorder refers to decreasing the risk of occurrence of the disease, condition or disorder in a subject or group of subjects (e.g., a subject or group of subjects predisposed to or susceptible to the disease, condition or disorder). In some embodiments, preventing a disease, condition or disorder refers to decreasing the possibility of acquiring the disease, condition or disorder and / or its associated symptoms. In some embodiments, preventing a disease, condition or disorder refers to completely or almost completely stopping the disease, condition or disorder from occurring.
[0235] Methods of use
[0236] STING pathway
[0237] Without being bound by any theory, it is believed that STING is a key signaling molecule that functions downstream of a DNA sensor called cGAS. Accumulation of host or foreign DNA results in the activation of cGAS which catalyzes the conversion of ATP and GTP into a second messenger called cyclic GMP-AMP (“cGAMP”). cGAMP, in turn, binds to and activates STING leading to transcription of inflammatory genes. Bacteria can also release cyclic di-nucleotides that activate the STING pathway. Without being bound by a theory, it is believed that reliable discrimination of self from non-self-nucleic acids is fundamental to immunological homeostasis, to prevent debilitating inflammatory and autoimmune diseases. Excessive STING-mediated inflammatory reaction to foreign DNA and autoinflammatory reaction to the body’s own DNA could be ameliorated by a compound that inhibits the STING pathway.
[0238] Further, a growing number of monogenic diseases characterized by mutations in one or more DNases are characterized by excessive production of type I IFNs and are collectively termed type I interferonopathies. In these diseases, loss of nuclease function leads to autoinflammatory state including markedly enhanced type I interferon signaling. Nucleases (such as DNase II) play a central role in the clearance of nucleic acids following phagocytosis, so the absence of these enzymes lead to chronic activation of type I interferon signaling mediated through the sGAS STING pathway. These diseases, collectively called type I interferonopathies, include Aicardi-Goutieres syndrome (AGS) as well as a disease caused by biallelic mutations in DNASE2 (e.g., type I interferonopathy due to DNase II deficiency). These conditions include co-morbidities such as anemia, mcmbranoprolifcrativc glomerulonephritis, liver fibrosis, thrombocytopenia, hepatosplenomegaly, cholestatic hepatitis, hypogammaglobulinemia, and proteinuria.
[0239] On the other hand, mutations in TMEM173 gene which encode STING (resulting in mutant STING protein), also lead to excessive production of interferon and associated inflammatory conditions. For example, a spectrum of gain-of-function (“GOF”) mutations in STING result in an autoinflammatory disease called SAVI (STING-associated vasculopathy with onset in infancy), which is also associated with an interferon signature due to constitutive activation of STING. SAVI patients are particularly prone to developing a co-morbidity such as an interstitial lung disease (“ILD”). SAVI mutations lead to spontaneous STING dimerization and constitutive activation of IRF3 and NFkB, resulting in elevated IFN and cytokine levels.
[0240] Beyond the rare genetic diseases, there is growing evidence that self-DNA-driven inflammation and erroneous activation of the STING pathway underlies the pathogenesis of a broader collection of inflammatory diseases. Self-DNA initiated inflammation contributes to tissue damage following myocardial infarction, acute kidney injury, macular degeneration, systemic lupus erythematosus (SLE) as well as Parkinson’s disease and ALS. STING activation in hepatic macrophages led to the production of proinflammatory cytokines, leading to nonalcoholic steatohepatitis (NASH), which is characterized by hepatic steatosis and fibrosis. Acute kidney injury (AKI) associated with mitochondrial dysfunction has also been shown to drive inflammation through the cGAS-STING pathway.
[0241] Accordingly, in some embodiments, the present disclosure provides a method of treating or preventing a disease or a condition in which a STING pathway is implicated. Suitable examples of such diseases include Aicardi-Goutieres syndrome (AGS), STING- associated vasculopathy with onset in infancy (SAVI), interferonopathy due to inherited DNase deficiency (e.g., DNase II deficiency), Sjogren’s syndrome, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, acute kidney injury, and inflammatory response to gene therapy. In some embodiments, the present disclosure provides a method of treating or preventing a type I intcrfcronopathy selected from Aicardi-Gouticrcs syndrome (AGS), STING-associated vasculopathy with onset in infancy (SAVI), type I interferonopathy due to inherited DNase deficiency, as well as Sjogren’s syndrome, the method comprising administering to a subject in need thereof a compound of any one of the Formulae disclosed herein (e.g., compounds of Formula (I), Formula (II), Formula (III), or a pharmaceutically acceptable salt of any of the foregoing), or a pharmaceutical composition comprising same.
[0242] In some embodiments, the present disclosure provides a method of treating or preventing a disease or condition selected from nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, and acute kidney injury, the method comprising administering to a subject in need thereof a compound of any one of the Formulae disclosed herein (e.g., compounds of Formula (I), Formula (II), Formula (III), or a pharmaceutically acceptable salt of any of the foregoing), or a pharmaceutical composition comprising same.
[0243] In some embodiments, the present disclosure provides a method of treating or preventing a diabetes (e.g., diabetes mellitus, type I diabetes, or type II diabetes), the method comprising administering to a subject in need thereof a compound of any one of the Formulae disclosed herein (e.g., compounds of Formula (I), Formula (II), Formula (III), or a pharmaceutically acceptable salt of any of the foregoing), or a pharmaceutical composition comprising same.
[0244] In some embodiments, the present disclosure provides a method of treating or preventing an inflammatory response to a gene therapy (e.g., inflammation and sensitivity at an injection site and other adverse events associated with gene therapy). For example, the disclosure provides a method of treating or preventing an immune response to a gene therapy. In some embodiments, the gene therapy includes administering to a subject an adenovirus vector, adeno-associated virus vector, lentivirus vector, siRNA, or a naked DNA. Examples of gene therapies include those that replace and those that disrupt defective genes. Upon administration to the subject, DNA reaches the damaged cells, enter the cell and either express or disrupt a function of a protein. Suitable examples of gene therapeutics include Neovasculgen (cambiogen plasmid delivering the gene encoding vascular endothelial growth factor (VEGF)), Gendicine (recombinant adenovirus engineered to express wildtypc-p53 (rAd-p53)), Glybcra (adcno-associatcd virus serotype 1 (AAV1) vector delivering an intact copy of the human lipoprotein lipase (LPL) gene), as well as others. These gene therapies can treat various disorders or conditions, including many inherited genetic diseases. Suitable examples of such disease include peripheral artery disease, including critical limb ischemia, various cancers, including mutated cancers (e.g., having mutated P53 genes), lipoprotein lipase deficiency (LPLD), pancreatitis, and various neurodegenerative diseases. In some embodiments, the gene therapy is personalized to the subject.
[0245] Generally, upon delivery of a gene therapy to a subject, an innate immune response develops, causing pro-inflammatory cytokine production and other inflammatory responses. Simultaneously, T-cells eliminate the infected cells by secretion of interferon and induction of apoptosis. Without being bound by a theory, it is believed that administering a STING inhibitor of the present disclosure before, after, or simultaneously with a gene therapy mitigates these adverse events and reduces or eliminates undesired inflammatory responses and injection- site sensitivity. On some embodiments, a STING inhibitor can be administered orally before injecting gene therapy to a subject. In other embodiments, a STING inhibitor can be co-injected to a subject along with the gene therapy.
[0246] PAD
[0247] Certain compounds disclosed herein (e.g., ca ompound of Formulae (II) and / or (III), or a pharmaceutically acceptable salt of any of the foregoing) are inhibitors or inactivators of a protein arginine deiminase (“PAD”). In some embodiments, the compound is an inhibitor of PAD1, PAD2, PAD3, and / or PAD4. In some embodiments, the inhibitors are orally available, potent, and selective to the PAD enzyme. The compounds (and pharmaceutical compositions comprising the compounds) may be used to treat or prevent diseases or conditions in which a PAD enzyme is implicated, such as immune system disorders (including autoimmune disorders), inflammatory diseases or conditions, and cancer. These compounds display improved metabolic stability, cell permeability, and / or potency. As used herein, the term “immune system” diseases or conditions refers to a group of conditions characterized by a dysfunctioning immune system. These disorders can be characterized in several different ways: by the component(s) of the immune system affected, by whether the immune system is overactive or underactive, or by whether the condition is congenital or acquired. Autoimmune diseases or conditions are among immune system diseases or conditions.
[0248] As used herein, the term “autoimmune” diseases or conditions refers to conditions arising from an abnormal immune response to a normal body pail. Examples of include, but not limited to rheumatoid arthritis, lupus, multiple sclerosis, inflammatory bowel disease, and psoriasis.
[0249] As used herein, the term “inflammatory” diseases or conditions refers to a group of conditions including rheumatoid arthritis, osteoarthritis, juvenile idiopathic arthritis, psoriasis, allergic airway disease (e.g., asthma, rhinitis), inflammatory bowel diseases (e.g., Crohn’s disease, colitis), endotoxin-driven disease states (e.g., complications after bypass surgery or chronic endotoxin states contributing to, e.g., chronic cardiac failure), and related diseases involving cartilage, such as that of the joints. Suitable examples of inflammatory diseases also include Alzheimer’s disease and Parkinson’s disease.
[0250] In some embodiments, the present disclosure provides a method of treating a disease or condition selected from ulcerative colitis, spinal cord injury, and atherosclerosis.
[0251] In some embodiments, the present disclosure provides a method of treating a cancer. As used herein, the term “cancer” refers to or describes the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, carcinoma, lymphoma, sarcoma, blastoma and leukemia. More particular examples of such cancers include squamous cell carcinoma, lung cancer, pancreatic cancer, cervical cancer, bladder cancer, hepatoma, breast cancer, colon carcinoma, and head and neck cancer.
[0252] In some embodiments, the present disclosure provides a method of treating or preventing a disease or condition selected from an immune system disease or disorder, an inflammatory disease or disorder, and an autoimmune disease or disorder, the method comprising administering to a subject in need thereof a compound of any one of the Formulae disclosed herein (e.g., Formulae (II) or (III), or a compound of Table 2), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising same.
[0253] In some embodiments, the present disclosure provides a method of treating or preventing a disease or condition selected from rheumatoid arthritis, collagen-induced arthritis (CIA), osteoarthritis, juvenile idiopathic arthritis, lupus, Alzheimer’s disease, Parkinson’s disease, multiple sclerosis, inflammatory bowel disease, psoriasis, asthma, rhinitis, Crohn’s disease, colitis, ulcerative colitis, spinal cord injury, and atherosclerosis, the method comprising administering to a subject in need thereof a compound of any one of the Formulae disclosed herein (e.g., Formulae (II) or (III), or a compound of Table 2), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising same.
[0254] Pharmaceutical compositions
[0255] The present application also provides pharmaceutical compositions comprising an effective amount of a compound of the present disclosure (e.g., Formula (I), Formula (II), or Formula (III)) disclosed herein, or a pharmaceutically acceptable salt thereof; and a pharmaceutically acceptable carrier. The pharmaceutical composition may also comprise any one of the additional therapeutic agents described herein. In certain embodiments, the application also provides pharmaceutical compositions and dosage forms comprising any one the additional therapeutic agents described herein. The camer(s) are “acceptable” in the sense of being compatible with the other ingredients of the formulation and, in the case of a pharmaceutically acceptable carrier, not deleterious to the recipient thereof in an amount used in the medicament.
[0256] Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the pharmaceutical compositions of the present application include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fat.
[0257] The compositions or dosage forms may contain any one of the compounds and therapeutic agents described herein in the range of 0.005% to 100% with the balance made up from the suitable pharmaceutically acceptable excipients. The contemplated compositions may contain 0.001%-100% of any one of the compounds and therapeutic agents provided herein, in one embodiment 0.1-95%, in another embodiment 75-85%, in a further embodiment 20-80%, wherein the balance may be made up of any pharmaceutically acceptable excipient described herein, or any combination of these excipients.
[0258] Routes of administration and dosage forms
[0259] The pharmaceutical compositions of the present application include those suitable for any acceptable route of administration. Acceptable routes of administration include, but are not limited to, buccal, cutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-abdominal, intra-arterial, intrabronchial, intrabursal, intracerebral, intracisternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumoral, intrauterine, intravascular, intravenous, nasal, nasogastric, oral, parenteral, percutaneous, peridural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral and vaginal.
[0260] Compositions and formulations described herein may conveniently be presented in a unit dosage form, e.g., tablets, sustained release capsules, and in liposomes, and may be prepared by any methods well known in the art of pharmacy. See, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, Baltimore, MD (20th ed. 2000). Such preparative methods include the step of bringing into association with the molecule to be administered ingredients such as the carrier that constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers, liposomes or finely divided solid carriers, or both, and then, if necessary, shaping the product. In some embodiments, any one of the compounds and therapeutic agents disclosed herein arc administered orally. Compositions of the present application suitable for oral administration may be presented as discrete units such as capsules, sachets, granules or tablets each containing a predetermined amount (e.g., effective amount) of the active ingredient; a powder or granules; a solution or a suspension in an aqueous liquid or a nonaqueous liquid; an oil-in-water liquid emulsion; a water-in-oil liquid emulsion; packed in liposomes; or as a bolus, etc. Soft gelatin capsules can be useful for containing such suspensions, which may beneficially increase the rate of compound absorption. In the case of tablets for oral use, carriers that are commonly used include lactose, sucrose, glucose, mannitol, and silicic acid and starches. Other acceptable excipients may include: a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions are administered orally, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and / or flavoring and / or coloring agents may be added. Compositions suitable for oral administration include lozenges comprising the ingredients in a flavored basis, usually sucrose and acacia or tragacanth; and pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia.
[0261] Compositions suitable for parenteral administration include aqueous and nonaqueous sterile injection solutions or infusion solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, saline (e.g., 0.9% saline solution) or 5% dextrose solution, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets. The injection solutions may be in the form, for example, of a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long- chain alcohol diluent or dispersant.
[0262] The pharmaceutical compositions of the present application may be administered in the form of suppositories for rectal administration. These compositions can be prepared by mixing a compound of the present application with a suitable non-irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components. Such materials include, but are not limited to, cocoa butter, beeswax, and polyethylene glycols.
[0263] The pharmaceutical compositions of the present application may be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the ail of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and / or other solubilizing or dispersing agents known in the art. See, for example, U.S. Patent No. 6,803,031. Additional formulations and methods for intranasal administration are found in Ilium, L., J Pharm Pharmacol, 56:3-17, 2004 and Ilium, L., Eur J Pharm Sci 11:1-18, 2000.
[0264] The topical compositions of the present disclosure can be prepared and used in the form of an aerosol spray, cream, emulsion, solid, liquid, dispersion, foam, oil, gel, hydrogel, lotion, mousse, ointment, powder, patch, pomade, solution, pump spray, stick, towelette, soap, or other forms commonly employed in the art of topical administration and / or cosmetic and skin care formulation. The topical compositions can be in an emulsion form. Topical administration of the pharmaceutical compositions of the present application is especially useful when the desired treatment involves areas or organs readily accessible by topical application. In some embodiments, the topical composition comprises a combination of any one of the compounds and therapeutic agents disclosed herein, and one or more additional ingredients, carriers, excipients, or diluents including, but not limited to, absorbents, anti-irritants, anti-acne agents, preservatives, antioxidants, coloring agents / pigments, emollients (moisturizers), emulsifiers, film-forming / holding agents, fragrances, leave-on exfoliants, prescription drugs, preservatives, scrub agents, silicones, skin-identical / repairing agents, slip agents, sunscreen actives, surfactants / detergent cleansing agents, penetration enhancers, and thickeners.
[0265] The compounds and therapeutic agents of the present application may be incorporated into compositions for coating an implantable medical device, such as prostheses, artificial valves, vascular grafts, stents, or catheters. Suitable coatings and the general preparation of coated implantable devices are known in the art and are exemplified in U.S. Patent Nos. 6,099,562; 5,886,026; and 5,304,121. The coatings are typically biocompatible polymeric materials such as a hydrogel polymer, polymethyldisiloxane, polycaprolactone, polyethylene glycol, polylactic acid, ethylene vinyl acetate, and mixtures thereof. The coatings may optionally be further covered by a suitable topcoat of fluorosilicone, polysaccharides, polyethylene glycol, phospholipids or combinations thereof to impart controlled release characteristics in the composition. Coatings for invasive devices are to be included within the definition of pharmaceutically acceptable carrier, adjuvant or vehicle, as those terms are used herein.
[0266] According to another embodiment, the present application provides an implantable drug release device impregnated with or containing a compound or a therapeutic agent, or a composition comprising a compound of the present application or a therapeutic agent, such that said compound or therapeutic agent is released from said device and is therapeutically active.
[0267] Dosages and regimens
[0268] In the pharmaceutical compositions of the present application, a compound of the present disclosure (e.g., a compound of Formula (I) or Formula (II)) is present in an effective amount (e.g., a therapeutically effective amount). Effective doses may vary, depending on the diseases treated, the severity of the disease, the route of administration, the sex, age and general health condition of the subject, excipient usage, the possibility of co-usage with other therapeutic treatments such as use of other agents and the judgment of the treating physician.
[0269] In some embodiments, an effective amount of the compound (e.g., Formula (I) or Formula (II)) can range, for example, from about 0.001 mg / kg to about 500 mg / kg (e.g., from about 0.001 mg / kg to about 200 mg / kg; from about 0.01 mg / kg to about 200 mg / kg; from about 0.01 mg / kg to about 150 mg / kg; from about 0.01 mg / kg to about 100 mg / kg; from about 0.01 mg / kg to about 50 mg / kg; from about 0.01 mg / kg to about 10 mg / kg; from about 0.01 mg / kg to about 5 mg / kg; from about 0.01 mg / kg to about 1 mg / kg; from about 0.01 mg / kg to about 0.5 mg / kg; from about 0.01 mg / kg to about 0.1 mg / kg; from about 0.
[0270] 1 mg / kg to about 200 mg / kg; from about 0. 1 mg / kg to about 150 mg / kg; from about 0. 1 mg / kg to about 100 mg / kg; from about 0.1 mg / kg to about 50 mg / kg; from about 0. 1 mg / kg to about 10 mg / kg; from about 0.1 mg / kg to about 5 mg / kg; from about 0.1 mg / kg to about
[0271] 2 mg / kg; from about 0.1 mg / kg to about 1 mg / kg; or from about 0.1 mg / kg to about 0.5 mg / kg). In some embodiments, an effective amount of a compound of Formula (I) or Formula (II) is about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, or about 5 mg / kg.
[0272] The foregoing dosages can be administered on a daily basis (e.g., as a single dose or as two or more divided doses, e.g., once daily, twice daily, thrice daily) or non-daily basis (e.g., every other day, every two days, every three days, once weekly, twice weekly, once every two weeks, once a month). Kits
[0273] The present invention also includes pharmaceutical kits useful, for example, in the treatment of disorders, diseases and conditions referred to herein, which include one or more containers containing a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present disclosure. Such kits can further include, if desired, one or more of various conventional pharmaceutical kit components, such as, for example, containers with one or more pharmaceutically acceptable carriers, additional containers, etc. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and / or guidelines for mixing the components, can also be included in the kit. The kit may optionally include an additional therapeutic agent as described herein.
[0274] Combinations
[0275] The compounds of the present disclosure can be used on combination with at least one medication or therapy useful, e.g., in treating or alleviating symptoms of the disorders described herein. Suitable examples of such medications include an anti-inflammatory agent, or a pharmaceutically acceptable salt thereof. Suitable examples include nonsteroidal anti-inflammatory drugs such as celecoxib, rofecoxib, ibuprofen, naproxen, aspirin, diclofenac, sulindac, oxaprozin, piroxicam, indomethacin, meloxicam, fenoprofen, diflunisal, BAY 11-7082, or a pharmaceutically acceptable salt thereof. Suitable examples of steroid (e.g., corticosteroid) anti-inflammatory agents include cortisol, corticosterone, hydrocortisone, aldosterone, deoxycorticosterone, triamcinolone, bardoxolone, bardoxolone methyl, triamcinolone, cortisone, prednisone, and methylprednisolone, or a pharmaceutically acceptable salt thereof. Other suitable examples of anti-inflammatory agents include proteins such as anti-inflammatory antibodies (e.g., anti-IL-1, anti-TNF), and integrins. The compound of the present disclosure may be administered to the patient simultaneously with the additional therapeutic agent (in the same pharmaceutical composition or dosage form or in different compositions or dosage forms) or consecutively (the additional therapeutic agent may be administered in a separate pharmaceutical composition or dosage form before or after administration of the compound of the present disclosure). In some embodiments, the compound can be administered in combination with a gene therapy. It is to be understood that while the present application has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the present application, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
[0276] EXAMPLES
[0277] The exemplified compounds were prepared and tested for their PAD and / or STING activity as follows.
[0278] Example 1 - synthesis of N-(l-(lH-benzo[d]imidazol-2-yl)-4-(2- chloroacetimidamido)butyl)-2,3,5-triiodobenzamide
[0279] Diisopropyl ethylamine (DIPEA) (1.2 mL, 6.6 mmol), HBTU (1.3 g, 3.3 mmol) and HOBt (297 mg, 2.2 mmol) were added sequentially to a solution of Fmoc-Om(Boc)- OH (1 g, 2.2 mmol) and 1,2-phenylenediamine (238 mg, 2.2 mmol) in anhydrous dimethylformamide (DMF) and the mixture was stirred for 4 h at 25 °C under nitrogen atmosphere. Then the reaction mixture was poured into water to precipitate Int 1 and it was recovered by vacuum filtration, washed with water and dried in vacuo. Crude Int 1 was then dissolved in glacial acetic acid (20 mL) and was refluxed for 4 h. Then the mixture was evaporated in vacuo to afford a gummy brown liquid which was poured into brine, neutralized with sodium bicarbonate and extracted with excess dichloromethane. The organic extract was washed thoroughly with water, brine, dried over anhydrous sodium sulphate and concentrated in vacuo to afford compound Int 2. Int 2 was treated with 1:4 piperidine / DMF (v / v) for 30 min to remove the Fmoc-group and the mixture was vigorously stirred with excess hexane. The hexane layer was decanted off and this procedure was repeated for several times until most of the DMF was removed. Fmoc- removal afforded Int 3 as gummy brown oil which was used in subsequent steps without further purification. DIPEA (0.5 mL, 3 mmol), HBTU (751 mg, 2 mmol) and HOBt (268 mg, 2 mmol) were added sequentially to a solution of 2,3,5-triiodobenzoic acid (495 mg, 1 mmol) and Int 3 (300 mg, 1 mmol) in anhydrous DMF. The mixture was allowed to stir at room temperature for 12 h under a nitrogen atmosphere. Then the reaction mixture was poured into water to precipitate Int 4, which was recovered by vacuum filtration, washed with water, dried in vacuo and was used in the subsequent step without further purification. Int 4 (400 mg, 0.5 mmol) was dissolved in 1:4 trifluoroacetic acid / dichloromethane (v / v) (5 mL) and the mixture was stirred at room temperature for 1 h. Excess trifluoroacetic acid / dichloromethane was evaporated under reduced pressure to afford Int 5 as a gummy liquid. Triethylamine (0.4 mL, 2.6 mmol) and ethyl chloroacetimidate hydrochloride (206 mg, 1.3 mmol) were added sequentially to a solution of Int 5 (520 mg, 0.65 mmol) in anhydrous methanol. The mixture was allowed to stir at room temperature for 4 h. Methanol and excess triethylamine were evaporated under reduced pressure. Title compound was then purified as trifluoro acetate salt by reverse phase HPLC using a pre-packed C 18 column and a water / acetonitrile (supplemented with 0.05% TFA) gradient as the eluent. Title compound was thoroughly characterized byJH and13C NMR spectroscopy and mass spectrometry.1H NMR (CD3OD) 8 (ppm): 8.24 (d, J= 2 Hz, 1H), 7.68 (s, 2H), 7.64 (d, J= 1.9 Hz, 1H), 7.44- 7.46 (m, 2H), 5.36 (t, J= 7 Hz, 1H), 4.27 (s, 2H), 3.35 (t, J= 7 Hz, 2H), 2.17-2.21 (m, 2H), 1.91-1.96 (m, 1H), 1.74-1.80 (m, 1H);13C NMR (CD3OD) 8 (ppm): 169.7, 163.4, 161.3, 152.7, 147.7, 145.2, 135.1, 132.4, 125.9, 125.6, 114.0, 111.6, 105.6, 93.4, 41.9, 38.7, 29.1, 23.8; ESI-MS (m / z) calculated for C2OH2OC1II3N5OI [M]+: 761.85, found
[0280] 761.40.
[0281] Example 2 - N-benzyl-5-(2-chIoroacetimidamido)-2-(4-(2-fluorophenyl)-lH- l,2,3-triazol-l-yl)pentanamide
[0282] Example 3 - 2-(4-([l,r-biphenyl]-4-yl)-lH-l,2,3-triazol-l-yl)-N-benzyl-5-(2- chloroacetimidamido)pentanamide
[0283] Synthesis of compounds 2 and 3
[0284] Synthesis of Int 7. Sodium azide (1.78 g, 27.5 mmol) was dissolved in distilled water (4.5 mL) with DCM (7.5 mL) and the mixture was cooled on an ice bath. To this cooled mixture, Triflyl anhydride (0.9 mL, 5.6 mmol) was added slowly over 5 min and the stirring continued for 2 h. After 2 h the DCM layer was removed using a separatory funnel. The aqueous layer was further extracted twice with DCM. The organic fractions with triflyl azide were combined and washed once with saturated sodium carbonate. Triflyl azide in DCM (15 mL) was added to a mixture of Om(Boc)-OH (650 mg, 2.8 mmol), K.2CO3 (578 mg, 4.2 mmol) and CuSCU pentahydrate (7 mg, 27.9 mmol) in water / methanol (1:2) and the suspension was stirred at room temperature for 12 h. The organic solvents were removed under reduced pressure and the mixture was acidified with concentrated HC1 (pH 2). Then the mixture was quickly extracted with ethyl acetate, washed with 0.25 M phosphate buffer (pH 6.2), dried over anhydrous sodium sulfate and concentrated in vacuo to afford Int 6 as a pale oil which was used for subsequent steps without further purification. HBTU (1422mg, 3.75mmol), HOBt (121.77mg, 0.9mmol) and DIPEA (1163.25mg, 9mmol) were added to mixture of benzylamine (419.62mg, 3.3mmol) and Int 6 (744.84mg, 3mmol) in DMF, and the mixture was stirred for 12 h at room temperature. The reaction was quenched with water, extracted with DCM, washed with brine and dried over anhydrous sodium sulfate and concentrated in vacuo to afford Int 7 as yellow solid. The crude product was further purified by silica gel using hexanes and ethyl acetate using a gradient 100% hexanes to 60% hexanes to obtain the a white fine powder.
[0285] General procedure for the synthesis of 2 and 3 from Int 7. Phenylacetylene derivative (2 equivalent) and Int 7 (1 equivalent) were suspended in a mixture of water / THF (1:1, 5 mL). CuSCMAFEO (10 mol%) and sodium ascorbate (3 equivalent) were added to the reaction mixture and the mixture was stirred at room temperature for 5 h. The completion of the reaction was indicated by TLC and Int 8-9 were purified by column chromatography using hexanes and ethyl acetate as mobile phase. The Boc-group in Int 8-9 was removed by treating them with 5 mL TFA / DCM (1:4) for 2 h at room temperature. Excess DCM and TFA were removed in vacuo to afford Int 10-11 as gummy liquid. The Boc-deprotected free amine (Intl0-ll) (1 equivalent) was dissolved in methanol (5 mL), and triethylamine (3 equivalent) and ethyl chloroacetimidate hydrochloride (1 equivalent) were sequentially added to the mixture. The reaction was allowed to stir at room temperature for 4 h. Excess methanol and triethylamine were removed under vacuum. The crude product was purified by reverse phase HPLC using a pre-packed Cl 8 column and a water / acetonitrile (supplemented with 0.05% TFA) gradient as the eluent. 2 and 3 were thoroughly characterized by ' l l and13C NMR spectroscopy.
[0286] Compound 2.3H NMR (CD OD) 8 (ppm): 8.43 (d, 7- 3.4 Hz, 1H), 8.12-8.15 (m, 1H), 7.39-7.44 (m, 1H), 7.23-7.33 (m, 7H), 5.47 (t, J = 8 Hz, 1H), 4.43 (d, J= 4.5 Hz, 2H), 4.36 (s, 2H), 3.38 (t, J= 7.4 Hz, 2H), 2.31-2.41 (m, 2H), 1.67-1.77 (m, 1H), 1.54-1.65 (m, 1H);13C NMR (CD3OD) 8 (ppm): 168.2, 163.3, 162.0, 161.7, 161.5, 161.2, 160.3, 158.3, 141.2, 141.1, 137.9, 129.8, 129.7, 128.3, 127.3, 127.2, 127.2, 127.1, 124.5, 124.5, 122.7, 122.6, 118.0, 117.9, 115.7, 115.5, 63.4, 43.1, 41.8, 38.7, 29.3, 23.5; ESI-MS (m / z) calculated for C22H24CI1F1N6O1 [M+H]+: 443.1757, found 443.2.
[0287] Compound 3.JH NMR (CD3OD) 3 (ppm): 8.41 (s, 1H), 7.81-7.83 (m, 2H), 7.62- 7.63 (m, 2H), 7.55-7.57 (m, 2H), 7.34-7.37 (m, 2H), 7.13-7.27 (m, 6H), 5.32 (t, J= 8.1 Hz, 1H), 4.33 (d, 7= 4.6 Hz, 2H), 4.24 (s, 2H), 3.25-3.29 (m, 2H), 2.22-2.27 (m, 2H), 1.58-1.65 (m, 1H), 1.45-1.52 (m, 1H);13C NMR (CD3OD) 8 (ppm): 168.2, 163.4, 147.5, 141.2, 140.3, 137.9, 129.1, 128.6, 128.3, 127.3, 127.1, 127.1, 126.5, 125.8, 120.1, 63.4, 43.1, 41.8, 38.7, 29.3, 23.5; ESI-MS (m / z) calculated for C28H29CI1N6O1 [M+H]+: 501.2164, found 501.2.
[0288] Example 4 - synthesis of N-(l-(lH-benzo[d]imidazol-2-yl)-4-(2- chloroacetimidamido)butyl)-2-naphthamide
[0289] Reagents: (a) naphthoyl chloride, triethylamine, THF / H2O; (b) TFA, CH2CI2; (c) ethyl 2-chloroacetimidate, triethylamine, MeOH.
[0290] To a stirred solution of Int 3 (1.0 equivalent) in THF / H2O (1:1) was added triethylamine (3.0 equivalent) followed by naphthoyl chloride (1.0 equivalent) and allowed to stir at room temperature for 3 h. Solvents were evaporated and the crude product was purified by reverse phase HPLC using MeCN:H2O (0.5% TFA) as the eluent to give the product in 68-73% yield. This product was then treated with TFA to remove the Boe group giving the Naphthyl- Om-benzimidazole intermediate. The solvent was then evaporated to dryness and the crude material was dried in vacuo. To a stirred solution of the corresponding Naphthyl-Orn-benzimidazole intermediate in dry MeOH was added triethylamine (4.0 equivalent) followed by ethyl haloacetimidate HCl (2.0 equivalent). The reaction was stirred under nitrogen atmosphere at room temperature for 3 h. Solvents were then evaporated under reduced pressure and the crude product was purified by reverse phase HPLC using MeC hbhO (0.5% TFA) as an eluent to give compound 4. ’ H NMR (CD3OD; 400 MHz): 8 8.58 (s, 1H), 8.12-7.92 (m, 4H), 7.81-7.73 (m, 2H), 7.67-7.55 (m, 4H), 5.74-5.70 (m, 1H), 4.42 (s, 2H), 3.57-3.49 (m, 2H), 2.43- 2.39 (m, 2H), 2.10-1.85 (m, 2H).13C NMR (100 MHz, CD3OD) 8 170.4, 169.4, 164.9, 163.0, 162.6, 154.6, 139.1, 133.8, 133.7, 131.7, 131.2, 130.3, 128.9, 127.2, 115.2, 43.3,
[0291] 40.1, 30.4, 25.0. HRMS m / z calculated for C24H25CIN5O (M + H+) 434.1739; found 434.1741.
[0292] Example 5 - N-(l-(lH-benzo[d]imidazol-2-yl)-4-(2- chloroacetimidamido)butyl)-4'-fluoro-[l,l'-biphenyl]-4-carboxamide
[0293] Example 6 - N-(4-(2-chloroacetimidamido)-l-(5,6-difluoro-lH- benzo[d]imidazol-2-yl)butyl)-[l,l'-biphenyl]-4-carboxamide Example 7 -N-(4-(2-chloroacetimidamido)-1-(5,6-difluoro-lH- benzo[d]imidazol-2-yl)butyl)-4'-fluoro-[l,r-biphenyl]-4-carboxamide
[0294] Int 3, R1=R2=R3=R4=H 5: R1=R2=R3=R4=H, R5=F
[0295] Int 12, R1=R2=H, R3=R4=F 6: R1 =R2=R5=H, R3=R4=F
[0296] 7: R^R^H, R3=R4=R5=F
[0297] Reagents: (a) biphenyl -4-carbonyl chloride, triethylamine, CH2G2; (b) TFA, CH2CI2; (c) ethyl 2-chloroacctimidatc, tricthylaminc, McOH.
[0298] To a stirred solution of Int 3 or Int 12 (1.0 equivalent) in CH2CI2 was added triethylamine (3.0 eq) followed by biphenyl-4-carbonyl chloride or biphenyl-4'-fluoro-4- carbonyl chloride (1.0 equivalent) and allowed to stir at room temperature for 3 h. Solvents were evaporated and the crude product was purified by reverse phase HPLC using MeCN:H2O (0.5% TFA) as the eluent to give the product in 69-80% yield. This product was then treated with TFA to remove the Boc group giving the 4-Ph-Bz-Om- benzimidazole intermediate. The solvent was then evaporated to dryness and the crude material was dried in vacuo. To a stirred solution of the corresponding 4-Ph-Bz-Om- benzimidazole intermediate in dry MeOH was added triethylamine (4.0 equivalent) followed by ethyl haloacetimidate HCl (2.0 equivalent). The reaction was stirred under N2 at room temperature for 3 h. Solvents were then evaporated under reduced pressure and the crude product was purified by reverse phase HPLC using MeCN:H?O (0.5% TFA) as an eluent to give compounds 4, 5, and 6.
[0299] Compound 5: ’H NMR (CD3OD; 500 MHz): 5 7.94 (d, 7=9.3 Hz, 2H), 7.68-7.63 (m, 4H), 7.61-7.57 (m, 2H), 7.47-7.44 (m, 2H), 7.12-7.08 (m, 2H), 5.57-5.54 (m, 1H), 4.28 (s, 2H), 3.42-3.32 (m, 2H), 2.30-2.24 (m, 2H), 1.94-1.86 (m, 1H), 1.80-1.72 (m, 1H).13C NMR (125 MHz, CD3OD) 5 168.6, 164.0, 163.3, 162.0, 162.0, 161.8, 161.4, 153.9, 143.9, 136.0, 135.9, 131.9, 131.3, 128.8, 128.7, 128.1, 126.5, 125.8, 117.8, 115.5,
[0300] 115.3, 113.8, 41.9, 38.7, 29.1, 23.6. HRMS m / z calculated for C26H25FCIN5O (M + H+) 478.1804; found 478.1803.
[0301] Compound 6:1H NMR (CD3OD; 500 MHz): 5 7.92 (d, 7=9.3 Hz, 2H), 7.63 (d, 7=9.4 Hz, 2H), 7.56-7.49 (m, 4H), 7.37-7.34 (m, 2H), 7.29-7.26 (m, 1H), 5.50-5.47 (m, 1H), 4.27 (s, 2H), 3.38-3.33 (m, 2H), 2.28-2.15 (m, 2H), 1.90-1.82 (m, 1H), 1.79-1.71 (m, 1H).13C NMR (125 MHz, CD3OD) 8 168.6, 163.3, 161.3, 161.0, 156.2, 150.0, 149.8, 148.1, 147.9, 144.9, 139.6, 131.5, 129.9, 128.71, 128.0, 127.8, 126.7, 126.7, 102.4, 102.4,
[0302] 102.3, 102.2, 42.0, 38.7, 29.5, 23.6. HRMS mJz calculated for C26H24F2CIN5O (M + H+) 496.1710; found 496.1706.
[0303] Compound 7: ‘H NMR (CD3OD; 500 MHz): 6 7.91 (d, 7=9.4 Hz, 2H), 7.61 (d, 7=9.3 Hz, 2H), 7.59-7.56 (m, 2H), 7.52-7.50 (m, 2H), 7.11-7.07 (m, 2H), 5.50-5.46 (m, 1H), 4.27 (s, 2H), 3.39-3.31 (m, 2H), 2.28-2.14 (m, 2H), 1.92-1.82 (m, 1H), 1.79-1.70 (m, 1H).13C NMR (125 MHz, CD3OD) 8 168.6, 163.9, 163.3, 162.0, 161.2, 160.9, 156.2, 150.0, 149.8, 148.0, 147.8, 143.8, 135.9, 131.6, 129.8, 128.7, 128.0, 126.6, 115.4, 115.3,
[0304] 102.4, 102.3, 102.3, 102.2, 42.0, 38.7, 29.6, 23.6. HRMS m z calculated for C26H23F3CIN5O (M + H+) 514.1616; found 514.1612.
[0305] Example 8 - tert-butyl 2-((4-(2-chloroacetimidamido)-l-(l-isopropyl-lH- benzo[d]imidazol-2-yl)butyl)carbamoyl)benzoate Reagents: (a) 2-(t-butoxycarbonyl)benzoic acid, HOBt, HBTU, DIPEA, DMF; (b) 1 M HCl / EtOAc; (c) ethyl 2-chloroacctimidatc, tricthylaminc, McOH.
[0306] To a stirred solution of Int 13 (1.0 eq) in DMF was added HOBt (2.0 eq), HBTU (2.0 eq), and DIPEA (3.0 eq) followed by 2-(tert-butoxycarbonyl)benzoic acid (1.0 eq) and allowed to stir at rt for 12 h. The reaction mixture was then diluted with water. The product was filtered, washed with water, dried under vacuum, and obtained in 62-71% yield. This product was then treated with 1 M HC1 in EtOAc to remove the Boc group giving the ( U'Bu-Bz-Oni-bcnzimidazolc intermediate. The solvent was then evaporated to dryness and the crude material was dried in vacuo. To a stirred solution of the corresponding COi'Bu-Bz-Orn-bcrizimidazolc intermediate in dry MeOH was added TEA (4.0 eq) followed by ethyl haloacetimidate HCl (2.0 eq). The reaction was stirred under N at rt for 3 h. Solvents were then evaporated under reduced pressure and the crude product was purified by reverse phase HPLC using MeCN:H2O (0.5% TFA) as an eluent to give compound 8 in 59% yield. H NMR (CD3OD; 400 MHz): 5 8.12-8.07 (m, 1H), 7.85-7.81 (m, 2H), 7.63-7.57 (m, 3H), 7.55 (dd, 7=1.3 Hz, 7=7.8 Hz, 1H), 7.52-7.48 (m, 1H), 5.73-5.68 (m, 1H), 5.43-5.46 (m, 1H), 4.37 (s, 2H), 3.47-3.42 (m, 2H), 2.41-2.21 (m, 2H), 2.10-1.98 (m, 1H), 1.93-1.85 (m, 1H), 1.84 (d, 7=3.1 Hz, 3H), 1.82 (d, 7=3.2 Hz, 3H), 1.36 (9H).13C NMR (100 MHz, CD3OD) 5 170.9, 168.8, 165.0, 163.1, 151.0, 136.4, 131.4, 130.5, 130.3, 129.7, 129.3, 127.1, 125.6, 125.2, 115.1, 114.4, 81.5, 77.0, 76.1, 50.9, 45.5, 41.8, 38.7, 28.9, 26.7, 23.4, 19.9, 19.8. HRMS m / z calculated for C28H 6CIN5O3 (M + H+) 526.2579; found 526.2577.
[0307] Example 9 - 4-((4-(2-chloroacetimidamido)-l-(l-ethyl-lH-benzo[d]imidazol-
[0308] 2-yl)butyl)carbamoyl)-[l,l'-biphenyl]-3-carboxylic acid
[0309] Reagents: (a) 5-phenylisobenzofuran- 1,3-dione, THF; (b) TFA, CH2CI2; (c) ethyl 2-haloacetimidate, triethylamine, MeOH To a stirred solution of Int 14 (1 .0 eq) in THF was added 5- phcnylisobcnzofuran-l,3-dionc (1.0 cq) and allowed to stir at rt under N2 for 18 h. Solvents were evaporated and the crude product was purified by reverse phase HPLC using MeCbhHoO (0.5% TFA) as the eluent to give the product in 78% yield. This product was then treated with TFA to remove the Boc group giving the 4-Ph-2-CO2H-Bz- Om-benzimidazole and 3-Ph-2-CO2H-Bz-Orn intermediates as a -50:50 mixture. The solvent was then evaporated to dryness and the crude material was dried in vacuo. To a stirred solution of the corresponding 4-Ph-2-CO2H-Bz-Orn-benzimidazole and 3-Ph-2- CChH-Bz-Orn mixture in dry MeOH was added TEA (4.0 eq) followed by ethyl haloacetimidate-HCl (2.0 eq). The reaction was stirred under N2 at rt for 3 h. Solvents were then evaporated under reduced pressure and the crude product was purified by reverse phase HPLC using MeCN:H2O (0.5% TFA) as an eluent to give compounds 9a and 9b in 58% yield. Compounds 9a and 9b were isolated as a -40:60 mixture, respectively. ’ H NMR (CD3OD; 400 MHz): 5 8.20 (d, 7=2.3 Hz, 0.4H), 8.07 (dd, 7=1.9 Hz, 7=9.6 Hz, 0.6H), 7.94-7.80 (m, 3H), 7.73-7.57 (m, 5H), 7.48 (t, 7=7.4 Hz, 2H), 7.43-
[0310] 7.38 (m, 1H), 5.70-5.65 (m, 1H), 4.86-4.76 (m, 1H), 4.73-4.65 (m, 1H), 4.39 (s, 0.8H),
[0311] 4.38 (s, 1.2H),4.37 (s, 0.4H), 4.36 (s, 0.6H), 3.50-3.40 (m, 2H), 2.41-2.31 (m, 1H), 2.29- 2.20 (m, 1H), 2.13-2.02 (m, 1H), 1.96-1.85 (m, 1H), 1.64 (t, 7=7.5 Hz, 3H).13C NMR (100 MHz, CD3OD) 5 171.7, 171.5, 167.4, 167.1, 163.3, 161.5, 161.2, 151.7, 145.0, 142.9, 138.9, 138.8, 137.9, 135.7, 131.7, 130.9, 130.1, 129.9, 128.8, 128.4, 128.3, 128.0, 128.0, 127.9, 127.6, 126.8, 126.6, 126.3, 126.0, 125.8, 118.0, 115.1, 114.6, 112.4, 45.6, 45.5, 41.9, 40.6, 38.7, 29.0, 28.9, 23.6, 13.6. HRMS in / z calculated for C29H30CIN5O3 (M + H+) 532.2110; found 532.2112.
[0312] Example 10 - STING activity of Cl-amidine and BB-C1 amidine
[0313] BB-Cl-amidine potently inhibits STING activity based on multiple readouts (FIGs. 1 A and IB). Pretreatment of primary bone marrow derived macrophages (BMDMs) with BB-Cl-amidine at 1 pM completely blocked STING agonist-induced IFNP, CxcllO, Ccl5 and 116 mRNA expression as measured by qPCR (FIG. 1A). BB-Cl- amidine also potently inhibited the phosphorylation of IRF3, TBK1, and STAT1 all of which are activated downstream of STING (FIG. IB). BB-Cl-amidine treatment blocked the full transcriptional program elicited downstream of STING as measured by RNA- sequencing (FIG. 2). Co-administration of BB-Cl-amidine in vivo with a STING agonist, di-amidobenzimidazole (diABZI) also resulted in inhibition of serum IFNP production (FIG.3). Chemical structure of diABZI is shown below:
[0314] In addition, administration of BB-Cl-amidine orally via a specially formulated mouse diet enhanced survival and reduced myocarditis and splenomegaly in the TREX1D18N mouse model of AGS (FIG. 4). Cl-amidine showed activity as follows.
[0315] Example 11 - PAD and STING activity of exemplified compounds 1-9
[0316]
[0317] Example 12 -PAD and STING activity of exemplified compounds 10-20
[0318]
[0319] The compounds were tested as trifluoroacetate salts. The exemplified STING antagonists 1-20 block INF0 production (FIG. 5). Bar graph shows INF0 levels after treatment with the exemplified inhibitors. As shown in FIG 5 and FIG. 6, exemplified compounds potently inhibit STING signaling. STING was activated with a diamidobenzimidazole (diABZI), which binds and activates STING. Compounds were found to potently suppress STING induced IFNB production at a concentration of 5 M. or even a lower concentration of 1 pM. Example 13 - PAD and STING activity of exemplified compounds 21-39
[0320]
[0321] Example 14. Mechanistic studies of compounds that inhibit STING oligomerization
[0322] The cytosolic detection of pathogen derived dsDNA is an essential component of anti-viral immunity. This pathway has two major components: cGAMP synthase (cGAS) and Stimulator of interferon genes (STING). Upon binding to dsDNA in the cytosol, cGAS activity is allosterically increased and it catalyzes the conversion of GTP and ATP into cyclic guanosine monophosphate-adenosine monophosphate (cGAMP). cGAMP then binds STING, an endoplasmic reticulum (ER) localized adaptor protein. cGAMP binding is associated with large scale conformational changes that promote STING oligomerization, trafficking from the ER to the Golgi, palmitoylation, and subsequent lysosome mediated degradation. Once oligomerized, the C-terminal tail of STING recruits TBK1 and induces auto-activation and trans-phosphorylation of TBK1 followed by phosphorylation of STING on Ser365. TBK1 then promotes IRF3 and NFKB activation, thereby promoting their translocation into the nucleus where they bind DNA and activate the transcription of type I IFNs and numerous cytokines. Given the damaging consequences of DNA accrual in the cytosol, several regulatory mechanisms exist to restrict spontaneous cGAS-STING signaling. In the absence of stimulation, STING translocation is inhibited by the ER protein STIM1 and via its retrograde transport to the ER through COPI vesicles and the adaptor protein SURF4.
[0323] Protein citrullination is catalyzed by the Protein Arginine Deiminases (PADs), a family of enzymes whose activity controls a wide number of biological processes and contributes to numerous inflammatory diseases, including rheumatoid arthritis (RA). In RA, patients produce antibodies to citrullinated proteins (ACPA) whose levels correlate with disease severity. In addition to antigen generation, aberrant PAD activity is associated with neutrophil extracellular trap (NET) formation, a proinflammatory form of neutrophil cell death that has been implicated in the pathogenesis of SLE, ulcerative colitis, sepsis and fibrosis. Notably, COPA, a major component of COPI vesicles, and SURF4 are citrullinated. Given the potential impact of protein citrullination on STING trafficking, ability of a pan-PAD inhibitor to modulate STING signaling was evaluated. This compound, BB-Cl-amidine (FIG. 7A), has been demonstrated to possess potent antiinflammatory properties in several experimental models. Interestingly, BB-Cl-amidine blocked STING dependent signaling, but not other innate immune signaling pathways, in the sub-nanomolar range. Using a chemo protcomic strategy, it was demostrated that BB-Cl-amidine covalently modifies STING in a PAD-independent manner to impair oligomerization and all proximal downstream pathways such as activation of TBK1-IRF3 signaling leading to type I IFN production, NFKB activation, and the production of associated cytokines and autophagy. Furthermore, BB-Cl-amidine efficiently alleviated STING-dependent disease in the TrexlD18N / D18Nmouse model of AGS. In summary, our data identify a chemical entity that inhibits STING oligomerization. Thereby providing a previously unknown scaffold for the development of therapeutics for treating STING- dependent inflammatory diseases.
[0324] Results
[0325] Beyond their role in NET formation and their ability to generate TLR4 agonists, little is known about how the PADs contribute to innate immune signaling, especially with regard to their impact on the regulation of toll-like receptors (TLRs) and nucleic acid sensing pathways. As such, it was sought to determine how the PADs broadly contribute to innate immune signaling. For these studies, Bone Marrow Derived Macrophages (BMDMs) were pre-treated with BB-Cl-amidine (FIG. 7A) and then stimulated with an array of innate immune receptor ligands. Changes in IFNP and TNF-a levels were used as proximal readouts of activation. Vehicle treated cells had comparable responses across all ligands. The one exception is cGAMP, where BB-Cl-amidine treatment led to a marked reduction in both TNF-a and IFNp levels (FIGs. 7B, 7C, and 7C). It was then confirmed that BB-Cl-amidine blocks DNA sensing and not RNA sensing, by comparing its ability to inhibit IFNp production induced by Herpes Simplex Virus (HSV1), a DNA virus, to that of Sendai virus, an RNA virus (FIG. 7D). Together, these data indicate that BB-Cl-amidine selectively inhibits signaling downstream of cGAS and STING.
[0326] Next, BMDMs were stimulated with the synthetic STING agonist diABZI in the presence of increasing concentrations of BB-Cl-amidine. Inhibition of Ifn / 3 transcription and secretion were used as readouts of STING activation (FIGs. 7E-7F). Notably, BB-Cl- amidine inhibited diABZI induced IFNP production at an EC50 of ~0.5 pM. To confirm that BB-Cl-amidine directly inhibits STING signaling, it was shown that BB-Cl-amidine also inhibited diABZT induced phosphorylation of STING, IRF3, TBK1 , p65 and STAT1 , all of which arc readouts of STING or STING dependent responses, in a dosc-dcpcndcnt manner. BB-Cl-amidine also impaired diABZI induced conversion of LC3, indicating that BB-Cl-amidine blocks the activation of autophagy, a key downstream effector response following STING activation (FIG. 7G). In addition to its ability to inhibit murine STING, BB-Cl-amidine also blocked the STING-dependent induction of I FN [3 in primary human monocytes (FIG. 7H). Thus, BB-Cl-amidine inhibits all pathways downstream of STING activation in both mouse and human cells. The efficacy of BB-Cl- amidine was then assessed in vivo. Mice administered diABZI i.p. induced robust production of IFN|3 in serum. However, mice pre-treated with BB-Cl-amidine showed a significant reduction in the production of diABZI induced IFNp in vivo (FIG. 71). Thus, BB-Cl-amidine can also suppress the activation of the STING pathway in vivo.
[0327] To further assess the inhibitory effects of BB-Cl-amidine on STING dependent signaling, the transcriptional response to diABZI was profiled by RNA-sequencing in the presence or absence of BB-Cl-amidine. diABZI treatment induced robust induction of the type I IFN and interferon stimulated genes (ISGs) (FIGs. 8A-8C). However, in the presence of BB-Cl-amidine the transcriptional program induced downstream of STING was completely abolished (FIGs. 8A-8C). Given that BB-Cl-amidine was initially characterized as a pan-PAD inhibitor, it was further assessed whether BB-Cl-amidine mediated its effect via the inhibition of PADs. Surprisingly, WT and PAD4 deficient mice displayed comparable expression levels of diABZI induced Ifn / 3 (FIG. 9A) and IRF3 phosphorylation (FIG. 9B). It was then determined whether BB-Cl-amidine could also inhibit STING activation independently of PAD4. Indeed, BB-Cl-amidine impaired both diABZI induced expression of Ifn / 3 and CxcllO (FIGs. 9C-9D) and IRF3 phosphorylation (FIG. 3E) in WT and PAD4 deficient macrophages, comparably. In addition to PAD4, myeloid cells also express PAD2 at high levels. To rule out redundancy between PAD family members, STING responses in PAD2 and PAD2 / 4 deficient mice were assessed. Notably, diABZI induced the expression of Ifn / 3 and CxcllO to a similar degree in WT, PAD2 knockout, and PAD2 / 4 knockout mice (FIGs. 9F-9G). Given that BB-Cl-amidine retained its inhibitory effects on STING signaling in the absence of PAD2 and PAD4, it was sought to account for these PAD-indcpcndcnt effects by identifying additional targets of BB-Cl-amidine. To that end, an alkyne- containing derivative of BB-Cl-amidine, BB-Cl-Yne (BB-Cl-Yne) were used (FIG. 10A), which can be rapidly coupled to an azide-containing reporter tag (e.g., biotin-azide) via ‘click chemistry’; the reporter tag enables the rapid visualization or enrichment of modified proteins. To ensure that the alkyne handle does not impact the inhibition of STING signaling, the inhibitory effects of BB-Cl-amidine and BB-Cl-Yne were compared. As a control, BB-F-Yne, a more selective probe of PAD activity due to the relatively poorer leaving group ability of the fluoro group was also tested (FIG. 10B). Importantly, the potencies of BB-Cl-amidine and BB-Cl-Yne were comparable. By contrast, BB-F-Yne showed no inhibition of STING signaling (FIG. IOC). These data not only confirm that PAD inhibition does not impact STING signaling but also demonstrate that BB-Cl-Yne can be used to identify host factors bound by this drug.
[0328] To identify such factors, BMDMs were treated with BB-Cl-Yne, BB-Cl-Yne plus BB-Cl-amidine, or vehicle control. Lysates were prepared, ‘clicked’ to biotin-azide, and modified proteins enriched on streptavidin beads. Mass spectrometry revealed that STING itself was highly enriched by BB-Cl-Yne across all replicate samples but not in the control samples (FIGs. 10D-10E, FIG. 13A). Consistent with STING being a predominant target of BB-Cl-amidine, co-treatment of cells with BB-Cl-Yne and BB-Cl- amidine reduced STING enrichment as judged by relative STING coverage and by Western blotting (FIG. 10F, FIG. 13B). Further evaluation of BB-Cl-Yne binding of STING was confirmed by western blot (FIG. 10G).
[0329] To assess the efficacy of BB-Cl-amidine in a STING-dependent disease context, a mouse model of AGS was used. TREX1 is an abundant 3 ’-5’ exonuclease which digests cytoplasmic DNA and prevents unwanted activation of cGAS. TREX1 mutations were first identified in AGS patients presenting with severe encephalitis, intracranial calcifications and elevated type I IFN in the cerebrospinal fluid. Several studies have confirmed that Trexl deficiency results in the abnormal accumulation of cytosolic DNA and the constitutive activation of cGAS / STING signaling. Tre l deficient mice also exhibit systemic inflammation, production of autoantibodies to dsDNA, renal disease, reduced post-natal survival, and severe myocarditis. To more easily study the in vivo role of Trcxl, a nuclease deficient knock-in model was developed by generating a D18N mutation; this mutation compromises enzymatic activity. Trex 1D18N / D18Nmutant mice have shortened lifespans and develop severe myocarditis. To first demonstrate the dependency on STING and IFN in the TrexlD18N / D18Nmodel TrexlD18N / D18Nmice were intercrossed to Irf3 deficient, STING knockout mice, or STINGR237A / R237Amutant mice; arginine 237 lies within the ligand binding domain of STING and is critical for cGAMP binding. Thus, ST|]\|CIR237A / R237Amice do not respond to the cGAMP. Consistent with previous studies, TrexlD18N / D18Nmice had reduced survival, displayed mild splenomegaly, accumulation of serum CxcllO, and severe myocarditis (FIGs. 14A-14E). By contrast, mice intercrossed to Irf3 deficient mice were completely rescued from disease (FIGs. 14A-14E). Thus, disease in the TrexlD18N / D18Nmodel is dependent on IRF3 and the induction of type I IFNs. Trex 1D18N / D18Nmice were also protected by crossing them to either STING deficient mice or srp|NGR277A / R277Amice (FIGs. 15A-15D). Thus, TrexlD18N / D18Nmyocarditis is dependent on cGAS / STING signaling. Having established that the development of myocarditis by TrexlD18N / D18Nmice is STING dependent, it was further determined whether BB-Cl-amidine could alleviate disease. To that end, WT and TrexlD18N / D18Nmice were administered BB-Cl-amidine or vehicle control daily for 8 weeks from 2-months age. BB-Cl-amidine alleviated disease pathology in the TrexlD18N / D18Nmice as evident by improved survival, reduced splenomegaly and reduced myocarditis when compared to TrexlD18N / D18Nmice receiving control diet (FIGs. 11A- 1 IE). BB-Cl-amidine also alleviated cardiac fibrosis in Trex 1D18N / D18Nmice (FIG. 1 IF).
[0330] BB-Cl-amidine is a cysteine reactive molecule that derivatizes cysteine residues to generate a 423 Da post-translational modification that alters protein function. Thus, BB-Cl-amidine was further assessed if it could modify cysteine residues in STING. Using an in vitro reaction system, full length recombinant STING was incubated with BB-Cl-amidine and an LCMS / MS was run to determine if BB-Cl-amidine modified STING. Peptide mapping analysis revealed that treatment of recombinant human STING with BB-Cl-amidine led to a 423 Da modification on Cys148(FIG. 12A). In addition to Cys148BB-Cl-amidine also modified STING on Cys206, Cys257and Cys309(FIGs. 16A- 16C). Interestingly, Cys148is critical for STING oligomerization following activation (2(5). Previous studies have identified Cys148in human STING and Cys147in murine STING as an essential residue for forming disulfide bridges and stabilizing STING oligomers. High molecular weight oligomerization of STING creates a structural platform for recruitment and activation of TBK1. Upon oligomerization the STING C- terminal tail recruits TBK1 and facilitates the phosphorylation of protruding C-terminal tails of proximal STING molecules in the oligomer followed by the recruitment of IRF3 (27-29). The importance of Cys147was assessed by generating mutations at this site and evaluating STING function. HEK293T cells expressing WT STING or the STINGCysl47Amutant were stimulated with diABZI. diABZI induced robust oligomerization of WT STING. However, cells expressing STINGCysl47Ahad a significant reduction in diABZI induced STING oligomerization. (FIG. 12B). Thus, it was hypothesized that BB-C1- amidine targets Cys148to impair oligomerization. The effect of BB-Cl-amidine on STING oligomerization was then assessed in primary cells. WT BMDMs were pre-treated with a titration of BB-Cl-amidine followed by treatment with diABZI to activate STING. BB- Cl-amidine inhibited diABZI induced STING oligomerization in a dose dependent manner (FIG. 12C). In addition, diABZI induced comparable levels of STING oligomerization in both WT and PAD4 deficient cells (FIG. 12D). Thus, BB-Cl-amidine inhibits STING oligomerization independently of PAD4.
[0331] Discussion
[0332] STING activation directly leads to the robust IRF3 dependent production of type I IFNs as well increased NFKB signaling. Aberrant STING activation has been linked to several mendelian and non-mendelian inflammatory diseases, and as such, STING inhibitors have the potential to directly modulate inflammatory responses in these diseases. In this study, it was shown that BB-Cl-amidine directly inhibits the STING- dependent activation of IRF3, NFKB, and autophagy in vitro and in vivo. Given that BB- Cl-amidine was initially developed as a pan-PAD inhibitor, the role of protein citrullination in modulating STING was explored. BB-Cl-amidine retained its inhibitory effects on STING in PAD-deficient cells. Mechanistically, BB-Cl-amidine modified the functionally important Cys148, conserved as Cys147in mouse and blocked oligomerization. Given that STING oligomerization is a pre-requisite for its activity BB- Cl-amidine inhibited STING dependent activation of IRF3, NFKB and autophagy thus leading to impaired production of type T IFNs and inflammatory cytokines. Administration of BB-Cl-amidinc also alleviated the inflammatory phenotype in an experimental model of AGS. Interestingly, BB-Cl-amidine targeted Cys148and prevented oligomerization of STING. By contrast, H-151, a previously reported STING inhibitor with a comparable IC50 value, has been reported to block palmitoylation by modifying Cys91. While BB-Cl-amidine derivatized 3 other functionally inert cysteine residues in STING, modification of Cys91was not detected. Thus, BB-Cl-amidine inhibits STING in a mechanistically distinct manner.
[0333] There are several implications of these studies. First, BB-Cl-amidine has been evaluated in several animal models where aberrant PAD activity has been implicated. These models include the Collagen Induced Arthritis (CIA) model of RA and the MRL / lpr model of lupus. STING knockout has either no effect or aggravates disease in these models suggesting that the efficacy observed in these models is principally driven by PAD inhibition. For other models, care should be taken in interpreting the effects of BB-Cl-amidine as any observed efficacy may relate to STING inhibition. Given this issue, it is recommended to use BB-F-amidine which shows excellent proteome-wide selectivity or combinations of isozyme specific inhibitors including the PAD1 selective inhibitor SM26 the PAD2 selective inhibitor AFM30a and the PAD4 selective inhibitor GSK484.
[0334] In summary, a new small molecule STING antagonist that inhibit STING activation by covalently modifying Cys 148 and blocking oligomerization was identified.
[0335] Methods
[0336] Mice
[0337] All animal experiments were approved by the Institutional Animal Care Use Committees at the University of Massachusetts Medical School. Animal were kept in specific pathogen free (SPF) environment. Animals were housed in groups and fed standard chow diets. Sample sizes used are in line with other similar' published studies. B6.Cg-Padi4Lml 1Kmow / J (Padi4' / _) mice were obtained from the Jackson laboratory, strain number 030315. Padi2‘ / _mice were generated using the sgRNA sequence: GCACGTACACCGCCTCCACG (SEQ. ID 1). Embryos were microinjected with the target sgRNA sequence (20ng / pl) with Alt-R® S.p. Cas9 Nuclease V3 (50ng / pl) and implanted into C57BL6 or PAD4 ’ / ’ mice to generate Padi2‘ / _mice or Padi2‘ / _Padi4‘ / _double knockout (DKO) respectively. Resulting founder mice had a 25nt or 29nt deletion for the DKO, or 8nt, lOnt deletion for the single Padi2’ / _. TrexiD18N / D18NSTING7’ and STINGR237A / R237Awere provided by GSK. diABZI-4 treatment
[0338] 8-12-week-old male and female mice, were anaesthetized with isoflurane and administered 0.5mg / kg diABZI-4 intranasally for the indicated times.
[0339] Reagents
[0340] All chemicals were purchased from Cayman chemical or sigma. Compounds were dissolved in DMSO and further diluted in media. Cells were transfected using gene juice according to the manufacturer’s instructions. diABZI-4 was provided by GSK under a material transfer agreement.
[0341] Plasmids
[0342] Murine WT STING and Cysteine mutant constructs were kindly provided by Tomohiko Taguchi, Department of Health Chemistry, Graduate School of Pharmaceutic al Sciences, University of Tokyo.
[0343] Cell Culture
[0344] Human kidney cell line HEK293T were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% (v / v) fetal bovine serum, lOOU / ml penicillin and lOOpg / ml streptomycin. Human peripheral blood monocyte cell line, THP1 cells were cultured in RPMI-1640 medium supplemented with 10% (v / v) fetal bovine serum, 100 U / ml penicillin and 100 pg / ml streptomycin. For isolation of BMDMs, tibias and femurs were removed from wild type and Padi4~’~ mice and bone marrow was flushed with complete DMEM-medium. Cells were plated in medium containing 20% (v / v) conditioned medium of L929 mouse fibroblasts cultured for 7 days at 37°C in a humidified atmosphere of 5% CO2. Medium was replaced every 3 days.
[0345] ELISA
[0346] Conditioned media or serum was collected as indicated and mouse IL- 1 P or TNF- a, were quantified by sandwich ELISA (R&D Systems).
[0347] Immunoblotting and Immunoprecipitation Primary BMDMs from WT or Padi4‘ / _mice were cultured in 12-well plates (IxlO6cells per ml; 1 ml). HEK293T cells (2.5 x 105cells per ml) were cultured in 6- well plates and transfected with the relevant constructs where indicated. For cell lysate analysis cells were lysed directly in IX Lamelli sample buffer. For native gel analysis cells were lysed in in NP-40 lysis buffer (50 mM Tris-HCl, pH 7.4, containing 150 mM NaCl, 0.5% (w / v) IgePal, 50 mM NaF, 1 mM Na3VO4, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride and protease inhibitor cocktail. For immunoprecipitation of STING, cells were treated as indicated and then collected in 250 pl of lysis buffer, followed by incubation for 15 min on ice. Lysates were incubated with STING antibody and protein A-protein G-agarose was added to each sample, followed by incubation overnight at 4°C. Immunoprecipitates were collected by centrifugation and washed four times with 1 ml of lysis buffer. Immunoprecipitates were eluted from beads using IX sample buffer. Samples were resolved by SDS-PAGE and transferred to nitrocellulose membranes and analyzed by immunoblot. Immunoreactivity was visualized by the Odyssey Imaging System (LICOR Biosciences). All antibodies were obtained from Cell signaling, cell signaling and anti-P-actin (AC-15; A1978) were from Sigma; anti-mouse IRDyeTM 680 (926-68070) and anti-rabbit IRDyeTM 800 (926-32211) were from LICOR Biosciences
[0348] RNA sequencing
[0349] RNA sequencing was performed by BGI, Shanghai, China. cDNA synthesis and real time PCR.
[0350] Total RNA was extracted from whole lung tissue or cells. Ipg of RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio Rad). 5ng of cDNA was then subjected to qPCR analysis using iQ SYBR Green super-mix reagent (Bio Rad). Gene expression levels were normalized to TATA-binding protein (TBP) or HPRT. Relative mRNA expression was calculated by a change in cycling threshold method as 2"ddC(t). Specificity of RT-qPCR amplification was assessed by melting curve analysis. The sequences of primers used in this study are listed in Table A.
[0351] Table A. Primers used for cDNA synthesis and real time PCR.
[0352] Peptide mapping by nano LC-MS / MS
[0353] The resulting peptides were lyophilized, re-suspended in 5% acetonitrile, 0.1% (v / v) formic acid in water and injected onto a NanoAcquity UPLC (Waters) coupled to a Q Exactive (Thermo Scientific) hybrid quadrupole orbitrap mass spectrometer. Peptides were trapped on a 100 pm I.D. fused-silica pre-column packed with 2 cm of 5 pm (200A) Magic C18AQ (Bruker-Michrom) particles in 5% acetonitrile, 0.1% (v / v) formic acid in water at 4.0 pl / min for 4.0 minutes. Peptides were then separated over a 75 pm I.D. gravity-pulled 25 cm long analytical column packed with 3 pm (100A) Magic C18AQ particles, at a flow rate of 300 nl / min containing mobile phase A, 0.1% (v / v) formic acid in water and mobile phase B, 0.1% (v / v) formic acid in acetonitrile, using a biphasic gradient: 0-60 min (5-35% B), 60-90 min (35-60% B), 90-93 min (60% B), 93-94 min (60-90% B), 94-109 (90% B), followed by equilibration to 5% B. Nano-ESI source was operated at 1.4 kV via liquid junction. Mass spectra were acquired over m / z 300-1750 at 70,000 resolution (m / z 200) with an AGC target of le6. Data-dependent acquisition (DDA) selected the top 10 most abundant precursor ions for tandem mass spectrometry by HCD fragmentation using an isolation width of 1.6 Da, max fill time of 110ms, and AGC target of le5. Peptides were fragmented by a normalized collisional energy of 27, and product ion spectra were acquired at a resolution of 17,500 (m / z 200). Raw data files were peak processed with Proteome Discoverer (version 2.1, Thermo Scientific) followed by identification using Mascot Server (Matrix Science) against the Mouse (Swissprot) FASTA file (downloaded 07 / 2019). Search parameters included full tryptic enzyme specificity, and variable modifications of N-terminal protein acetylation, oxidized methionine, glutamine conversion to glutamic acid, and a 423 Da cysteine mass shift corresponding to modification by BB-C1- Amidine. Assignments were made using a 10 ppm mass tolerance for the precursor and 0.05 Da mass tolerance for the fragment ions. All non-filtered search results were processed by Scaffold (version 4.8.4, Proteome Software, Portland, OR) utilizing the Trans-Proteomic Pipeline (Institute for Systems Biology, Seattle, WA) at 1% false-discovery rate (FDR) for peptides and 99% threshold for proteins (2 peptides minimum).
[0354] Histology
[0355] Tissue blocks were sectioned at 5 m thick. Tissues were fixed in 4% paraformaldehyde overnight. Tissue sections were stained with H&E for evaluation of inflammation. Pathology evaluation was performed by applied pathology systems.
[0356] BB-CL-amidine mouse diet
[0357] BB-Cl-amidine embedded mouse diet was formulated by Lab Diets®. BB-C1- amidine was added to a base diet of laboratory lab diet. 5001 at a dose 100 mg / kg / day of consumption. Mice received the control base diet or the BB-Cl-amidine containing diet for the indicated times.
[0358] Copper click chemistry
[0359] Cells treated with or without the BB-Cl-Yne probe were lysed and quantified by protein DC assay. Proteome samples (2 mg / ml) were incubated with TCEP, TBTA ligand, copper sulphate and Biotin Azide for 1 hour at room temperature with vortexing every 15 min. Precipitated proteins were centrifuged for 5 minutes at 4600g. Protein pellets were washed twice with ice cold methanol and sonicated in 1.2% SDS. Samples were heated at 95°C for 5 min and diluted to a final volume of 6 ml with PBS (0.2% SDS). An aliquot of the post-clicked lysate was retained, and the remainder was incubated with streptavidin beads on a rotator overnight at 4°C. Samples were rotated at room temperature for 2 hours to resolubilize the SDS. Beads were washed five times with 0.2% SDS / PBS and placed on a rotator for 10 min in between washes. Beads were washed with ultra-pure water a further three times. At this point beads were eluted in IX sample buffer or further processed for mass spec as described.
[0360] PBMC isolation
[0361] PBMC were isolated from whole blood of consenting donors. Blood was diluted 1:1 in sterile PBS and layered over 15 mis of Lymphoprep. Blood was spun at 450g with no break. The interphase was transferred to a fresh tube using a Pasteur pipette and washed twice in PBS. Red blood cells were lysed in red blood cell lysis buffer for 10 min at room temperature. Cells were washed once more in PBS and counted.
[0362] CD14+ monocyte isolation
[0363] PBMC were isolated from whole blood of consenting donors. Blood was diluted 1 : 1 in sterile PBS and layered over 15 mis of Lymphoprep. Blood was spun at 450g with no break. The interphase was transferred to a fresh tube using a Pasteur pipette and washed twice in PBS. Red blood cells were lysed in red blood cell lysis buffer for 10 min at room temperature. Cells were washed once more in PBS and counted. CD 14+ monocytes were isolated using human CD14 magnetic microbeads (Miltenyi), washed twice in ice-cold macs buffer and plated in RPMI medium.
[0364] Ethics
[0365] All animal studies were performed in compliance with the federal regulations set forth in the Animal Welfare Act (AWA), the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health, and the guidelines of the UMass Medical School Institutional Animal Use and Care Committee. All protocols used in this study were approved by the Institutional Animal Care and Use Committee at the UMass Medical School (protocols A- 1633).
[0366] Statistical analysis
[0367] For comparisons of two groups two-tailed studenls’t test was performed. Multiple comparison analysis was performed using two-way ANOVA. Mantel-Cox were used for survival analysis. Three to ten mice were used per experiment, sufficient to calculate statistical significance, and in line with similar studies published in the literature. Example 15. SAR and in vivo studies of amidine analogs that inhibit mouse and human STING-dependent signaling
[0368] Double stranded DNA (dsDNA) is normally restricted to the nucleus or mitochondria, however, upon infection, microbial dsDNA can accumulate in the cytosol. Self dsDNA can also accumulate in the cytosol under a variety of alternative scenarios including mitochondrial dysfunction, uptake of exogenous dsDNA, or due to mutations in one of several nucleases and exonucleases (e.g., TREX1 or DNase II). The accumulation of cytosolic dsDNA is a sign of danger, and humans and other mammals have developed mechanisms to detect dsDNA with the most prominent sensor being cGMP-AMP synthase (cGAS), a cytosolic nucleotidyltransferase. Upon binding to dsDNA, cGAS dimerizes and the cGAS-dsDNA complex, which contains two cGAS molecules and two dsDNA molecules, undergoes a conformational change that allows cGAS to catalyze the cyclization of ATP and GTP, leading to the production of the second messenger cyclic guanosine monophosphate- adenosine monophosphate (cGAMP). cGAMP diffuses through the cytosol and binds to an endoplasmic reticulum (ER)-associated integral membrane protein known as Stimulator of Interferon Genes (STING, also referred to as MITA, ERIS, MPYS or TMEM173).
[0369] STING is a 379 amino acid protein that is encoded by the TMEM173 gene. There are five STING alleles in humans whose ability to induce downstream signaling varies. The most common allele, the R232 variant, is present in 57.9% of the population and is considered to be wild type (WT) STING. The R71H-G230A-R293Q (HAQ) allele is the next most common; it is present in 20.4% of the population. The R232H, G230A-R293Q (AQ), and R293Q alleles are present in 13.7%, 5.2%, and 1.5% of the population, respectively (FIG. 17A). STING consists of 3 domains including an -140 amino acid N- terminal domain that is comprised of 4 helices that span the membrane, a ligand binding domain (amino acids 138-340) that consists of five helices and a single curved sheet with five strands (01 -5), and a C-terminal tail (FIG. 17A) that is important for downstream signaling.
[0370] In the absence of a ligand, STING localizes to the endoplasmic reticulum (ER) as an obligate dimer. Ligand binding stabilizes a conformation that promotes STING oligomerization, trafficking from the ER to the Golgi (a process mediated by coat protein complex IT (COP-II)), and its subsequent palmitoylation on cysteines 88 and 91 . Each of these steps is essential for STING signaling. TBK1 then binds to the C-tcrminal tail of STING to facilitate the phosphorylation of TBK1 present on adjacent oligomers. Next, TBK1 phosphorylates STING at S365, which leads to the recruitment and phosphorylation of IRF3 and NFKB. Once phosphorylated, these transcription factors translocate into the nucleus where they bind DNA and activate the transcription of type I interferons (IFNs) and numerous cytokines. STING activation can also occur independently of cGAS sensing by either directly sensing bacterial derived cyclic dinucleotides or in some circumstances during virus-cell fusion. There are also several mutations that constitutively activate STING in the absence of a ligand. These mutations lead to a lupus-like disease known as STING associated vasculopathy with onset in infancy (SA VI).
[0371] The cGAS-STING pathway therefore plays a critical role in sensing cytosolic microbial or self dsDNA that is aberrantly localized to the cytosol and activation of this pathway leads to a robust inflammatory response. Accumulating evidence indicates that STING pathway activation leads to severe pathology in human diseases as aberrant STING activation is observed in amyotrophic lateral sclerosis (AES), familial chilblain lupus, Aicardi-Goutieres Syndrome (AGS), lupus, and SAVE Thepathological role of STING in these inflammatory diseases has prompted intense efforts to identify STING inhibitors (FIG. 17B).
[0372] It was previously reported that BB-Cl-amidine (FIG. 18 A) inhibits STING- dependent signaling. BB-Cl-amidine was originally developed as an inhibitor of the Protein Arginine Deiminases (PAD), a small family of mammalian enzymes that post- translationally modify arginine residues to form citrulline. Protein citrullination regulates several biological processes (e.g., gene transcription) and is aberrantly increased in numerous inflammatory diseases, including rheumatoid arthritis (RA), sepsis, ulcerative colitis, interstitial pulmonary fibrosis, and diabetes. Notably, BB-Cl-amidine inhibits all four active PAD isozymes and PAD inhibitors display potent anti-inflammatory activity in experimental models of these diseases.
[0373] It was further demonstrated that BB-Cl-amidine can covalently modify STING in vitro at C 148, C206, C257, and C309. Since this compound blocks STING oligomerization in cells, which is essential for TBK1 -IRF3 dependent IFN production, NFKB activation, cytokine production, and autophagy, is was concluded that the efficacy of BB-Cl-amidine was most likely due to its modification of C148 which is also important for oligomerization. Moreover, BB-Cl-amidine inhibited type I IFN production in response to dsDNA in vivo and reduced inflammation and pathology in a TrexlD18N / D18Nmouse model of AGS, improving survival. Although BB-Cl-amidine displays potent and highly efficacious activity in several inflammatory models, it is a relatively promiscuous drug with several off targets. Accordingly, a program was initiated to identify analogs with improved potency and proteome-wide selectivity. Herein is disclosed the initial results of those efforts. Specifically, herein is reported the development of LB244, which is a BB-Cl-amidine analog that inhibits both mouse and human STING-dependent signaling with low nanomolar potency. Moreover, LB244 inhibits STING with markedly enhanced proteome-wide selectivity over both BB-Cl- amidine and H-151, a well-established STING inhibitor. Herein is also shown that LB244 maintains its potency against the most common human STING variant (R232) whereas the potency of H- 151 is decreased by 8.2-fold. Moreover, LB 244 inhibits STING signaling in primary human monocytes whereas H-151 does not. Finally, herein is demonstrated that LB 244 inhibits in vivo STING signaling mirroring the efficacy of BB- Cl-amidine. In summary, LB244 represents a novel scaffold for the development of therapeutics for treating STING-dependent inflammatory diseases.
[0374] Results
[0375] To gain insights into the key structural features that are required for the potency of BB-Cl-amidine, a 131-member library of structurally related compounds was screened. For these studies, bone marrow derived macrophages from C57 / B16 mice (BMDMs) were incubated with each inhibitor at 5 pM for 1 h prior to the addition of a linked amidobenzimidazole (diABZI) STING agonist. After 24 h, IFN0 levels were measured by ELISA and 12 compounds showed potent inhibition of IFNP as determined by 1.5 o cutoff (FIG. 18B, Table El). An additional 6 compounds were chosen for further evaluation as they were close to the cutoff (FIG. 18A). These compounds were then rescreened at 1 pM (FIG. 18C). Notably, all the highly potent inhibitors of STING signaling contain a chloroacetamidine warhead (FIG. 18A). By contrast, reduced inhibition with related compounds containing the less reactive fluoroacetamidine warhead was observed. These data arc consistent with the covalent modification of a cysteine residue that is critical for STING signaling. Potent compounds also generally contain highly hydrophobic groups attached to the alpha amine and hydrophilic substitutions on these moieties were not tolerated (e.g., FIGs. 18B, 18C; AFM83B and SM17). Substitutions around the benzimidazole were reasonably well tolerated.
[0376] Table El: Potency of screen hits.
[0377]
[0378]
[0379] To provide a baseline for the development of inhibitors with reduced proteome- widc reactivity, the protcomc-widc selectivity of BB-Cl-ync, an analog of BB-Cl-amidinc that contains an alkyne, was compared to that of H- 151-yne, an alkyne containing analog of H- 151, a commonly used STING inhibitor (FIG. 19A). H- 151 is an irreversible STING inhibitor that forms a covalent adduct with C91 and blocks palmitoylation. The specific mechanism of inactivation is unknown and H-151 may be metabolized into a more reactive form in cells. The potency of BB-Cl-amidine, BB-Cl-yne, H-151, and H- 151-yne were evaluated in THP1 Dual Cells stimulated with diABZI; THPl-Dual cells express a secreted Lucia luciferase gene that is controlled by five interferon (IFN)- stimulated response elements that respond to IRF3 signaling. These cells also express a secreted alkaline phosphatase whose expression is controlled by NF-KB. Both IRF3 and NF-KB are activated by STING agonists. In this system, BB-Cl-amidine, BB-Cl-yne, H- 151, and H-151-yne possessed ECso values of 2.00, 0.80, 0.085, and 0.19 pM respectively (FIG. 19B). The fact that the addition of the alkyne had minimal effects on potency indicated that both BB-Cl-yne and H-151-yne could serve as useful proxies to characterize the proteome-wide reactivity of the parent molecules.
[0380] Next, HEK293T cells engineered to overexpress STING were incubated with BB- Cl-yne or H- 151-yne (FIG. 19C). Cells were then lysed, clicked to biotin-azide and the proteome-wide selectivity visualized using streptavidin-conjugated to the IR800 dye (FIG. 19D). As expected, BB-Cl-yne modified multiple proteins including a band at the expected molecular weight (42 kDa) of the STING monomer. Surprisingly, H-151-yne modified a similar number of off-targets (FIG. 19D). These experiments were repeated over a range of concentrations (0.1 nM to 2.5 pM) and showed that both BB-Cl-yne and H-151-yne are highly promiscuous compounds (FIG. 25). It was confirmed that both BB- Cl-yne and H-151-yne could enrich STING from these cells using a similar approach wherein probe labelled proteins were enriched on streptavidin agarose, eluted, and then visualized by western blotting with antibodies to STING (FIGs. 19C and 19E). A small background level of STING binding to streptavidin agarose in the DMSO only treated controls was routinely observed.
[0381] Given the high reactivity of both BB-Cl-amidine and H-151, it was next sought to identify compounds with reduced proteome-wide reactivity. Given that potent compounds identified in the initial screening set (Fig. 18) generally contain highly hydrophobic groups attached to the alpha amine and that substitutions around the benzimidazole were reasonably well tolerated, the core BB-Cl-amidine scaffold was maintained to generate analogs wherein the warhead portion of the molecule was varied. Initially, LB 111 was generated as it had been found that longer side chains are poorly tolerated by the PADs (FIGs. 20A-20C, and FIG 24C). LB111, showed a ~3-fold improvement in potency (FIG. 20C). Next, the neutral chloroacetamide derivatives BB- Cl-amidine and LB111 (LB082 and LB231 respectively, FIG. 20A-20B) were generated. In both cases, a loss in potency was observed upon moving from the positively charged amidine to the neutral amide (FIG. 20D). Acrylamide (LB081) and acryloamidine (LB070) versions of these compounds were also generated, but they lacked significant potency in cell-based assays (ECso > 40 pM). Next, the effect of adding a methyl group to either the amidino nitrogen (FIGs. 20A, 20B, LB265) or alpha to the chloro group (LB237 and LB246) was invenstigated. LB265 maintained its ability to inhibit STING whereas both LB237 and LB246 showed a significant reduction in potency (FIG. 20E); the extra methyl group in LB246 likely sterically blocks the efficient of methylating of the benzimidazole nitrogen in BB-Cl-amidine and LB111 (LB095 and LB225 respectively). In both cases, this modification led to an improvement in activity compared to the parent compounds (FIG. 20F). N-methylation reduces hydrophilicity of the molecule, which could aid cellular uptake. Nitrofuran- and chlorofuran-based warheads (FIGs. 20A-20B) were also assessed. Interestingly, all the chlorofuran-based compounds showed reduced potency relative to BB-Cl-amidine (FIG. 20G). By contrast, the nitrofuran-based compounds were at least as potent as BB-Cl-amidine (FIG. 20H).
[0382] Significantly, greater potency was achieved when the amidine (LB365) was replaced with an amide linker (LB 244). Further improvements in potency were achieved when the benzimidazole nitrogen was methylated (LB409)._To evaluate the importance of the nitro group, an analog of LB244 that lacks the nitro group was also prepared and tested. This compound, LB588, showed little to no inhibition of STING signaling THP1 dual cells (IC50 > 40 pM; FIG. 26), which demonstrates that covalent bond formation is critical for inhibition. Having identified several warheads with improved potency, it was next sought to evaluate their protcomc-widc reactivity. To that end, alkyne containing variants of LB265, LB246, LB244, and LB270 (FIG. 21A) were generated. Notably, all the probes blocked STING signaling in THP1 Dual Cells with potencies that were comparable to the parent non-alkyne containing compounds (FIG. 21B). Next, their proteome-wide reactivity and ability to isolate STING were evaluated. For these experiments, HEK- STING cells were incubated with an alkyne bearing probe for 4 h. Cell lysates were obtained, and probe-labelled proteins coupled to biotin-azide via click chemistry (FIG. 19C). Labelled proteins were visualized by western blotting (FIG. 21C-21D). Consistent with previous results, H- 151-yne and BB-Cl-yne modified multiple proteins and could enrich for STING. LB346 modified a similar repertoire of proteins; LB346 contains a methyl group on the amidino nitrogen. By contrast, LB298, LB299, and LB295 showed a remarkable reduction in proteome-wide reactivity. The loss in reactivity observed for LB298 and LB299 is consistent with these compounds being much poorer STING antagonists. Notably, LB295, which possesses a nitrofuran warhead, showed robust labeling of a band corresponding the approximate molecular weight of STING, i.e. 42 kDa. Consistent with the direct modification of STING, when probe labeled cells were clicked to biotin-azide and proteins isolated on streptavidin agarose, robust enrichment of STING with H-151-yne, LB346, BB-Cl-yne, and LB295, the alkyne containing analog of LB244, was observed. Little to no enrichment above background was observed for LB298 and LB299, again consistent with them being relatively poor STING inhibitors. These data suggest that LB295 possesses an appropriate balance between potency and reactivity.
[0383] Previous work has shown that the nitrofuran warhead covalently modifies cysteine residues via an initial attack on the carbon alpha to the nitro group followed by the loss of water and the concomitant reduction of the nitro group to a nitroso species (EIG. 21E). Next, the proteome-wide selectivity of LB295 was assessed over a range of concentrations (0.1 nM to 2.5 pM). Relative to both BB-Cl-yne and H- 151-yne, LB295 was much less promiscuous (FIG. 25C). Competition experiments with free compound (LB244) over a range of concentrations (0.5 - 10 pM) showed that LB244 can block the covalent modification of STING in a dose-dependent manner (FIG. 27 A). It was further shown that LB295 preferentially isolates STING from HEK293T cells transfected with a STING expressing plasmid (FIG. 27B).
[0384] Quantitative proteomics was used to directly assess the proteome-wide selectivity of LB295. For these experiments, cells were treated with DMSO control or LB295. Cell lysates were prepared, clicked to biotin-azide, and probe labelled proteins enriched on streptavidin agarose. Enriched proteins were digested with trypsin and the digests analyzed by quantitative proteomics after ReDiMe labeling (FIG. 21E). The results indicate that STING is highly enriched from LB295 treated cells. Several other highly abundant cysteine-containing proteins were also identified, however, none of these proteins play a known role in STING signaling, consistent with LB295 directly inhibiting STING activity. Similar' experiments with BB-Cl-yne were performed. Relative to LB295, BB-Cl-yne enriched a significantly greater number of proteins (FIG. 2 IF).
[0385] Given the promising proteome-wide selectivity data obtained for LB295, the effect of LB 244, the parent compound, on the viability of THP1 cells was evaluated. Notably, LB244 only showed a marked effect on viability when the dose exceeds 40 pM. By contrast, BB-Cl-amidine begins to reduce viability at doses higher than 2.5 pM (FIGs. 24A-24B). Since BB-Cl-amidine was originally developed as a PAD inhibitor, the ability of LB244 to inhibit the four active PAD isozymes (PADs 1-4) was evaluated. Importantly, LB244 showed little to no inactivation of any PAD isozyme (FIG. 24C). The stability of LB244 in PBS, PBS plus DTT and in the presence of human and mouse liver microsomes was determined. The results indicate the LB244 is stable for >4 h in PBS but reacted with DTT (ti / 2 = 0.8 h) and was metabolized in both human and mouse liver microsomes (Table E2), consistent with it being a thiol reactive molecule (FIG. 24D).
[0386] Table E2. Liver microsomal stability of LB244 compared to positive control Sunitinib
[0387] To directly demonstrate that LB244 blocks STING signaling, the ability of LB244 to block STING activation in primary bone marrow derived macrophages (BMDMs) was evaluated. For these studies, wild type BMDMs were pretreated with LB244 (1 M). or DMSO as a control, and then STING signaling induced by the addition of diABZI (500 nM). LB 244 potently inhibited the diABZI induced transcription of the Ifrib and 116 genes (FIGs. 22A-22B). LB244 also inhibited the diABZI induced phosphorylation of IRF3 and TBK1 (FIG. 22C). Since it was previously reported that BB-Cl-amidine blocks STING oligomerization, the effects of LB244 on the formation of STING oligomers by immunoblot analysis of native and reduced fractions of lysates from BMDMs pre-treated with LB 244 (1 |1M) followed by treatment with diABZI-4 for 30 min was evaluated. These data indicate that LB244 blocks STING oligomerization similarly to BB-Cl- amidine (FIG. 22D).
[0388] To further characterize the molecular mechanism of inhibition, MS analyses of STING modified by LB244 was attempted several times. Although the specific site of modification was not established, previous work with BB-Cl-amidine identified several candidate residues including C148, C206, C257, C309 that were modified when pure protein was incubated with this compound. Because C148 is critical for oligomerization and the data showed that BB-Cl-amidine inhibits oligomerization, it was concluded that inhibition was most likely due to the modification of this residue. To better address this issue, all ten cysteine residues in STING were individually mutated and the ability of LB295 to isolate these mutant forms of STING from cells expressing these variants was evaluated. All but three of the mutant proteins (i.e., C64S, C206S, and C309A) could be expressed at high levels in HEK293T cells (FIG. 28A). Notably, mutation of C88 and C91, the sites of palmitoylation, and putative H-151 modification sites, did not impact the ability of LB295 to modify STING (Fig. 28A). Moreover, the C148A mutant was also modified by EB295 indicating that this was not the site of modification. By contrast, mutation of C292 led to a marked reduction in labeling indicating that this residue is the primary site of modification. To further address whether C292 is the primary site of modification, the phosphor-IRF3 (pIRF3) response was evaluated for both wild type STING and the C292A mutant. Notably, the C292A mutant did not adversely impact the pIRF3 response (FIG. 28B). However, the LB244 dose response curve showed a marked rightward shift (FIG. 28C) consistent with the modification of C292 being responsible for inhibiting STING signaling. Cryo-EM structures of STING bound to cGAMP show that C292 is positioned on a C-terminal helix adjacent to the extreme N-terminus of the protein (FIG. 28D). The juxtaposition of the N-terminus explains why little labeling of the purified ligand binding domain (not shown) was seen.
[0389] The pharmacokinetics of EB244 after dosing mice at 10 mg / kg by oral gavage (PO) or at 5 mg / kg by intraperitoneal injection (IP) (Table E3) was assessed. No adverse events or signs of toxicity were observed from EB244 at the tested dose, and after the 24 h time point, normal bleeds were observed. EB244 displayed limited oral bioavailability with a Cmax = 0.04 pM and a half-life of 2.8 h and high observed clearance of 2854.3 mE / min / kg. The high level of clearance may be due to high first-pass metabolism. The IP parameters showed significant improvement with rapid absorption reaching maximal plasma concentration in 15 min compared to PO dosing which took 70 min. The rapid absorption is likely the reason it displays a higher plasma concentration. The IP clearance 240.7 mE / min / kg is 12-fold lower than PO, and the bioavailability through IP dosing is over 18-fold higher compared to PO. Given the poor oral bioavailability, in vivo efficacy of LB244 was determined by intraperitoneal (i.p.) delivery. For these studies, mice were pretreated with LB244 (5 mg / kg i.p.) for 2 h followed by administration of diABZI. Notably, LB 244 significantly reduced serum IFNp and IL-6 production even at this low dose (FIGs. 22E-22F).
[0390] Table E3. Pharmacokinetic parameters of EB244 following 10 mg / Kg oral dose in mice
[0391] LB244 also blocked the STING-dependent induction of IFNP in primary human monocytes (FIG. 23A) to a level that is comparable to that observed for BB-Cl-amidine. Surprisingly, H-151 showed limited inhibition of primary human monocytes despite being a highly potent inhibitor of STING signaling in THP1 cells (FIG. 23B). To rationalize this observation, it should be recognized that THP1 cells express the HAQ allele of STING rather than the R232 allele that is present in 57.9% of the human population. It was therefore hypothesized that H-151 may preferentially inhibit the HAQ isoform which is only present in 20.4% of the human population. To test this hypothesis, THP1 Dual Cells were obtained that express wild type STING and the inhibitory effects of LB244, BB-Cl-amidine, and H-151 were evaluated in them. Notably, the potency of H-151 was reduced by 8.2-fold in the wild type STING expressing cells. By contrast, BB-Cl-amidine was slightly more potent in wild type cells and LB244 showed only a 3.3- fold reduction in potency (FIGs. 23C-23E). Discussion
[0392] Given the important links between aberrant STING activation and inflammatory disease, an efforts was initiated to develop BB-Cl-amidine analogs with higher potency and selectivity. Initially, a library of related compounds was screened to identify key structural motifs that arc required for potent STING inhibition. These efforts showed that the chloroacetamidine warhead was essential, as was the inclusion of the hydrophobic biphenyl moiety. Given the inherent reactivity of this warhead, a series of warheads were evaluated in order to identify one that displayed a high degree of selectivity whilst maintaining potent STING inhibition. These efforts led to the identification of LB244, which possesses a nitrofuran warhead. This compound potently inhibits STING signaling in vitro in mouse and human cells and in vivo. Importantly, LB244 maintains its potency against the most common STING allele in humans similarly to BB-Cl-amidine. By contrast, H-151 shows an 8.2-fold reduction in potency in THPl Dual cells expressing the wild type STING allele and in primary human PBMCs, with little to no inhibition of STING signaling. The reason for the lack of potency in primary human PBMCs cannot solely be attributed to the loss in potency towards wild type STING as H-151 inhibits wild type STING expressing with an IC50 of 1 pM, which is similar in potency to BB-Cl- amidine and LB244. Future research will be needed to understand this finding. The data presented herein reveal for the first time that H-151 has a high degree of proteome-wide reactivity. Given the above, it is anticipated that LB 244 will be broadly useful for characterizing STING dependent signaling in a variety of different cell types and sources.
[0393] In the context of LB244, the nitrofuran warhead provided superior potency and proteome-wide selectivity. While the chloroacetamidine warhead in BB-Cl-amidine could be replaced by the nitrofuran, other warheads could not act as substitutes. Notably, acrylamide -based analogs lacked sufficient potency. The geometry, size, and distance of acrylamide in the binding pocket may explain why they lacked any activity. Chloroacetamide warheads showed relatively good activity, but chloroacetamides tend to be highly reactive. Finally, chlorofuran containing compounds only showed moderate activity compared to the nitrofuran. The strong electron withdrawing potential of the nitro group, likely explains the higher potency of this warhead.
[0394] The ability of LB244 to inhibit STING signaling by modification of C292 is particularly striking because it represents the first inhibitor directed towards this site. This region of STING has previously been suggested to regulate its degradation and the data presented herein suggests that modification of this residue can adversely impact STTNG oligomerization. Further work will be necessary to fully understand how modification of this residue leads to the inhibition of STING signaling and definitively establish that LB244 inhibits STING by modification of C292 as opposed to C64, C206, or C309.
[0395] In summary, STING is a central driver of pathology in multiple autoinflammatory and autoimmune disorders, including SA VI, SLE, and AGS. Collectively, the use of inhibitors of STING pathway may present an effective treatment strategy for diseases associated with this signaling pathway. Herein is reported the discovery of covalent small-molecule inhibitors of STING that were obtained through warhead explorations. These efforts led to LB244 as the most efficacious, selective, and non-toxic, lead compound. The ability of LB244 to pharmacologically inhibit the wild type R232 STING variant, may advance the understanding of its relevance in various contexts of health and disease.
[0396] Methods and Materials
[0397] Chemistry
[0398] Warhead Synthesis. Warheads were either synthesized using Pinner synthesis.61(Scheme El) to form imidate salts or bought from commercially available sources. Chloro acetyl chloride and 5-nitrofuran-2-carboxylic acid were obtained from Sigma- Aldrich, Co., St. Louis, MO. For the Pinner reaction, acetal chloride (1.0 equiv.) was added dropwise to a stirred solution of a nitrile substrate (0.2 equiv.) and anhydrous ethanol (1.0 equiv.) in an ice bath for 20 min. Thereafter, the reaction mixture was stirred at room temperature and monitored by Thin Layer Chromatography (TLC) over 4 h. The reaction was then concentrated in vacuo to remove volatile materials. The crude solid product was carefully washed with diethyl ether, filtered to obtain the product as a white solid. NMR spectra of the crude products were taken to confirm the synthesis of the desired products, and these were then used for subsequent steps without further purification.
[0399] Nitrile substrate Imidate salt
[0400] Scheme El. Synthesis scheme of imidate salts and substrate scope of warheads.
[0401] Inhibitor synthesis. BB-Cl-amidine analogs were synthesized similarly to previously established methods (see Scheme E2). Briefly, to a stirring solution of Fmoc- Orn(Boc)-OH or Fmoc-Lys(Boc)-OH (1.0 equiv.) in a 100 mF round bottom flask in DMF were added 3.0 equiv. of DIPEA and the solution allowed to stir at room temperature under a nitrogen atmosphere for 10 min. HBTU and HOBt (2.0 equiv.) were then sequentially added and the reaction mixture was allowed to stir further for an additional 10 min and thereafter 1 ,2-phenylenediamine (1.0 equiv.) was added. The reaction mixture was stirred under nitrogen atmosphere for 4 h at 25 °C and poured into water to precipitate intermediate 1, which was recovered by vacuum filtration, washed with water, and dried in vacuo. Crude intermediate 1, was dissolved in glacial acetic acid (50 mF) and the mixture was refluxed for 4 h. Then the reaction mixture was cooled to room temperature and poured into water. Excess acetic acid was neutralized with saturated sodium carbonate solution and the mixture extracted with excess dichloromethane. The organic extract was then washed extensively with water, brine, dried over anhydrous sodium sulphate and concentrated in vacuo to afford intermediate 2 as a gummy oil. Intermediate 2 was then treated with 20% piperidine in DMF (v / v) for 30 min to remove the Fmoc group. The reaction mixture was then vigorously stirred with excess hexanes. The hexane layer was decanted off and this procedure repeated three times to afford intermediate 3 as an orange-colored oil. Intermediate 3 was used for the successive steps without further purification.
[0402] Scheme E2. Synthetic route for the final products.
[0403] To a stirred solution of a commercially available biphenyl-4-carboxylic acid (1.0 equiv.) in a 100 mL round bottom flask containing DMF was added 3.0 equiv. of N- diisopropylethylamine and the reaction allowed to stir at room temperature under a nitrogen atmosphere for 10 min. Thereafter, HBTU and HOBt (2.0 equiv.) were added sequentially to the reaction mixture, which was allowed to stir for an additional 10 min, at which point intermediate 3 (1.2 equiv.) was added. The reaction mixture was then stirred for 12 h under a nitrogen atmosphere at room temperature. Then the reaction mixture was diluted in water and extracted with DCM. The organic layer was concentrated and purified by silica gel chromatography using 10% of DCM / MeOH to yield intermediate 4. Intermediate 4 (1.0 equiv. of the Ornithine or Lysine amino acid version) was then treated with trifluoroacetic acid / dichloromethane (1:4) (10 mL) for 1 h at room temperature and excess trifluoroacetic acid was evaporated under reduced pressure in a fume hood to afford intermediate 5. Intermediate 5 was then reacted with different electrophilic warheads to the yield respective products.
[0404] Synthesis of LB295, LB298, LB299 and LB346. The synthesis of BB-Cl-yne (LB103) was reported previously. The synthesis of LB295, LB298, LB299, and LB346 proceeded similarly. Briefly, methyl-4-(4-bromophenyl)benzoate (1.0 equiv.), Pd(PPh3)2Ch (0.1 equiv.), copper (I) iodide (0.1 equiv.) and trimethylsilyl acetylene (TMSA) (2.0 equiv.) were placed into a two-necked round bottom flask and deoxygenated tricthylaminc (30 mL) was added to the mixture (Scheme E3). The resultant mixture was refluxed for 12 h under a nitrogen atmosphere. The resulting dark brown suspension was evaporated in vacuo to remove excess TEA and then resuspended in water. Next, the mixture was extracted two times with DCM and the combined organic extracts were washed with water, dried over anhydrous sodium sulfate, and concentrated in vacuo. The crude product was then purified by column chromatography using hexanes / ethyl acetate (9:1) as the mobile phase to afford intermediate 6 as a white solid. Intermediate 6 (1.0 equiv.) was dissolved in a mixture of 1 M potassium hydroxide and tetrahydrofuran (1:1) and stirred at room temperature for 12 h. The reaction mixture was then diluted with water, washed with diethyl ether and the aqueous layer was acidified with 1 M HC1. The resultant suspension was extracted two times with diethyl ether and the combined organic extracts were washed with water, dried over anhydrous sodium sulfate, and concentrated in vacuo to afford intermediate 7 as an off-white solid.
[0405] Scheme E3. Synthesis of intermediate 7.
[0406] DIPEA (3.0 equiv.), HBTU (2.0 equiv.) and HOBt (2.0 equiv.) were added sequentially to a mixture of intermediate 7 and 3 in THF (10 mL) (Scheme S4). The reaction mixture was stirred for 8 h under a nitrogen atmosphere at room temperature. The mixture was then concentrated in vacuo to remove THF and subjected to silica gel column chromatography using 10% DCM / MeOH to yield intermediate 8 as a brown oily liquid. Intermediate 8 was deprotected to afford intermediate 9 as a viscous liquid. To a stirred solution of Intermediate 9 in dry MeOH was added triethylamine (0.39 mmol) followed by ethylchloroacetimidate.HCl (0.26 mmol, LB234). The reaction was stirred under a nitrogen atmosphere at room temperature for 4 h. Solvents were evaporated under reduced pressure and the crude product was dissolved in methanol and purified by reverse phase HPLC using ACN:H?O (0.5% TFA) as an eluent to give LB298. The same protocol was used for the synthesis of LB295, LB299 and LB346. Scheme E4. Synthesis of LB298.
[0407] Synthesis ofH-151-yne. Commercially available 3-isocyanato- I / -indole and 4- ethylnylaniline were sourced from Enamine, Monmouth Junction, New Jersey. To synthesize H-151-yne, 3-isocyanato- 1 / / -indole (1.0 equiv.) was added to a solution of 4- ethynylaniline (1.2 equiv.) in 10 mL of anhydrous DCM (Scheme S5). The reaction mixture was stirred for 3 h at Room Temperature (RT), followed by concentration under reduced pressure and the crude product dissolved in acetonitrile and purified by reverse phase HPLC using ACNiHsO (0.5% TFA) as an eluent to give H- 151-yne.
[0408] Compound Characterization
[0409] H-151-yne (LB002)
[0410] H-151-yne (LB002), off-white solid, ‘H NMR (DMSO-d6, 500 MHz): 6 = 10.68 (s, 1H, NH), 8.74 (s, 1H, NH), 8.45 (s, 1H, NH), 7.45 - 7.42 (m, 4H, Ar-H), 7.05 - 6.93 (m, 2H, Ar-H), 3.95 (s, 1H, -CCH);13C NMR (DMSO-d6, 100 MHz) 5 = 152.9, 141.3, 134.3, 133.2, 132.9, 130.2, 121.9, 121.4, 118.6, 118.0, 117.8, 117.4, 117.2, 115.3, 114.6, 112.0, 84.4, 79.7. LC-MS (ESI) m / z calculated for C17H14N3O [M+H]+276.1 1 , observed
[0411] 276.10
[0412] BB-Cl-yne (LB 103), off-white solid, *H NMR (DMSO-d6, 500 MHz): 5 - 9.90 (s, 1H, NH), 9.45 (s, 1H, NH), 9.08 (s, 1H, NH), 8.03 (d, 7=8.4 Hz, 2H, Ar-H), 7.76 (m, 4H,
[0413] Ar-H), 7.66 (m, 2H, Ar-H), 7.55 (m, 2H, Ar-H), 7.46 (m, 4H, Ar-H), 5.64 (m, 1H, -CH-), 3.45 (m, 2H, -CH2), 3.00 (s, 1H, -CCH), 2.36 (m, 2H, -CH3), 2.00 (m, 2H, -CH2);13C NMR (DMSO-d6, 100 MHz) 5 = 168.7, 166.7, 161.8, 161.5, 161.2, 153.9, 145.1, 139.6, 131.9, 131.3, 128.7, 128.0, 127.9, 126.7, 125.8, 113.0, 82.6, 78.5, 41.9, 29.1, 23.5, 21.1. LC-MS (ESI) m / z calculated for C^Hz / ClNsO [M+H]+484.19, observed 484.20
[0414] LB070, off-white solid, ’ H NMR (CD3OD, 500 MHz): 8 = 8.15 (d, 7=8.4 Hz, 2H, Ar-H), 7.86 (m, 4H, Ar-H), 7.78 (m, 2H, Ar-H), 7.55 (m, 2H, Ar-H), 7.45 (m, 2H, Ar-H), 7.40 (m, 1H, Ar-H), 6.40 (m, 1H, -CH-), 5.72 (m, 1H, -CH-), 5.10 (m, 3H, -CH-), 4.25 (d, 7=5.5 Hz, 2H, -CH-), 4.00 (m, 2H, -CH-), 3.70 (m, 4H, -CH2-), 2.28 (m, 2H, -CH-),
[0415] 1.85 (m, 2H, -CH2-);13C NMR (CD3OD, 100 MHz) 6 = 168.1, 162.3, 161.9, 154.4, 144.9, 139.9, 131.2, 128.9, 128.9, 128.3, 128.1, 127.1, 126.2, 126.0, 117.6, 115.3, 114.4, 68.1, 58.9, 41.7, 31.7, 23.6. LC-MS (ESI) m / z calculated for C27H28N5O [M+H]+438.23, observed 438.00
[0416]
[0417] LB081, off-white solid, NMR (CD3OD, 500 MHz): 8 = 8.02 (d, 7=8.4 Hz, 2H, Ar-H), 7.74 (m, 4H, Ar-H), 7.67 (m, 2H, Ar-H), 7.55 (m, 2H, Ar-H), 7.45 (m, 2H, Ar-H), 7.40 (m, 1H, Ar-H), 6.40 (m, 1H, -CH-), 5.72 (m, 1H, -CH-), 5.10 (m, 3H, -CH-), 4.25 (d, 7=5.5 Hz, 2H, -CH-), 4.00 (m, 2H, -CH-), 3.70 (m, 4H, -CH2-), 2.28 (m, 2H, -CH-), 1.85 (m, 2H, -CH2-);13C NMR (CD3OD, 100 MHz) 8 = 168.1, 162.3, 161.9, 154.4, 144.9, 139.9, 131.2, 128.9, 128.9, 128.3, 128.1, 127.1, 126.2, 126.0, 117.6, 115.3, 114.4, 68.1, 58.9, 41.7, 31.7, 23.6. LC-MS (ESI) m / z calculated for C^H^NsO [M+H]+439.21, observed 439.20
[0418] LB082, off-white solid,JH NMR (CDCI3, 500 MHz): 8 = 9.84 (s, 1H, NH), 7.97 (m, 2H, Ar-H), 7.50 (m, 7H, Ar-H), 7.25 (m, 7H, Ar-H), 6.00 (m, 1H, -CH-), 3.97 (s, 2H, -CH2-), 3.35 (m, 2H, -CH2-), 1.72 (m, 2H, -CH2-), 1.25 (m, 2H, -CH2);13C NMR (CD3OD, 100 MHz) 8 = 168.9, 168.1, 154.6, 145.1, 139.7, 131.4, 128.7, 128.1, 127.9, 126.7, 125.9, 113.6, 38.6, 28.4, 22.6. LC-MS (ESI) m / z calculated for C26H26C1N4O2[M+H]+461.17, observed 461.00 LB095, off-white solid, ‘H NMR (DMSO-d6, 500 MHz): 5 = 10.06 (s, 1H, NH), 9.58 (s, 1H, NH), 9.25 (d, 7=7.1 Hz, NH), 9.17 (s, 1H, NH), 7.96 (d, 7=8.4 Hz, 2H, Ar- H), 7.65 (m, 6H, Ar-H), 7.36 (m, 5H, Ar-H), 5.56 (m, 1H, -CH-), 4.34 (s, 2H, -CH2-), 3.92 (s, 3H, -CH3), 2.16 (m, 2H, -CH2-), 1.70 (m, 2H, -CH2-), 1.45 (m, 2H, -CH2);13C NMR (DMS0-d6, 100 MHz) 5 = 166.8, 162.9, 159.4, 159.1, 158.8, 158.7, 154.2, 143.8, 139.5, 134.5, 132.4, 129.5, 128.8, 128.6, 127.8, 127.4, 127.2, 127.1, 126.9, 124.7, 120.6, 118.3, 116.8, 115.9, 113.5, 112.2, 55.4, 46.1, 46.0, 31.2, 29.4, 24.1. LC-MS (ESI) m / z calculated for C^H^ClNsO [M+H]+474.21, observed 474.00
[0419] LB 111, off-white solid, ’ H NMR (DMSO-d6, 500 MHz): 8 = 9.88 (s, 1H, NH), 9.43 (s, 1H, NH), 9.14 (d, 7=7.1 Hz, 2H, NH), 9.01 (s, 1H, NH), 8.01 (d, 7=8.4 Hz, 2H, Ar-H), 7.76 (d, 7=8.4 Hz, 2H, Ar-H), 7.65 (m, 6H, Ar-H), 7.41 (m, 6H, Ar-H), 5.40 (m, 1H, -CH-), 4.28 (s, 2H, -CH2-), 3.20 (m, 2H, -CH2-), 2.12 (m, 2H, -CH2-), 1.55 (m, 2H, - CH2-), 1.45 (m, 2H, -CH2);13C NMR (DMSO-d6, 100 MHz) 8 = 166.9, 164.8, 160.6,
[0420] 156.9, 156.7, 156.5, 156.2, 153.2, 141.7, 139.3, 137.7, 137.4, 133.8, 130.5, 127.4, 127.4, 126.8, 126.6, 126.2, 125.7, 125.3, 125.1, 124.9, 124.8, 122.9, 116.2, 113.8, 112.7, 44.1,
[0421] 37.9, 30.1, 24.9, 22.4. LC-MS (ESI) m / z calculated for C27H29C1N5O [M+H]+474.21, observed 473.80
[0422] LB225, off-white solid,1H NMR (CD3OD, 500 MHz): 8 = 7.80 (m, 3H, Ar-H), 7.75 (m, 3H, Ar-H), 7.61 (m, 5H, Ar-H), 7.40 (m, 5H, Ar-H), 5.65 (m, 1H, -CH-), 4.32 (s, 2H, -CH2-), 4.15 (s, 3H, CH3), 2.35 (m, 2H, -CH2-), 1.80 (m, 2H, -CH2-), 1.57 (m, 2H, -CH2-), 1.30 (m, 2H, -CH2);13C NMR (CD3OD, 100 MHz) 8 = 168.6, 163.2, 153.3,
[0423] 145.1, 139.6, 133.1, 131.6, 131.1, 128.7, 127.9, 127.9, 126.8, 126.7, 126.2, 125.9, 114.4,
[0424] 112.1, 42.3, 38.7, 37.5, 31.0, 26.6, 22.8. LC-MS (ESI) m z calculated for C28H3IC1N5O [M+H]+488.22, observed 488.20
[0425] LB231, off-white solid,1H NMR (CD3OD, 500 MHz): 8 = 8.03 (m, 2H, Ar-H), 7.65 (m, 6H, Ar-H), 7.50 (m, 6H, Ar-H), 5.49 (m, 1H, -CH-), 3.97 (s, 2H, -CH2-), 3.10 (m, 2H, -CH2-), 2.29 (m, 2H, -CH2-), 1.67 (m, 2H, -CH2-), 1.50 (m, 2H, -CH2);13C NMR (CD3OD, 100 MHz) 8 = 168.9, 168.1, 154.6, 145.1, 139.7, 131.4, 128.7, 128.1, 127.9, 126.7, 125.9, 113.6, 41.8, 38.6, 28.4, 22.6. LC-MS (ESI) m / z calculated for
[0426] C27H28C1N4O2[M+H]+475.19, observed 475.20
[0427] LB237, off-white solid, ’ H NMR (CD3OD, 500 MHz): 8 = 8.14 (m, 2H, Ar-H), 7.80 (m, 3H, Ar-H), 7.75 (m, 3H, Ar-H), 7.61 (m, 5H, Ar-H), 7.40 (m, 5H, Ar-H), 5.65 (m, 1H, -CH-), 4.32 (s, 2H, -CH2-), 4.15 (s, 3H, CH3), 2.35 (m, 2H, -CH2-), 1.80 (m, 2H,
[0428] -CH2-), 1.57 (m, 2H, -CH2-), 1.30 (m, 2H, -CH2);13C NMR (CD3OD, 100 MHz) 8 = 168.6, 163.2, 153.3, 145.1, 139.6, 133.1, 131.6, 131.1, 128.7, 127.9, 127.9, 126.8, 126.7,
[0429] 126.2, 125.9, 114.4, 112.1, 42.3, 38.7, 37.5, 31.0, 26.6, 22.8. LC-MS (ESI) m / z calculated for C28H3iClN5O [M+H]+488.22, observed 488.20
[0430] LB244, Red solid,3H NMR (CD3OD, 500 MHz): 6 = 8.10 (m, 3H, Ar-H), 7.78 (m, 7H, Ar-H), 7.56 (m, 7H, Ar-H), 7.28 (m, 1H, Ar-H), 5.61 (m, 1H, -CH-), 2.35 (m, 2H, -CH2-), 1.80 (m, 2H, -CH2-), 1.57 (m, 2H, -CH2-), 1.30 (m, 2H, -CH2);13C NMR (CD3OD, 100 MHz) 5 = 168.8, 157.5, 154.7, 151.8, 147.9, 144.9, 144.9, 139.7, 139.6, 131.9, 131.5, 128.7, 128.6, 128.0, 127.9, 126.7, 126.7, 126.6, 125.6, 118.8, 116.9, 115.3,
[0431] 113.7, 111.9, 111.4, 111.3, 38.0, 31.5, 28.3, 22.7. LC-MS (ESI) m / z calculated for
[0432] C30H28N5O5 [M+H]+538.21, observed 538.20
[0433] LB 246, off-white solid,1H NMR (CD3OD, 500 MHz): 8 = 8.03 (d, 7=8.4 Hz, 2H,
[0434] Ar-H), 7.76 (m, 4H, Ar-H), 7.66 (m, 2H, Ar-H), 7.55 (m, 2H, Ar-H), 7.46 (m, 4H, Ar-H),
[0435] 5.64 (m, 1H, -CH-), 3.45 (m, 2H, -CH2-), 3.10 (m, 1H, -CH-), 2.36 (m, 2H, -CH3), 2.00
[0436] (m, 2H, -CH2-), 1.80 (d, 7=7.0 Hz, 3H, -CH3);13C NMR (DMSO-d6, 100 MHz) 5 =
[0437] 168.7, 166.7, 161.8, 161.5, 161.2, 153.9, 145.1, 139.6, 131.9, 131.3, 128.7, 128.0, 127.9,
[0438] 126.7, 125.8, 113.0, 41.9, 29.1, 23.5, 21.1. LC-MS (ESI) m / z calculated for C27H29CIN5O [M+H]+474.21, observed 474.20
[0439] LB259, brown solid, (CD3OD, 500 MHz): 6 = 8.10 (m, 3H, Ar-H), 7.78 (m, 7H, Ar-H), 7.56 (m, 7H, Ar-H), 7.28 (m, 1H, Ar-H), 5.61 (m, 1H, -CH-), 2.35 (m, 2H, -CH2-), 1.80 (m, 2H, -CH2-), 1.57 (m, 2H, -CH2-);13C NMR (CD3OD, 100 MHz) 8 = 168.8, 157.5, 154.7, 151.8, 147.9, 144.9, 144.9, 139.7, 139.6, 131.9, 131.5, 128.7, 128.6,
[0440] 128.0, 127.9, 126.7, 126.7, 126.6, 125.6, 118.8, 116.9, 115.3, 113.7, 111.9, 111.4, 111.3, 38.0, 31.5, 28.3, 22.7. LC-MS (ESI) m / z calculated for C29H26N5O5 [M+H]+524.19, observed 524.40 LB265, off-white solid, ‘H NMR (CD3OD, 500 MHz): 5 = 7.80 (m, 3H, Ar-H),
[0441] 7.75 (m, 3H, Ar-H), 7.61 (m, 5H, Ar-H), 7.40 (m, 5H, Ar-H), 5.65 (m, 1H, -CH-), 4.32
[0442] (s, 2H, -CH2-), 4.15 (s, 3H, CH3), 2.35 (m, 2H, -CH2-), 1.80 (m, 2H, -CH2-), 1.57 (m, 2H,
[0443] -CH2-), 1.30 (m, 2H, -CH2);13C NMR (CD3OD, 100 MHz) 8 = 168.6, 163.2, 153.3,
[0444] 145.1, 139.6, 133.1, 131.6, 131.1, 128.7, 127.9, 127.9, 126.8, 126.7, 126.2, 125.9, 114.4, 112.1, 42.3, 38.7, 37.5, 31.0, 26.6, 22.8. LC-MS (ESI) m z calculated for C28H31CIN5O
[0445] [M+H]+488.22, observed 488.40
[0446] LB269, off-white solid, ’H NMR (CD3OD, 500 MHz): 6 = 8.16 (m, 3H, Ar-H),
[0447] 7.80 (m, 7H, Ar-H), 7.60 (m, 6H, Ar-H), 6.67 (d, J=3.4 Hz, 1H, Ar-H), 5.72 (m, 1H, -
[0448] CH-), 3.60 (m, 2H, -CH2-), 2.38 (m, 2H, -CH2-), 2.00 (m, 2H, -CH2-), 1.71 (m, 2H, - CH2-);13C NMR (CD3OD, 100 MHz) 8 = 168.7, 154.0, 151.6, 145.1 , 142.5, 140.7, 139.6, 132.4, 131.4, 128.7, 128.1, 127.9, 126.7, 126.7, 125.5, 119.8, 113.8, 110.1, 41.6, 29.3, 26.7, 23.9. LC-MS (ESI) m / z calculated for C3OH29C1N502[M+H]+526.20, observed
[0449] 526.20
[0450] LB270, off-white solid,1H NMR (CD3OD, 500 MHz): 5 = 8.03 (m, 2H, Ar-H), 7.75 (m, 4H, Ar-H), 7.65 (m, 2H, Ar-H), 7.50 (m, 5H, Ar-H), 7.39 (m, 1H, Ar-H), 6.67 (d, 1=3.4 Hz, 1H, Ar-H), 5.65 (m, 1H, -CH-), 3.56 (m, 2H, -CH2-), 2.38 (m, 2H, -CH2-), 2.00 (m, 2H, -CH2-);13C NMR (CD3OD, 100 MHz) 5 = 168.7, 154.0, 151.6, 145.1, 142.5, 140.7, 139.6, 132.4, 131.4, 128.7, 128.1, 127.9, 126.7, 126.7, 125.5, 119.8, 113.8, 110.1, 41.6, 29.3, 23.9. LC-MS (ESI) m / z calculated for C29H27CIN5O2 [M+H]+512.18, observed 512.40
[0451] (S)-N-(l-(lH-benzo[d]imidazol-2-yl)-5-(5-nitrofuran-2- carboximidamido)pentyl)-4'-ethynyl-[l,l'-biphenyl]-4-carboxamide (LB295), Red solid, 10 mg, 26%, ’H NMR (CD3OD, 500 MHz): 8 = 8.10 (d, J = 8.6 Hz, 2H), 8.03 (d, J = 8.6 Hz, 2H), 7.83 - 7.82 (m, 4H), 7.76 - 7.74 (m, 2H), 7.59 - 7.57 (m, 2H), 7.45 (d, J = 3.8 Hz, 1H), 7.17 (d, 7 = 3.8 Hz, 1H), 5.54 - 5.51 (m, 1H), 3.46 - 3.43 (m, 2H), 2.65 (s, 1H), 2.33 - 2.31 (m, 2H), 1.79 - 1.74 (m, 2H), 1.64 - 1.54 (m, 2H);13C NMR (CD3OD, 125 MHz) 5 = 168.6, 157.5, 154.5, 147.9, 144.2, 143.5, 136.4, 132.3, 131.3, 128.8, 128.2, 127.0, 126.9, 126.7, 126.5, 126.1, 117.3, 115.3, 113.6, 111.9, 60.1, 38.3, 28.4, 25.4, 22.8, 22.5. HRMS (ESI) m / z calculated for C32H28N5O5 [M+H]+562.2085, observed 562.2107
[0452] (S)-V-( l-( l / / -benzo|d|iuiidazol-2-yl)-5-(2-chloro- V- methylacetimidamido)pentyl)-4'-ethynyl-[l,l'-biphenyl]-4-carboxamide (LB346), off-white solid, 15 mg, 37%, ‘ H NMR (CD3OD, 500 MHz): 8 = 8.10 (d, 7 = 8.5 Hz, 2H), 8.05 (d, 7= 8.4 Hz, 2H), 7.86 - 7.82 (m, 4H), 7.73 - 7.71 (m, 2H), 7.52 - 7.49 (m, 2H), 5.62 - 5.58 (m, 1H), 3.64 -3.50 (m, 2H), 3.16 (s, 2H), 2.64 (s, 3H), 2.33 - 2.30 (m, 2H), 1.92 - 1.81 (m, 2H), 1.67 - 1.54 (m, 2H);13C NMR (DMSO-d6, 125 MHz) 8 = 168.5,
[0453] 162.6, 154.3, 144.3, 143.5, 136.4, 132.4, 132.3, 128.8, 128.1, 127.1, 127.0, 126.8, 126.7,
[0454] 125.6, 113.8, 60.1, 56.1, 37.9, 36.4, 31.6, 26.7, 25.4, 22.4. HRMS (ESI) m / z calculated for C30H31CIN5O [M+H]+512.2212, observed 512.2234
[0455] LB365, Red solid, ’H NMR (CD3OD, 500 MHz): 6 = 8.10 (m, 3H, Ar-H), 7.78 (m, 7H, Ar-H), 7.56 (m, 7H, Ar-H), 7.28 (m, 1H, Ar-H), 5.61 (m, 1H, -CH-), 2.35 (m, 2H, -CH2-), 1.80 (m, 2H, -CH2-), 1.57 (m, 2H, -CH2-), 1.30 (m, 2H, -CH2);13C NMR (CD3OD, 100 MHz) 8 = 168.8, 157.5, 154.7, 151.8, 147.9, 144.9, 144.9, 139.7, 139.6, 131.9, 131.5, 128.7, 128.6, 128.0, 127.9, 126.7, 126.7, 126.6, 125.6, 118.8, 116.9, 115.3,
[0456] 113.7, 111.9, 111.4, 111.3, 38.0, 31.5, 28.3, 22.7. LC-MS (ESI) m / z calculated for C30H28N5O5 [M+H]+538.21, observed 538.20
[0457]
[0458] LB298, off-white solid, 'H NMR (CD3OD, 500 MHz): 8 = 8.03 (d, 7=8.4 Hz, 2H, Ar-H), 7.76 (m, 4H, Ar-H), 7.66 (m, 2H, Ar-H), 7.55 (m, 2H, Ar-H), 7.46 (m, 4H, Ar-H), 5.64 (m, 1H, -CH-), 3.45 (m, 2H, -CH2-), 3.10 (m, 1H, -CH-), 3.00 (s, 1H, -CH), 2.36 (m, 2H, -CH3), 2.00 (m, 2H, -CH2-), 1.80 (d, 7=7.0 Hz, 3H, -CH3);13C NMR (DMSO-d6, 100 MHz) 8 = 168.7, 166.7, 161.8, 161.5, 161.2, 153.9, 145.1, 139.6, 131.9, 131.3, 128.7, 128.0, 127.9, 126.7, 125.8, 113.0, 82.6, 78.5, 41.9, 29.1, 23.5, 21.1. LC-MS (ESI) m / z calculated for C29H29CIN5O [M+H]+498.21, observed 498.20
[0459] (S)-A-(l-(lH-benzo[d]imidazol-2-yl)-4-(5-chlorofuran-2- carboximidamido)butyl)-4' -ethynyl- [1,1 ' -biphenyl] -4-carboxamide (LB299) , off- white solid, 18 mg, 46%,rH NMR (CD3OD, 500 MHz): 8 = 8.10 (d, J= 8.6 Hz, 2H), 8.06 (d, 7 = 8.6 Hz, 2H), 7.86 - 7.82 (m, 4H), 7.77 - 7.75 (m, 2H), 7.59 - 7.57 (m, 2H), 5.59 - 5.56 (m, 1H), 3.45 - 3.41 (m, 2H), 2.31 - 2.26 (m, 2H), 1.88 - 1.75 (m, 2H);13C NMR (DMSO-d6, 100 MHz) 8 = 168.6, 154.2, 144.3, 142.5, 136.4, 132.4, 131.8, 128.8, 128.2, 128.0, 127.0, 126.7, 126.5, 125.9, 113.7, 53.4, 38.6, 29.0, 25.4, 25.1. HRMS (ESI) m / z calculated for C31H27CIN5O2 [M+H]+536.1848, observed 536.1871
[0460] LB393, off-white solid,1H NMR (CD3OD, 500 MHz): 8 = 8.00 (m, 3H, Ar-H), 7.80 (m, 7H, Ar-H), 7.60 (m, 6H, Ar-H), 6.67 (d, 7=3.4 Hz, 1H, Ar-H), 5.72 (m, 1H, - CH-), 3.60 (m, 2H, -CH2-), 2.38 (m, 2H, -CH2-), 2.00 (m, 2H, -CH2-), 1.71 (m, 2H, - CH2-);13C NMR (CD3OD, 100 MHz) 8 = 168.7, 154.0, 151.6, 145.1 , 142.5, 140.7, 139.6,
[0461] 132.4, 131.4, 128.7, 128.1, 127.9, 126.7, 126.7, 125.5, 119.8, 113.8, 110.1, 41.6, 29.3,
[0462] 26.7, 23.9. LC-MS (ESI) m / z calculated for C31H30CIN4O3 [M+H]+541.20, observed
[0463] 541.20
[0464] LB394, off-white solid, NMR (CD3OD, 500 MHz): 8 = 8.16 (m, 3H, Ar-H), 7.80 (m, 7H, Ar-H), 7.60 (m, 6H, Ar-H), 6.67 (d, J=3.4 Hz, 1H, Ar-H), 5.72 (m, 1H, - CH-), 3.60 (m, 2H, -CH2-), 2.38 (m, 2H, -CH2-), 2.00 (m, 2H, -CH2-), 1.71 (m, 2H, - CH2-);13C NMR (CD3OD, 100 MHz) 8 = 168.7, 154.0, 151.6, 145.1, 142.5, 140.7, 139.6, 132.4, 131.4, 128.7, 128.1, 127.9, 126.7, 126.7, 125.5, 119.8, 113.8, 110.1, 41.6, 29.3,
[0465] 26.7, 23.9. LC-MS (ESI) m / z calculated for C30H28CIN4O3 [M+H]+527.20, observed 527.20
[0466] LB409, Red solid, ’H NMR (CD3OD, 500 MHz): 3 = 8.00 (m, 3H, Ar-H), 7.78 (m, 6H, Ar-H), 7.56 (m, 4H, Ar-H), 7.28 (m, 1H, Ar-H), 5.61 (m, 1H, -CH-), 4.18 (s, 3H, -CH3), 2.35 (m, 2H, -CH2-), 1.80 (m, 2H, -CH2-), 1.57 (m, 2H, -CH2-), 1.30 (m, 2H, - CH2);13C NMR (CD3OD, 100 MHz) 8 = 168.8, 157.5, 154.7, 151.8, 147.9, 144.9, 144.9,
[0467] 139.7, 139.6, 131.9, 131.5, 128.7, 128.6, 128.0, 127.9, 126.7, 126.7, 126.6, 125.6, 118.8, 116.9, 115.3, 1 13.7, 1 11.9, 111.4, 111.3, 46.8, 38.0, 31.5, 28.3, 22.7. LC-MS (ESI) m / z calculated for C31H28N5O5 [M-H]’ 550.21, observed 550.20
[0468] (S)-AI-(5-([ l,l'-biphenyl]-4-carboxamido)-5-( l / / -benzo|<7|iinidazol-2- yl)pentyl)furan-2-carboxamide (LB588), off-white solid, 15 mg, 46%, H NMR (CD3OD, 500 MHz): 8 = 8.01 (d, J = 8.4 Hz, 2H), 7.76 - 7.72 (m, 4H), 7.68 - 7.66 (m, 2H), 7.59 - 7.57 (m, 3H), 7.49 - 7.46 (m, 2H), 7.41 - 7.38 (m, 1H), 7.01 - 7.00 (m, 1H), 6.53 - 6.52 (m, 1H), 5.50 - 5.48 (m, 1H), 3.42 - 3.39 (m, 2H), 2.34 - 2.26 (m, 2H), 1.76 - 1.72 (m, 2H), 1.66 - 1.54 (m, 2H);13C NMR (CD3OD, 125 MHz) 8 = 168.9, 159.7,
[0469] 154.6, 147.6, 145.1, 144.8, 139.6, 131.4, 131.2, 128.7, 128.0, 127.9, 126.7, 126.1, 113.8,
[0470] 113.6, 111.5, 53.4, 37.8, 31.2, 28.7, 22.6. HRMS (ESI) z / z calculated for C32H29N6O4 [M+H]+561.2245, observed 493.2249.
[0471] Biology
[0472] All reagents were obtained from commercial sources and their specific sources are indicated below or in the supporting information. PADs 1, 2, 3, and 4 were purified using established methods.
[0473] Library Screening. BMDMs were obtained from wild type mice. Briefly, tibias and femurs were removed from wild type mice and bone marrow was flushed with complete DMEM-medium. Cells were plated in medium containing 20% (v / v) conditioned medium of L929 mouse fibroblasts cultured for 7 days at 37 °C in a humidified atmosphere of 5% CO2. Medium was replaced every 3 days. BMDMs were pre-treated with vehicle control (DMSO) or an individual library member for 1 h followed by treatment with diABZI at 500 nM (Invivogen) for 24 h. Conditioned media was collected as indicated and mouse IFNP levels were quantified by sandwich ELISA (R&D Systems).
[0474] STING inhibition assay in THP-1 Dual Cells.
[0475] THP- 1 Dual cells derived from human THP- 1 monocytes were purchased from InvivoGen. These cells contain an inducible Lucia luciferase reporter gene which is controlled by the ISG54 (interferon-stimulated gene) minimal promoter in conjunction with five interferon (IFN)-stimulated response elements. The cells were grown in RPMI 1640, 2 mM L-glutamine, 25 mM HEPES, 10% heat-inactivated fetal bovine serum, 100 pg / mL Normocin™, Pen-Strep (100 U / mL-100 pg / mL). For selection, the cells were passaged with and without addition of antibiotics (10 pg / mL of Blasticidin and 100 pg / mL of Zcocin™) to the growth medium every other passage. Once the cells were confluent, they were pelleted and suspended in test medium containing: RPMI 1640, 2 mM L-glutamine, 25 mM HEPES, 10% heat-inactivated fetal bovine serum, Pen-Strep (100 U / mL-100 pg / mL). The cells were counted in a cell counter to obtain a cell density of 1 x 106cells / mL of test media. The cells were plated (25 pL) in a 384-well Greiner plate (Catalog No. 781098). Compounds were generally dosed at a final concentration of 40, 20, 10, 5, 2.5, 1, 0.5, 0.25, 0.01, and 0.05 pM (1% DMSO final). After 1 h of incubation at 37 °C, 50 nM of diABZI was added to all the wells containing compounds and control wells. The negative control wells contained 1% DMSO. The cells were then incubated at 37 °C for 24 h. QUANTI-Luc (Invivogen) reagent was then diluted in 30 mL of water and 75 pL was added to each well and luminescence was read immediately (Perkin Elmer Envision 2105). The data was normalized to the DMSO only controls (without diABZI) and percent activation was calculated based on the diABZI only control. Compounds were dosed in triplicate. Inhibition experiments using THPl-Dual KI-hSTING-R232 cells were performed analogously.
[0476] Proteome-wide selectivity studies.
[0477] HEK-293T cells expressing human full-length wild type STING were cultured in 25 cm2T-25 flasks in DMEM (supplemented with 10% heat-inactivated fetal bovine serum, 1 x Corning Penicillin-Streptomycin solution and O.Olmg / mL Blasticidin). Upon reaching -80% confluence, cells were treated with an alkyne-tagged probe (5 pM) in FBS-free DMEM for 4 h. The cells were scraped, harvested by centrifugation at 1000 x g for 3 min. The resulting pellet was then resuspended in IX PBS with IX Halt protease inhibitor and 1% NP-40. Cell lysis was performed by probe sonication and soluble proteins in the lysate were quantified by DC Assay (BioRad). Probe labeled proteins were coupled to biotin-Na via copper catalyzed click chemistry. Briefly, lysates (2 mg / mL, 50 pL final, total 100 pg) were incubated with Biotin-Na (100 pM), freshly prepared TCEP (1 mM), TBTA (0.3 mM) and CuSOa (4 mM). The tubes were left on a gentle rocking platform at room temperature for 1 h, following which the precipitated proteins were collected via centrifugation at 3000 x g for 10 min. The pellet was then denatured in IX SDS loading buffer by boiling for 10 min and proteins were separated by SDS-PAGE (4-20% gradient gel). The separated proteins were electroblotted onto a PVDF membrane. Biotinylated proteins were detected with Streptavidin IR dye 800CW using a LICOR Image Analyzer. All the experiments were performed at least in duplicate. These experiments were repeated over a range of concentrations (0.1 nM to 2.5 pM).
[0478] Pulldown.
[0479] For pull down experiments, cell lysates (2 mg / mL, 50 pL final, total 100 pg) prepared as described above were incubated with Biotin-Na (100 pM), freshly prepared TCEP (1 mM), TBTA (0.3 mM) and CuSCU (4 mM). The tubes were left on a gentle rocking platform at room temperature for 2 h, following which the precipitated proteins were collected via centrifugation at 3000 x g for 10 min. The precipitate was subsequently washed with ice-cold methanol and left to dry at room temperature for 5 min. The dried pellet was resuspended in 1.2% SDS in PBS (30 pL). SDS-solubilized proteins were then diluted with PBS to a final SDS concentration of 0.2% and incubated overnight with streptavidin-agarose beads (10-20 pL for 100 pg of total protein) at 4 °C on an end-over end shaker. The solutions were then incubated at room temperature for 2 h to solubilize any precipitated SDS. The streptavidin beads were collected by centrifugation at 1,300 x g for 3 min and were washed with 2 M urea (2 x 250 pL), PBS (3 x 250 pL), water (3 x 1 mL). The beads were pelleted by centrifugation at 1,300 x g for 3 min between washes. The washed beads were resuspended in a mixture of 4 M urea and lx SDS (30 pL) and boiled at 95 °C for 15 min and ran on an SDS-PAGE (4-20% gel). The separated proteins were electroblotted onto a PVDF membrane, which was probed with primary rabbit monoclonal anti-STING (Abeam, cat: ab239074) and secondary (goat anti rabbit IR dye 680) antibodies. The immunoblotted protein bands were visualized using a LICOR Image Analyzer. All the experiments were performed at least in duplicate. This approach was also used to identify the site of modification.
[0480] Quantitative Proteomics.
[0481] HEK-293T cells expressing full-length wild type STING were cultured in 75 cm2T-75 flasks in DMEM (supplemented with 10% heat-inactivated fetal bovine serum, IX Corning Penicillin-Streptomycin solution and 0.01 mg / mL Blasticidin). Upon reaching -80% confluence, cells were treated with LB295 (5 pM) for 4 hours in FBS-free DMEM. Cells were treated with BB-Cl-yne (1 pM) for 24 h. The cells were scraped, harvested by centrifugation at 1000 x g for 3 min. The resulting pellet was then resuspended in IX PBS with IX Halt protease inhibitor and 1% NP-40. Cell lysis was performed by probe sonication. Prior to quantifying soluble protein concentration via DC Assay (BioRad), the samples were treated with 100 p L of streptavidin-agarose beads to remove endogenously biotinylated proteins. Lysates (2 mg / mL, 1 mL final, total 2 mg) were then incubated with Biotin-N (100 pM), freshly prepared TCEP (1 mM), TBTA (0.3 mM) and CuSCU (4 mM). The tubes were left on a gentle rocking platform at room temperature for 2 h, following which the precipitated proteins were collected via centrifugation at 3000 x g for 10 min. The precipitate was subsequently washed with ice-cold methanol and left to dry at room temperature for 5 min. The dried pellet was resuspended in 1.2% SDS in PBS (600 pL). SDS-solubilized proteins were then diluted with PBS to a final SDS concentration of 0.2% and incubated overnight with streptavidin-agarose beads (170 pL for 2 mg of total protein) at 4 °C on an end-over end shaker. The solutions were then incubated at room temperature for 2 h to solubilize any precipitated SDS. The streptavidin beads were collected by centrifugation at 1,300 x g for 3 min and were washed with 0.2% SDS in PBS (2 5 mL), PBS (3 x 5 mL), water (3 x 5 mL) and 100 mM TEAB (1 x 5 mL). The beads were pelleted by centrifugation at 1,300 x g for 3 min between washes. The washed beads were resuspended in 6 M urea (500 pL) in 100 mM TEAB and were treated with TCEP (10 mM) at 65 °C for 15 min. lodoacetamide (20 mM final) was then added to the mixture and the beads were further incubated at 37 °C for 30 mins. The beads were collected by centrifugation and treated with a pre- mixed solution of 2 M urea in TEAB (200 pL), 100 mM CaCE (2 pL) and trypsin (4 pL of 20 pg reconstituted in 40 pL of 100 mM TEAB) at 37 °C for 12 h. The digested peptides were separated from the beads by centrifugation and the beads were washed twice with 100 mM TEAB (50 pL). For the DMSO and probe treated samples, 4 pL of 20% HCHO (light formaldehyde) and 20% D13CDO (heavy formaldehyde) were added respectively. 20 pL of 0.6 M sodium cyanoborohydride (for light samples) and 20 pL of 0.6 M sodium cyanoborodeuteride (for heavy labeled samples) were added to the samples and left to incubate for 2 h at room temperature. The samples were cooled on ice and the reaction quenched with 4 pL of 20% ammonium hydroxide. 8 pL of formic acid was then added to the samples. All samples were mixed and desalted using Pierce Cl 8 spin columns following the manufacturer’s protocol. The desalted samples were dried under vacuum and stored at -20 °C for proteomic analysis. All experiments were performed in triplicate.
[0482] Cell viability assays.
[0483] The cellular toxicity of compounds was assessed using the MTT assay. Briefly, THP1 Dual cells were counted in a cell counter to obtain a cell density of 1 x 106cells / mL of test media (RPMI 1640 without phenol indicator). The cells were plated (200 pL) in 96-well plates. Compounds were dosed at a final concentration of 40, 20, 10, 5, 2.5, 1, 0.5, 0.25, 0.01, and 0.05 pM (1% DMSO) and incubated at 37 °C for 24 h. CyQUANT MTT Cell Proliferation kit (ThermoFisher) was used to carry out the MTT assay. After 24 h, the plates were centrifuged to pellet the cells and the media was removed. Fresh media (100 pL) was added to each well followed by 10 pL of 12 mM MTT reagent provided in the kit. The cells were incubated again at 37 °C for 2-3 h. All media except 25 pL of media was removed after pelleting the cells using a centrifuge. DMSO (100 pL) was then added to each well and mixed well by pipetting cells up and down. The plates were again incubated for 0.5 h and the plates were then read in a plate reader by measuring absorbance at 540 nm. The percentage of viable cells was calculated using the DMSO only control. Compounds were dosed in triplicate.
[0484] PAD inhibition experiments.
[0485] The ability of LB244 to inhibit PADs 1, 2, 3, and 4 was determined as previously described. Briefly, PADs (0.2 pM) were incubated at 37° C in reaction buffer (100 mM Tris pH 7.6, 50 mM NaCl, 2 mM DTT, and LB244) and aliquots were collected at set time points (0, 2, 4, 6, 10, 15 minutes) and further incubated at 37° C with BAEE (1 mM) for 15 minutes followed by flash freezing. Citrulline production was determined using the COLDER assay as previously described. Experiments were performed in duplicates.
[0486] Absorbance was measured at 595 nm and the rates of inactivation were determined by fitting the fractional activity to following equation: v = voe -Kkit
[0487] When the plots showed curvature, the observed rate (kObs) of inactivation from these plots was then fit to the following equation: kobs=kiiiact [I] / (7 i+[I] When the linear plots resulted the data were fit to: kobs—kinact [ i]
[0488] Stability studies.
[0489] Inhibitors (100 pM) prepared in PBS were incubated in the presence and absence of DTT (1 mM) in a final volume of 100 pL. The samples were incubated at 37 °C for 0, 0.5, 1, 2, and 4 hours while rotating. After incubating, the samples were flash frozen in liquid nitrogen and kept in -80 °C freezer until analysis. Samples were thawed and run on the LCMS ('HiCTACN + 0.1% formic acid gradient) and the reduction in the starting material analyzed.
[0490] Hepatic microsomal stability.
[0491] Microsome stability was evaluated by incubating 1 pM test compound with 1 mg / mL hepatic microsomes in 100 mM potassium phosphate buffer. pH 7.4. The reaction was initiated by adding NADPH (1 mM final concentration). Aliquots were removed at 0, 5, 10, 20, 40, and 60 minutes and added to acetonitrile (5X v:v) to stop the reaction and precipitate the protein. NADPH dependence of the reaction was evaluated with -NADPH samples. At the end of the assay, the samples were centrifuged through a Millipore Multiscreen Solvinter 0.45 micron low binding PTFE hydrophilic filter plate and analyzed by LC-MS / MS. Data was log transformed and represented as half-life and intrinsic clearance.
[0492] Site directed mutagenesis. The pUNOl-hSTING vector was used as a template to generate the various Cysteine mutants (C12S, C29S, C64S, C88S, C91S, C148A, C206S, C257A, C292A, C309A). Primers used for this site directed mutagenesis are listed in Table S4. PCR reactions were performed under standard conditions using the respective forward and reverse primers using iProof High-Fidelity DNA Polymerase (BioRad) kit according to the manufacturers protocol. The PCR product was incubated with 10 units of Dpnl for 2 h at 37 °C followed by transformation into chemically competent E. coli XL1- Blue cells. Single colonies were picked and grown overnight in low salt LB (pH = 8.0) media with 100 pg / mL Blasticidin. The desired mutations were confirmed by DNA sequencing of the entire gene.
[0493] Inhibition of STING signaling in BMDMs. Wild type BMDMs were pretreated with LB244 (1 pM), or DMSO as a control, and then STING signaling induced by the addition of diABZI (500 nM). Total RNA was extracted from cells and 1 pg of RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio Rad). 5 ng of cDNA was then subjected to qPCR analysis using iQ SYBR Green super-mix reagent (Bio Rad). Gene expression levels were normalized to HPRT. Relative mRNA expression was calculated by a change in cycling threshold method as 2"ddC(t). Specificity of RT-qPCR amplification was assessed by melting curve analysis. The sequences of primers used in this study are listed in Table E3. For western blotting, cells were lysed directly in IX Lamelli sample buffer containing phosphatase inhibitor cocktail (Tocris). Anti-p-IRF3, anti-p-TBKl and anti-STING antibodies were from Cell Signaling. For native gel analysis of STING oligomerization, cells were lysed in NP-40 lysis buffer (50 mM Tris-HCl, pH 7.4, containing 150 mM NaCl, 0.5% (w / v) IgePal, 50 mM NaF, 1 mM Nm VO4, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail (Thermo Fisher Scientific).
[0494] Table E3. Primer sequences
[0495] Primer Sequence
[0496] Murine TFN-R F
[0497] AcAA TA Af ATAAGCAGCTCCAGCTCCAA
[0498] IL) 12)
[0499] Murine TFN-R R
[0500] AeAA TA AA CTGTCTGCTGGTGGAGTTCA
[0501] T 15)
[0502] ^AA" ™^HAACGATGATGC ACTTGCAGA
[0503] (bt / . ID 14)
[0504] GAGCATTGGAAATTGGGGTA
[0505] (SEQ. ID 15)
[0506] Mouse pharmacokinetics .
[0507] Pharmacokinetics were tested in male C57B1 / 6J mice. LB244 was formulated at 1 mg / ml in 5%DMSO / 5%Tween80 / 90% saline and dosed in three mice at 10 mg / kg by oral gavage. For intraperitoneal injection, LB244 was formulated in 20% DMSO / 80%PBS and dosed in three mice at 5 mg / kg. Micro-sampling blood collection strategies were used with 25 pl blood collected in heparin coated capillary hematocrit tubes at multiple time points (0, 5, 15, 30, 60, 120, 240, 360 and 480 minutes). Plasma was generated by standard centrifugation techniques resulting in approximately 10-15 pl of plasma which was immediately frozen. Drug levels were determined by mass spectrometry using an Sciex 6500 mass spectrometer in positive ion mode. LB244 was detected using the mass transition of parent=538.1 and fragment=341.1. Pharmacokinetic parameters were calculated using a non-compartmental model (Phoenix WinNonlin, Pharsight Inc.). All procedures are approved by the Scripps Florida IACUC and the Scripps vivarium is fully AAALAC accredited.
[0508] PBMC isolation and inhibition experiments.
[0509] Studies with human cells were conducted with approval from the Institutional Review Board of the University of Massachusetts Chan Medical School. Primary human peripheral blood mononuclear cells (PBMCs) were isolated from de-identified concentrated leukoreduction system (LRS) chambers purchased from Rhode Island Blood Center as previously described. Briefly, concentrated blood was diluted 1:1 in sterile PBS and layered over Lymphoprep (15 mL, Stem Cell Technologies #07801) in a Leucosep tube (VWR #89048-938). Blood was spun at 2000 rpm for 25 min. The interphase was transferred to a fresh tube and washed once in PBS. Cells were lysed in red blood cell lysis buffer (Sigma #R7757) and washed twice more to obtain PBMCs. CD14 positive monocytes were further isolated from PBMCs by magnetic cell separation (MACS) using CD14 microbeads (Miltenyi #130-050-201) according to the manufacturer’s recommendations. After counting, primary monocytes were used within 16 h of isolation and cultured in complete RPMI 1640 supplemented with 10% heat- inactivated fetal bovine serum and Pen-Strep (100 U / mL-100 pg / mL). For cytokine analysis experiments, monocytes were plated in 96-well round bottom plates at a concentration of 3x 106cells / mL, allowed to rest for at least 1 h, then pretreated with indicated inhibitors or vehicle only (DMSO) at 10, 5, 2.5, and 1 .25 uM for 1 h. Next, cells were stimulated with 200 nM diABZI for 4 h and supernatants were collected and frozen for cytokine analysis.
[0510] Cytokine Analysis.
[0511] Supernatants or serum was collected as indicated. Mouse IFNp, CXCL10, IL-6 were quantified by sandwich ELISA (R&D Systems #DY8234, # DY466, #DY406) according to the manufacturer’s recommendations. For human cells, cytokine analysis was performed using the Human IFN-beta DuoSet ELISA (R&D #DY814) kit according to the manufacturer’s recommendations and read using a SpectraMax iD5 microplate reader. diABZI treatment in vivo.
[0512] C57 / B16 mice were purchased from lackson Labs and bred inhouse. Animal were kept in a pathogen free (SPF) environment. Sample sizes used are in line with other similar published studies. All protocols used in this study were approved by the Institutional Animal Care and Use Committee at the UMass Chan Medical School (protocols Fitzgerald 202200019). 8-12-week-old male and female C57 / B16 mice were pretreated with LB244 (5 mg / kg i.p.) dissolved in 20% DMSO (v / v final volume) in PBS for 2 h followed by administration of diABZI (0.5 mg / kg) for 3 h. The vehicle control represents an equal volume of 20% DMSO in PBS. Mice were sacrificed, and serum was collected for cytokine analysis.
[0513] Statistical analysis.
[0514] For comparisons of two groups two-tailed students’t test was performed. Multiple comparison analysis was performed using two-way ANOVA. Mantel-Cox were used for survival analysis. Three to ten mice were used per experiment, sufficient to calculate statistical significance, and in line with similar studies published in the literature.
[0515] Example 16. Endothelial Cell Expression of a STING Gain-of-functioa Mutation Initiates Pulmonary Lymphocytic Infiltration.
[0516] Summary Patients afflicted with STING gain-of-function mutations frequently present with debilitating interstitial lung disease (ILD) that is recapitulated in mice expressing the STINGI54Mmutation (VM). Prior radiation chimera studies revealed an unexpected and critical role for non-hematopoietic cells in initiating ILD. To identify STING-expressing non-hematopoietic cell-types required for the development of ILD, we generate a conditional knock-in (CKI) model and direct expression of the VM allele to hematopoietic cells, fibroblasts, epithelial cells, or endothelial cells. Only endothelial cell-targeted VM expression results in enhanced recruitment of immune cells to the lung associated with elevated chemokine expression and the formation of bronchus-associated lymphoid tissue, as seen in the parental VM strain. These findings reveal the importance of endothelial cells as instigators of STING-driven lung disease and suggest that therapeutic targeting of STING inhibitors to endothelial cells could potentially mitigate inflammation in the lungs of SAVI patients or patients afflicted with other ILD-related disorders.
[0517] Introduction
[0518] The cGAS-STING pathway is a cytosolic dsDNA sensing pathway that initiates protective inflammatory responses against viruses, bacteria, and cancer. However, activation of the cGAS-STING pathway has been increasingly tied to a range of pathologic inflammatory processes across multiple organs including the gut, lung, and brain, pointing to the need to better understand how STING activation in specific cell types contributes to tissue pathology. STING is normally expressed in both hematopoietic and non-hematopoietic cells, raising the possibility that STING- regulated stromal and or parenchymal cell types play a key role in the regulation of tissue-specific inflammatory outcomes. In fact, in models of vaccination and cancer immunotherapy, cGAS-STING-expressing non-hematopoietic cells have been implicated in the promotion of B cell and cytotoxic T cell responses, respectively. However, much remains unknown about the consequences of non-hematopoietic cell driven cGAS-STING pathway activation in vivo.
[0519] Patients with constitutively active mutations in STING develop a severe autoinflammatory disease known as STING-associated vasculopathy with onset in infancy (SAVI), which presents as a highly penetrant and often lethal interstitial lung disease (ILD) strongly associated with the development of cutaneous vascular endothelial pathology. Mice heterozygous for SAVI STING mutations such as V154M (VM) similarly develop severe ILD characterized by bronchus-associated lymphoid tissue (BALT) formation. Severe ILD in VM mice requires lymphocytes, particularly IFNy-producing T cells. However, VM in hematopoietic cells is not required for BALT formation. Instead, VM in yet unidentified non-hematopoietic radioresistant cells was sufficient to initiate the activation and recruitment of lymphocytes to the lung.
[0520] Presumably, the non-hematopoietic cells that drive VM ILD normally express STING, even in the absence of the VM mutation. Importantly, STING is prominently expressed by endothelial cells, epithelium, and fibroblasts. Activation of the cGAS- STING pathway in these non-hematopoietic cells occurs in the context of various infectious and sterile inflammatory pathologies. In severe Sars-CoV-2, activation of cGAS-STING in epithelial and endothelial cells promotes macrophage-driven immune pathology and in TNFa-induced peritonitis, STING expressing endothelial cells promote the recruitment of T lymphocytes by enhancing trans -endothelial migration. Moreover, STING activation in fibroblasts has been implicated in lung fibrosis. These studies identify numerous mechanisms through which STING activation in non- hematopoietic cells promotes immunopathology.
[0521] Given the evidence of prominent vasculopathy in both SAVI patients and mice, we hypothesized that VM in lung endothelial cells (LEC) would contribute to ILD pathology. For this purpose, we developed a conditional knock-in (CKI) mouse model wherein the expression of the VM mutation is dependent on the activity of Cre recombinase but remains under the control of the endogenous STING promoter. We now' show that targeted expression of VM in endothelial cells leads to the induction of chemokines and is sufficient to initiate BALT formation. However, ubiquitous targeting of the VM mutation further exacerbates inflammation and organization of immune aggregates within lung tissues. These findings underscore the unique and critical role played by STING in endothelial cells, where it initiates BALT formation through the recruitment of immune cells and demonstrate that VM in additional cell types likely further amplifies VM ILD. Materials and Methods
[0522] Mouse strains. Rosa26-stop-cYFP (R26YFP), CMV-Crc, CAGG-CrcER™, Nkx2.1 -Cre, Tie2-Cre, Rorc-Cre, and LysM-Cre were obtained from the Jackson Laboratory. PDGFRa-Cre mice were kindly provided by Dr. Jae-Hyuck Shim (UMass Chan Medical School, Worcester MA). Cdh5-CreERT“ mice were kindly provided by Dr. Chinmay M. Trivedi (UMass Chan Medical School, Worcester MA). STING KO mice fully backcrossed to C57BL / 6 background were kindly provided by Dr. Dan Stetson (University of Washington, Seattle, WA). The parental VM STI GV’54M / WI) mice have been described previously. Purchased and received mice were allowed to acclimate to the University of Massachusetts Chan Medical School housing facility for at least one week prior to breeding. In all experiments, mice were age- and sex- matched within experimental groups. We have not seen a gender bias from our previous studies so both sexes were included in our current study. Specific ages of mice are indicated in figure legends. All experimental procedures were approved by the institutional animal care and use committee at the University of Massachusetts Chan Medical School (IACUC 202100109, IACUC 202200019).
[0523] The conditional V154M knock-in line (CKI) was made in by the Transgenic and Gene Targeting facility, in the Department of Immunology at the University of Pittsburgh, using a strategy described previously. These mice utilize a gene trap, consisting of a pair of LoxP sites flanking the adenovirus major late transcript splice acceptor followed by stop codons in each of the three reading frames. Similar to other gene trap alleles, the VM allele should be null in the absence of Cre recombinase since the splice acceptor cassette creates aberrantly spliced isoforms with premature stop codons that are likely to lead to nonsense-mediated mRNA decay. To generate these mice, a STOP / flox construct was inserted between exon 4 and exon 5 of the endogenous VM STING locus. Two single guide RN were used, the SA VI-129forw target sequence (5’-gtgtggagctatgaaggctt-3’; SEQ. ID 36) is in the intron upstream of the exon encoding STING-V154, the SA VI-315 forw target sequence (5’- gttaaatgttgcccacggge-3’; SEQ. ID 37) overlap V154. The single guide RNAs were synthesized as previously described. A long single stranded oligonucleotide (synthesized by Integrated DNA Technologies) was used as donor template. Briefly, fertilized embryos (C57BL / 6J, The Jackson Laboratory) produced by natural mating, were micro injected, in the pronuclci, with a mixture of 0.33 pM EnGcn Cas9 protein (New England Biolabs. Cat. No. M0646T), two Cas9 guides RNA: SAVI-129for and SAVI-315forw (21.23 ng / pl each) and the long single stranded oligonucleotides SAVI- V154M-ssODN (10 ng / jul). The injected zygotes were cultured overnight, the next day the embryos that developed to the 2-cell stage were transferred to the oviducts of pseudo pregnant CD1 female surrogates. Potential founder mice were genotyped by PCR and diagnostic restriction digestion of the PCR product, proper targeting was confirmed by Sanger sequencing. PCR with primers (previously described) that span a region from Exon 4 to Exon 5 produce fragments of 595, 774 and 636 bp for the wildtype, targeted and recombined alleles, respectively. The primers sequences are 5’- GGTCCTCTATAAGTCCCTAAG-3’ (SEQ. ID 38) and 5’- GGTCACCCTCAAATAAATAGG-3’ (SEQ. ID 39). This strategy was adopted because of the simple and compact design using a long single stranded oligonucleotide as efficient donors for both insertion and gene replacement. A similar targeting strategy has also been successfully used to conditionally express a pathogen mutation in Pacsl. The makeup of the long single stranded oligonucleotide is illustrated in FIG.
[0524] The sequence of the long single stranded oligonucleotide is as follows. LoxP site are in bold, the adenovirus major late transcript splice acceptor is underlined, exon 5 is in italics; and substitutions (bold and capital) for V154M mutation, a silent mutation creating a Ncol site and silent substitution to inactivate the SAVI-315forw target sequence’s protospacer adjacent motif. 5’- gctcagtgctgagactcagactaatttaaaggttggagacctgggtgtggagctatgaaggcttctcgagataactcgtata gca tacatta tacgaagtlaltagggcgcagtagtccagggttccitgatgatgtcatacttatcctgtcccttttttttccaca gctcgcggttgaggacaaactcttcgcggtcttccagtataacttcgtatagcatacatiatacgaagttatgggatgatg ggtttaatagcagtgctgagagcaagctggcagcaggttgggaaagttltctgcaagagaagggctttggacatcccccttg a.aagtccctcaggcccU.ctgctgtcttcagagcllgaciccageggaag}ctclgcagtclglgaagaaaagaagttaaat AlGgccca gggctTgcctggtcataciacattgggtacttgcggttgatcttaccaggtagggca cctclggatgttgatgtgt-3’ (SEQ, ID 40). Homozygous founder CKI male mouse were generated and the KI allele was backcrossed to wild-type animals for 4 generations. To prevent possible germline transmission of excised floxed cassettes in our CKI and R26cYFP mice, we took the following precautions: CKI mice were maintained as a true-breeding colony homozygous for the STING CKI allele. CKI x R26eYFP mice were generated by baekerossing CKI mice with R26eYFP mice until STING CKI homozygous R26eYFP homozygous mice were generated and maintained as true- breeding colony. We then crossed these CKI and CKI x R26eYFP true breeding mice with mice heterozygous for our various Cre lines indicated above. The progeny from these crosses generated our experimental mice (either STING CKI / WT x Cre / WT or STING CKI / WT x R26eYFP / WT x Cre / WT) alongside littermate controls which did not carry the allele for Cre expression (either STING CKI / WT x WT / WT or STING CKI / WT x R26eYFP / WT x WTAVT.
[0525] In vivo tamoxifen administration. To induce the expression of Cre in mice carrying CAGG-CreER ,Mand Cdh5-CreERnalleles, neonates were treated with 2.5 ul of tamoxifen (Sigma Aldrich, 20ug / ul) dissolved in corn oil P0-P2.
[0526] Differentiation of bone marrow-derived macrophages with 4-OHT. Femurs and tibias were isolated from STINGCKL'WTand STINGCKIx CAGG-CreER™ mice. Bones were flushed with DM EM then centrifuged at 1500 rpm for 5 min. Red blood cells were lysed with RBC lysis buffer (Sigma) then cells were centrifuged, filtered through 70-micron mesh filter, and resuspended in complete DMEM culture medium containing 20% (v / v) conditioned medium of L929 mouse fibroblasts cultured for 7 days at 37°C in a humidified atmosphere of 5% CO2. Cells were split at day 4 and assessed at days 4 and 7.
[0527] To induce the expression of Cre in mice carrying CAGG-CreERiMand Cdh5- CreERE2alleles, BMDMs were grown in complete culture medium supplemented with 4-OHT (Sigma) at 2uM / mL throughout differentiation. At d7, BMDMs were sorted as YFP+and YFP" by the Flow Cytometry Core Facility (University of Massachusetts Medical School) using the Ilu Aria Fusion cell sorter. DNA extracts were generated as described below for lung endothelial cells and PCR was performed as described below.
[0528] Antibodies. All antibodies were purchased from BioLegend, ThermoFisher, Tonbio Biosciences, eBioscience, and EMD Millipore, All cells were stained for viability with Ghost Violet510 (Tonbo). Note that all unique antibodies used in this study are listed in this section and one or more or the same antibodies may have been used to stain different cell types. To identify pan-immune markers (FIG. 29F-29G, FIG. 31C-31D, FIG. 32A-32D, FIG. 32G-32I, FIG. 3.3D, FIG. 34B), the following antibodies were used: IgD PB (ll-26c.2a), PD-1 BV421 (29F.1A12), CD 11c BV570 (N418), CD45.2 BUV8O5 (104), CXCR5 BV711 (L138D7), CD86 BV785 (GL-1), Ly6G FITC (1A8), CD8a PerCP-Cy5.5 (53-6.7), CDllb SparkUV387 (MI / 70), CD3 PE (17A2), CXCR3 PE-Dazzle594 (CXCR3-173), CD69 PE-Cy5 (H1.2F3), CD44 BV605 (1M7), Ly6C APC (HK1.4), CD4 SparkNIR685 (GK1.5), MHCII AF700 (M5 / 114.15.2), CD62L APC-eFluor780 (MEL-14), B220 APC-Fire810 (RA3-6B2). To identify B cells (FIG. 34A), the following antibodies were used: CD138 BV421 (281- 2), MHCII PB (M5 / 114.15.2), Fas BV605 (SA367H8), CD21 BV711 (4E3), GL7 FITC (GL7), CD11c SparkBlue550 (N418), CD45.2 PerCP-Cy5.5 (104), IgM PE (11 / 41), CD23 PE-Cy7 (B3B4), AA4.1 APC (AA4.1), IgD AF700 ( 1 l-26c.2a), CD 19 APC-Cy7 (6D5). To identify T cells (FIG. 33E, FIG. 34 ), the following antibodies were used: TCR0 BUV737 (H57-597), CD45 BUV805 (30-F11), CD 127 BV421 (A7R34), Tirn3 BV785 (RMT3-23), CD4 AF700 (RM4-5). To identify bone marrow- derived macrophages, the following antibodies were used: CDl lb BUV8O5 (MI / 70), CDl lc F4 / 80 BV421 (BM8), CD45 PB (30-F11), MHCII APC-Cy7 (M5 / 114.15.2). To identify non-hematopoietic cells (FIG. 29C, FIG. 31A, FIG. 33A, FIG. 34C-34D): CD8a SparkUV387 (53-6.7), MHCII BUV563 (M5 / 114.15.2), CD140a BV421 (APA5), CD4 Spark Violet423 (RM4-5), ICAM1 BV711 (YN1 / 1.7.4), CD45.2 BV750 (104), IgM PerCP-Cy5.5 (RMM-1), GP38 PE (8.1.1), CD31 PE-Dazzle594 (MEC 1 .3), CD104 PE-Cy7 (346-1 I A;. CDl lc PE-Fire810 (N418), EPCAM APC (G8.8), CD 19 SparkNIR685 (6D5), MHCI AF700 (AF6-88.5.3), CD24 APC-Cy7 (MI / 69), F4 / 80 APC-Fire810 (BM8), ICAM2 FITC (3C4, MIC2 / 4), Teri 19 PerCP- Cy5.5 (TER-119), VCAM-1 PE-Cy7 (429, MVCAM.A).
[0529] Genotyping. Mice were genotyped using a combination of in-house genotyping PCRs performed on ear-clip DNA isolated from mice during weaning and custom probe-based genotyping performed by Transnetyx using real-time PCR to delect the STING V154M mutation, and the floxed STING CK1 insert. Genotyping PCRs were performed on STING CKI mice using the forward and reverse primers listed in the key resources table (mSAVI PNAS F, mSAVI PNAS R). The wildtype allele generates a 595bp fragment, the KI allele generates a 774 bp fragment, and the deleted allele generates a 636 bp fragment.
[0530] In vivo diABZI treatment. Mice were anesthetized with isoflurane and injected intravenously with diABZI (Cayman Chemical) at 0.5 mg / kg for 1 hr prior to sacrifice.
[0531] In vivo intravascular labeling. Circulating immune cells were identified as previously described. In brief, mice were injected intravenously with 3 pg of anti- CD45 BV650 (BioLegend) and euthanized 3 minutes later. Lungs were collected without subsequent perfusion and digested as described below.
[0532] Lung digestion. To assess immune cells and endothelia from the lung, the left lobe of lung was digested using a GentleMACS lung digestion kit (Miltenyi). In brief, lung was intratracheally inflated with 1ml of GentleMACS lung digestion digestion buffer. Lungs were then incubated at 37°C and dissociated using the GentleM ACS Octo Dissociator with Heaters (Miltenyi). Cells were then filtered through a 70-micron mesh filter, spun down at 300xg for 10 minutes, and treated with RBC lysis buffer (Sigma) before subsequent assessments.
[0533] To isolate lung endothelial, epithelial, and fibroblast populations, lungs were processed and digested as previously described. In brief, mice were perfused with ice- cold 2% Hanks’ Balanced Salt Solution (HBSS) and whole lung was intratracheally washed 3X with 5 pM EDTA in DPBS. Lungs were then intratracheally instilled with digestion buffer containing 4.5Units / ml of Elastase (Worthington) and lOug / ml DNase I (Sigma) in R PM II 640 media. Laings were digested in a petri dish for 1 hr at 37°C on a shaking platform at 200rpm, minced with a razor plate, digested for an additional 20 minutes, filtered through a 70-micron mesh filter, and pelleted by centrifugation at 300 x g for 10 minutes.
[0534] To isolate endothelial and stromal cells for RNA, DNA, and protein, we performed a collagenase I (ThermoFisher) digestion method. Briefly, lungs were collected in isolation media (DMEM, 20% FCS, 1% Pen- Strep) then transferred to 60mm petri dishes. Lung lobes were separated then minced 100X using sterile scissors. 8mL of lung digestion buffer (3 mg / mL collagenase I in DMEM) was added and the tissue was incubated at 37 °C for 45 min, with swirling every 15 minutes. Tissue suspensions were passed through a 20G needle and lOmL syringe about 10X. Cells were passed through a 70-micron mesh filter pre-placed with 4mL of isolation buffer, then washed with another 4mL of isolation buffer. Cells were centrifuged at 1200 rpm for 8 minutes at 4°C.
[0535] Spleen processing for flow cytometry. Spleens were dissected from euthanized mice and collected into 2% HBSS. Tissue was macerated between two microscope slides. Spleen suspensions were centrifuged al 1250 rpm for 5 min, RBC lysed (Sigma), centrifuged again, and resuspended in 2% HBSS.
[0536] Flow cytometry. Cells were incubated in CD16 / 32 (Bio X Cell ) and stained with antibodies as listed above for 25 min at room temperature in the dark. Cells were washed twice with 3% FACS buffer (3% FCS in PBS). Samples were fixed using Fluorofix buffer (BioLegend) for 30 min at room temperature in the dark and then washed twice with 3% FACS. Intracellular staining was performed for 30 rain at 4°C using the Cytofix / Cytoperm Fixation / Permeabilization kit (BD). Absolute cell counts were determined using precision counting beads (Bio Legend). Cells were acquired on a 5-laser Aurora Cytek Cytometer (University of Massachusetts Chan Medical School) and analyzed with FlowJo software. All analyses include gating on singlets and live cells prior to subsequent identification of specific cell populations, unless otherwise stated.
[0537] Histology. Lungs were dissected, inflated intratra ch eally with 10% phosphate buffered formalin (PBF, Fisher) via a flexible catheter, fixed in 10% PBF at room temperature for 48 hrs, and transferred into 70% EtOH. Lungs were then paraffin embedded, sectioned, and then stained with H&E by Applied Pathology Systems (Shrewsbury, MA). Whole H&E lung slides were scanned at 4X using an EVOS FL Auto microscope or an EVOS M7000 microscope housed in the Bone Analysis Core (University of Massachusetts Chan Medical School, Worcester, MA).
[0538] Immunofluorescence. Lung sections were generated from formalin-fixed paraffin embedded (FFPE) lungs. For FFPE sections, 7 -micron thick sections were prepared from FFPE blocks by the University of Massachusetts Chan Medical School Morphology Core. Slides with tissue sections were deparaffinized using xylene (Fisher) and antigen retrieval was performed with lOmM Na Citrate (Sigma) 0.05% Tween 20 (ThermoFisher) in a pressure cooker for 15 minutes, FFPE sections were then permeabi Sized in 0.3%- TritonX-100 (Sigma), blocked in 10% donkey sera, incubated with primary antibody overnight at 4°C. T cells were stained with anti-CD3 (abeam), endothelium was stained with anti-LYVEl (RND), B cells were stained with anti-B220 (BioLegend), lymphatic endothelium and type- 1 alveolar epithelium were stained with anti-podoplanin (BioLegend), myeloid cells were stained with anti-CDl lb (abeam), myofibroblasts were stained with anti-smooth muscle actin (abeam), and immune adhesion was stained by and- VC AM- 1 (abeam). Slides were incubated with the following secondary antibodies for 1 hr at room temperature: Donkey anti-Rat IgG AF 488 Plus (ThermoFisher), Donkey anti-Goat IgG AF555 (ThermoFisher), Streptavidin AF647 (ThermoFisher). Slides were mounted with Pro-Long Gold AntiFade Mountant with DAPI (ThermoFisher) or stained with a lug / ml solution of DAPI (ThermoFisher) and then mounted with Prolong Gold Diamond Anti-Fade Mountant (ThermoFisher). Microscopy was captured on a Leica SP8 confocal fluorescence microscope or a Leica Thunder widefield fluorescence microscopy at 63X with oil drop immersion, and then analyzed in the Leica. Application Suite X v3.7.3.23245.
[0539] Magnetic bead selection of king stroma and endothelial cells. Lungs -were digested using collagenase I as described above. For CD31* endothelial cell purifications, cells were incubated in CD 16 / 32 (Bio X Cell) made with IMAG buffer (BD) for 15 min on ice, then stained with CD31-biotinyIated antibody (BioLegend) at 1:200 for 30 min on ice. Cells were washed twice with IMAG buffer, centrifuged at 1200 rpm for 5 rain at 4°C. Cells were then incubated with IMAG Streptavidin Particles Plus (BD) for 45 min on ice, in the dark, gently swirled every 15 min. 3 mL of IMAG buffer was added to the cells containing streptavidin particles, then placed on IMAG cell separation magnet. (BD) for 30 min. Cells were washed 3X with I G buffer and reconstituted in PBS after the final wash. 50uL of 50mM NaOH was added to cell pellets for DNA extraction. The same PCR genotyping protocol described above was performed.
[0540] To obtain Teri 19’ CD45" lung stromal cells, cells were resuspended in 90 uL of MACS buffer (PBS, 2% FCS, 2mM EDTA) per 10' cells. 30 uL of anti-Ter! 19 microbeads (Miltenyi) were added per IO7cells and incubated for 15 min at. 4°C. Cells were washed with MACS and resuspended in 500 uL of MACS per 108cells and loaded onto LS columns (Miltenyi) topped with 30-micron mesh pre-separation filters (Miltenyi). Cells were washed 3X with 3 mLs of MACS buffer each time. Immediately after Teri 19 selection, eluted cells (Ter i 19') were counted and resuspended in 90uL of MACS buffer per 10' cells with 30 uL of CD45 microbeads (Miltenyi) per 10'' cells and the same protocol used for Teri 19 selection was followed. Eluted cells are doublenegative for Teri 19 and CD45.
[0541] Western blot. CD31+ lung endothelial cells were isolated as described above and lysed with 4X Lamelli sample buffer (Bio-Rad), denatured at 95°C for 15 min, and centrifuged at 17,000xg for 5 minutes. Lysates from 5 x 105cells were loaded into wells of 10% poly-acrylamide gels. SDS-PAGE was then performed at 120V for 1.5 hrs. Protein was then transferred onto a nitrocellulose membrane using a semi-dry transfer method run at 110mA for 105 minutes. Membranes were then blocked with 5% BSA in 0.1% TBS-Tween20. Membranes were stained with the following primary antibodies at 1: 1000: STING (CST), pSTATl (CST), STAT1 (CST), pIRF3 (CST), IRF3 (CST). p-actin was stained at 1 :10,000 (Bio-Rad). Blots were developed with the following secondary antibodies at 1:20,000: Goat-anti Rabbit and goat anti-mouse (LI- COR Biosciences). Membranes were imaged using a LI-COR Odyssey Imager and analyzed in Image Studio Lite V5.2.
[0542] Multiplex ELISA, Cytokine levels in mouse sera were measured by multiplex protein analysis by EVETechnologies using their Mouse Cytokine Proinflammatory Focused 10-plex Discovery Assay Array (MDF10).
[0543] RNA-Seq. Teri 19' CD45’ cells were isolated from lung digests as described above. RNA was extracted using miRNeasy Micro Kit (Qiagen). mRNA was prepared using the Illumina Stranded mRNA Prep kit which includes indexes (Illumina). Libraries were shipped to Novogene for sequencing. cDNA reads were processed using an RNAseq pipeline (DolphinNext / ViaFoundry) to align and quantify mRNA transcripts as expected counts (RSEM). Differentially gene analysis and quality control were performed in DEBrowser. Principal component analysis was performed on the top 1000 most variable genes with >10 transcript counts. Differentially expressed genes were identified by DESeq2 and filtered for padj<O.O5 and fold change >2. Volcano plots were generated using MRN normalized expression data. Gene ontology enrichment for biologic processes was performed on differentially expressed genes using g:Profiler as an ordered multi-query with a threshold of padj<O.O5 and a term size limited to between 5-200 genes, Gene set enrichment analysis for GO:BP signatures (https: / / www.gsea-msigdb.Org / gsea / msigdb / mouse / genesets.jsp7collection-GO:BP) was performed on MRN-normalized expression data in GSEA v4.3.3 with mouse MSigDB with 1000 gene set permutations, weighted statistical enrichment, and genes ranked by Signal2Noise. Dot plots were generated in R using ggplot2 and heatmaps with ComplexHeatmap. LogiFC was calculated in heatmaps after adding 0.01 to a table of MRN normalized expected counts to make all values non-zero.
[0544] Quantification and statistical analysis. / Ml bar graphs depict mean as a measure of centrality and standard deviation as measure of dispersion. Since we were unable to confirm that our data was normally distributed, we used non-parametric tests for all statistical analyses with n<15. For single comparisons, Mann-Whitney tests were performed. For one-way ANOVA, the Kruskal -Wallis test with Dunn’s multiple corrections was used. For multiple comparisons testing, multiple-Mann- Whitney test with FDR adjustment by two-stage step-up method of Benjamini, Krieger and Yekutieli was used. Parametric T tests and one-way ANOVA were used when our sample was greater than 15 in all groups compared. For our multiplex ELISA data, samples that were statistical outliers in >1 analyte measured as determined by a ROUT-test (Q-1%) were removed from our analysis. All experiments represent at least 2 independent replicates unless otherwise stated. All statistical tests were performed in GraphPad Prism vl0.0.3. (ns: not significant p>0.05, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).
[0545] Results
[0546] Ubiquitous targeting of Cre recombinase-induced VM expression recapitulates SA VI ILD. To assess the impact of the VM SAVI mutation on specific cell types, we created a conditional knock-in (CKI) model dependent on a modified gene trap strategy. The gene trap cassette was inserted into the intron preceding exon 5 of the endogenous STING locus (FIG. 29A). The VM mutation was simultaneously introduced into exon 5. As in other gene trap alleles, the VM allele should be null in the absence of Cre recombinase. Heterozygous mice carrying the CKI allele still express one WT STING allele, and following Cre expression, deletion of the gene trap should restore normal splicing and expression of the VM allele. In the studies reported below, unless otherwise indicated, all mice that inherited the CKI allele also inherited and expressed one WT STING allele, similar to the original VM strain.
[0547] PCR amplification of CKI tail DNA using primers flanking the gene trap cassette insertion site (FIG. 29A) identified a 774bp amplification product consistent with the presence of the insert (FIG. 29B). Intracytoplasmic flow cytometry further confirmed the loss of STING expression in mice that only expressed the CKI allele (STINGCK1 / KO) (FIG. 29C), To demonstrate that mice inheriting the CKI allele can develop lung disease, we crossed CKI mice to CMV-Cre mice to drive ubiquitous Cre expression. Excision of the gene trap cassette in CKI x CMV-Cre offspring resulted in a 636bp amplification product (FIG. 29B), Furthermore, CKI x CMV-Cre mice developed prominent peri-broncho-vascular immune infiltrates (FIG. 29D) rich in CD3+and B220+lymphocytes (FIG. 29E), not observed in CKI littermate controls and similar to the original VM mice. To distinguish lung-infiltrating cells, mice were injected intravenously (i.v.) with a fluorophore-conjugated CD45 antibody, 3 minutes prior to euthanasia, staining the intravascular (IV) CD45* cells but leaving the extravascular (EV) CD45+cells unstained. These studies showed that CKI x CMV-Cre mice had a significant increase in the number of EV immune cells in the lung, similar to VM mice (FIG. 29F). Additionally, lung EV T cells within CKI x CMV-Cre mice showed significant upregulation of the activation marker CD69 (FIG. 29G), consistent with our previous studies in unmanipulated VM mice. CKI x CMV-Cre mice also developed other features of systemic inflammation previously observed in VM mice, including low' body weight and splenomegaly, although these findings were more profound in VM mice (FIG. 29H). This intermediate phenotype of CKI x CMV-cre mice may reflect incomplete excision of the gene-trap cassette (FIG. 29B).
[0548] Lung stroma expresses STING. To assess the distribution of STING- expressing cells in the lung, sections from WT, VM, and STING-deficient (STING KO) mice were examined by immunofluorescent (IF) microscopy. LYVE1 is a well- known marker for lymphatic endothelium, but functions as a pan-endothelium marker in lung tissues. Podoplanin (PDPN) is expressed by lymphatic endothelium and typc-1 alveolar epithelium in the lung. A combination of LYVE1, PDPN, and tissue morphology, identified LYVE1* PDPN’ blood vascular endothelium, LYVE1*PDPN* lymphatic endothelium, and LYVEl’PDPN* T1 alveolar epithelium. STING was expressed throughout the lung of both WT and VM mice, including blood and lymphatic endothelium as well as respiratory and conducting epithelium (FIG. 30).
[0549] Tie2-cre targeted expression of STING V154M is sufficient to initiate immune recruitment to the lung. Since STING is expressed by several lineages of non-hematopoietic cells in the lung, we next asked whether VM in any of these cell types was sufficient to drive the VM ILD phenotype. We targeted lung epithelium using NKX2.1-Cre mice, fibroblasts using PDGFRa-Cre mice, and endothelium using Tie2-Cre mice. To directly measure the degree and specificity of Cre targeting in vivo, a fluorescent Cre reporter Rosa26-st / fl-eYFP (YFP) was crossed onto CKI mice. These CKI x YFP mice were subsequently crossed to the tissue specific Cre lines described above, Lungs were processed by elastase digestion to optimally capture a variety of stromal and parenchymal populations within the lung. We confirmed that Cre recombinase activity in Nkx2.1-Cre, PDGFRa-Cre, and Tie2-Cre targets epithelial, fibroblast, and endothelial cell types, respectively, in our CKI mice by determining the percentage of YFP+cells in each of these cell types (FIG. 3 LA).
[0550] In the Nkx2.1-Cre and PDGFRa-Cre mice, -80% of epithelial and fibroblasts, respectively, were YFP*. Unexpectedly, only -60% of the endothelial cells in CKI x Tie2-Cre mice were YFP*. Therefore, targeted excision of the gene trap in CKI x Tie2- Cre and CMV-Cre mice was further assessed by PCR amplification of the STING locus. CD31* lung endothelial cells (LECs) were magnetic bead-purified from lung cell suspensions obtained from CKI x Tie2-Cre and CKI x CMV-Cre mice. The gene trap was almost completely excised from the LECs and it was also removed from many of the remaining CD3L cells. Together the flow cytometry and PCR data confirm that Tie2 drives Cre expression in both LECs and hematopoietic cells, as described previously. They further show' that YFP expression underestimates the extent of gene excision in LECs, an observation confirmed in cultures of CKI YFP bonc-marrow-dcrivcd macrophages stimulated in vitro with a tamoxifen-inducible Crc.
[0551] Importantly, targeting VM expression to epithelial cells or fibroblasts in CKI x NKX2.1-Cre and CKI x PDGFRa-Cre mice, respectively, did not result in any increase in the number or fraction of infiltrating lung EV cells or any increase in the % of activated CD69* EV T cells in the spleen (FIG. 3 IB.31C). However, CKI x Tie2-Cre- directed VM expression led to an increase in the total number of EV CD45+immune cells, the total number of T cells and the % of activated CD69+T cells (FIG. 31B,31C). The flow cytometry data corresponded to the formation of histologically apparent immune aggregates (FIG. 3 I D), enriched for T and B lymphocytes (FIG. 3 IE). Additionally, CKI x Tie2-Cre mice developed significant splenomegaly and trended towards reduced body weight (p=0.1068), features not observed in the epithelial cell-targeted or fibroblast-targeted mice (FIG. 3 IF).
[0552] To confirm that. LECs were activated in CKI x Tie2-Cre mice and CKI x CMV- Cre mice, protein lysates from purified endothelial cells (in duplicate) were compared to lysates from VM mice and WT mice treated with a STING agonist diABZI for 1 hr in vivo. As showm by western blot, all cells expressed STING and the diABZI activated WT cells, VM cells and CKI x Cre-activated cells all showed increased pIRF3, pSTATl and total ST ATI consistent with a STING activation profile and subsequent cytokine induction.
[0553] Targeted expression of STING VJ.54M in myeloid and T cells is insufficient to initiate ILD. The development of lung inflammation in CKI x Tie2-Cre mice along with previous studies documenting robust development of BALT in WT” VM bone marrow chimeras pointed to a primary role for the VM mutation in non-hematopoietic radioresistant endothelial cells in initiating VM ILD. Nevertheless, since the Tie2-Cre promoter also drives Cre expression in hematopoietic cells, and VM mice exhibit aberrantly activated T cells and excessive myelopoiesis, we needed to consider the potential contribution of VM expression by hematopoietic T and myeloid cells to the phenotype of CKI x Tie2-Cre mice.
[0554] CKI x YFP mice were crossed to Rorc-Cre (RORy) mice to target VM to T cells and innate immune lymphocytes, and also crossed to LysM-Cre mice to target macrophages, monocytes, and granulocytes. To confirm the specificity of T cell and monocytc / granulocytc targeting in these mice, we assessed YFP expression in splenic immune cell populations. Consistently, CKI x Rorc-Cre led to prominent YFP expression in T cells; whereas CKI x LysM-Cre led to YFP expression in neutrophils and other myeloid cells (FIG. 32A),
[0555] To determine whether T cell-targeted or myeloid cell-targeted VM altered the peripheral immune composition, spleen cell suspensions were examined by flow cytometry. Consistent with reports of lymphocyte-intrinsic T cell lymphopenia in VM mice, we found that the number of splenic T cells was significantly reduced in CKI x Rorc-Cre mice (FIG. 32B). However, the remaining T cells did not show increased expression of the activation marker CD69, as seen in T cells from VM mice (FIG. 32C). This indicated that even though T cell-intrinsic VM promotes T cell lymphopenia, it does not promote T cell activation, thereby supporting the premise that WT T cell activation in our chimeric mice depended on non -hematopoietic radioresistant cells in the VM host. Furthermore, despite the ability of VM stem cells to gi ve rise to an expanded myeloid compartment in VM- VT chimeras, we did not find expansion of mature myeloid populations in the spleen of CKI x LysM-Cre mice (FIG. 32B,32D).
[0556] In addition to targeting T cells, Rorc-Cre also targets lyrnphotoxln inducer cells (LTi), a population of innate lymphoid cells (ILCs) critical for LN organogenesis. STING N153S SAVI mice are deficient in LTi, show' impaired LN development, and have suggested that disruption of normal lymphatic function could contribute to lung inflammation in SAVI. We confirmed that many CKI x C V-Cre and CKI x Rorc-Cre mice lacked inguinal LNs: however, CKI x RORc-Cre mice did not exhibit increased extravascular immune infiltration of the lung (FIG. 32E,32F). Similarly, CKI x LysM- Cre mice al o did not show' significant lung immune infiltration, although they did show' a modest increase in the % of EV cells (FIG. 32F). Consistently, neither CKI x Rorc-Cre nor CKI x LysM-Cre mice showed increased lung EV T cell activation markers or signs of lung EV monocyte activation (FIG. 32G.32H). Thus, targeted expression of VM to T cells and LTi or myeloid cells is insufficient to induce lung inflammation. Post-natal endothelial targeted expression of STING V154M is sufficient to initiate immune recruitment to the lung. The capacity of CKI x Tic2-Cre mice, and not CKI x Rorc-Cre or CKI x LysM-Cre mice, to develop features of VM ILD, indicated that endothelial cell intrinsic VM is sufficient for the initiation of VM lung disease. Tie2 is considered an endothelial cell promoter, however, as discussed above, constitutive Tie2-Cre expression also has off target effects and drives recombinase activity prenatally in hematopoietic cell precursors. An alternative explanation for our findings is that a combination of VM in hematopoietic and endothelial cells is required to initiate ILD in CKI x Tie2-Cre mice. To address this possibility, we crossed CKI mice to a tamoxifen-inducible endothelial-targeting Cre line, Cdh5-CreERI’ where Cre expression depends on post-natal treatment with tamoxifen and results in minimal off- target induction of Cre expression in hematopoietic cells while retaining endothelial- targeted Cre expression. However, one important consideration of using tamoxifen- inducible Cre mice is that this protocol precludes targeting outcomes that require prenatal exposure.
[0557] To determine whether post-natal expression of the VM mutation is sufficient for the development of the lung phenotype, ubiquitous tamoxifen-inducible CAGG- CreER™were crossed t0 CKI xYFP mice. CKI x CAGG-CreER™ x YFP neonates were given a total of three doses of tamoxifen from PO-2 to induce Cre expression. Lungs were assessed at 6-weeks of age and significant YFP expression was detected in CD31+ endothelial and CD45+ hematopoietic cells (FIG. 33A). These mice also developed prominent peri-broncho-vascular immune aggregates and well-organized BALT with distinct T and B cell zones (FIG. 33B.33C). Tamoxifen- treated CKI x CAGG-CreER,Mmice showed an increase in lung EV immune cells both by percentage and cell number, when compared to Tamoxifen treated CKI littermate controls (FIG. 33 D). These results indicate that post-natal expression of the VM mutation is sufficient for the development of VM ILD.
[0558] By comparison, tamoxifen-treated CKI x Cdh5-CreERI2x YFP mice only expressed YFP in CD31 + cells (FIG. 33 A). Thus, postnatal induction of an endothelial cell targeting Cre targets the endothelium and not hematopoietic cells, in contrast to prenatally expressed Tie- 2 Cre that drives expression in both endothelial cells and hematopoietic precursor cells (FIG. 33A). Importantly, tamoxifen treated CKI x Cdh5- CrcERT2mice developed lymphocyte-rich BALT as shown by histology and immunofluorescence (FIG. 33B,33C). This corresponded to an increase in the percentage and number of EV immune cells compared to tamoxifen-treated CKI controls (FIG, 33D). Nevertheless, there was significant variability in the extent of immune cell consolidation in the lungs of CKI x CDH5-CreEE f2mice, with some animals showing impressively dense infiltrates (FIG. 33B, bottom right), and others showing lightly scattered infiltrates (FIG. 33B, bottom left). In both instances, the CKI x CDH5-CreERT2BALT were less well-organized than in the corresponding CKI x CAGG-CreER1Mmice, which showed round and condensed aggregates (FIG. 33B, top right). This disorganized appearance was reflected by the distribution of B and T cells, with CKI x CDH5-CreEET2mice showing poorly demarcated T and B cell zones (FIG. 33C). Additionally, the tamoxifen-treated CKI x CAGG-CreERIMmice showed discrete aggregates of CD 11 b+ myeloid cells within the BALT, while myeloid cells did not contribute to BALT in CKI x CDH5-CreER1mice.
[0559] CKI x CAGG-CreERIMmice showed a modest increase in the fraction of CD69 positive EV T cells, although this was not statistically significant (p=0.3194); this was not the case for the CKI x CDH5 mice (FIG. 33E). Lastly, CKI x CAGG-CreER™ mice showed a significant reduction in body weight and higher spleen weight (although this did not reach statistical significance), which was not observed CKI x CDH5-CreERT2mice (FIG. 33F). Thus, we find that targeting VM to the endothelium is sufficient to initiate recruitment of immune infiltrates into lung tissue, a key feature of the VM ILD phenotype, but the resulting BALT was less well-organized and lacked myeloid cells when compared to ubiquitous targeting Cre targeting in the CKI x CAGG-CreER fMmice.
[0560] Endothelial targeted VM produces minimal elevations in serum inflammatory cytokines. VM mice show' significantly elevated serum titers of pro- inflamrnatory cytokines and in particular IL-6, TNFa, and CCL2. To determine whether endothelial-targeted or ubiquitously -targeted VM also leads to increased cytokine production, sera collected from CKI, CKI x CMV-Cre, and CKI x Tie2-Cre mice were compared to sera collected from WT and VM mice were screened by multiplex ELISA (Eve Technologies). VM mice had much higher titers of IL-6, TN Fa and CCL2 than WT littermates. The same cytokines were also elevated in the CKI x CMV-Cre, and CKI x Tie2-Cre mice. Sera were also collected from tamoxifen-treated CKI, CKI x CAGG-CreERTM, and CKI x CDH5-CreERT2mice. Here the effects were more modest due to higher baseline levels in the control group, perhaps reflecting an effect of Tamoxifen.
[0561] Lung inflammation is enhanced by non-endothelial expression of VM. To further determine to what extent VM expression in endothelial cells recapitulated the phenotype of ubiquitous VM expression, we compared the activation status of immune cells from the lungs of tamoxifen-treated CKI, CKI x CAGG-CreER1Mand CKI x CDH5-CreERT2mice. A hallmark of SA VI disease is the presence of activated T and B lymphocytes in the lungs. The CKI x CAGG-CreEK™ mice showed significantly increased expression of PD-1 in lung T cells, that was not seen in CKI x CDH5- CreERI2mice (FIG. 34A). PD-1 is a co-inhibitory receptor which is upregulated during chronic T cell mediated inflammation, thus T cell upregulation of PD-1 following ubiquitous but not endothelial specific targeting of VM expression suggests that additional factors beyond endothelial STING activation contribute to persistent activation of T cells in VM ILD. Similarly, only CKI x CAGG-CreER™ B cells expressed significantly higher le vels of the co-stimulatory marker CD86, again indicating that factors beyond endothelial VM expression promote the activation of lung T and B cells in SA VI (FIG. 34A).
[0562] Extensive infiltration of the lung by inflammatory monocytes is another distinguishing feature of VM ILD. While lung myeloid cells in CKI x CDH5-CreEKJ2mice tend to be enriched for CD1 lb+Ly6C!uinflammatory monocytes (p=0.1103), inflammatory monocytes are more significantly elevated in the lungs of CKI x CAGG- CreER1Mmice (FIG. 34B). Moreover, only CKI x CAGG-CreER™ monocytes upregulated the co-stimulalory ligand CD86 (FIG. 34B). Thus, endothelial intrinsic expression of the VM allele is insufficient for recruitment and activation of myeloid cells in the context of VM ILD.
[0563] To assess the extent of endothelial cell activation in CKI x CDH5-CreERT2and CKI x CAGG-CreERiMmice, the level of MHCII expression, as assessed by flow cytometry, was used as a surrogate for antigen presentation capacity. Levels of the inducible adhesion molecule VCAM-1 were also determined, since other molecules are known to be are upregulated during inflammation. Expression of both MHCII and VCAM-1 were elevated in lung endothelial cells from CKI x CDH5-CreERi2mice, as well as in CKI x CAGG-CreER1lung endothelium (FIG. 34C).
[0564] Fibroblasts also play important roles in immune responses, in particular, the organization and activation of recruited immune cells. For example, subsets of fibroblasts known as fibroblastic reticular cells (FRC) are found within lymphoid organs, express immune adhesion markers such as ICAM-1 and VCAM-1, and play an important role in organizing immune aggregates. Expression levels of these markers on lung fibroblasts can be considered a surrogate for stromal-mediated immune organization. Fibroblast IC.AM- 1 and VCAM-1 were both elevated in CKI x CAGG- CreER1 Mbut not CKI x Cdh5-CreERUmice (FIG. 34D). These data are consistent with the more defined immune organization seen in lung immune aggregates of CKI x CAGG-CreER1Mmice compared to CKI x CDH5-CreERI2mice (FIG. 34C). The levels of VC AM- 1 expression in endothelial cells and non-endothelial cells in these two strains was further confirmed by immunofluorescent microscopy.
[0565] Notably, staining for VCAM-1 on non-endothelial BALT stroma appeared to overlap with staining for PDPN in both CKI x CAGG-CreERl Mand VM mice, while CKI x CDH5-CreERT2showed a relative paucity for PDPN staining within non- endothelial BALT stromal cells (FIG. 34E). PDPN is expressed by fibroblastic reticular cells, which also express the myofibroblast marker smooth-muscle actin (SMA). Additional IF stains for SMA and PDPN demonstrated co-staining for PDPN and SMA throughout the BALT stroma of VM and CKI x CAGG-CreER fMbut not CKI x CDH5-CreEET2mice. Overall, the expression of VCAM-1 and SMA by PDPN+ BALT stroma suggests the presence of fibroblastic reticular cell-like mesenchymal cells within BALT result from ubiquitous expression of the VM allele in the lung, but not from endothelial-specific targeted VM. In summary, although endothelial directed VM is sufficient to recruit immune cells to the lung, VM in additional cell types further enhances T cell, myeloid, and fibroblast activation and contributes to lung inflammation in VM ILD. Endothelial directed VM shows a transcriptional signature in lung parenchyma and stroma significant for chemokine production. Lung endothelial cells from VM mice upregulate genes encoding interferon stimulated genes (ISG), chemokines, and proteins involved in antigen presentation. However, this data included changes that could be attributable to either endothelial intrinsic or extrinsic expression of VM. As now demonstrated, endothelial- specific targeting of VM (CKI x CDH5-CreER12mice) recapitulates the EV recruitment of lymphocytes into lung tissues of VM mice. Thus, we can use this model to identify immunogenic changes specifically initiated by endothelial intrinsic VM. Additionally, our RNAseq study was also limited to assessment of gene changes in lung endothelial cells. Since we now show non-endothelial BALT stroma undergoing significant changes in VM mice (FIG. 34C-34E), it becomes important to understand how endothelial vs ubiquitous targeting of VM alters gene expression within all CD45“ lung stroma and parenchymal cells.
[0566] We enriched for lung stromal and parenchymal cells b> depleting CD45+hematopoietic and Terl l9+erythrocytes from lungs. This strategy yielded a population of non-hemalopoietic derived lung cells with -60% viability, including vascular and lymphatic endothelia, fibroblasts, and epithelial cells, with minimal immune cell contamination. This enriched population of stromal and parenchymal cells was collected from WT, VM, and tamoxifen-treated CKI, CKI x CAGG-CreFRi M, and CKI x CDH5-CreEET2mice. RNA isolated from cells was evaluated by bulk RNA-seq to define the transcriptional changes in lung stromal and parenchymal cells induced by either ubiquitous or endothelial targeted VM.
[0567] PCA analysis of the 1000 most varied genes immediately demonstrated that samples clustered by genotype, with our WT and CKI negative controls clustering together and close to CKI x Cdh5-Cre samples. VM and CKI x CAGG formed distinct and separate clusters (FIG. 35A). We next identified genes differentially expressed by VM, CKI x CAGG-CreER™, and CKI x CDH5-CreERT2conditions as compared to their respective littermate controls. We used volcano plots to visualize differential gene expression and labeled genes with a padj <0.05 and a positive fold change (FC) >2 as red and negative FC<2 as blue, with all other genes labelled in gray. Additionally, to assess the quality of these differentially expressed genes, we also labelled a subset of 5 genes in green which have previously been associated with inflammatory processes in VM mice which wc will refer to as our “basic SAVI signature genes”. We sec that the largest number of differentially expressed genes were identified in the VM mice, where we find 220 upregulated and 24 downregulated genes, and CKI x CAGG- CreERIMmice, where we find 258 upregulated and 34 downre ulated genes with our basic SAVI signature genes upregulated in both. In contrast, CKI x CDH5-CrefcRl 2mice showed much fewer differentially expressed genes, identifying 28 upregulated and 7 downregulated genes; however, amongst these 28 upregulated genes, two relating to chemotaxis within the basic SAVI signature were identified as being significant (Cxcl9) or near significant (Cc / 5), suggesting that CKI x CDH5-CreERI2mice retain chemotactic aspects of the SAVI gene signature. We also assessed differentially expressed genes in our negative control conditions CKI vs WT and found very few differentially expressed genes with 30 upregulated and 16 downregulated, none of which included the basic SAVI signature genes.
[0568] We next performed a gene ontology (GO) analysis on upregulated genes in our VM, CKI x CAGG-CreER™, and CKI x CDH5-CreERT2mice, as well as a complementary gene set enrichment analysis ( GSEA ) to identify enrichments for specific biologic processes. We identified similar terms from both approaches related to several themes, including humoral antimicrobial immunity, platelet activation / coagulation, leukocyte extravasation, complement production, interferon responses, antigen presentation, chemokine and cytokine production, and immune cell responses (FIG. 35C). Overall, VM mice showed the greatest enrichment across all these themes, with CKI x CAGG-CreER1Mmice showing a similar degree of enrichment, except for a less significant enrichment for an adaptive immune response by T and B cells. In contrast, CKI x CDH5-CreERT2mice showed enrichment only in the themes of chemokine, antimicrobial responses, platelet activation, complement production, and leukocyte extravasation, indicating that CKI x CDH5-CreERT2mice have a more restricted stromal transcriptional signature of SAVI (FIG. 35C).
[0569] To understand specific genes which contributed to the terms identified within our comparisons, we further performed a GSEA leading-edge analysis to identify genes which contribute to multiple signatures. We then stratified a subset of these leading-edge genes based on their enrichment relating to specific categories: chemokines, antimicrobial, platelets, complement, leukocyte extravasation, antigen presentation, and ISG, and visualized their expression with a heatmap (FIG. 35D), We find that CKI x CDH5-CreERimice show elevation of several chemokines including Cxcl9, Ccl20, Cxcl.5, Ccl5, Ppbp, and P 4. Interestingly, VM and CKI x CAGG- CreERIMalso show upregulation of additional chemokines not seen in CKI x CDH5- CreERi2mice, including Ccll9 and Cxc!13 which are known to be expressed by fibroblasts in the lung during BALT formation. Additionally, VM, CKI x CAGG- CreER™ , and CKI x CDH5-CreERT2mice upregulate genes related to anti-microbial immunity like Pglyrpl , complement genes like C2 and C3, as well as platelet genes Gp9, Gp5, and Gplbb. Both VM and CKI x Cdh5-CreERT2mice also upregulated factors related to leukocyte extravasation including tgam, hgb2, and Ccr2, although this was diminished in CKI x CAGG-CreER fMmice.
[0570] However, CKI x CDH5-CreERT2mice show an attenuated upregulation of antigen presentation genes as compared to VM and CKI x CAGG-CreEREMmice, which affirms our FACS data showing lower MHCII expression on lung endothelial cells from CKI x CDH5-CreER12mice as compared to CKI x CAGG-CreER1Mmice (Figure 12C). Additionally, unlike VM and CKI x CAGG-CreER™ mice, CKI x CDH5-CreEK {2mice do not upregulate ISGs (FIG. 35D).
[0571] Overall, our RNAseq analysis indicates that endothelial intrinsic VM is sufficient to induce some changes in the transcriptional signature of lung parenchyma and stroma significant for the upregulation of chemokines, anti-microbial responses, platelet activation, complement, and leukocyte extravasation whereas, ubiquitous expression of VM then further drives additional chemokines, antigen presentation, and ISGs.
[0572] Discussion
[0573] VM mice recapitulate many of the features seen in human SAVI ILD and provide an excellent model for exploring the cell-specific role of GOF STING mutations in lung Inflammation. Radiation chimera studies demonstrated that non- hematopoietic cells in VM mice were sufficient to initiate ILD. Nevertheless, other reports have implicated T cell or innate immune cell expression of VM in the development of ILD. We have now utilized a conditional knock-in model of the SAVI STING mutant V154M to demonstrate a unique role for endothelial cell expression of the GOF VM mutant in the development of VM ILD, specifically in the initial recruitment of immune cells to the lung. However, our studies also demonstrate that VM expression in endothelial cells alone is insufficient to fully recapitulate the phenotype of the parental VM mice. VM expression in additional cell types is likely required for further lymphocyte and myeloid cell activation, fibroblast activation, and even further endothelial cell activation, that are all likely to contribute to BALT organization and lung pathology.
[0574] The unique role of endothelial cells in VM ILD aligns with the known role of the endothelium in inflammation, as the blood endothelial barrier is tightly regulated to limit the extravasation of recruited leukocytes under homeostatic conditions. However, during active inflammation, endothelial cells upregulate contact-dependent (selectins and integrins) and contact-independent (cytokines) factors to enhance immune cell recruitment. T cell recognition of MHC-assoeiated antigens also contributes to T cell recruitment by endothelial cells. We have now shown, by both flow cytometry and immunofluorescence, that lung endothelial cells (LEG) in tamoxifen-treated CKI x Cdh5~CreERT2mice exhibit elevated expression of adhesion molecules like VC AMI and antigen presentation molecules like MHCII. We also demonstrate that LEG intrinsic VM expression is sufficient to induce expression of numerous genes associated with chemotaxis, leukocyte extravasation, and antigen presentation. .Additionally, we find LEG intrinsic VM expression leads to a gene signature associated with platelets, including transcripts for the glycoprotein Ib-IX-V complex which binds to vWF on damaged endothelial cells, and likely reflects an enrichment for platelet bound-endothelial cells. In addition to initiation of coagulation, platelet adhesion also leads to enhanced inflammation and immune recruitment, indicating another plausible route by which LEG intrinsic VM expression promotes lung immune recruitment. Collectively, these data significantly expand upon our previous findings where we showed that LECs isolated from VM mice were enriched for gene ontology pathways related to immune activation, chemotaxis and antigen presentation. Previous studies from Bennion and colleagues, using a different strategy for the conditional expression of VM mutant N153S, found that Rorc-Crc targeting of their knock-in allele led to a loss of LTi innate lymphocytes; these mice also developed ILD. LTi plays a critical role in lymph node formation and these mice, similar to the parental VM mice, did not have lymph nodes. One possible explanation for these findings was that normal lymphatic function is critical for resolving inflammation and maintaining tissue homeostasis and that LN agenesis in VM mice could promote lymphatic dysfunction and the subsequent development of spontaneous lung inflammation. Although our CKI x Rorc-Cre mice also lack LN, they did not develop ILD. Importantly, expression of the VM mutant in our CKI mice is regulated by the endogenous STING locus, in contrast to the Bennion et al. model in which the mutant STING allele was constitutively expressed using the ROSA26 locus under control of the chicken actin promoter. Thus, our conditional model maintains the original level and regulation of VM expression, which we consider a more appropriate context for delineating outcomes of VM across cell types.
[0575] Surprisingly, despite prominent neutrophilia in VM mice and evidence for colitis resulting from VM bone marrow derived myeloid cells, we found that there was very little impact on myeloid cells following targeted expression of the VM allele to mature myeloid cells in CKI x LysM-Cre mice. We speculate this may indicate that STING activation early during myeloid cell development may play a role in development of myeloid driven pathologies in VM disease, and have previously reported an increased frequency of common myeloid progenitors in the bone marrow of VM mice. Alternatively, VM-expressing myeloid cells may synergize with other VM-expressing cells, such as LEC, to promote more severe lung inflammation.
[0576] Endothelial cell expression of VM alone did not fully restore the extent of ILD seen in the original VM parental mice or in the CKI x CAGG-CreER SMmice where VM was expressed in all post-natal tissues. Ubiquitous post-natal expression resulted in BALT myofibroblast expansion, organization of immune infiltrates, and further activation of infiltrating T and myeloid cells, when compared to CKI x Cdh5-CreERi / mice. Additionally, we find CKI x Cdh5-CreERT2mice did not significantly recruit GDI lb+myeloid cells into BALT, as seen in VM and the CKI x CAGG-CreER,Mmice, potentially due to the absence of activated T cells in the CKI x CDH5-CreER nmice. This observation would be consistent with our prior study that showed an absence of myeloid cells in the lungs of T cell-deficient VM mice.
[0577] We further speculate that STING activation in lung epithelial cells and fibroblasts further contributes to VM ILD, consistent with their known functions in other settings. For example, lung epithelial cells form a critical mucosal barrier that constantly encounters foreign and self-antigens. Epithelial expression of antigen presentation machinery is critical for the formation and regulation of memory T cell responses. Thus, it may be that STING activation in lung epithelium promotes T cell activation. Indeed, STING agonist stimulation of the human lung epithelial cell line Calu-3 results in significant upregulation of genes involved in antigen processing and presentation. Antigen presentation by fibroblasts has also been shown to facilitate memory T-cell responses. Additionally, specialized fibroblasts known as fibroblastic reticular cells (FRCs) play a critical role in organizing immune responses in lymphoid organs by producing chemokines like CXCL13 and CCL19, and fibroblasts in the lung have also been shown to produce CXCL.13 following infection. In support of a role for FRC-like cells in VM ILD, we find evidence for elevated expression of CXCL13 and CCL19 as well as an expanded population of SMA+PDPN*VCAM-1+myofibroblasts within lungs of VM and CKI x CAGG-CreER,Mbut not CKI x CDH5-CreERI2mice. STING activation in lung fibroblasts may thus play a role in the localization and persistence of the recruited immune cells to enhance inflammation, The combined effects of endothelial VM with epithelial and / or fibroblast VM could be tested by simultaneously targeting VM expression to more than one cell type by generating CKI mice with multiple cell- type specific Cre genes.
[0578] In conclusion, our findings demonstrate a critical role for endothelial cell STING activation in mediating immune infiltration of the lung in VM ILD, although VM in other non-hematopoietic cell types likely synergizes with endothelial STING activation to mediate fulminant disease. We speculate that, endothelial STING activation is critical step in SA VI ILD initiation which could be therapeutically targeted via antibody-drug conjugates, which have been utilized in the field of cancer to target chemotherapeutic agents selectively to tumors. As several small molecule antagonists of STING have been recently developed (H-l 51 , SN-011 , and those described above), it is conceivable that the conjugation of small molecule STING inhibitors to endothelial targeting antibodies could be a viable strategy to treat SA VI ILD. Beyond the importance of our findings to SAVI ILD, this work also has important implications regarding the role of cGAS-STING sensing within endothelial cells in other pathologic settings such as infection, autoimmunity, and cancer, which may be further exploited for therapeutic benefit.
[0579] Categorically, our study is limited by three different aspects: our use of a fluorescent reporter gene as a measure of Cre-activity, tissue-specific Cre recombinase efficacy and penetrance, and limitations of our study design with respect to claims regarding endothelial cells and fibroblasts. First, throughout this study, we use mice expressing the fluorescent Cre reporter Rosa26-st / fi-eYFP (YFP) as a surrogate for Cre-recombinase activity to demonstrate targeting of Cre activity in mice expressing different tissue specific Cre (e.g., CMV-Cre, Tie2-Cre, etc... ). Although expression of the YFP reporter certainly marks a history of Cre activity in a ...
Claims
WHAT IS CLAIMED IS:
1. A method of treating or preventing a disease or condition selected from: a type I interferonopathy selected from Aicardi-Goutieres syndrome (AGS), STING- associated vasculopathy with onset in infancy (SAVI), and inherited DNase deficiency;Sjogren’s syndrome, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, acute kidney injury, diabetes, and inflammatory response to gene therapy, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I):or a pharmaceutically acceptable salt thereof, wherein:R£, R2, R3, R4, and R5are each independently selected from H, NO2, CN, halo, Ci- 6 alkyl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRclRdl, C6-io aryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R1and R2, together with the carbon atoms to which they are attached, form a pyrrolidin-2-one ring, which is optionally substituted with 1 or 2 substituents independently selected from R9a; or R2and R3, together with the carbon atoms to which they are attached, form a phenyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; each R9ais independently selected from C1-6 alkyl, C3-5 cycloalkyl, C1-6 alkylene- C3-5 cycloalkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl;each R9bis independently selected from NO2, CN, halo, Ci-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRelC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl;X is selected from O and NR8;R8is selected from H, OH, CN, C1-6 alkyl, C1-4 haloalkyl, C1-6 alkoxy, and C1-4 haloalkoxy;R6and R7are each independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; or R6and R7, together with the N atom to which they are attached from a 5-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; or R7and R8, together with the N atoms to which they are attached form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R9b; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl.
2. The method of claim 1, wherein the disease or condition is selected from a type I interferonopathy selected from Aicardi-Goutieres syndrome (AGS), STING- associated vasculopathy with onset in infancy (SAV1), and inherited DNase deficiency, and Sjogren’s syndrome.
3. The method of claim 1, wherein the disease or condition is selected from nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, and acute kidney injury.
4. The method of claim 1, wherein the disease or condition is diabetes.
5. The method of claim 1, wherein the disease of condition is inflammatory response to gene therapy.
6. The method of any one of claims 1-5, wherein R1, R2, R3, R4, and R5are each independently selected from halo, Ci-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-ioaryl, and -N=N- Ce-io aryl, wherein each of said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R9b.
7. The method of any one of claims 1-6, wherein R9bis selected from halo, Ci-6 alkyl, ORal, and NRclRdl.
8. The method of any one of claims 1-7, wherein R6and R7are each independently selected from H, Ci-6 alkyl, and Ci-4 haloalkyl.
9. The method of any one of claims 1-8, wherein X is O.
10. The method of any one of claims 1-8, wherein X is NR8.
11. The method of claim 10, wherein R8is selected from H, Ci-6 alkyl, and Cn 4 haloalkyl.
12. The method of any one of claims 1-11, wherein each Ral, Rel, and Rdlis independently selected from H and Ci-6 alkyl.
13. The method of claim 1, wherein the compound of Formula (I) has formula:or a pharmaceutically acceptable salt thereof.
14. The method of claim 1, wherein the compound of Formula (I) has formula:or a pharmaceutically acceptable salt thereof.
15. The method of claim 1 , wherein the compound of Formula (I) has formula:or a pharmaceutically acceptable salt thereof.
16. The method of claim 15, wherein R9ais selected from Ci-6 alkyl, C3-5 cycloalkyl, and C1-6 alkylene-C3-5 cycloalkyl.
17. The method of claim 1 , wherein the compound of Formula (I) has formula:or a pharmaceutically acceptable salt thereof.
18. The method of claim 1, wherein the compound of Formula (I) has formula:or a pharmaceutically acceptable salt thereof.
19. The method of claim 1, wherein the compound of Formula (I) has formula:or a pharmaceutically acceptable salt thereof.
20. The method of claim 19, wherein the compound of Formula (I) has formula:or a pharmaceutically acceptable salt thereof.
21. The method of claim 1, wherein the compound of Formula (I) is selected from any one of the compounds listed in Table 1 , or a pharmaceutically acceptable salt thereof.
22. The method of claim 1, wherein the compound of Formula (I) is selected from any one of the compounds listed in Table 2 and Table El, or a pharmaceutically acceptable salt thereof.
23. A compound selected from any one of the compounds listed in Table 2 and Table El, or a pharmaceutically acceptable salt thereof.
24. A compound of Formula (II):or a pharmaceutically acceptable salt thereof, wherein:R1is selected from H, halo, Ci-6 alkyl, Ci-4 haloalkyl, ORal, and C(O)ORal; each R2is selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl,C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRelC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRelRdl, and C6-io aryl, wherein said C6-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6;R3and R4are each independently selected from H, C1-6 alkyl, C1-6 alkylene-Ce-12 aryl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl; wherein said C1-6 alkylene-C6-n aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6; or R3and R4, together with the N atom to which they are attached from a 5-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R6;X is selected from O and NR5;R5is selected from H, OH, CN, Ci-6 alkyl, C1-4 haloalkyl, Ci-6 alkoxy, and C1-4 haloalkoxy; or R4and R5, together with the N atoms to which they are attached form a benzimidazole ring, which is optionally substituted with 1, 2, or 3 substituents independently selected from R6; each R6is independently selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl,C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, and C2-6 alkynyl.
25. The compound of claim 24, wherein R1is selected from H, Ci-6 alkyl, and Ci-4 haloalkyl.
26. The compound of claim 24 or 25, wherein R2is selected from halo, Ci-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, and Ce-io aryl, wherein said Ce-io aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6.
27. The compound of any one of claims 24-26, wherein R3is selected from H and C1-6 alkyl.
28. The compound of any one of claims 24-27, wherein R4is selected from H, C1-6 alkyl, and C1-6 alkylene-Ce-n aryl, wherein said C1-6 alkylene-Ce-n aryl is optionally substituted with 1, 2, or 3 substituents independently selected from R6.
29. The compound of any one of claims 24-28, wherein X is O.
30. The compound of claim 29, wherein the compound of Formula (II) has formula:or a pharmaceutically acceptable salt thereof.
31. The compound of claim 30, wherein the compound of Formula (II) has formula:or a pharmaceutically acceptable salt thereof.
32. The compound of claim 29, wherein the compound of Formula (II) has formula:or a pharmaceutically acceptable salt thereof.
33. The compound of any one of claims 24-28, wherein X is NR5.
34. The compound of claim 33, wherein R5is selected from H, Ci-6 alkyl, and Ci-4 haloalkyl.
35. The compound of claim 33, wherein the compound of Formula (11) has formula:or a pharmaceutically acceptable salt thereof.
36. The compound of any one of claims 24-35, wherein R6is selected from halo, Ci-6 alkyl, ORal, and NRclRdl.
37. The compound of any one of claims 24-35, wherein Ral, Rbl, Rcl, and Rdlare independently selected from H and Ci-6 alkyl.
38. The compound of claim 24, wherein the compound of Formula (II) is selected from any one of the following compounds listed in Table 3, or a pharmaceutically acceptable salt thereof.
39. A compound of Formula (III):or a pharmaceutically acceptable salt thereof, wherein:W is a warhead functional group selected from any one of the following moieties (i)-(xii):wherein: each RA, RB, and Rcare independently selected from H and methyl; each RDis independently selected from H, methyl, halo, and NO2; each Y1is independently selected from O and NH; n is 1 or 2;X is Cl or F; and each Y is independently selected from O and S; provided if W is a moiety of formula (xii), then L comprises at least one optionally substituted phenylene moiety;L is selected from -C3-6 alkylene-, -C1-3 alkylene-phenylene-, -phenylene-Ci-3 alkylene-, and -C1-3 alky lene-phenylene-C 1-3 alkylene-, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, C1-4 haloalkyl, Ci-6 alkoxy, and C1-4 haloalkoxy;R1, R2, R3, R4, and R5are each independently selected from H, NO2, CN, halo, Ci- 6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, S(O)2NRclRdl, Ce-ioaryl, Ce-12 aryloxy, C2-6 alkenylene-C6-i2 aryl, and C2-6 alkynylene-Ce- 12 aryl, wherein each of said Ce-io aryl and C6-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12; each R12is independently selected from NO2, CN, halo, C1-6 alkyl, C1-4 haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl;R6is selected from Ci-6 alkyl, Ci-6 alkylene-Ce-12 aryl, C3-6 cycloalkyl, C3-6 cycloalkcnyl, C1-6 alkylcnc-C -6 cycloalkyl, CM alkylcnc-C3-6 cycloalkcnyl, CM haloalkyl, C2-6 alkenyl, and C2-6 alkynyl;R7is selected from C alkyl, Ci-6 alkylene-Ce-12 aryl, C3-6 cycloalkyl, C3-6 cycloalkenyl, C1-6 alkylene-C3-6 cycloalkyl, CM alkylene-C3-6 cycloalkenyl, CM haloalkyl, C2-6 alkenyl, and C2-6 alkynyl;R8, R9, R10, and R11are each independently selected from NO2, CN, halo, C1-6 alkyl, C6-12 aryloxy, C6-12 aryl, CM haloalkyl, C2-6 alkenyl, C2-6 alkynyl, ORal, C(O)ORal, C(O)Rbl, C(O)NRclRdl, NRclRdl, NRclC(O)Rbl, NRclC(O)ORal, NRclS(O)2Rbl, S(O)2Rbl, and S(O)2NRclRdl, wherein said C6-12 aryloxy and C6-12 aryl are each optionally substituted with 1, 2, or 3 substituents independently selected from R12; and each Ral, Rbl, Rcl, and Rdlis independently selected from H, Ci-6 alkyl, CM haloalkyl, C2-6 alkenyl, and C2-6 alkynyl.
40. The compound of claim 39, wherein the warhead functional group is selected from any one of the moieties (i)-(xi).
41. The compound of claim 40, wherein L is -C3-6 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, CM alkyl, C1-4 haloalkyl, C1-6 alkoxy, and C haloalkoxy.
42. The compound of claim 39, wherien L is -C4-6 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, CM alkyl, C haloalkyl, C1-6 alkoxy, and CM haloalkoxy.
43. The compound of claim 39, wherein L is -C1-3 alkylene-phenylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, CM haloalkyl, C1-6 alkoxy, and CM haloalkoxy.
44. The compound of claim 39, wherein L is -phenylene-Ci-3 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, C1-6 alkyl, CM haloalkyl, C1-6 alkoxy, and CM haloalkoxy.
45. The compound of claim 39, wherein L is -C1-3 alkylene-phenylene-Ci-3 alkylene-, optionally substituted with 1, 2, or 3 substituents independently selected from halo, NO2, CN, Ci-6 alkyl, CM haloalkyl, Ci-6 alkoxy, and CM haloalkoxy.
46. The compound of any one of claims 42-45, wherein the warhead functional group is a moiety of formula (xii).
47. The compound of any one of claims 42-45, wherein the warhead functional groups is a moiety of any one of the formulae (i)-(xi).
48. The compound of any one of claims 39-47, wherein R1, R2, R3, R4, and R5are each independently selected from H, halo, Ci-6 alkyl, C2-6 alkynyl, ORal, C(O)ORal, Ce-io aryl, Ce-12 aryloxy, C2-6 alkenylene-Ce-12 aryl, and C2-6 alkynylene-Ce- 12 aryl, wherein each of said Ce-io aryl and Ce-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12.
49. The compound of any one of claims 39-48, wherein R6is selected from C1-6 alkyl, C3-6 cycloalkyl, and C1-6 alkylene-C3-6 cycloalkyl.
50. The compound of any one of claims 39-49, wherein R7is selected from C1-6 alkyl, C3-6 cycloalkyl, and C1-6 alkylene-C3-6 cycloalkyl.
51. The compound of any one of claims 39-50, wherein R8, R9, R10, and R11are each independently selected from halo, C1-6 alkyl, Ce-12 aryloxy, C1-4 haloalkyl, ORal, C(O)ORal, C(O)NRclRdl, and NRclRdl, wherein said Ce-12 aryloxy is optionally substituted with 1, 2, or 3 substituents independently selected from R12.
52. The compound of any one of claims 39-51, wherein R12is selected from NO2, halo, C1-6 alkyl, ORal, and NRclRdl.
53. The compound of any one of claims 39-52, wherein Ral, Rbl, Rcl, and Rdlis independently selected from H and C1-6 alkyl.
54. The compound of claim 39, wherein the compound of Formula (III) is selected from any one of the following compounds, or a pharmaceutically acceptable salt thereof:
55. The compound of claim 39, wherein the compound of Formula (111) is selected from any one of the compounds in FIG. 20, or a pharmaceutically acceptable salt thereof, such as LB244 or a pharmaceutically acceptable salt thereof, the structure of which is shown below.
56. A pharmaceutical composition comprising a compound of any one of claims 23-55, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
57. A method of treating or preventing a disease or condition in which a PAD enzyme is implicated, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of claims 23-55, or a pharmaceutically acceptable salt thereof.
58. The method of claim 57, wherein the disease or condition is selected from an immune system disease or disorder, an inflammatory disease or disorder, and an autoimmune disease or disorder.
59. The method of claim 58, wherein the disease or condition is selected from rheumatoid arthritis, collagen-induced arthritis (CIA), osteoarthritis, juvenile idiopathic arthritis, lupus, Alzheimer’s disease, Parkinson’s disease, multiple sclerosis, inflammatory bowel disease, psoriasis, asthma, rhinitis, Crohn’s disease, colitis, ulcerative colitis, spinal cord injury, and atherosclerosis.
60. The method of claim 57, wherein the disease or condition is cancer.
61. The method of claim 60, wherein the cancer is selected from carcinoma, lymphoma, sarcoma, blastoma, leukemia, squamous cell carcinoma, lung cancer, pancreatic cancer, cervical cancer, bladder cancer, hepatoma, breast cancer, colon carcinoma, and head and neck cancer.
62. The method of claim 57, wherein the disease or condition is diabetes.
63. A method of treating or preventing a disease or conditions in which a STING pathway is implicated, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of claims 24-55, or a pharmaceutically acceptable salt thereof.
64. The method of claim 63, wherein the disease or condition is selected from: Aicardi-Goutieres syndrome (AGS), STING-associated vasculopathy with onset in infancy (SAVI), type I interferonopathy due to inherited DNase deficiency, Sjogren’s syndrome, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, acute kidney injury, and inflammatory response to gene therapy.
65. The method of claim 64, wherein the disease or condition is selected from Aicardi-Goutieres syndrome (AGS), STING-associated vasculopathy with onset in infancy (SAVI), type I interferonopathy due to inherited DNase deficiency, and Sjogren’s syndrome.
66. The method of claim 64, wherein the disease or condition is selected from nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), chronic obstructive pulmonary disease, systemic lupus erythematosus (SLE), amyotrophic lateral sclerosis (ALS), myocardial infarction, macular degeneration, and acute kidney injury.
67. The method of claim 64, wherein the disease of condition is inflammatory response to gene therapy.