A method for increasing plant resistance to stress, and stress resistant plants

Abstract

The present invention provides a method of increasing the resistance of plants to abiotic stress, especially to drought and soil salinity, wherein the expression of the DIR13 gene or its ortholog or its homolog in the plant is increased. It also provides plants with such increased expression of the DIR13 gene or its ortholog or its homolog.

Description

[0001] A method for increasing plant resistance to stress, and stress resistant plants

[0002] Field of Art

[0003] The invention relates to the production of plants with increased resistance to abiotic stress, in particular to drought and / or soil salinity.

[0004] Background Art

[0005] Drought is one of the most significant and severe plant stressors, and due to ongoing climate change, drought frequencies are increasing in many regions (Vicente-Serrano, S. M., et al. (2015). Remote Sens- Basel 7, 4391-4423; Santos, M. J. , et al. (2010). Environ Manage 45, 239-249). In addition to the effect on the plants themselves, drought also has a significant socio-economic impact. Events caused by the East African drought of 1984 are responsible for the deaths of about 450,000 people in Sudan and Ethiopia. Extreme drought in Somalia and Ethiopia in 2011 triggered the migration of about 380,000 refugees to surrounding countries and the need for humanitarian aid for ten million people. However, the serious consequences of drought are recorded not only in Africa. In 2008 there was a global food crisis caused in part by drought, and in 2012 the drought significantly affected agricultural yields in the U.S.A., which exports 53% of the world's com production and 43% of the world's soybean production. Yields of major crops are predicted to decrease by more than 50% by 2050 and by up to 90% by 2100 due to drought. In 2015, the Czech Republic experienced one of the worst droughts in its history, which led to significant consequences for crop yields, but also for wildlife.

[0006] Soil salinity is another stressor type with a major impact on plant production. Soil salinization has two fundamental mechanisms of its effect on plant growth and production. First, there is an increase in the osmotic potential of the environment, which makes it difficult for the plant to absorb water. Thus, salinity causes very similar effects to drought, and often this type of stress is used in model situations to simulate drought. Second, damage to leaf cells occurs after the uptake of increased amounts of salts by the transpiration stream.

[0007] Drought mitigation measures can be divided into three groups, i) increasing water supply, ii) reducing water consumption, and Hi) minimizing the effects of drought. To achieve the maximum effect, a combination of all three types of measures is ideal. In the case of protecting agricultural production, one of the very effective options is the breeding of plants with increased resistance to drought, which will enable both a reduction in the water demand of agricultural production (measure type ii) and a reduction in the effects of drought (measure type Hi).

[0008] Disclosure of the invention

[0009] An aspect of the present invention is a method of increasing the resistance of plants to abiotic stress, in particular to drought and soil salinity. The method involves increasing the expression of the DIR13 gene or its ortholog or its homolog in the plant.

[0010] The DIR13 gene (also called A d)IR13. AGI code AT4G11190) is found in the Thale cress (Arabidopsis thcdiand).

[0011] A homolog is a gene in another plant species that is derived from a gene common (ancestral) to this homologous gene (homolog) and to the DIR13 gene from the Thale cress.

[0012] An ortholog means a gene in another plant species that is derived from a gene common (ancestral) to this homologous gene and to the DIR13 gene from the Thale cress. An orthologous gene is evolved by speciation and usually retains the same function in different species throughout evolution.

[0013] DIR proteins show a high degree of conservation, enabling the identification of orthologs, i.e. proteins with the same function, both in dicotyledons and monocotyledons, including important crops such as rice, maize, wheat, barley or cotton (Corbin, C., et al. (2018). Plant Mol Biol 97, 73-101).

[0014] Preferably, the present invention provides for increasing the resistance of cruciferous plants, and increasing the expression of the DIR13 gene or its ortholog or homolog in the cruciferous plant. Brassicaceous plants include economically important crops such as wild cabbage (Brassica oleracea) and its cultivated forms such as cabbage, broccoli, cauliflower, kale, Brussels sprouts, collard greens, Savoy cabbage, kohlrabi, and gai lan or oilseed rape (Brassica napus).

[0015] Gene expression can generally be increased by inserting additional copies of the gene, preferably under the control of promoters increasing the level of expression as needed, and / or by applying to the plant expression activators, especially transcription activators, of the given gene.

[0016] For example, the expression of the DIR13 gene or its homolog or ortholog in a plant can be increased by first amplifying the coding and / or genomic sequences of the DIR13 gene or its homolog or ortholog using primers that anneal to the 5' and 3' ends of the coding sequence and which may include generally known adapter sequences to facilitate cloning, e.g. using Gateway or LIC; subsequently, the coding and / or genomic sequences of the DIR13 gene or its homolog or ortholog are cloned into a vector with a suitable expression cassette containing a strong constitutively active promoter, e.g. CaMV 35S or RPS5A, or a promoter allowing chemically regulated expression of transgenes, e.g. the dexamethasone-inducible system pOp6- LhG4 or estradiol-inducible systems based on XVE promoter; and then the said vector is transformed into the plant.

[0017] In a preferred embodiment, in the method according to the invention, the expression of the DIR13 gene or its ortholog or its homolog which is naturally present in the plant is increased. Methods for generally increasing expression of genes are known.

[0018] In another preferred embodiment, in the method according to the invention, the expression of the DIR13 gene or its ortholog or its homolog is increased in the plant, and simultaneously or subsequently, at least one exogenous cytokinin is applied on the growing plant.

[0019] In another preferred embodiment, in the method according to the invention, the expression of the DIR13 gene or its ortholog or its homolog is increased in the plant; and simultaneously the expression of at least one gene for the biosynthesis of an endogenous cytokinin, such as ISOPENTENYL TRANSFERASE (IPT) or LONELY GUY (LOG), is increased in the plant, or the expression of at least one gene for the degradation of cytokinins, e.g. CYTOKLNLN OXIDASE / DEHYDROGENASE (CKX), is decreased.

[0020] Plants with increased expression of the DIR13 gene or its homolog or ortholog may also be suitable for achieving antiviral and / or anticarcinogenic effects due to the increased amount of endogenous lignans and / or neolignans.

[0021] An aspect of the present invention is also a plant with increased resistance to abiotic stress, in particular to drought and soil salinity, which contains inserted additional copies of the DIR13 gene or its ortholog or its homolog to increase the production of the protein encoded by this gene. The term “additional” refers to copies of the genes which are inserted and thus present in the plant genome in addition to the naturally present copies of the genes.

[0022] Dirigent proteins (DIRs), named after the Latin term "dirigere", meaning "to direct" or "to lead", were first described in Forsythia sp. more than two decades ago as proteins responsible for mediating the stereoselective formation of the lignan (+)-pinoresinol from two coniferyl alcohol radicals (Davin, L. B., et al. (1997). Science 275, 362-366; Gang, D. R., et al. (1999). Chemistry & Biology 6, 143-151). Since then, various DIR and DIR-like proteins have been identified throughout the plant kingdom except for algae and cyanobacteria, suggesting that DIRs are found in almost all vascular plant species including lichens, fems, gymnosperms, and angiosperms (Ralph, S. , et al. (2006). Plant Molecular Biology 68, 1975-1991 19, 347- 352; Li, Q„ et al. (2014). BMC Genomics 15, 388).

[0023] The DIR protein family in Arabidopsis (AtDIR) includes 26 members with mostly unknown biochemical functions. DIR5 and DIR6, both belonging to the DIR-a subfamily, are involved in (-)-pinoresinol biosynthesis. According to phylogenetic analysis, DIR13 is the closest paralog of DIR5, DIR6, and DIR12, but lacks conserved residues necessary for (-)-pinoresinol formation (Paniagua, C., et al. (2017). J Exp Bot 68, 3287-3301; Kim, K. W„ et al. (2012). J Biol Chem 287, 33957-33972). DIR13 and its homologs and orthologs in various plants increase the formation of lignans and neolignans. Furthermore, it was found within the framework of the present invention that DIR13 and its homologs and ortho logs increase reactive oxygen species (ROS) production in response to abiotic stress.

[0024] Lignins and lignans are products of phenylpropanoid metabolism. This metabolic pathway leads to the production of monolignols (coniferyl, sinapyl, and p-coumaryl alcohols), which are precursors of both lignan and lignin biosynthesis (Buchanan, B.B., et al. (2000). Biochemistry & Molecular Biology of Plants. Rockville, Md.: American Society of Plant Physiologists). The term “lignan” includes a class of dimeric phenylpropanoids (CeC ) linked by an 8-8' linkage, while alternatively linked dimers are known as neolignans (Buchanan, B.B., et al. (2000). Biochemistry & Molecular Biology of Plants. Rockville, Md.: American Society of Plant Physiologists). Lignans and neolignans are quite widespread, with 23 types of lignans and neolignans described across the plant kingdom (Teponno, R.B., et al. (2016). Nat Prod Rep 33, 1044- 1092). Biosynthesis of lignans and neolignans begins with the synthesis of phenylalanine, a precursor of coniferyl alcohol (Hao, Z., et al. (2014). Crit Rev Biochem Mol Biol 49, 212-241; Barros, J., et al. (2015). Ann Bot 115, 1053-1074). The dimerization / coupling of two coniferyl alcohol radicals leading to (+ / -)- pinoresinol is mediated by oxidases such as peroxidases or laccases, with the assistance of DIRs, which ensure the stereoselectivity of coniferyl alcohol dimerization (Davin, L. B., et al. (1997). Science 275, 362- 366. Biochemistry 41, 2587-2595). The role of DIR proteins is essential in this process, as optical activity is a determinant of the properties of most lignans (Akiyama, K., et al. (2007). Biosci Biotechnol Biochem 71, 1745-1751; Akiyama, K., et al. (2009 ). Biosci Biotechnol Biochem 73, 129-133). Pinoresinol can be converted to other types of lignans including piperitol, laciresinol, sesamin, secoisolaresinol and their glucosides (Dinkova-Kostova, A. T., et al. (1996). J Biol Chem 271, 29473-29482; Satake, H., et al. (2015). Metabolites 5, 270-290).

[0025] Lignans and neolignans play an important role in plant defense where they act as biological weapons against pathogens (Davin, L. B., et al. (2008). Nat Prod Rep 25, 1015-1090; Davin, L. B., et al. (2005). Current Opinion in Biotechnology 16, 398-406). Lignans are able to inhibit the extracellular fungal enzymes cellulase, polygalacturonase, glucosidase, and laccase (MacRae, W.D., et al. (1984). Phytochemistry 23, 1207-1220). Furthermore, it has been predicted that lignans could prevent plant damage by disrupting the endocrine system of herbivorous insect larvae (Harmatha, J., et al. (2003). Phytochemistry Reviews 2, 321— 330). Lignans could also be used as drugs and chemopreventive agents in conventional medicine. For example, podophyllotoxin (derived from Podophyllum peltatum) has antiviral properties and its derivative (etopophos) has found application in cancer chemotherapy (Davin, L.B., et al. (2008). Nat Prod Rep 25, 1015-1090). In addition, lignans could serve as a reservoir of monolignols for lignification. An increase in the expression of lignan synthesis genes was observed during xylogenesis in lignified tissues of Scots pine (Villalobos, D. P., et al. (2012). BMC Plant Biol 12, 100) and flax (Huis, R., et al. (2012). Plant Physiol 158, 1893-1915). In flax, the presence of lignans in its secondary cell walls was also revealed by immunolabeling (Attoumbre, J., et al. (2010). Phytochemistry 71, 1979-1987). Disruption of PINORESINOL REDUCTASE 1 (PrRl), which catalyzes the conversion of pinoresinol to lacinoresinol, has also been shown to result in reduced lignin content and altered lignin distribution in the Arabidopsis inflorescence stem (Ruprecht, C., et al. (2011). Front bhPlant Sci 2, 23; Zhao, Q., et al. (2015). Phytochemistry 112, 170-178).

[0026] The present invention makes it possible to obtain economically important crops with resistance to salinity, drought and / or other types of stress.

[0027] Brief Description of Drawings

[0028] Figure 1. The DIR13 promoter is active early after germination and dominantly in the root. (A - C) AtDIRl 3 promoter activity detected by GFP fluorescence (bright signal in cell nuclei, examples highlighted by white arrowheads in A and C) in 3-day-old Arabidopsis seedlings carrying the pDIR13::NLS-3xGFP construct. pDIR13 activity is detectable mainly in the root (A). A fluorescent signal was also detected in the shoot apical meristem (B) and in root hairs (C). The plasma membrane signal due to propidium iodide (PI) staining is shown in magenta. Scale bar represents 50 pm.

[0029] Figure 2. The DIR13 promoter is active in all root tissues and lateral root primordia; DIR13 expression is regulated by cytokinins. (A) Representative images of 7-day-old (7 DAG] seedlings and transverse optical sections of root cells expressing pDIR13::NLS-3xGFP. Fluorescent GFP signal (bright signal in cell nuclei, examples highlighted by white arrowheads in A, B and E) was detected in all Arabidopsis root cell types (1-3, pictured right). Scale bar 50 pm. ep, epidermis; en, endodermis; co, cortex; pe, pericycle. (B) DIR13 activity in 9-day-old seedlings in the lateral root primordia (LRP) of 9-days-old (9 days after germination, 9 D AG) Arabidopsis seedlings. Scale bar represents 20 pm. The plasma membrane signal is shown in purple in (A) and (B). (C) Cytokinin-induced DIR13 expression was analyzed by RT-qPCR in 11 -day-old seedlings (5 pM 6-benzylaminopurine, BAP) and control (0.1% DMSO) for 0, 0.5, 1, 3 and 5 h. Transcription levels were normalized to the reference gene EF-la, shown as a relative expression ratio of DIR13 / EF-la in a representative result of repeated measurements, error bars indicate + / - SE (n=3). Asterisks indicate statistically significant differences at p < 0.05 between BAP and treatment by control based on two-way ANOVA followed by Tukey's HSD test (*p < 0.05, **p < 0.01). (D) DIR13 expression is regulated by B-type ARR transcription factors. The expression level of DIR13 was examined by RT- qPCR in cirri, 10, arrl,12, and arr!0,12 double mutants after treatment with 5 pM BAP and in control (0.1% DMSO) for 1 hour. Transcript levels were normalized to the EF-la reference gene, the relative expression ratio of DIR13 / EF-la is shown. The data demonstrate the result of a representative experiment. Error bars indicate + / - SE, (n=3). Asterisks indicate statistically significant differences between BAP and control based on two-way ANOVA followed by Tukey's HSD test (**P < 0.01, ***P < 0.001). (E) The DIR13 promoter is activated by cytokinin in the root apical meristem. Representative images of 5-day-old seedlings expressing pDIRl 3 : :NLS-3xGFP after 24 h treatment with 5 pM BAP and in control (0.1% DMSO). Plasma membrane signal from PI staining is shown in magenta and GFP in green. Scale bar represents 50 pm. (F) Number of fluorescent nuclei per root in the root apical meristem (RAM) of 5-day- old seedlings expressing pDIRl 3 : :NLS-3xGFP after 4 and 24 h of BAP treatment and in the control (0.1% DMSO). Data are presented as mean + / - SE (n > 10). Asterisks indicate statistically significant differences between BAP and control based on mixed Poisson model analysis (**P < 0.01, ***P < 0.001). (G) Fluorescence intensity of individual nuclei after 4 h and 24 h of BAP and control (DMSO) treatment was quantified in RAM. Results are means + / - SE (n > 10). Asterisks indicate statistically significant differences between BAP and control treatments based on one-way ANOVA followed by Dunnett's HSD test (**P < 0.01, ***P < 0.001).

[0030] Figure 3. DIR13 localizes to Arabidopsis root endodermis and peripheral cells of lateral root primordia. (A- C) DIR13 protein localizes to the endodermal cells of the root differentiation zone. Representative images of 7-day-old seedlings expressing pDIR13:DIR13::mCherry. (A) - single layer, (B) projection (Z-stack) of confocal sections and (C) transverse optical section of the root from Fig. (B). (D, E) Treatment with 5 pM BAP increases the amount of DIR13 and shifts its localization closer to the root apical meristem (indicated by arrows). Representative projections of confocal images of 7-day-old seedlings after 24 h treatment with 5 pM BAP and control (0.1% DMSO). (F— I) DIR13 is detected in peripheral cells of lateral root primordia (LRP) and emerged lateral root (ELR). Representative confocal images of 9-day-old seedlings at different stages of LR development from LRP (F) to ELR (G-I). Roots were stained with Calcofluor White, cell wall is shown in blue, mCherry signal is shown in in grey, mostly in cell walls (examples highlighted by white arrowheads). Scale bars represent 50 pm in (A-C) and (F— I) and 100 pm in (D, E). en, endodermis.

[0031] Figure 4. DIR13 is not required for normal Caspar! strip morphology and function. (A-F) Autofluorescence visualization (white / light grey signal) of lignin after clearing roots of 7-day-old WT Col-0 (A, D), 35S.DIR13 #8 (B), dirl3-5 (C), esbl-1 (E), and caspl-l 3-1 (F) and their detail images (1 - 6) shown in that order in red dashed rectangles. (G-H; J-O) Propidium iodide (PI, light grey) penetration of 5-day-old WT Col-0 (G, J, M), dir!3-5 (H, L), 35S:DIR13 #8 (K) esbl-1 (N) and caspl-l;3-l (O). Asterisks indicate the 15 th (in G, H) and 19th (in J - O) endodermal cell from the beginning of the early differentiation zone of the root. The beginning of the early differentiation zone is defined as the zone where an endodermal of cell length greater than twice its width was observed. Scale bar represents 50 pm in (A - 0) and 20 pm in (1 - 6). ep, epidermis; ct, cortex; en, endodermis; st, stele. (I) Quantification of PI penetration into the stele quantified as the number of endodermal cells from the first fully expanded cell in WT Col-0, 35S.DIR13 #8, dir 13-5. esbl-1 , and caspl-l;3-l . Data shown are the result of a representative experiment. Error bars indicate + / - SE, (n > 10). Asterisks indicate statistically significant differences at P < 0.05 between WT Col-0 and mutant genotypes by one-way ANOVA followed by Dunnett's HSD test (**p < 0.01, ***p < 0.001).

[0032] Figure 5. Scheme of the gene construct used for the preparation of DIR13 overexpressing lines. The coding sequence of DIR13 (green rectangle) was placed under the control of a strong constitutive promoter of tobacco mosaic 35S RNA (CaMV 35S, white arrow). The annealing sites of the primers used to amplify the coding sequence of DIR13 are depicted by gray arrows under the DIR13 sequence.

[0033] Figure 6. Molecular characterization of DIR13 overexpressing lines and mutant lines deficient in DIR13 expression. (A) DIR13 expression in lines carrying the 35S::DIR13 construct was analyzed by RT-qPCR in roots of 11-day-old seedlings. Transcript levels were normalized to the reference gene EF-la and the relative expression ratio of DIR13 / EF-la was quantified. Data shown are the result of a representative experiment. Error bars indicate + / - SE, (n = 3). Asterisks indicate statistically significant differences at P < 0.05 between WT Col-0 and overexpressing lines based on one-way ANOVA and Tukey's HSD test (*p < 0.05, ***p < 0.001). (B) Scheme representing the structure of the DIR13 gene and the position of T-DNA (upper panel) and sgRNA (lower panel) insertions in DIR13. Blue arrows indicate the positions of primers used for RT-qPCR and semi-quantitative RT-PCR amplification of DIR13. (C) The expression level of DIR13 was tested in the available T-DNA insertion mutants by RT-qPCR in the roots of 11-day-old seedlings. Transcript levels were normalized to the EF-la reference gene, and the relative expression ratio of DIR13 / EF-la is shown. Data shown are the result of a representative experiment. Error bars indicate + / - SE, (n > 3). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and mutant lines based on one-way ANOVA followed by Tukey's HSD test (***p < 0.001). (D) Semiquantitative RT- PCR gel electrophoresis shows the absence of DIR13 transcripts in dir 13-4 and dir 13-5 mutant lines. EF- la was used as a control. (E) Expression levels of the closest DIR13 homologues are not affected by DIR13 overexpression or the dir 13-5 knock-out mutation. Expression levels of DIR6, DIR10 (ESB1), DIR! 3. and DIR14 were quantified by RT-qPCR in roots of 11-day-old seedlings on WT Col-0, 35S::DIR13, and dir!3- 5 backgrounds. Transcript levels were normalized to the EF-la reference gene, and relative ratios of EF- la expression to the expression level of a given gene are shown. Data shown are the result of a representative experiment. Error bars indicate + / - SE, (n = 4). Asterisks indicate statistically significant differences at p < 0.05 between different genotypes based on two-way ANOVA followed by Tukey's HSD test (***p < 0.001). (F) Comparison of primary root length (in cm) in seedlings overexpressing WT Col-0 and DIR13. Seed plants were scanned after 9, 11, and 15 days of cultivation in vertically oriented Petri dishes using a benchtop scanner (Epson Perfection V700) and root length was measured manually using Image J 1.53m. Data shown are from a representative experiment. Error bars indicate + / - SE, (n > 30). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and 35S::DIR13 based on mixed model ANOVA followed by Dunnetfs HSD test (*p < 0.05, **p < 0.01, *** p < 0.001). (G) Comparison of primary root length (in cm) in WT Col-0 seed plants and / V / ? / 3-dcficicnt plants. Seed plants were scanned after 9, 11, and 15 days of cultivation in vertically oriented Petri dishes using a benchtop scanner (Epson Perfection V700) and root length was measured manually using Image J 1 ,53m. Data shown are from a representative experiment. Error bars indicate + / - SE, (n > 30). Based on mixed model analysis followed by Dunnett's HSD test, no statistically significant differences at p < 0.05 were found between WT Col-0 and dir 13-4 or dir 13-5.

[0034] Figure 7. HPLC-MS / MS analysis of lignans and neolignans in DIR13 overexpressing and dir 13-5 mutant lines. (A) Overexpression of DIR13 leads to the accumulation of some lignans and neolignans in plant roots. Metabolites were extracted from 10-day-old WT Col-0, 35S.DIR13 #6, #8 roots and detected by HPLC- MS / MS. Data are given as relative to the content of these substances in wild-type plants (WT Col-0) and are the average of a representative experiment. Error bars indicate + / - SE, (n = 5). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and 35S.DIR13 #6, #8 based on two-way ANOVA followed by Dunnetfs HSD test. (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). Molecular weight (m / z) and predicted identity of compounds with increased concentration in DIR13 overexpressing lines: (1) m / z 556.24 Neolignan, MNH ; (2) m / z 583.16 Neolignan, MH+; (3a) m / z 480.16 Matairesinol- cysteine, MH+; (3b) m / z 359.14 Matairesinol (fragment), MH+; (4) m / z 355.11 Lignan, MH+; (5) m / z 343.11 Lignan or neolignan, MH+; (6) m / z 373.13 Lignan or neolignan, MH+; (7) m / z 512.15 Lignan, MH MNH ; (8) m / z 343.11 Lignan, MH+. Compounds with reduced concentration in DIR13 overexpressing lines: (1) m / z 540.24; Lariciresinol 4-O-glucoside, MNH : (2) m / z 373.14 Syringin, MH+. (B) Changes in endogenous lignan and neolignan levels in dir 13-5 mutants compared to WT Col-0. Metabolites were extracted from roots of 10-day-old WT Col-0 and dir 13-5 seed plants and detected by HPLC-MS / MS. Data are shown relative to WT Col-0 and are the mean of a representative experiment. Error bars indicate + / - SE, (n = 6). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and dir 13- 5 based on the multiple Mann-Whitney test. (*p < 0.05, **p < 0.01). Molecular weight (m / z) and predicted identity of compounds with increased concentration in the dir 13-5 mutant line: (1) m / z 1027.5499; (2) m / z 967.5295; (3) m / z 824.5453; (4) m / z 1072.2485; (5) m / z 905.4538; (6) m / z 277.1826. Molecular mass (m / z) and predicted identity of compounds with reduced concentration in the dirl3-5 mutant line: (1) m / z 469.081, G(8-O-4)FA Sulfate, Lignan or neolignan; (2) m / z 505.1358 Lignan or neolignan; (3) m / z 827.4372; (4) m / z 389.1247, guaiacylglycerol-beta-ferulic acid ether, Lignan or neolignan; (5) m / z 755.452; (6) m / z 725.4405; (7) m / z 775.2468 Lignan or neolignan; (8) m / z 551.1775, beta-D-Glucopyranoside, 2- methoxy-4-[tetrahydro-3 a,6a-dihydroxy-4-(4-hydroxy-3-methoxyphenyl)-lH,3H-furo[3,4-c]furan-l- yl]phenyl, Lignan or neolignan; (9) m / z 493.1182.

[0035] Figure 8. Overexpression of DIR13 increases plant salinity tolerance. (A, B) Seed germination rates of 35S.DIR13 #6, 35S.DIR13 #8 (A), and dirl3-5 (B) transgenic plants after salt stress. The germination rate was recorded for 7 days after stratification in the presence of 150 mM NaCl. Data shown are means of three independent experiments, error bars indicate + / - SE, (n > 100). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and 35S.DIR13 (A) and between WT Col-0 and dirl3-5 (B) by two-way ANOVA and Dunnetfs HSD test (*p < 0 .05, **p < .01). (C, D) Overexpression of DIR13 promotes lateral root growth in the presence of salt. The average number of emerged lateral roots (C) and their total length per root plant (D) were measured 9 days after transfer of root plants to medium with 150 mM NaCl. Petri dishes were scanned using a tabletop scanner (Epson Perfection V700) and measurements were made manually using Image J 1.53m. Data shown are means of a representative experiment + / - SE, (n > 38). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and 35S.DIR13 based on analysis by mixed-model ANOVA followed by Tukey's HSD test (*p < 0.05, **p < 0.01). Numbers in rectangles indicate relative difference to WT Col-0 in percent. (E, F) Deficiency in DIR13 increases sensitivity of lateral root growth to salinity. The average number of lateral roots (E) and their total length per root plant (F) were measured 9 days after transfer of WT Col-0 and dir 13-5 root plants to 150 mM NaCl medium. Petri dishes were scanned using a tabletop scanner (Epson Perfection V700) and length measurements were made manually using Image J 1.53m. Data shown are means of a representative experiment + / - SE, (n > 40). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and dirl3-5 based on mixed-model ANOVA followed by Sidak's HSD test (*p < 0.05, **p < 0.01). Numbers in rectangles indicate the relative difference to WT Col-0 in percent. (G, H) Phenotypes of 8- week-old WT Col-0 and 35S.DIR13 #8 plants growing under short-day conditions after 4 weeks of progressive salt treatment (application of increasing concentrations of NaCl each week - 100, 150, 200, and 300 mM, in that order). Scale bar corresponds to 1 cm. (I) Quantification of the basal fluorescence ratio (Fv / Fm) in WT Col-0 and 35S.DIR13 #8 transgenic plants after 23 days of progressive salt stress application. Data are means of a representative experiment. Error bars indicate + / - SE, (n > 5). Asterisks indicate statistically significant differences at p < 0.05 between WT Col-0 and 35S:DIR13 #8 based on two- way ANOVA followed by Sidak's HSD test (**p < 0.01). Figure 9. Overexpression of DIR13 increases plant drought tolerance. (A) Phenotype of 8-week-old Col-0 WT and 35S.DIR13 #8 plants grown under normal short-day conditions. Scale bar represents 1 cm. (B) Representative snapshot of the phenotype of regenerating plants after 5 days of rewatering of 8-week-old drought-stressed Col-0 WT and 35S:DIR13 #8 plants. (C, D) The percentage of wilted plants (C) was calculated 3 weeks after the end of watering, the percentage of regenerated plants (D) was calculated 5 days after the resumption of irrigation. Data shown are the mean of three independent experiments. Error bars indicate + / - SE, (n = 45). Asterisks indicate statistically significant differences at p < 0.05 between Col-0 WT and 35S.DIR13 #8 based on analysis by one-way ANOVA and Dunnetfs HSD test (*p < 0.05). (E, F) Plant rosette area (in mm2) (E) and maximum quantum yield efficiency (Fv / Fm) of photosystem II (F) were quantified in Col-0 WT and 35S.DIR13 #8 during the stress phase of regeneration. Data shown are the result of a representative experiment. Error bars indicate + / - SE, (n = 13). Asterisks indicate statistically significant differences at p < 0.05 between Col-0 WT and 35S.DIR13 #8 based on one-way ANOVA followed by Dunnett's HSD test (*p < 0.05, **p < 0.01).

[0036] Figure 10. Overexpression of DIR13 increases the accumulation of reactive oxygen species in root cells in response to salinity stress. (A) Reactive oxygen species (ROS) production analyzed using the fluorescent dye H2DCFDA in 7-day-old Col-0 WT, 35S.DIR13 #8 and dir 13-5 seedlings under control conditions (0 mM NaCl, 0.1% DMSO), after 30 min treatment with 150 mM NaCl, after 5 pM BAP treatment for 2 h and BAP treatment for 2 h followed by 30 min application of 150 mM NaCl. Figure shows representative confocal images, signal specific for H2DCFDA is shown in light grey (highlighted by white arrowheads). Scale bar represents 20 pm. (B) Observation of ROS production was performed in the differentiation zone of the root, schematically indicated by the green square. (C) Quantification of H2DCFDA fluorescence after 30-min treatment with 0 or 150 mM saline and 5 pM BAP or 5 pM BAP plus 150 mM NaCl in Col-0 WT, 35S.DIR13 #8, and dirl3-5. Data show median and upper and lower quartiles of three independent experiments (n > 20). Asterisks indicate statistically significant differences at p < 0.05 between Col-0 WT, 35S.DIR13 #8 and dir 13-5 based on mixed-model ANOVA followed by Tukey's HSD test. (*p < 0.05, **p < 0.01, ***p < 0.001).

[0037] Examples

[0038] Example 1: AtDIR13 is expressed in all root cell types and is induced by cytokinins.

[0039] To determine the spatiotemporal localization of DIR13 expression, we created a gene construct containing a transcriptional fusion of the gene promoter (pl)IRI3) with the sequence encoding the nuclear localization signal and three copies of green fluorescent protein (GFP; pDIRl 3-NLS-3xGFP). We transformed this construct into Arabidopsis thaliana using Agrobacterium tumefaciens and selected stable, single-copy T3 homozygous lines that were used for subsequent analyses. By observing seedlings of Arabidopsis transgenic lines carrying pDIRl 3-NLS-3xGFP , we found that the pDIR13 promoter is active mainly in the root and from an early developmental stage (1 day after germination, 1 DAG, Fig. 1A), very weak activity was detectable in the apical shoot apical meristem (SAM, Fig. IB). pDIR13 activity is detectable in the region of the so-called transient zone towards the root-shoot junction in all root cell types including root hairs (Fig. 1C, 2A). Later (7 G. G). pDIRl 3 activity was also observed in lateral root primordia (Fig. 2B). It was previously predicted that DIR13 could be a direct target of a cytokinin signaling pathway, specifically the cytokinin-activated transcription factor ARR1 (Taniguchi, M., et al. (2007). Plant Cell Physiol 48, 263- T1T, Bhargava, A., et al. .(2013). Plant Physiology 162, 272-294). Using RT-qPCR quantification of DIR13 expression in wild-type (WT Col-0) Arabidopsis roots, we demonstrated the ability of exogenous cytokinins (5 pM BAP) to increase DIR13 expression (Fig. 2C). Accordingly, we observed a reduction in DIR13 expression in mutants defective in the cytokinin signaling pathway (mutants in type-B ARR genes, Fig. 2D). These results were confirmed by spatiotemporal analysis of DIR13 expression using a line carrying pDIRl 3-NLS-3xGFP , where we found that cytokinins are able to activate pDIR13 in the root meristematic zone, where DIR13 expression is only very weakly detected under normal conditions (Fig. 2E-G).

[0040] Example 2: DIR13 localizes to the endodermis cell wall but is not essential for the formation of Casparian strips.

[0041] We prepared lines carrying a translational fusion of the coding sequence of DIR13 with the red fluorescent protein mCherry under the transcriptional control of the native DIR13 promoter (pDIRl 3 :DIR13-mCherry). Using this line, we found that DIR13 localizes to the cell wall of the endodermis of the differentiation zone of the root (Fig. 3A, B) in the area of the so-called Casparian strips (CS; Fig. 3C). Consistent with the inducibility of the DIR13 promoter by cytokinins (see above), we observed an enhancement of the DIR13- mCherry signal in the root endodermis after treatment with 5 pM BAP (Fig. 3D, E). Localization of DIR13 was also observed at the periphery of lateral root primordia (Fig. 3F-I). In light of the observation of the localization of DIR13 protein to the area of CS, our study focused on investigating the impact of overexpression and deficiency of DIR13 on the development and organization of CS. To assess CS structure, we performed lignin autofluorescence visualization experiments (Fig. 4 A-F) and histological staining with basic fuchsin (data not shown). Both in the case of the mutant deficient in DIR13 (dirl3-5) and in the case of the line with increased expression of DIR13 (35S. DIRI 3 #8), we did not observe any visible changes in the structure of CS. As a positive control, we used esbl-1 and caspl-l;3-l mutants, in which the loss of the well-organized structure of CS was previously described (Hosmani, P. S., et al. (2013). Proc Natl Acad Set USA 110, 14498- 14503). Furthermore, we performed propidium iodide (PI) staining as a functional test of a potential delay in the formation of an effective apoplastic barrier. In the case of dir 13-5, the formation of CS occurred 2 cells higher towards the root / shoot junction and therefore slightly later compared to WT Col-0 (Fig. 4 G-I). However, this delay did not lead to visible changes in the organization or disruption of the morphology of the CS. This suggests only a weak effect compared to the caspl-l;3-l or esbl-1 mutants, which show a delay of more than 15 cells in Casparian strip formation (Fig. 4 I-O).

[0042] Example 3: Preparation and molecular characterization of lines deficient in DIR13 and lines with increased expression of DIR13.

[0043] To investigate the functional importance of DIR13 in plant growth and development, we generated stable transgenic lines overexpressing DIR13 in a wild-type (WT Col-0) genetic background. The coding sequence (CDS) of the DIR13 gene was amplified by PCR from gDNA with primers containing adaptor sites to introduce the desired fragment into the pPLV26 LIC vector containing an expression cassette with the cauliflower mosaic virus 35S rRNA promoter, allowing strong constitutive gene expression (Fig. 5). The primers Prl-Fw 5-3 (5'-TAGTTGGAATAGGTTCATGGCAAACCAAATCTACATAATCTCC TTGATC-3', SEQ ID NO: 1) and Pr2-Rw 5-3: (AGTATGGAGTTGGGTTCCTAATAGTAA CATTCATAGAGTTTAATATCCATTTGACACG, SEQ ID NO: 2) were used to amplify the coding sequence of DIR13. The resulting plasmids were transformed using standard protocols into Escherichia coli DH5a cells and further into electrocompetent Agrobacterium tumefaciens GV3101 containing the helper plasmid pGreen pSOUP (Hellens, R., et al. (2000). Trends Plant Sci 5, 446-451) and plated on LB plates with kanamycin (50 pg / ml antibiotic). Transgenic plants were obtained using the "floral dip" protocol (Zhang, X., et al. (2006). NatProtoc 1, 641-646).

[0044] For the preparation of lines with excessive production of DIR13 and / or its orthologs in various crops, it is possible to use other promoters allowing strong constitutive overexpression of the given sequence [e.g. RPS5A (Moore, I., et al. (2006). Plant J 45, 651-683), PD7 (Jiang, P„ et al. (2018). BMC Biotechnol 18, 59) and other, commonly known and used promoters]. Alternatively, systems for chemically regulated expression of transgenes can also be used, e.g. the dexamethasone-inducible system pOp6-LhG4 (Samalova, M., et al. (2005). Plant J 41, 919-935; Craft, J., et al. (2005). Plant J 41, 899-918) or estradiol- inducible systems based on the XVE promoter (Zuo, J., et al. (2000). Plant J 24, 265-273; Brand, L., et al. (2006). Plant Physiol 141, 1194-1204).

[0045] T3 homozygous lines 35S.DIR13 #6 and 35S.DIR13 #8 with high expression levels (33- and 85-fold increase in DIR13 expression compared to WT Col-0, Fig. 6A) were selected for further research. Three independent T-DNA insertion mutants in DIR13, dirl 3-1 , dir!3-2 and dirl3-3 have insertional mutations located in the 3'UTR and promoter regions, respectively (Fig. 6B top). Using RT-qPCR analyses, a residual level of DIR13 expression was still detectable in the dir 13-1, dir 13-2 and dirl 3-3 mutants, indicating that they are knock-down (not knock-out) mutants (Fig. 6C). To generate a knock-out mutant completely deficient in DIR 13. we used a CRISPR-Cas9 genome editing system with two sgRNAs, allowing for a deletion between nucleotides 128 and 1036 of the DIR13 coding sequence (Fig. 6B bottom). We obtained two independent lines, which were named dirl3-4 and dirl3-5, producing no or a truncated DIR13 transcript. The absence of DIR13 transcript in homozygous dir 13-4 and dir 13-5 mutants was confirmed by semiquantitative RT-PCR (Fig. 6D). To rule out possible functional redundancy within the DIR family, we checked the expression level of the closest DIR13 homologues, the DIR6, DIR10 / ESB1 and DIR14 genes, both in lines with overexpression of DIR13 (35S:I)IRI 3) and in the mutant line dir 13-5. RT-qPCR results showed no change in expression level for these genes (Fig. 6E). Other close homologs DIR5 and DIR12 were not included in this experiment because they are not expressed in the plant root (Kim, K. W., et al. (2012). J Biol Chem 287, 33957-33972; Yonekura-Sakakibara, K„ et al. (2021). Plant Cell 33, 129-152).

[0046] Example 4: Increased expression of DIR13 leads to increased endogenous levels of lignans and neolignans.

[0047] According to the protocol of Routaboul et al. (Routaboul, J.M., et al. (2006). Planta 224, 96-107) with some modifications, the phenolic compounds were isolated from plants of the standard type (WT Col-0) as well as from lines with increased expression of DIR13 (35S:DIR13 #6 and 35S:DIR13 #8) and mutants deficient in DIR13 expression (dir 13-5). and subsequently used for analysis by HPLC-MS / MS. Using this method, we found that lines with increased expression of DIR13 demonstrate upregulated production of a range of lignans and neolignans (representing 8 of the 11 compounds with the highest increase in DIR13 OE vs. WT Col-0, Fig. 7A). In contrast, in the case of a line deficient in DIR13 production, there was a reduction in the production of endogenous lignans (Fig. 7B).

[0048] Example 5: Plants with increased expression of DIR13 show increased tolerance to salinity and drought Since dirigent genes are associated with (a)biotic stress responses [see chapter Current state of the art and (Paniagua, C., et al. (2017). J Exp Bot 68, 3287-3301)], we decided to test the possible change in sensitivity of plants with increased expression of DIR13 (35S.DIR ! 3) and mutants deficient in DIR13 expression (dir 13-5) to abiotic stresses compared to plants of the standard type (WT Col-0).

[0049] Germination rates of WT Col-0, 35S.DIR13 #6 and 35S.DIR13 #8 were measured daily for 1 week in the presence of 0 - 150 mM NaCl. Under control conditions (0 mM NaCl), germination of transgenic seeds was not significantly different from WT Col-0 (data not shown). With increasing salt concentrations, germination was inhibited in all tested lines. However, germination rates of lines 35S.DIR13 #6 and 35S.DIR13 #8 were significantly higher than WT Col-0, with the most significant difference observed at 150 mM NaCl (Fig. 8A). In contrast, seed germination of the dirl3-5 mutant was more sensitive to NaCl at 150 mM, whereas under control conditions and with 50 and 100 mM NaCl, germination rates of both mutants and WT Col-0 were comparable (Fig. 8B).

[0050] Next, we investigated the effects of salt treatment on root growth. WT Col-0, 35S:DIR13 #6 and 35S:DIR13 #8 and dir 13-5 seeds were grown under normal conditions for 5 days. Then, the seed plants were transferred to Petri dishes containing medium with 0 or 150 mM NaCl and cultured for another 7 days. Compared to the control, the presence of 150 mM NaCl significantly reduced the length of the primary root as well as the number of lateral roots in all tested lines. Compared to WT Col-0, however, the primary root in lines 35S:DIR13 #6 and 35S:DIR13 #8 was 27% and 13% longer, whereas the dirl3-5 line had a root on NaCl medium 18% shorter than WT Col-0 (data not shown). In addition, the 35S.DIR13 #6 and 35S.DIR13 #8 lines had a higher number and length of lateral roots compared to WT Col-0 under salt stress conditions (Fig. 8C, D). In contrast, the dir 13-5 mutant line showed a reduced number of lateral roots that were shorter (Fig. 8E,F).

[0051] Further, we tested the effect of DIR13 expression on the response to salt stress in plants growing in soil. 4- week-old WT Col-0 and 35S.DIR13 #8 plants grown under normal conditions (without salinity stress) were watered every 7 days for an additional 4 weeks with increasing salt concentrations (100, 150, 200, and 300 mM NaCl), as control was used irrigation with clean water. In the absence of stress, growth and development of both WT Col-0 and 35S.DIR13 #8 were normal and comparable (data not shown). Plants of the standard type (WT Col-0) started to turn yellow under salinity conditions. In contrast, 35S.DIR13 #8 plants had still green leaves (Fig. 8G, H). The visual phenotype of leaf yellowing was quantified by measuring the ratio of variable (Fv) to maximum (FM) fluorescence (FV / FM) of photosystem II and thus photosynthetic efficiency (Garcia, A., et al. (2023). New Phytol 237, 60-77 ). This parameter was significantly higher under salt stress conditions in 35S.DIR13 #8 compared to wild-type plants (Fig. 81). After salt stress treatment, almost all 35S.DIR13 #8 plants survived, whereas only 44% of WT Col-0 survived (data not shown), dir 13-5 plants did not show a statistically significant difference in salt tolerance compared to WT Col-0 (data not shown).

[0052] The above findings clearly show that overexpression of DIR13 promotes tolerance to salinity stress during seed germination, root growth, and photosynthetic efficiency.

[0053] We also analyzed the effect of DIR13 expression on drought tolerance. Four-week-old plants grown in soil under short-day conditions were exposed to a 3 -week drought. After this period, the plants were watered again and a recovery phase followed for another 5 days (Fig. 9 A, B). 35S.DIR13 plants showed higher resistance to desiccation as demonstrated by a lower percentage of wilted plants as well as a higher survival rate compared to Col-0 WT during the recovery phase (Fig. 9C, D). To obtain more information about the stress adaptation of plants with increased DIR13 expression, we used an automatic phenotyping platform (PlantScreen™ SC Root System) to monitor the studied genotypes during the drought stress experiment. 35S.DIR13 #8 plants showed a higher level of stress tolerance as indicated by a larger rosette area during the drought stress phase compared to Col-0 WT plants. This difference was even more striking during the recovery phase when 35S.DIR13 #8 plants showed a higher shoot growth rate (Fig. 9E). Moreover, a higher efficiency (maximum quantum yield) of photosystem II was found in 35S.DIR13 #8 plants during the recovery phase, indicating more productive photosynthesis (Fig. 9F).

[0054] Together, these data show that DIR13 positively regulates acclimation to abiotic stresses and plays an important role in plant responses to environmental fluctuations.

[0055] Example 6: Increased expression of DIR13 increases the ability of plants to respond to drought.

[0056] Salinity stress triggers the accumulation of intracellular reactive oxygen species (ROS) (Das, K., et al. (2014). Front Env Sci-Switz 2). To investigate the level of ROS production in DIR13 overexpressing and dirl3-5 mutant plants after application of salt stress, we used a general ROS sensor, 2', 7'- dichlorodihydrofluorescein diacetate (H2DCFDA), forming the highly fluorescent 2', 7' compound dichlorofluorescein [ DCF; (Ubezio, P., et al. (1994). Free Radical Bio Med 16, 509-516)]. We analyzed ROS production in salinity-stressed roots in epidermal and cortical cells of the differentiation zone and by quantifying the DCF signal in salinity-stressed and control roots (Fig. 10A, B). Since DIR13 expression is cytokinin-inducible and overproduction of endogenous cytokinins has previously been reported to increase ROS accumulation in response to salinity stress in both roots and shoots (Wang, Y., et al. (2015). Front Plant Sci 6, 1004), we also investigated the possible effect of exogenous BAP application on ROS production in the presence or absence of 150 mM NaCl. We found that even in control conditions, the basal level of ROS production was significantly higher in seedlings with increased production of DIR13 (35S:DIR13) and, conversely, lower in dir 13-5 mutants compared to Col-0 WT. Application of 150 mM NaCl increased ROS levels in all genotypes tested, but much more so in 35S.DIR13 roots (Fig. 10C). The basal level of ROS production after quantification of the fluorescence signal in the case of exogenous BAP treatment was at the same level for Col-0 WT and dir 13-5, but in the case of 35S.DIR13 we observed a 2.5- fold higher change. Finally, the combination of hormonal treatment with salt stress resulted in the same increase in the level of ROS generation in Col-0 WT and dir 13-5 as seen with salinity stress alone, but was significantly higher in 35S.DIR13 roots (Fig. 10 C).

[0057] In conclusion, we can summarize that overexpression of DIR13 increases the ability of plants to respond to stress by producing ROS, and this type of response is positively regulated by cytokinins.

Claims

CLAIMS1. A method for increasing the resistance of a plant to abiotic stress, in particular to drought and soil salinity, said method comprising the step of increasing the expression of the DIR13 gene or its ortholog or its homolog in the plant.

2. The method according to claim 1, wherein the expression of the DIR13 gene or its ortholog or its homolog is increased by inserting additional copies of the gene DIR13 or its ortholog or its homolog into the plant, preferably under the control of promoters increasing the level of expression, and / or by applying expression activators, especially transcription activators, of a given gene onto the plant.

3. The method according to claim 1, wherein the expression of the DIR13 gene or its homolog or ortholog in the plant is increased by first amplifying the coding and / or genomic sequences of the DIR13 gene or its homolog or its ortholog using primers that anneal to 5' and 3' end of the coding sequence; subsequently, the coding and / or genomic sequences of the DIR13 gene or its homolog or its ortholog are cloned into a vector with a suitable expression cassette containing a strong constitutively active promoter, preferably CaMV 35S or RPS5A, or a promoter enabling chemically regulated expression of transgenes, preferably the dexamethasone-inducible system pOp6-LhG4 or estradiol-inducible systems based on the XVE promoter; and then the said vector is transformed into the plant.

4. The method according to any of claims 1 to 3, wherein at least one exogenous cytokinin is applied to the plant simultaneously with or subsequently to the increase in the expression of the DIR13 gene or its homolog or its ortholog.

5. The method according to any one of claims 1 to 3, wherein simultaneously with the increase in the expression of the DIR13 gene or its homolog or its ortholog in the plant, the expression of at least one gene for the biosynthesis of endogenous cytokinins, preferably IPT or LOG, is increased, or the expression of at least one gene for enzyme mediating degradation of cytokinins, preferably CKX, is decreased.

6. The method according to any one of claims 1 to 5, wherein the plant is a cruciferous plant.

7. A plant with increased resistance to abiotic stress, in particular to drought and soil salinity, wherein the said plant contains inserted additional copies of DIR13 gene or its ortholog or its homolog to increase the production of the protein encoded by this gene.

8. The plant according to claim 7, wherein the plant is a cruciferous plant.

Images