Application of OsMGD protein in regulating rice seedling stage alkali tolerance

By regulating the expression of rice OsMGD protein and knocking out the coding gene of OsMGD protein using CRISPR/Cas9 technology, the problem of insufficient alkali tolerance in rice seedlings was solved, and the alkali stress tolerance and growth capacity of rice were significantly improved.

CN116024257BActive Publication Date: 2026-06-23INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2022-10-21
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the alkali tolerance of rice, especially its resistance to alkali stress during the seedling stage, leading to limited growth and reduced yield.

Method used

By regulating the expression or activity of the OsMGD protein in rice, and using CRISPR/Cas9 technology to knock out the gene encoding the OsMGD protein, the expression or activity of the OsMGD protein in the rice genome can be reduced, thus cultivating rice varieties with stronger alkali resistance.

Benefits of technology

It significantly improved the physiological tolerance of rice under alkaline stress, reduced the physiological damage of alkaline stress to rice, and enhanced the growth capacity of rice seedlings.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003902211800000051
    Figure BDA0003902211800000051
  • Figure BDA0003902211800000061
    Figure BDA0003902211800000061
  • Figure BDA0003902211800000071
    Figure BDA0003902211800000071
Patent Text Reader

Abstract

The application discloses application of OsMGD protein in regulating rice seedling stage alkali tolerance, and belongs to the technical field of genetic engineering breeding. The technical problem to be solved by the application is how to improve plant stress resistance, for example, how to improve rice alkali tolerance. To solve the above technical problem, the application provides application of a protein or a substance for regulating expression of a gene coding the protein or a substance for regulating activity or content of the protein, and the application can be application of the protein or the substance for regulating expression of the gene coding the protein or the substance for regulating activity or content of the protein in regulating plant stress resistance. The protein can be a protein with an amino acid sequence of SEQ ID No. 1. The application first discloses application of the OsMGD protein in regulating rice alkali tolerance, and regulating expression amount or activity of the OsMGD protein in rice plants can obtain rice with significantly changed alkali tolerance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering breeding technology, specifically involving the application of OsMGD protein in regulating alkali tolerance in rice seedlings. Background Technology

[0002] Rice is an important food crop in my country, but rice production is frequently subjected to various abiotic stresses. Among these, soil salinization is one of the most severe abiotic stresses that limits rice growth and development, ultimately leading to yield reduction. The impact of alkali stress on rice growth varies with the growth stage, and the sensitivity of rice to alkali stress differs at different stages. The damage caused by alkali stress during the rice bud stage is mainly manifested in inhibited seed germination, leading to decreased root vigor, yellowing and bending of bud tips (Qi Dongling et al., 2007; Du Zhiqiang et al., 2017; Leng Chunxu et al., 2020). Alkali stress during the rice seedling stage results in stunted growth, decreased chlorophyll content, accelerated leaf senescence and death (Zhang Lili et al., 2011; Zhao Haixin, 2012). When rice is subjected to alkali stress during its reproductive growth stage, tillering and elongation are affected, heading is delayed, leading to a prolonged heading period, reduced grain filling rate, and ultimately yield reduction (Liang Zhengwei et al., 2004). Rice at the two-leaf-one-heart stage and the young panicle differentiation stage is usually most sensitive to alkali stress.

[0003] Currently, there are four main methods for identifying rice alkali tolerance: laboratory identification, greenhouse cultivation identification, artificial field identification, and natural field identification (Xing Jun, 2015). Due to space limitations, laboratory identification is usually used to identify rice alkali tolerance during the bud stage. Greenhouse cultivation identification generally uses pots or seedling trays to identify alkali tolerance, which can control the plant growth environment, but the number of plants is limited. Some researchers have used artificial saline-alkali ponds to simulate saline-alkali environments for identifying rice salt-alkali tolerance (Cheng Guangyou et al., 1994; Liang Yinpei, 2017). Traditional natural field identification methods usually involve planting rice in natural saline-alkali soil environments or irrigating with prepared saline-alkali water. However, due to uncontrolled climate change and uneven stress in saline-alkali soil, it is difficult to accurately evaluate rice salt-alkali tolerance.

[0004] Different concentrations of alkali stress have varying effects on the alkali tolerance assessment of rice at different growth stages. When simulating alkaline soil environments, the high CO3 content in alkaline soils is taken into account. 2- and HCO3 -Alkali stress is often simulated using Na₂CO₃, NaHCO₃, and Na₂CO₃+NaHCO₃. Qi Dongling et al. (2006) used five concentration gradients of Na₂CO₃ (0%, 0.05%, 0.10%, 0.15%, and 0.20%) to assess the alkali tolerance of rice during the budding stage. They concluded that the optimal alkali stress concentration for assessing alkali tolerance during the budding stage is 0.15%-0.20%, and the optimal concentration for assessing alkali tolerance in the early seedling stage is 0.10%-0.15%. This provides a reliable basis for selecting the conditions for assessing alkali tolerance of rice germplasm resources during the budding and seedling stages.

[0005] In recent years, researchers have mostly focused on the alkali tolerance identification of rice during the germination and seedling stages. Whether rice can germinate under alkali stress affects its subsequent normal growth; therefore, germination rate, germination potential, germination index, root number, root length, seedling height, and seedling dry weight are considered evaluation indicators for alkali tolerance identification during the germination stage (Sun Xingrong et al., 2021; Wu Qi et al., 2021). There are many evaluation indicators for alkali tolerance during the seedling stage, such as seedling height, aboveground and underground fresh and dry weight, alkali damage level, and survival days (Wang Ying et al., 2017). Indicators measured at maturity are mainly related to yield, such as the three components of yield: number of panicles, number of grains per panicle, and thousand-grain weight (Guo Wei, 2019). Summary of the Invention

[0006] The technical problem to be solved by this invention is how to improve the stress resistance of plants, specifically, how to improve the salt tolerance of rice.

[0007] To address the first aspect of the aforementioned technical problem, the present invention provides the application of a protein, a substance regulating the expression of the protein-coding gene, or a substance regulating the activity or content of the protein, wherein the application may be any of the following:

[0008] D1) The application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in regulating plant stress resistance.

[0009] D2) The application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in the preparation of products that regulate plant stress resistance.

[0010] D3) The application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in the preparation of products for cultivating stress-resistant plants;

[0011] D4) The application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in plant breeding.

[0012] The protein may be A1), A2), or A3):

[0013] A1) The amino acid sequence of this protein is that of SEQ ID No. 1;

[0014] Proteins obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequences shown in A2) and A1) have more than 80% identity with the protein shown in A1) and are related to plant stress resistance.

[0015] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0016] In the above applications, the stress resistance can refer to the plant's resistance to abiotic stresses. Examples include low temperature, high temperature, drought, salinity, alkali, flooding, excessive light, ultraviolet radiation, mineral nutrient deficiency, oxygen deficiency, strong winds, damage, and air, soil, or water pollution such as heavy metals, pesticides, ozone, and sulfur dioxide pollution.

[0017] In the above applications, the purpose of plant breeding may be to cultivate stress-resistant plants.

[0018] Specifically, in the above applications, the purpose of plant breeding may be to cultivate alkali-tolerant rice.

[0019] In this invention, SEQ ID No.1 consists of 508 amino acid residues.

[0020] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0021] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0022] Furthermore, in the above applications, the protein can be derived from rice.

[0023] Furthermore, in the above applications, the stress resistance can be alkali resistance.

[0024] Furthermore, in the above applications, the plant can be any of the following:

[0025] P1) Monocotyledons,

[0026] P2) Plants of the order Poales,

[0027] P3) Gramineae plants,

[0028] P4) Rice plants,

[0029] P5) Rice.

[0030] Furthermore, in the above applications, the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein can be a biological material, which can be any one of B1) to B9) below:

[0031] B1) Nucleic acid molecules that encode the above proteins;

[0032] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0033] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0034] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0035] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0036] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0037] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0038] B8) Nucleic acid molecules that inhibit or reduce the expression of the genes encoding the aforementioned proteins or nucleic acid molecules that inhibit or reduce the activity of the aforementioned proteins.

[0039] B9) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0040] Furthermore, in the above applications, the nucleic acid molecule described in B1) can be a DNA molecule as shown in any of the following b1) to b3):

[0041] b1) The coding sequence of the coding strand is the DNA molecule shown in SEQ ID No. 2;

[0042] b2) The nucleotide sequence of the coding strand is the DNA molecule shown in SEQ ID No. 3;

[0043] b3) has 80% or more identity with the nucleotide sequence defined by b1) or b2) and is a DNA molecule encoding the protein;

[0044] Furthermore, in the above applications, the nucleic acid molecule described in B8) may be a DNA molecule expressing gRNA targeting the protein-coding gene or gRNA of the protein-coding gene.

[0045] The target sequence of the gRNA is: 5'-GCATGTGCAGCTATGGAAGG-3' (SEQ ID No. 3, positions 821-840).

[0046] To address the aforementioned technical problems, in a second aspect, the present invention provides a method for improving the alkali tolerance of plants, comprising reducing or downregulating the expression of the protein-coding genes or reducing or downregulating the activity or content of the proteins in the recipient plant, thereby obtaining a target plant with higher alkali tolerance than the recipient plant.

[0047] Furthermore, in the above method, the recipient plant is rice, and the reduction or downregulation of the expression of the protein-coding gene or the reduction or downregulation of the protein activity or content in the recipient plant is achieved by performing at least one of the following mutations on the DNA molecule in the rice genome whose nucleotide sequence is SEQ ID No. 3:

[0048] M1) Insert nucleotide A between nucleotides 837 and 838 of sequence 3 in the sequence listing of the rice genomic DNA;

[0049] M2) Inserts nucleotide T between nucleotides 837-838 of sequence 3 in the sequence listing of the rice genomic DNA.

[0050] To address the aforementioned technical problems, in a third aspect, the present invention provides a method for preparing alkali-tolerant plants, comprising reducing or downregulating the expression of the protein-coding gene or reducing or downregulating the activity or content of the protein in the recipient plant, thereby obtaining a target plant with higher alkali tolerance than the recipient plant.

[0051] Further, in the above method, the recipient plant is rice, and the reduction or downregulation of the expression of the protein-coding gene or the reduction or downregulation of the protein activity or content in the recipient plant is achieved by performing any of the following mutations on the DNA molecule in the rice genome whose nucleotide sequence is SEQ ID No. 3:

[0052] M1) Insert nucleotide A between nucleotides 837 and 838 of sequence 3 in the sequence listing of the rice genomic DNA;

[0053] M2) Inserts nucleotide T between nucleotides 837-838 of sequence 3 in the sequence listing of the rice genomic DNA.

[0054] The M1 mutation causes the insertion of nucleotide A at positions 496-497 of the coding sequence of the target protein, namely sequence 2 in the sequence listing, resulting in a frameshift mutation that causes premature termination of translation, thereby knocking out the OsMGD protein.

[0055] The M2 mutation causes the insertion of nucleotide T at positions 496-497 of the coding sequence of the target protein, i.e., sequence 2 in the sequence listing, resulting in a frameshift mutation that leads to premature termination of translation, thereby knocking out the OsMGD protein.

[0056] To address the aforementioned technical problems, in a fourth aspect, the present invention provides the aforementioned protein and the aforementioned biological material.

[0057] In this invention, identity refers to the similarity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0058] In the above applications, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0059] In the aforementioned biological materials, the expression cassette described in B2) refers to DNA capable of expressing the aforementioned proteins in host cells. This DNA may include not only promoters that initiate gene transcription but also terminators that terminate gene transcription.

[0060] In the aforementioned biological materials, the recombinant vector described in B3) may contain the DNA molecule shown in SEQ ID No. 2 for encoding the aforementioned protein.

[0061] Plant expression vectors carrying the protein-coding genes described in this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant cells or tissues can be cultured into plants.

[0062] Among the aforementioned biological materials, the recombinant microorganisms mentioned in B4) can specifically be yeast, bacteria, algae, and fungi.

[0063] Among the aforementioned biological materials, the plant tissues described in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0064] Among the aforementioned biological materials, the transgenic plant organs described in B7) can be the roots, stems, leaves, flowers, fruits, and seeds of transgenic plants.

[0065] Among the aforementioned biological materials, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0066] The beneficial technical effects achieved by this invention are as follows:

[0067] 1) This invention discloses for the first time the correlation between rice OsMGD protein and rice seedling alkali tolerance, and provides the application of OsMGD protein in regulating rice seedling alkali tolerance;

[0068] 2) The alkali-tolerant rice obtained by the method of the present invention can significantly reduce the physiological damage caused by alkali stress to rice in hydroponic experiments compared with the wild type, and significantly improve the alkali tolerance of rice. Attached Figure Description

[0069] Figure 1 Phenotypic analysis of alkali tolerance traits in rice seedlings.

[0070] Figure 2 This represents the GWAS results of alkali tolerance-related traits in the overall population during the seedling stage.

[0071] Figure 3 This is the GWAS result of alkali tolerance-related traits in a subpopulation of indica rice during the seedling stage.

[0072] Figure 4 This is the GWAS result of alkali tolerance-related traits in a subpopulation of japonica rice during the seedling stage.

[0073] Figure 5 Venn diagram showing the GWAS association results among the overall population, indica rice, and japonica rice.

[0074] Figure 6 Analysis of candidate genes within locus 10.

[0075] Figure 7 For the detection of mutation types at the OsMGD target site.

[0076] Figure 8 To identify the alkali tolerance of OsMGD mutant seedlings.

[0077] Figure 9 The results represent the seedling survival rates of wild-type and mutant strains under alkaline stress. Detailed Implementation

[0078] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0079] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0080] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. * indicates a significant difference (P < 0.05), ** indicates a highly significant difference (P < 0.01), and *** indicates a highly significant difference (P < 0.001).

[0081] Example 1: Identification of Alkali Tolerance in Rice Seedlings

[0082] 1.1 Experimental Methods

[0083] Thirty-six accessions from the 3K rice germplasm resources were selected to identify rice seedling alkali tolerance. These accessions included 137 indica rice accessions, 166 japonica rice accessions, 1 Aus accession, 1 Basmati accession, and 1 Admix accession (Table 1).

[0084] Table 1. Names and types of 306 rice seedling germplasm resources

[0085]

[0086] Table 1 (continued)

[0087]

[0088] Table 1 (continued)

[0089]

[0090] Table 1 (continued)

[0091]

[0092] Table 1 (continued)

[0093]

[0094] Thirty-six seed samples were dried in a 55℃ oven for 3 days to break dormancy. After disinfection, the seeds were soaked in a 3% sodium hypochlorite solution and rinsed repeatedly with distilled water. Following disinfection, the seeds were hydroponically germinated for 2 days. Once the seeds showed signs of germination, 36 uniform seeds were selected from each sample. The experiment was set up with three replicates, each with 12 seedlings. The seeds were sown in 96-well PCR plates with perforations at the bottom. The PCR plates containing the germinated seeds were then placed in a plastic container filled with water (pH 5.5) and cultured in an artificial climate chamber under the following conditions: 14h light / 10h darkness, temperature 28℃ / 26℃, and humidity 70%. After 7 days of cultivation, the water was replaced with Yoshida nutrient solution (pH 5.5) (YOSHIDA et al., 1976), and cultivation continued. When the seedlings reached the two-leaf-one-heart stage, alkali stress was applied. The alkali solution was Yoshida nutrient solution containing 0.15% Na2CO3, with a pH of around 9.5. The control was Yoshida nutrient solution without 0.15% Na2CO3, with a pH of around 5.5. The solution was changed every 3 days.

[0095] On day 23 of alkali treatment, the alkali toxicity level (SAT) of each line was assessed according to the rice standard evaluation system (CHAUDHARY, 1996), and the seedlings were classified into different levels 1-9 according to the severity of alkali damage (Table 2). Materials with an alkali toxicity level ≤3 were classified as alkali-tolerant, materials with an alkali toxicity level ≥7 were classified as alkali-sensitive, and the remaining materials were classified as intermediate-tolerance materials. Recording began when the first dead seedling appeared in the line, and the seedling survival days (SSD) were calculated using a weighted average after all seedlings had died. The ratio of survival days to alkali toxicity level, i.e., the vegetative index (VGI), was used to comprehensively assess the alkali tolerance of rice seedlings.

[0096] Table 2. Evaluation Criteria for Alkali Damage Levels

[0097]

[0098] 1.2 Experimental Results

[0099] The alkali damage level, survival days, and growth index of 306 materials were determined, and the results are shown in Table 3 and . Figure 1 As shown in Table 3, the statistical data on alkali tolerance-related traits during the seedling stage are presented. Figure 1 Phenotypic analysis of alkali tolerance-related traits in rice seedlings, including... Figure 1 (a) shows the performance of rice under alkali stress in terms of alkali damage level, survival days, and growth index. Figure 1 (b) shows the distribution of alkali tolerance-related traits in the subgroups of indica and japonica rice. Figure 1 (c) is the correlation analysis diagram of alkali tolerance traits in the overall population seedlings. ** and *** represent significance of P < 0.01 and P < 0.001, respectively. Figure 1 The middle (d) diagram shows the correlation analysis of alkali tolerance traits in seedlings of indica rice (top) and japonica rice (bottom).

[0100] Overall, all traits showed wide variation. Figure 1 (a) The average alkali damage level of the total population was 5.65, the average survival days were 26.16 days, and the average growth index was 5.83. Alkali-resistant materials, alkali-sensitive materials, and intermediate alkali-resistant materials were assessed according to the evaluation criteria in Table 2 and the evaluation method in section 1.1. A total of 51 alkali-resistant materials, 109 alkali-sensitive materials, and 146 intermediate alkali-resistant materials were identified. Among them, "NONA BOKRA" had an alkali damage level of 1 on day 23 of alkali stress, while "KHAO KAI" had the longest survival days under alkali stress, at 41.47 days.

[0101] Phenotypic variance analysis between indica and japonica rice populations revealed that the alkali damage level of japonica rice was significantly lower than that of indica rice, while its survival days and growth index were significantly higher, indicating that japonica rice was more alkali-tolerant than indica rice at the seedling stage. Figure 1 (b)). Significant correlations were observed between all three traits, both in the overall population and in the indica-japonica subpopulation. Figure 1 In (c) and (d), the alkali damage level showed a highly significant negative correlation with the survival days and growth index, while the survival days and growth index showed a highly significant positive correlation.

[0102] Table 3. Performance of alkali tolerance-related traits during the seedling stage

[0103]

[0104] Note: SAT: Alkali damage level, SSD: Survival days, VGI: Growth index (SSD / SAT).

[0105] Example 2: Genome-wide association analysis

[0106] 2.1 Experimental Methods

[0107] A 4.8M high-density SNP dataset was downloaded from the Rice SNP Seek database (http: / / snp-seek.irri.org / ) (ALEXANDROV et al., 2015). SNP genotype information for 306 materials was extracted using Plink software (PURCELL et al., 2007), retaining SNP markers with a deletion rate <20% and a minimum allele frequency >5%. After genotype filtering, 2,652,345, 1,946,491, and 1,130,390 SNPs were obtained for genome-wide association analysis (GWAS) of the overall population, indica rice population, and japonica rice population. Based on mixed linear model analysis (MLM), EMMAX (KANG et al., 2010) was used to detect the association between SNPs and alkali tolerance-related traits. The kinship matrix was first calculated using Plink for linked SNP filtering (parameters indep-pairwise 50 10 0.1), followed by calculation using EMMAX (parameters emmax-kin-vhd 10). A GRM matrix was generated using the make-grm module of GCTA software (YANG et al., 2011), and principal component analysis was performed. The first three principal components were extracted and used as covariates to control for population structure. The number of effective independent SNPs N was calculated using GEC software (LI et al., 2012), and the significance threshold (1 / N) of the suggestive P-value was calculated using the Bonferroni correction method. P = 2.51E-06, 2.85E-06, and 8.73E-06 were set as the genome-wide significance thresholds for the total population, indica rice population, and japonica rice population, respectively. Linkage disequilibrium distance (WANG et al., 2018) groups significant SNPs within 300 kb into a single site, and the SNP with the smallest P-value within a single site is defined as the lead SNP.

[0108] 2.2 Experimental Results

[0109] The experimental results are shown in Table 4 and Figures 2-5 As shown in Table 4, the GWAS results of alkali tolerance-related traits in rice seedlings are presented. Figure 2 This represents the GWAS results of alkali tolerance-related traits in the overall population during the seedling stage. Figure 3 This is the GWAS result of alkali tolerance-related traits in a subpopulation of indica rice during the seedling stage. Figure 4 This is the GWAS result of alkali tolerance-related traits in a subpopulation of japonica rice during the seedling stage. Figure 5 Venn diagram of GWAS association results among the overall population, indica rice, and japonica rice, where Figure 5 (a) is a Venn diagram showing significant SNPs among the total population, indica rice, and japonica rice. Figure 5(b) shows the Venn diagram of significant SNPs and their corresponding genes among the total population, indica rice, and japonica rice.

[0110] Genome-wide association analysis (GWAS) was performed on three traits—alkalinity toxicity (SAT), seeding survival days (SSD), and vegetative index (VGI)—in 306 materials using a mixed linear model (MLM). The results were analyzed in the overall population. Figure 2 ), Indica rice population ( Figure 3 ) and japonica rice population ( Figure 4 ) was associated with 90, 514 and 4 significant SNPs, of which 32 SNPs were co-associated in the total population and indica rice subgroups, while no significant SNPs were co-associated between indica and japonica subgroups. Figure 5 (a) Further analysis revealed no overlap between the genes containing significant SNPs detected in the indica and japonica rice populations. Figure 5 (b) suggests that indica and japonica rice may have different genetic mechanisms for alkali tolerance. To reduce redundancy caused by repeated localization of the same locus in different traits, adjacent SNPs within 300kb were defined as a locus. As a result, a total of 44 loci (locus 1-locus 44) were detected in the three traits. Significantly associated loci were detected on all chromosomes except chromosome 9 (Table 4).

[0111] Table 4. GWAS results of alkali tolerance-related traits in rice seedlings.

[0112]

[0113] Table 4 (continued)

[0114]

[0115] Table 4 (continued)

[0116]

[0117] Functional annotation of the genes containing significant SNPs detected in each population revealed no previously reported genes associated with alkali tolerance. However, genes associated with abiotic stress were detected in the overall population and the indica rice subpopulation, namely OsRACK1A, OsNPF7.3, OsNPF7.4, OsZIP6, OsGSTU4, OsBBX6, OsMGD, and OVP3. Additionally, several novel loci highly significantly associated with seedling alkali tolerance were identified, such as SNP rs1_28342694 on rice chromosome 1 (P = 2.34E-07), which was highly significantly associated with alkali damage level; and SNP rs11_17463475 on rice chromosome 11 (P = 7.65E-09), which was highly significantly associated with survival days.

[0118] Among the 44 loci detected, some were associated with multiple traits simultaneously. For example, locus3 on chromosome 1 was significantly associated with alkali damage level, survival days, and growth index in the overall population; in the overall population and the indica rice subpopulation, locus19 and locus40 on chromosomes 4 and 11, respectively, were detected that simultaneously affected survival days and growth index.

[0119] Example 3: Candidate Gene Analysis

[0120] 3.1 Experimental Methods

[0121] Genes meeting at least one of the following criteria were selected as candidate genes for alkali tolerance in seedlings: (1) functionally annotated genes related to salt and alkali stress based on the Nipponbare reference genome IRGSP 1.0 (KAWAHARA et al., 2013) and the funRiceGenes database (YAO et al., 2018); (2) genes corresponding to SNPs simultaneously associated with all three traits; and (3) genes corresponding to SNPs that were highly significantly associated with each trait (P-value < 0.05 / N). If an SNP was located between two genes, the downstream gene was selected.

[0122] Local linkage disequilibrium analysis was performed for each candidate gene using LDBlockshow (DONG et al., 2021). Using Nipponbare as the reference genome, haplotype analysis was performed on non-synonymous SNP mutations in the coding regions of candidate genes (ZHANG et al., 2021). The "agricolae" package in R (DE MENDIBURU, 2017) was used to perform Duncan's multiple range test on differences between different haplotypes (containing at least 10 materials).

[0123] 3.2 Experimental Results

[0124] The experimental results are shown in Table 5 and Figure 6 As shown in Table 5, information on seven candidate genes for alkali tolerance during the seedling stage is presented. Figure 6 For the analysis of candidate genes within locus 10, among which, Figure 6 (a) shows the local Manhattan plot and LD analysis of locus 10 VGI in the total population. The red dots represent the location of the lead SNP rs2_34228991 (candidate gene LOC_Os02g55910). Figure 6 (b) shows the gene structure diagram of LOC_Os02g55910 and the main haplotypes in the CDS region. Figure 6 (c) shows the haplotype analysis results of LOC_Os02g55910 in the total population. The letters on the box plot represent the results of multiple comparisons at the 0.05 significance level. Figure 6 (d) represents the subgroup distribution of the LOC_Os02g55910 haplotype.

[0125] Seven candidate genes were predicted according to the method described in 3.1 (Table 5). Haplotype analysis of these seven candidate genes revealed significant differences in alkali tolerance-related phenotypic traits among different haplotypes of four of them (LOC_Os01g06740, LOC_Os01g49310, LOC_Os02g55910, and LOC_Os04g50950), and these genes were selected as important candidate genes for alkali tolerance in seedlings.

[0126] Table 5. Information on 7 candidate genes for alkali tolerance in seedlings

[0127]

[0128] LOC_Os02g55910 was significantly associated with growth index in the overall population, with an LD interval of 0.17 kb, and contained 5 SNPs ( Figure 6 (a)). Five major haplotypes were found in the total population. Figure 6 In Figure (b), the growth indices of hap1 and hap5 were significantly higher than those of hap3 (Figure (c)). Furthermore, the materials carrying hap1 and hap5 were all japonica rice, while the materials carrying hap3 were all indica rice. Figure 6 The result (d) indicates that this gene exhibits significant differentiation between indica and japonica varieties.

[0129] The genomic sequence of the candidate gene OsMGD is SEQ ID No. 3, wherein exons 210-608 of SEQ ID No. 3 are exons 2, 741-913, 1890-2051, 2153-2294, 2711-2935, 3040-3102, 3208-3282, and 3589-3876. The nucleotide sequence encoding OsMGD is SEQ ID No. 2. The amino acid sequence of the encoded OsMGD protein is SEQ ID No. 1.

[0130] Example 4: Obtaining candidate gene knockout plants

[0131] 4.1 Experimental Methods

[0132] To verify the effect of the candidate gene OsMGD on alkali tolerance in rice seedlings, the japonica rice variety "Zhonghua 11" (ZH11) was used as the target rice. T0 mutant plants (only OsMGD was knocked out using CRISPR / Cas9 technology, without any other gene editing) were obtained. The T0 plants were provided by Baige Gene Technology Co., Ltd. (Jiangsu), and their preparation method is as follows:

[0133] 4.1.1 Design of primers for OsMGD gene editing knockout target and construction of CRISPR / Cas9 vector

[0134] Based on gene editing principles, a specific 20bp region in the full-length OsMGD cDNA sequence was screened as the target sequence for OsMGD gene editing knockout through online BLAST homology analysis. The nucleotide sequence of the target sequence is (5'-3'): GCATGTGCAGCTATGGAAGG (SEQ ID No. 3, positions 821-840, located in exon 2 of the OsMGD genome). Annealing primers were designed based on the target sequence to synthesize a DNA molecule containing the target sequence, which was then constructed into BGK032 to obtain the BGK032-SG recombinant vector. The BGK032-SG recombinant vector expresses Cas9 protein and sgRNA targeting the above-mentioned target sequence. The nucleotide sequence of the BGK032-SG recombinant vector is SEQ ID No. 4. Specifically, positions 519-538 of SEQ ID No. 4 represent the spacer region of the sgRNA, i.e., the target sequence of the sgRNA, while positions 539-614 represent the backbone region of the sgRNA. Bits 2815-6915 are the Cas9 encoding sequence.

[0135] 4.1.2 Obtaining OsMGD-KO transgenic rice

[0136] The BGK032-SG recombinant vector was transformed into Agrobacterium EHA105 using a freeze-thaw method. Agrobacterium-mediated transformation was performed on the japonica rice variety Zhonghua 11 (generally represented as ZH11). Mature seeds of Zhonghua 11 were mechanically dehulled, and plump, smooth, and spotless seeds were selected, sterilized, and then inoculated onto induction medium for induction culture. Rice callus tissue with good appearance and growth vigor was selected as recipient material. The BGK032-SG recombinant vector was transformed into the rice callus tissue using Agrobacterium-mediated transformation. Transformation was performed using a culture medium containing 100 μM acetylsyleugenone and Agrobacterium with an OD value of 0.3-0.5. The callus tissue soaked in the transformation medium (infection medium) was then placed on a co-culture medium for co-culture at 28°C in the dark for 50-55 hours. Callus without obvious Agrobacterium tumefaciens on the surface was transferred to N6 antibacterial medium containing 2.0 mg / L 2,4-D and 500 mg / L cephalosporin, and cultured in the dark at 28°C for 3-4 days. The callus was then transferred to selection medium and cultured for 30 days, subculturing every 10 days. Fresh hygromycin-resistant callus was inoculated into pre-regeneration medium and cultured in the dark at 28°C for 7 days. It was then placed in a light-controlled culture room (12h light / 12h dark) for another 7 days before being transferred to regeneration medium (250mL tissue culture flasks) and cultured under light until regenerated plantlets appeared. The culture medium formulations used in this example are as follows:

[0137] Table 6. Culture media and their formulations used for genetic transformation

[0138]

[0139] 4.1.3 Mutation sequencing of regenerated plants

[0140] The obtained T0 seedlings were transplanted to the field, and DNA was extracted from leaves. Specific primers, named OsMGD-F / R, were designed based on the target information of OsMGD using Primer 3.0. All sampled plants were sequenced, and the sequencing results were analyzed using DNAMAN and Chromas software. Homozygous mutant plants were selected and harvested. T1 seeds were used to cultivate lines, and seven plants from each line were randomly selected, tagged, and sampled for whole-genome DNA extraction, amplification, and sequencing. Homozygous mutant plants were selected and self-pollinated to propagate to T2.

[0141] Primers (5'-3') used for sequencing mutant plants

[0142] OsMGD-F: AGGTCTTCGTCAAGGATCTG;

[0143] OsMGD-R: AGCATCCCAAGTCAAAGAAG.

[0144] The rice DNA extraction method used was the TPS method, and the steps are as follows:

[0145] (1) Take a small amount of leaves and put them in a 2mL centrifuge tube. Add 2 steel balls, cover the tube, freeze it in liquid nitrogen for 30s, and then crush it with a grinder.

[0146] (2) Add 1000 μL of TPS extraction solution, place in an oven at 65°C for 30 min, and take it out and shake it vigorously every 10 min.

[0147] (3) Let stand for 10 minutes, then centrifuge at 12000 rpm for 10 minutes.

[0148] (4) Take 500 μL of supernatant into a new 1.5 ml centrifuge tube, add an equal volume of pre-cooled isopropanol, shake gently to mix, place at -20℃ for about 1 hour, and centrifuge at 12000 rpm for 10 min.

[0149] (5) Discard the supernatant, add 75% ethanol to wash the precipitate, place it in a fume hood to dry, and add 200 μL ddH2O after drying.

[0150] (6) Use Nano Drop software to identify DNA quality and store at 4°C for later use.

[0151] 4.2 Experimental Results

[0152] Experimental results are as follows Figure 7 As shown in Table 6. Figure 7 The results of OsMGD target site mutation type detection are as follows: Figure 7 In the middle (a), the mutation type (single base insertion) at the OsMGD target site is shown. Figure 7 (b) shows another type of OsMGD target site mutation (single base insertion).

[0153] After sequencing the PCR amplification products of T0 plants, sequence alignment was performed using DNAMAN software. The OsMGD sequence of wild-type Zhonghua 11 (ZH11) was compared with the mutant sequence. The sequencing results were viewed using Chromas software, and the mutation types at each gene target site were statistically analyzed.

[0154] Statistical analysis of mutation types at the OsMGD gene target site revealed two homozygous mutation types, both involving single-base insertions: one with an A base insertion and the other with a T base insertion. Figure 7 ).

[0155] Whole-genome DNA was extracted from the OsMGD mutant T1 plants, and 117 homozygous mutants were screened using OsMGD-F / R (Table 6). All mutants involved single-base insertions. Of these, 85 mutants had a single A insertion at the target site, and the other 32 mutants had a single T insertion at the target site. Through self-pollination, T2 mutant lines were obtained. The lines with one A insertion and the line with one T insertion were named qat2-1 and qat2-2, respectively, for subsequent verification of alkali tolerance phenotypes during the seedling stage.

[0156] Table 6. Mutation detection in T1 transgenic plants

[0157]

[0158] The specific mutation types of the homozygous mutant lines qat2-1 and qat2-2 are as follows:

[0159] Compared to the wild-type Zhonghua 11, the OsMGD in the mutant plant qat2-1 undergoes the following changes: the OsMGD gene in both homologous chromosomes is mutated to Osmgd-1. Osmgd-1 involves the insertion of nucleotide A at positions 837-838 of sequence 3 in the sequence listing. The coding sequence of Osmgd-1 involves the insertion of nucleotide A at positions 496-497 of sequence 2 in the sequence listing, resulting in a frameshift mutation that causes premature termination of translation, thereby knocking out the OsMGD protein.

[0160] Compared to the wild-type Zhonghua 11, the OsMGD in the mutant plant qat2-2 undergoes the following changes: the OsMGD gene in both homologous chromosomes is mutated to Osmgd-2. Osmgd-2 involves the insertion of nucleotide T at positions 837-838 of sequence 3 in the sequence listing. The coding sequence of Osmgd-1 involves the insertion of nucleotide T at positions 496-497 of sequence 2 in the sequence listing, resulting in a frameshift mutation that causes premature termination of translation, thereby knocking out the OsMGD protein.

[0161] Example 5: Functional Verification of Alkali Tolerance Candidate Genes

[0162] 5.1 Test Methods

[0163] The seedling culture method for wild-type and T2 homozygous mutant plants qat2-1 and qat2-2 was the same as in Example 1. After the seeds sprouted, 36 plump and uniform seeds were selected from each material and divided into two equal parts, one for control and the other for alkali stress treatment. The experiment was set up with three biological replicates. On day 17 of alkali stress, six seedlings from each material under alkali stress and normal conditions were randomly selected to measure seedling height and root length. The roots were simply rinsed with distilled water to wash away residual nutrient solution on the surface and then dried with filter paper. The fresh weight of the aboveground parts and roots of each material was measured. Then, the aboveground parts and root samples of each material were placed in different envelopes, blanched at 105℃ for 30 minutes, and then dried at 80℃ for several days. The dry weight of the aboveground parts and roots was then measured. After drying, the samples under alkali stress and control conditions were transferred to test tubes. Acetic acid solution (20 mL for aerial parts and 10 mL for roots) was added to the test tubes, and the test tubes were placed in a 90℃ constant temperature shaking water bath and shaken for 3 hours. After the solution cooled, the supernatant was collected and diluted. The Na+ content of the aerial parts and roots of each material was measured using a flame photometer. + Concentration. The calculation formula is as follows:

[0164] Na in the sample + Mass fraction (mg / g) = C × V × N / (M × 1000)

[0165]

C: elemental concentration of the sample tested on the instrument (mg / L), V: volume of acetic acid in the sample extract (mL), N: dilution factor, M: sample mass (g)

[0166] Seedling culture methods for wild-type and T2 homozygous mutant plants are as described in Example 1. After the seeds sprout, 40 plump and uniform seeds were selected from each mutant material to measure the survival rate of the mutants after alkali stress treatment. The experiment was set up with 3 biological replicates. After the seeds sprout, 40 plump and uniform seeds were selected from the wild-type to measure the survival rate of the wild-type after alkali stress treatment. The experiment was set up with 6 biological replicates. On day 36 of alkali stress, the number of surviving materials was counted and the survival rate was calculated.

[0167] 5.2 Results of Functional Verification Experiment on Alkali Tolerance of OsMGD Seedlings

[0168] Experimental results are as follows Figure 8 and Figure 9 As shown, where, Figure 8 (a) shows the phenotypes of the OsMGD mutant and wild-type ZH11 before treatment (left) and after 27 days of alkali stress (right); Figure 8 (b) represents the control and the wild-type ZH11 and OsMGD mutants subjected to alkali stress for 17 days. (c) represents seedling height (b), root length (c), aboveground fresh weight (d), aboveground dry weight (e), and aboveground Na content. +Content (f), fresh weight of root (g), dry weight of root (h), Na content of root + Content (i), scale bar in 3 cm; * and ** represent significance of P < 0.05 and P < 0.01, respectively. Data represent the mean ± standard deviation of 3 replicates. Figure 9 The results show the survival rates of mutant and wild-type strains on day 36 of alkali stress. Figure 9 The length of the scale bar represents 5 cm. Wild-type data represent the mean ± standard deviation of 6 replicates, and mutant data represent the mean ± standard deviation of 3 replicates.

[0169] Phenotypic evaluation of seedling alkali tolerance in wild-type and OsMGD homozygous mutants showed that qat2-1 exhibited stronger alkali tolerance, while qat2-2 showed slightly stronger alkali tolerance than the wild-type. Figure 8 (a)). Before stress, the OsMGD mutant and the wild-type plant showed consistent growth, with no significant differences in seedling height and root length. Figure 8 (b), (c)). Alkali stress inhibited the elongation of the aboveground parts and reduced the fresh and dry weight of the aboveground parts, but there was no significant difference between the mutant and the wild type. Figure 8 (d), (e)). Regarding the roots, the root length of the mutant under alkali stress was significantly shorter than that of the wild type. Figure 8 (c)), but there was no significant difference in fresh weight and dry weight between the two. Figure 8 (g), (h)). Determination of Na in the aboveground parts and roots. + The content of Na in the aboveground parts and roots was found to be reduced by alkali stress. + Increased, but there was no significant difference between wild-type and mutant. Figure 8 (f), (i)). Figure 9 The results show the survival rates of wild-type and mutant lines under alkaline stress.

[0170] 5.3 Survival rate statistics of OsMGD seedling alkali tolerance test

[0171] The OsMGD-KO transgenic lines qat2-1 and qat2-2 showed stronger alkali tolerance at the seedling stage compared to the wild-type Zhonghua 11. After 36 days of alkali stress, the average survival rate of 240 plants in six replicates of wild-type Zhonghua 11 was 9.6%, the average survival rate of 120 plants in three replicates of qat2-1 was 20.0%, and the average survival rate of 120 plants in three replicates of qat2-2 was 25.8%. The survival rates of the two OsMGD-KO transgenic lines were significantly higher than those of the wild-type Zhonghua 11. Figure 9 ).

[0172] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of a substance that knocks out protein-coding genes, characterized in that: The application is any one of the following: D1) Application in improving alkali tolerance in rice seedlings; D2) Application in the preparation of products that improve the alkali resistance of rice seedlings; Application of D3 in the preparation and cultivation of rice with seedling alkali tolerance traits; D4) Application in breeding to improve alkali tolerance traits in rice seedlings; The protein is either (1) or (2) as follows: (1) The amino acid sequence is that of the protein in SEQ ID No. 1; (2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (1).

2. The application according to claim 1, characterized in that: The protein is derived from rice.

3. The application according to claim 1 or 2, characterized in that: The substance that knocks out the protein-coding gene is a biological material, and the biological material is any one of the following: (1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the protein described in claim 1; (2) An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule described in (1).

4. The application according to claim 3, characterized in that: The nucleic acid molecule is a DNA molecule that expresses gRNA targeting the protein-coding gene described in claim 1 or gRNA targeting the protein-coding gene described in the application of claim 1; The target sequence of the gRNA is SEQ ID No. 3, sequence number 821. 840 bits.

5. A method for improving the alkali tolerance of rice seedlings, comprising knocking out the protein-coding gene as described in claim 1 in recipient rice to obtain target rice with higher alkali tolerance during the seedling stage than the recipient rice.

6. The method according to claim 5, characterized in that: The protein-coding gene in claim 1 of the knockout recipient rice is generated by performing at least one of the following mutations on a DNA molecule in the rice genome with the nucleotide sequence of SEQ ID No. 3: M1) Insert nucleotide A between nucleotides 837 and 838 of sequence 3 in the sequence listing of the rice genomic DNA; M2) Inserts nucleotide T between nucleotides 837-838 of sequence 3 in the sequence listing of the rice genomic DNA.

7. A method for preparing alkali-tolerant rice at the seedling stage, comprising knocking out the protein-coding gene as described in claim 1 in recipient rice to obtain target rice with higher alkali tolerance at the seedling stage than the recipient rice.

8. The method according to claim 7, characterized in that: The protein-coding gene in the knockout recipient rice is obtained by performing at least one of the following mutations on the DNA molecule in the rice genome whose nucleotide sequence is SEQ ID No. 3: M1) Insert nucleotide A between nucleotides 837 and 838 of sequence 3 in the sequence listing of the rice genomic DNA; M2) Inserts nucleotide T between nucleotides 837-838 of sequence 3 in the sequence listing of the rice genomic DNA.