Application of Anagallis arvensis WRKY38 gene in improving plant tolerance to waterlogging stress

By cloning the AnWRKY38 gene from Adiantum repens and overexpressing it in Arabidopsis thaliana, the problem of insufficient waterlogging tolerance in forest trees was solved, the plant's tolerance and recovery ability to waterlogging stress were improved, and an effective technical means was provided for waterlogging-tolerant breeding of forest trees.

CN122256418APending Publication Date: 2026-06-23CHINA THREE GORGES CORPORATION +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHINA THREE GORGES CORPORATION
Filing Date
2026-05-13
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

In existing technologies, the waterlogging tolerance of trees is insufficient, resulting in low efficiency of ecological restoration and vegetation reconstruction. Furthermore, existing research on stress-resistance genes mainly focuses on crops rather than trees, lacking effective means to regulate the waterlogging tolerance of trees.

Method used

The AnWRKY38 gene was cloned from Adiantum repens and transformed into Arabidopsis thaliana using gene overexpression technology. This enhanced the plant's resistance to waterlogging stress, including increasing photosynthetic activity, reducing malondialdehyde and hydrogen peroxide content, enhancing cell membrane integrity, and improving resistance to peroxide anions.

Benefits of technology

It significantly improved the plant's tolerance and recovery ability to waterlogging stress, enhanced the plant's survival rate and photosynthetic activity, reduced cell damage, and provided a scientific basis and technical means for waterlogging-resistant breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256418A_ABST
    Figure CN122256418A_ABST
Patent Text Reader

Abstract

The application belongs to the field of plant genetic engineering, and specifically discloses application of Anemiospermum neriiforme AnWRKY38 gene in improving plant waterlogging stress resistance. The application constructs AnWRKY38 overexpression vector, and transforms Arabidopsis thaliana to obtain a transgenic line. Experimental results show that overexpression of AnWRKY38 gene can significantly improve the survival rate of plants under waterlogging stress, enhance photosynthetic activity, cell membrane integrity, antioxidant capacity and proline accumulation, and reduce malondialdehyde and hydrogen peroxide content. The application first excavates the new function of Anemiospermum neriiforme AnWRKY38 gene in improving plant waterlogging stress resistance, provides gene resources and effective technical means for plant waterlogging tolerance breeding, and can be used for waterlogging resistance genetic improvement of forest trees and ecological restoration plants, and has important application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and stress-resistance breeding technology, specifically involving the application of the AnWRKY38 gene of Adiantum repens in improving the plant's resistance to waterlogging stress. Background Technology

[0002] Global climate change has led to frequent extreme precipitation and flooding events, posing a serious threat to the stability of global ecosystems, especially vulnerable ecosystems such as riparian zones, wetlands, and low-lying areas. Flooding stress is a key abiotic stress factor that limits tree growth, survival, and natural vegetation recovery. Prolonged flooding can cause root hypoxia, impaired respiration and metabolism, and an explosive accumulation of reactive oxygen species (ROS), leading to root rot, leaf wilting and shedding, growth stagnation, and even the death of entire trees, resulting in forest degradation, simplified community structure, and declining ecosystem function.

[0003] Currently, ecological restoration and vegetation reconstruction in flooded areas mainly rely on selecting water-tolerant native tree species or adopting engineering measures (such as building platforms and digging drainage ditches). However, the former has a limited selection of species, and many dominant or pioneer tree species with important ecological value (such as carbon sequestration, oxygen release, soil and water conservation, and habitat provision) generally have poor waterlogging tolerance; the latter is costly and may disrupt the original eco-hydrological processes. Therefore, fundamentally enhancing the waterlogging tolerance of the target forest trees themselves has become a new approach to improve ecological restoration efficiency and enhance ecosystem resilience.

[0004] The WRKY transcription factor family is a key class of regulatory factors in plants, widely involved in their growth and development as well as their responses to biotic and abiotic stresses. Previous studies have shown that WRKY genes participate in hypoxia stress responses in model plants such as Arabidopsis and rice, but research on their role in regulating forest waterlogging tolerance, particularly in ecological restoration, remains lacking. The vast majority of existing research on stress-resistance genes originates from crops, aiming to increase yield rather than enhance the survival and ecological adaptability of forest trees under long-term stress.

[0005] Adiantum nelumboides, an endangered fern endemic to my country, has long been adapted to the alternating seasonal drought and short-term flooding environment of the karst cliffs in the Three Gorges Reservoir area, making it a valuable resource for discovering stress-resistance genes. Cloning key stress-resistance genes from Adiantum nelumboides and developing their applications in enhancing the flood tolerance of forest trees has significant scientific value and application prospects for creating new flood-resistant forest germplasm through molecular breeding and promoting the restoration and reconstruction of ecological vegetation under difficult site conditions. Summary of the Invention

[0006] This invention addresses a gap in existing technologies by providing the application of the AnWRKY38 gene from *Adiantum repens* in enhancing the plant's resistance to waterlogging stress. The AnWRKY38 gene was cloned from *Adiantum repens* and transformed into wild-type *Arabidopsis thaliana* using gene overexpression technology. The results showed a significant enhancement of the *Arabidopsis thaliana* plant's tolerance and recovery ability to waterlogging stress, filling a technological gap in the development of stress-resistance gene resources in ferns. This provides crucial scientific evidence and effective technical means for using this gene in waterlogging-tolerant breeding of other plants.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: One of the objectives of this invention is to provide the application of the AnWRKY38 gene from the Adiantum repens in any of the following A1)-A4): A1) Application in improving the ability of plants to resist waterlogging stress; A2) Application in the preparation of products that enhance the plant's resistance to waterlogging stress; A3) Application in cultivating waterlogged tolerant plant germplasm; A4) Application in the preparation of products for cultivating water-resistant plant germplasm; The amino acid sequence encoded by the AnWRKY38 gene is shown in SEQ ID NO.2.

[0008] Furthermore, the nucleotide sequence of the AnWRKY38 gene is shown in SEQ ID NO.1.

[0009] Furthermore, by promoting the expression of the AnWRKY38 gene or enhancing the function or activity of its protein in plants, the plant's resistance to flooding stress can be improved.

[0010] Furthermore, the improvement in plant resistance to waterlogging stress or the enhancement of waterlogged-tolerant plant germplasm manifests as an improvement in one or more of the following traits: B1) Increased survival rate under flooding stress; B2) Enhanced photosynthetic activity; B3) Relative conductivity decreases; B4) Malondialdehyde content decreased; B5) Hydrogen peroxide content decreased; B6) Improved resistance to peroxide anions; B7) Increased proline content.

[0011] Furthermore, the plants include, but are not limited to: maidenhair fern, Arabidopsis thaliana, rice, corn, wheat, soybean, tobacco, etc.

[0012] The second objective of this invention is to provide the application of an overexpression vector containing the AnWRKY38 gene in any of the following A1)-A4): A1) Application in improving the ability of plants to resist waterlogging stress; A2) Application in the preparation of products that enhance the plant's resistance to waterlogging stress; A3) Application in cultivating waterlogged tolerant plant germplasm; A4) Application in the preparation of products for cultivating water-resistant plant germplasm; The amino acid sequence encoded by the AnWRKY38 gene is shown in SEQ ID NO.2.

[0013] Furthermore, the backbone vector of the overexpression vector is the pK7WG2D vector.

[0014] Furthermore, the construction method of the overexpression vector containing the AnWRKY38 gene includes: S1. Using the cDNA of Adiantum repens as a template, PCR amplification was performed using primers AnWRKY38-F and AnWRKY38-R as shown in SEQ ID NO.5-6 to obtain the AnWRKY38 gene fragment. S2. The AnWRKY38 gene fragment obtained in step S1 is ligated into the pDONR221 vector through the LR reaction to obtain the intermediate vector pDONR221-AnWRKY38. S3. Using the vector pDONR221-AnWRKY38 as a template, PCR amplification was performed using primers shown in SEQ ID NO.7-8. The amplification product was then ligated to the backbone vector pK7WG2D via a BP recombination reaction to obtain the overexpression vector pK7WG2D-AnWRKY38 containing the AnWRKY38 gene.

[0015] The third objective of this invention is to provide a method for improving the resistance of plants to waterlogging stress and / or cultivating waterlogging-tolerant plant germplasm. This method involves expressing the AnWRKY38 gene in plants or enhancing the function or activity of its protein, thereby improving the resistance of plants to waterlogging stress and obtaining waterlogging-tolerant plant germplasm. The amino acid sequence encoded by the AnWRKY38 gene is shown in SEQ ID NO.2.

[0016] Furthermore, using the expression vector pK7WG2D as the backbone vector, an overexpression vector pK7WG2D-AnWRKY38 containing the AnWRKY38 gene was constructed and transformed into plants to obtain AnWRKY38 gene overexpression lines, thereby improving the plant's resistance to waterlogging stress and / or cultivating waterlogging-tolerant plant germplasm.

[0017] Furthermore, the overexpression vector pK7WG2D-AnWRKY38 was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method, and then transformed into plants using the flower immersion method. After screening and culture, transgenic plants were obtained, resulting in AnWRKY38 gene overexpression plant lines.

[0018] Furthermore, the plants include, but are not limited to: maidenhair fern, Arabidopsis thaliana, rice, corn, wheat, soybean, tobacco, etc.

[0019] Beneficial Effects: This invention cloned the AnWRKY38 gene from *Adiantum repens* and overexpressed it in *Arabidopsis thaliana* using transgenic technology, verifying that the gene can effectively improve the plant's tolerance to waterlogging stress. Under long-term waterlogging (hypoxia) conditions, the AnWRKY38 gene overexpression lines improved photosynthetic activity, maintained cell membrane integrity, increased proline content and resistance to peroxide anions, and reduced malondialdehyde (MDA), hydrogen peroxide (H2O2), and peroxide anion (O2) levels. 2- The increased content of the gene significantly improved the plant's tolerance to waterlogging stress, resulting in a higher survival rate. This invention is the first to discover a new function of the AnWRKY38 gene in enhancing plant resistance to waterlogging stress, providing genetic resources and effective technical means for waterlogging-tolerant plant breeding, with broad application prospects. Attached Figure Description

[0020] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The relative expression levels of the AnWRKY38 gene at different time points under waterlogging stress in Example 1 of this invention are shown.

[0022] Figure 2 The relative expression levels of the AnWRKY38 gene at different time points under treatment with gibberellic acid (GA3), indoleacetic acid (IAA), and abscisic acid (ABA) in Example 2 of this invention are shown.

[0023] Figure 3 To identify the relative expression levels of the AnWRKY38 gene in transgenic Arabidopsis thaliana (OE-4 and OE-7) and wild-type lines in Example 3 of this invention.

[0024] Figure 4 This study aims to identify the waterlogging stress phenotype of Arabidopsis thaliana overexpressing AnWRKY38 in Example 3 of the present invention.

[0025] Figure 5 The chlorophyll content, relative conductivity, malondialdehyde (MDA), hydrogen peroxide (H2O2), and peroxide anion (O2) of the AnWRKY38 transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana lines before and after waterlogging stress treatment in Example 3 of this invention are shown. 2- Results of proline and proline detection. Detailed Implementation

[0026] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0027] Example 1: Relative expression levels of the AnWRKY38 gene in Adiantum repens at different time points under waterlogging stress. Based on transcriptome analysis from previous waterlogging stress experiments, this invention identified genes that exhibited significant changes in expression levels in response to waterlogging stress. Following this, the AnWRKY38 gene from *Adiantum repens* was cloned, with its nucleotide sequence shown in SEQ ID NO.1 and the encoded amino acid sequence shown in SEQ ID NO.2. The relative expression levels of this gene at different time points under waterlogging stress were analyzed using quantitative real-time PCR, as detailed below: Mature Adiantum repens plants with good and uniform growth were selected and divided into experimental and control groups. The experimental group was placed in water to completely submerge the plants, while the control group was cultured using conventional methods. Both groups were continuously cultured for 48 hours under conditions of 12h light (140 lx) / 12h darkness, 70% humidity, and 25℃. Samples were taken at 0h, 6h, 12h, 24h, and 48h.

[0028] Total RNA was extracted from the leaves of Adiantum repens, and the first strand of cDNA was obtained by reverse transcription. The first strand of cDNA was used as a template for quantitative real-time PCR amplification. Gene 40S was used as an internal reference gene to determine the relative expression level of AnWRKY38 at different time points under waterlogging stress.

[0029] Primers used to amplify the AnWRKY38 gene include: qAnWRKY38F: CCCCACCATAACCCTTGACC (SEQ ID NO.3) qAnWRKY38R:GATCCCCGAGCTTATCGCAT (SEQ ID NO.4) Primers used to amplify the 40S internal reference gene include: 40S-F:TTGTAGGTGAGTATGGGCTTCGCAA 40S-R:ATCAAGTGTCAGCAACATTCGGGCA The relative expression levels of the experimental group and the control group at different time points under water flooding stress are as follows: Figure 1 As shown, the results indicate that the AnWRKY38 gene responds positively to flooding stress.

[0030] Example 2: Relative expression levels of the AnWRKY38 gene from *Adiantum repens* at different time points under treatment with gibberellic acid (GA3), indoleacetic acid (IAA), and abscisic acid (ABA). Mature Adiantum repens plants with good and uniform growth were selected and divided into experimental groups I, II, III, and a control group. The control group received no treatment and grew normally. Experimental groups I, II, and III were sprayed with 20 mL of IAA (100 nm), GA (100 μm), and ABA (100 μm), respectively. The experimental groups and the control group were then cultured continuously for 48 hours under conditions of 12 h light (140 lx) / 12 h darkness, 70% humidity, and 25℃. Samples were taken at 0 h, 6 h, 12 h, 24 h, and 48 h.

[0031] Total RNA was extracted from the leaves of *Adiantum repens*, and the first strand of cDNA was obtained by reverse transcription. The cDNA first strand was used as a template for quantitative real-time PCR amplification, and gene 40S was used as an internal control gene to verify the relative expression levels of AnWRKY38 at different time points under treatment with gibberellic acid (GA3), indoleacetic acid (IAA), and abscisic acid (ABA). The primers used were the same as in Example 1.

[0032] The relative gene expression levels of each experimental group and control group are as follows: Figure 2 As shown, AnWRKY38 is regulated by ABA, GA and IAA during the growth and development of Adiantum repens.

[0033] Example 3: Cloning and Functional Verification of the AnWRKY38 Gene from Adiantum repens This embodiment verifies the function of the AnWRKY38 gene through a transgenic experiment.

[0034] 1. Construction of overexpression vectors Total RNA was extracted from the leaves of *Adiantum repens*, and the first strand of cDNA was obtained by reverse transcription. Using the first strand of cDNA as a template, the target gene was amplified by PCR using the primers shown in SEQ ID NO. 5-6. The specific primers used were: AnWRKY38-F:aaaagcaggctccATGGACGGCCCACTCTTACC (SEQ ID NO.5); AnWRKY38-R: agaaagctgggttCCGGGATTGTGTGAGGATGG (SEQ ID NO. 6); The PCR reaction system is shown in Table 1. The PCR amplification program is as follows: 98℃ pre-denaturation for 30 sec; 98℃ denaturation for 10 sec, 65℃ annealing for 5 sec, 72℃ extension for 20 sec, 34 cycles; 72℃ complete extension for 1 min.

[0035] Table 1 PCR reaction system The amplification product was recovered and ligated into the intermediate vector pDONR221 via an LR reaction. This vector was then transformed into DH5α competent cells, and positive clones were selected for sequencing. Sequencing results showed that the gene was 2190 bp in length, consistent with the sequence shown in SEQ ID NO.1, and it was named pDONR221-AnWRKY38.

[0036] Further PCR amplification was performed using pDONR221-AnWRKY38 as a template and the primers shown in SEQ ID NO.7-8. The specific primers used were: attB1-adapter:GGGGACAAGTTTGTACAAAAAAGCAGGCT (SEQ ID NO.7); attB2-adapter: GGGGACCACTTTGTACAAGAAAGCTGGGT (SEQ ID NO.8); The PCR reaction system is shown in Table 2. The PCR amplification program is as follows: 98℃ pre-denaturation for 30 sec; 98℃ denaturation for 10 sec, 65℃ annealing for 5 sec, 72℃ extension for 20 sec, 34 cycles; 72℃ complete extension for 1 min.

[0037] Table 2 PCR reaction system The amplification product was recovered, and the amplified AnWRKY38 gene product was ligated into the pK7WG2D vector via a backpropagation (BP) reaction. This vector was then transformed into DH5α competent cells, and positive clones were selected for sequencing. After successful sequencing, the AnWRKY38 gene overexpression vector was obtained and named pK7WG2D-AnWRKY38.

[0038] 2. Preparation of Arabidopsis thaliana lines overexpressing AnWRKY38 The AnWRKY38 gene overexpression vector pK7WG2D-AnWRKY38 prepared above was transferred into the model plant Arabidopsis thaliana to verify its function.

[0039] (1) Construction of Agrobacterium The overexpression vector pK7WG2D-AnWRKY38 was introduced into Agrobacterium tumefaciens GV1301 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) using the freeze-thaw method. The resulting Agrobacterium was labeled as pK7WG2D-AnWRKY38-GV1301.

[0040] (2) Transformation by soaking flowers ① Select healthy Arabidopsis thaliana plants that are in a suitable growth stage (the main inflorescence has just emerged and a small number of flowers have opened), Columbia (WT) ecotype.

[0041] ② After incubating Agrobacterium carrying the target gene upside down in an incubator at 28℃ for 2-3 days, inoculate it into 50 mL of MS liquid medium and incubate at 28℃ and 220 r / min on a shaker until the Agrobacterium is dispersed and homogenized to OD. 600 The concentration was 0.6~0.8; acetylsyleugenol (AS) was added to a final concentration of 150 μmol / L; ③ Flower soaking procedure: Carefully invert the prepared Arabidopsis thaliana inflorescences into a container (centrifuge tube or small beaker) containing Agrobacterium resuspension, ensuring the inflorescences are completely immersed in the Agrobacterium solution, and soak for 5 minutes. After soaking, gently remove the plants, place them sideways on a tray, cover with black plastic film or cling film, maintain humidity and darkness, and allow the plants to stand in this environment for 18-24 hours to allow Agrobacterium to fully infect the plants.

[0042] ④ Subsequent cultivation and selection: Remove the covering and place the plant upright under normal growth conditions (16h light cycle / 8h darkness, 22-24℃) to continue growing, allowing it to flower and bear fruit.

[0043] ⑤ Seed Collection and Screening: After the siliques of Arabidopsis plants mature, seeds are collected. Seeds are placed in 1.5ml centrifuge tubes and washed with sterile water for 2 minutes in a clean bench. After centrifugation, the sterile water is discarded, and 75% alcohol is added for disinfection for 2 minutes. After centrifugation, the alcohol is discarded, and 10% (v / v) sodium hypochlorite disinfectant is added for 2-5 minutes. After centrifugation, excess disinfectant is aspirated, and sterile water is added for washing. This process is repeated three times. The aseptically treated seeds are sown in 1 / 2 MS medium containing 50mg / L. Positive plants obtained through screening are designated as Generation T1. Generation T1 seeds are then screened for two more generations to obtain Generation T3 pK7WG2D-AnWRKY38 transgenic Arabidopsis.

[0044] 3. Identification of AnWRKY38 expression levels in transgenic Arabidopsis thaliana (OE-4 and OE-7) Total RNA was extracted from T3 generation pK7WG2D-AnWRKY38 transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana (WT), and cDNA was obtained by reverse transcription. The AnWRKY38 gene was analyzed by qRT-PCR using ChamQ Universal SYBR qPCR Master Mix, with actin2 as an internal control gene, to detect the expression level of AnWRKY38 in each transgenic Arabidopsis thaliana line. The results are as follows: Figure 3 As shown in the results, the expression level of the AnWRKY38 gene in the transgenic Arabidopsis lines was significantly increased compared with the wild type. The two lines with the highest expression levels (OE-4 and OE-7) were selected for subsequent experiments.

[0045] 4. Phenotypic identification and physiological index determination of AnWRKY38-overexpressing Arabidopsis thaliana under waterlogging stress (1) AnWRKY38-overexpressing Arabidopsis thaliana plants and WT plants that had grown to 4 true leaves on the culture medium were transferred to nutrient soil for further culture. When they reached 14 days of growth, water stress treatment was initiated, and the plants were completely submerged in water for 5 consecutive days. Photos were taken on the 5th day, and the results were as follows. Figure 4 As shown, the results indicate that after waterlogging treatment, most leaves of the wild-type plants wilted to varying degrees, while only a small number of leaves of the overexpressed line showed wilting. This result directly reveals that the AnWRKY38 gene can effectively improve the ability of Arabidopsis thaliana, a model plant, to resist waterlogging stress, providing a key scientific basis for using this gene in waterlogging-tolerant breeding of other plants.

[0046] (2) Determination of chlorophyll content before and after waterlogging stress treatment in transgenic and wild-type lines Sampling: Select Arabidopsis thaliana plants with uniform growth status, cut leaves with scissors, or use a hole punch to take leaf discs from the same part of the leaf. Quickly place them in pre-cooled aluminum foil packets and put them on ice.

[0047] Weighing: Accurately weigh 100 mg of the leaves (fresh weight, FW).

[0048] a. Place the weighed leaves into a pre-cooled mortar, add a small amount of quartz sand and about 2 mg of calcium carbonate powder.

[0049] b. Add 2-3 mL of pre-cooled 80% acetone and quickly grind into a homogenate under weak or green light until the tissue turns white.

[0050] c. Transfer the homogenate to a 25 mL brown volumetric flask using a funnel or pipette.

[0051] d. Rinse the mortar and pestle several times with a small amount of 80% acetone, and combine all the washings into a volumetric flask.

[0052] e. Dilute to the mark with 80% acetone. Tighten the cap and shake vigorously to mix.

[0053] f. Extraction in the dark: Wrap the volumetric flask with aluminum foil and place it in a 4°C refrigerator for 4-6 hours or overnight to ensure complete extraction.

[0054] g. Centrifugation: Aliquot the extract into 1.5 mL centrifuge tubes, centrifuge at 10,000 rpm for 10 minutes at 4°C, and use the supernatant for determination.

[0055] h. Pour the supernatant after centrifugation into a cuvette (optical path 1 cm) and read the optical density values ​​(OD values) at wavelengths of 750 nm, 663 nm, and 645 nm, respectively.

[0056] The results are as follows Figure 5 As shown, regardless of whether the Arabidopsis thaliana was subjected to waterlogging stress, the chlorophyll content of the overexpressing Arabidopsis thaliana lines was significantly higher than that of the wild-type Arabidopsis thaliana lines. This result indicates that the gene can significantly improve the photosynthetic activity of the plants.

[0057] (3) Measurement of electrical conductivity of transgenic and wild-type lines before and after water flooding stress treatment Place the leaflets in a clean 50mL centrifuge tube and add 15mL of distilled water. Prepare a separate tube of distilled water as a control. Place the centrifuge tubes on a rotary shaker at room temperature (50 rpm) for 1.5 hours. Measure the conductivity of the sample (C1) and control (CK1) using a conductivity meter (DSS-307, SPSIC, China). Then, boil the centrifuge tubes in boiling water for 10 minutes. After cooling naturally to room temperature, measure the conductivity values ​​C2 and CK2 at this point. The formula for calculating relative conductivity (%) is: C(%) = (C1 - CK1) / (C2 - CK2) × 100%.

[0058] The results are as follows Figure 5As shown, when plants were subjected to waterlogging stress, the relative conductivity of the AnWRKY38-overexpressing Arabidopsis thaliana lines was significantly lower than that of the wild-type Arabidopsis thaliana lines, indicating that the cell membrane maintained better integrity.

[0059] (4) Measurement of physiological indicators of transgenic and wild-type lines before and after water flooding stress treatment Leaves from Arabidopsis thaliana plants overexpressing the drug before and after treatment, and WT plants were ground under liquid nitrogen. The malondialdehyde (MDA) content, hydrogen peroxide (H2O2) content, and anti-peroxide (O2) content of each plant were then detected using a malondialdehyde (MDA) detection kit (Nanjing Jiancheng Technology Co., Ltd.). 2- The proline content was measured using a proline detection kit (Nanjing Jiancheng Technology Co., Ltd.).

[0060] The results are as follows Figure 5 As shown, after water flooding treatment, AnWRKY38 overexpressed malondialdehyde (MDA), hydrogen peroxide (H2O2), and superoxide anion (O2O2) from Arabidopsis thaliana. 2- The content of α-proline was significantly lower than that of wild type; the content of proline was significantly higher than that of wild type.

[0061] The above results indicate that overexpression of the AnWRKY38 gene can significantly improve the photosynthetic activity of plants, maintain better cell membrane integrity, increase proline content and resistance to peroxide anions, and significantly reduce malondialdehyde (MDA), hydrogen peroxide (H2O2), and peroxide anion (O2). 2- The content of ) thereby improves the plant's ability to withstand waterlogging.

[0062] In summary, this invention is the first to demonstrate the function of the AnWRKY38 gene of Adiantum repens in enhancing the plant's tolerance to waterlogging stress. It can be overexpressed in crops such as rice, corn, and wheat, or in forest trees or ecological restoration plants through transgenic technology, thereby enhancing the plant's waterlogging tolerance. This has important practical application value for cultivating new waterlogging-tolerant germplasm.

[0063] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. Application of the AnWRKY38 gene from *Adiantum repens* in any of the following A1)-A4): A1) Application in improving the ability of plants to resist waterlogging stress; A2) Application in the preparation of products that enhance the plant's resistance to waterlogging stress; A3) Application in cultivating waterlogged tolerant plant germplasm; A4) Application in the preparation of products for cultivating water-resistant plant germplasm; The amino acid sequence encoded by the AnWRKY38 gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the AnWRKY38 gene is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, By promoting the expression of the AnWRKY38 gene or enhancing the function or activity of its protein, the plant's resistance to waterlogging stress can be improved.

4. The application according to claim 1, characterized in that, The improvement in plant resistance to waterlogging stress or the enhancement of waterlogged-tolerant plant germplasm is manifested by the improvement of one or more of the following traits: B1) Increased survival rate under flooding stress; B2) Enhanced photosynthetic activity; B3) Relative conductivity decreases; B4) Malondialdehyde content decreased; B5) Hydrogen peroxide content decreased; B6) Improved resistance to peroxide anions; B7) Increased proline content.

5. Application of overexpression vectors containing the AnWRKY38 gene in any of the following A1)-A4): A1) Application in improving the ability of plants to resist waterlogging stress; A2) Application in the preparation of products that enhance the plant's resistance to waterlogging stress; A3) Application in cultivating waterlogged tolerant plant germplasm; A4) Application in the preparation of products for cultivating water-resistant plant germplasm; The amino acid sequence encoded by the AnWRKY38 gene is shown in SEQ ID NO.

2.

6. The application according to claim 5, characterized in that, The backbone vector of the overexpression vector is the pK7WG2D vector.

7. The application according to claim 6, characterized in that, Methods for constructing overexpression vectors containing the AnWRKY38 gene include: S1. Using the cDNA of Adiantum repens as a template, PCR amplification was performed using primers AnWRKY38-F and AnWRKY38-R as shown in SEQ ID NO.5-6 to obtain the AnWRKY38 gene fragment. S2. The AnWRKY38 gene fragment obtained in step S1 is ligated into the pDONR221 vector through the LR reaction to obtain the intermediate vector pDONR221-AnWRKY38. S3. Using the vector pDONR221-AnWRKY38 as a template, PCR amplification was performed using primers shown in SEQ ID NO.7-8. The amplification product was then ligated to the backbone vector pK7WG2D via a BP recombination reaction to obtain the overexpression vector pK7WG2D-AnWRKY38 containing the AnWRKY38 gene.

8. A method for improving the resistance of plants to waterlogging stress and / or cultivating waterlogged-tolerant plant germplasm, characterized in that, By expressing the AnWRKY38 gene or enhancing the function or activity of its protein in plants, the ability of plants to resist waterlogging stress is improved, thereby obtaining waterlogging-tolerant plant germplasm; wherein the amino acid sequence encoded by the AnWRKY38 gene is shown in SEQ ID NO.

2.

9. The method according to claim 8, characterized in that, Using the expression vector pK7WG2D as the backbone vector, an overexpression vector pK7WG2D-AnWRKY38 containing the AnWRKY38 gene was constructed and transformed into plants to obtain AnWRKY38 gene overexpression lines, thereby improving the plant's resistance to waterlogging stress and / or cultivating waterlogging-tolerant plant germplasm.

10. The method according to claim 9, characterized in that, The overexpression vector pK7WG2D-AnWRKY38 was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method, and then transformed into plants using the flower immersion method. After screening and culture, transgenic plants were obtained, and AnWRKY38 gene overexpression plant lines were obtained.