Micrornas designed against the microtubule-associated protein tau for the treatment of tauopathies

Abstract

The present description discloses miRNA constructs able to silence tau protein expression. The description also provides methods for treating tauopathies comprising the administration of said miRNA constructs.

Description

[0001] MICRORNAS DESIGNED AGAINST THE MICROTUBULE-ASSOCIATED PROTEIN TAU FOR THE TREATMENT OF TAUOPATHIES

[0002] FIELD OF THE INVENTION

[0003] The present invention generally is related to the treatment of neurodegenerative diseases, in particular of those associated to tau protein, such as Alzheimer’s disease. More particularly, the invention is related to the provision of microRNAs (miRNAs) designed to inhibit the expression of tau protein.

[0004] BACKGROUND OF THE INVENTION

[0005] Tauopathies are the most frequent neurodegenerative diseases, being the main etiology of the dementias. Within this group of diseases one can find Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease. At the moment, there are no effective therapies for these pathologies. The existing treatments are merely symptomatic, and they exhibit low effectiveness, with no therapy being effective against the progression of the degenerative process.

[0006] The classic dogma of tauopathies maintains that the neuronal death is fundamentally due to an increase in the toxic function of protein tau. In this context, it has been suggested the local suppression of protein tau (by immunotherapy or genic silencing) as a possible therapeutic intervention in the early stages of tauopathies.

[0007] For example, patent EP3019175B1 discloses the use of miRNAs which regulate the expression of protein tau for the treatment of tauopathies.

[0008] Patent application W02021202509A1 describes the preparation of precursors of miRNAs which would be useful for treating AD by means of the inhibition of the expression of a protein whose elimination improves the conditions of said disease in the patient. Among the possible proteins to be inhibited, protein tau is mentioned.

[0009] Patent application US2017246200A1 refers to the use of mimics of certain miRNAs for the treatment of neurodegenerative diseases, such as AD.

[0010] Patent application WO2021253729A1 discloses a short hairpin RNA (shRNA) which inhibits the expression of tau protein when it is cleaved to generate a small interfering RNA (siRNA).

[0011] However, there exists a constant need for additional therapeutical approaches for treating tauopathies in an effective and safe manner. SUMMARY OF THE INVENTION

[0012] The present invention provides a microRNA (miRNA) construct which targets the human MAPT transcript, the miRNA construct comprising: i- a nucleotide sense sequence as set forth in SEQ ID NO: 1 and a nucleotide antisense sequence as set forth in SEQ ID NO: 2; or ii- a nucleotide sense sequence as set forth in SEQ ID NO: 3 and a nucleotide antisense sequence as set forth in SEQ ID NO: 4.

[0013] In a particular embodiment of the present invention, the nucleotide sense and antisense sequences of the miRNA construct flank a loop sequence defined by the nucleotide sequence as set forth in SEQ ID NO: 5.

[0014] In a particularly preferred embodiment of the present invention, the miRNA construct comprises a nucleotide sequence as set forth in SEQ ID NO: 6.

[0015] In another particularly preferred embodiment of the present invention, the miRNA construct comprises a nucleotide sequence as set forth in SEQ ID NO: 7.

[0016] It is another aspect of the invention to provide a viral vector comprising: i- a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 1 and a nucleotide sequence as set forth in SEQ ID NO: 2; and ii- a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 3 and a nucleotide sequence as set forth in SEQ ID NO: 4.

[0017] In an embodiment of this aspect of the invention, the viral vector is a lentiviral vector. In another embodiment of th is aspect of the invention, the viral vector is an adeno-associated viral vector.

[0018] In a particularly preferred embodiment of this aspect of the invention, the viral vector comprises a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 6 and a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 7.

[0019] It is another aspect of the invention to provide a pharmaceutical composition comprising the viral vector of the invention.

[0020] In another embodiment of this aspect of the invention, the pharmaceutical composition is used for treating a tauopathy. Preferably, the tauopathy is selected from the group consisting of Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease. Preferably, the tauopathy is AD. It is yet another aspect of the invention to provide a method for treating a tauopathy, comprising administering therapeutically effective amount of a pharmaceutical composition according to the invention to a subject in need thereof.

[0021] In a particular embodiment of this aspect of the invention, the tauopathy is selected from the group consisting of Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease. Preferably, the tauopathy is AD.

[0022] It is yet another aspect of the invention to provide a use of the pharmaceutical composition of the invention to manufacture a medicament for the treatment of a tauopathy. Preferably, the tauopathy is selected from the group consisting of Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease. Preferably, the tauopathy is AD.

[0023] BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Fig. 1. A) Western blots from miRNA-SCR or miRNA-tau transduced human neurons showing total tau reduction (=55 kDa, top row). Actin was used as loading control. B) Quantification of total tau optical density normalized to actin (N = X wells from X independent experiments). C) Neuronal arborization measured by Sholl analysis at DIV37 in miRNA-SCR or miRNA-tau transduced human neurons showing the number of projection intersections versus radius (in micrometers).

[0025] Fig. 2. A) Left: Total tau protein contents in the mPFC of 3- and 6-months-old WT and hTau mice (3 months: WT=2, hTau=3, **p=0,0012; unpaired t-test. 6 months: WT=3, hTau=3; *p=0,0125, unpaired t-test). Right: Total tau protein contents from mPFC protein homogenates of injected groups (WT SCR=4, hTau SCR=5, hTau miR=8; *p<0,05, **p<0,01 , ***p<0,001 , One-way ANOVA followed by Tukey’s test). B) Left: Insoluble tau contents obtained by Sarkosyl fractioning from equal amounts of protein from the mPFC of 3- and 6-months-old WT and hTau mice. (3 months: WT=3, hTau=3, *p=0,0109; unpaired t-test. 6 months: WT=3, hTau=3; **p=0,005, unpaired t-test). Right: Insoluble Tau contents from mPFC homogenates of injected groups. (WT SCR=3, hTau SCR=5, hTau miR=4; *p<0,05, One-way ANOVA followed by Tukey’s test).

[0026] Fig. 3. Discrimination index in the Novel Object Recognition test performed by noninjected groups of 3 and 6 months of age (left, 3 months: WT=19, hTau=23; unpaired t- test. 6 months: WT=11 , hTau=1 1 ; *p<0,05, unpaired t-test), and injected groups at 12 months old (right, WT SCR=10, WT miR=9, hTau SCR=12, hTau miRNA=1 1 ; *p<0,05, **p<0,01 , One-way ANOVA followed by Tukey’s test). Fig. 4. A) Firing rate of putative pyramidal neurons from electrophysiological recordings in vivo in the mPFC for WT and hTau mice at 3, 6 and 12 months of age (3 months: WT=, hTau=; 6 months: WT=, hTau=; 12 months: WT= , hTau= ; *p=0,0215, Mann-Whitney U test). B) Cumulative frequencies for firing rates of putative pyramidal neurons in the mPFC of 12 months-old mice. C) Representative electrophysiological recordings in vivo in the mPFC for the different injected groups. D) Firing rate of putative pyramidal neurons for the different injected groups at 12 months of age (WT SCR= , hTau SCR= , hTau miR= ; *p<0,05, **p<0,01 , Mann-Whitney U test). E) Cumulative frequencies for firing rates of putative pyramidal neurons in the mPFC of injected groups at 12 months of age.

[0027] Fig. 5. Age related changes in glucose uptake in WT and htau mice injected with miRNA- SCR or miRNA-Tau . Glucose uptake was evaluated at 6 and 12 months of age. Changes in glucose uptake is shown for each group. Color changes represent a statistical change, determined by t-test comparisons (*p < 0.05) between the groups compared (indicated in each panel). Lighter grey indicates [18F]-FDG uptake decrease. Coronal sections show that [18F]-FDG uptake decrease in the medial prefrontal cortex of control (miRNA-SCR) htau mice between 6 to 12 months, while htau mice injected with miRNA-Tau showed lower decrease in glucose uptake in the injected area.

[0028] Fig. 6. Discrimination index in the Novel Object Recognition test in 12 months old mice injected with miRNAs at 6 months of age. WT Scr-miRNA n=18, WT Tau-miRNA n=9, htau Scr-miRNA n=11 , htau Tau-miRNA n=15. **p<0,01 ; One-Way ANOVA followed by Tu key’s post hoc test. Data is shown as scatter dot plots, with mean ± SEM.

[0029] Fig. 7. Firing rate of putative pyramidal neurons in the mPFC of 12 months old mice injected with miRNAs at 6 months of age. WT Scr-miRNA n=107 neurons / 8 mice, htau Scr-miRNA n=101 neurons / 8 mice, htau Tau-miRNA n=126 neurons / 10 mice; *p<0.05, **p<0,01 , ***p<0,001 ; Mann-Whitney U test. Each dot represents the mean firing rate of each recorded neuron along the session. Grey lines indicate the median value per group.

[0030] Fig. 8. Total distance travelled in the Open Field task in 12 months old mice injected with miRNAs at 6 months of age. WT Scr-miRNA n=10, WT Tau-miRNA n=10, htau Scr-miRNA n=9, htau Tau-miRNA n=12. **p<0,01 ; ****p<0,0001 ; One-Way ANOVA followed by Tu key’s post hoc test. Data is shown as scatter dot plots, with mean ± SEM.

[0031] DETAILED DESCRIPTION OF THE INVENTION The present application discloses microRNAs (miRNAs) constructs suitable for silencing the expression of neuronal tau protein.

[0032] The terms “microRNA construct” or “miRNA construct” are to be interpreted as referring to the whole polynucleotide structure which may be properly administered to a subject and processed by the organism to release the proper miRNA, which is the nucleotide sequence effectively exhibiting the mRNA-interfering properties required to silence the targeted gene. This kind of construct is sometimes referred to as “pre-miRNA” in the art.

[0033] Correspondingly, a miRNA construct according to the invention comprises the miRNA targeting the intended mRNA (referred to as “antisense” throughout this description) as well as its complementary nucleotide sequence (referred to as “sense” throughout this description, both flanking a “loop” sequence, as well additional terminal sequences which complete the structure of the construct, which takes a hairpin-like form.

[0034] Neuronal tau protein is expressed by the MAPT (microtubule-associated protein tau) gene. Therefore, the miRNA constructs of the invention were designed to silence the MAPT gene, targeting specific regions of its corresponding mRNA. The feature of being able to target regions of the MAPT gene mRNA exhibited by the miRNA constructs of the present invention is referred to throughout this description by defining said miRNA constructs as “miRNA constructs which target the human MAPT transcript”.

[0035] The design strategy (described in the examples found further below in the present description) yielded two miRNA constructs which, when administered in combination, successfully inhibit the expression of tau protein without exhibiting any negative secondary effects in in vivo studies.

[0036] It is therefore an aspect of the present invention to provide a miRNA construct which target the human MAPT transcript, said miRNA construct comprising: i- a nucleotide sequence as set forth in SEQ ID NO: 1 and a nucleotide sequence as set forth in SEQ ID NO: 2; or ii- a nucleotide sequence as set forth in SEQ ID NO: 3 and a nucleotide sequence as set forth in SEQ ID NO: 4.

[0037] Nucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 correspond to the sense and antisense sequences of one of the miRNA constructs designed as described above, which will be referred to throughout this description as Tau-166. Nucleotide sequences SEQ ID NO: 3 and SEQ ID NO: 4 correspond to the sense and antisense sequences of the other miRNA construct designed as described above, which will be referred to throughout this description as Tau-724.

[0038] As the antisense sequence is the region of the miRNA construct actually performing the mRNA interfering activity thereof, while the sense sequence is necessary to maintain the hairpin structure of the construct, these are the essential sequences for the miRNA constructs of the invention.

[0039] In a preferred embodiment, though, the sense and antisense sequences of each miRNA construct flank a loop sequence defined by the nucleotide sequence as set forth in SEQ ID NO: 5.

[0040] The terminal sections of the miRNA construct according to the invention referred to as “arm regions” throughout this description. Typically, the arm regions of the miRNA construct of the invention are extracted from a naturally occurring miRNA construct of a proper animal source. For instance, the arm regions may be arm regions from a mouse miRNA construct. More particularly, the arm regions may be the arm regions from mouse miRNA 155.

[0041] In a particularly preferred embodiment of the present invention, the miRNA construct comprises a nucleotide sequence as set forth in SEQ ID NO: 6, corresponding to Tau- 166.

[0042] In another particularly preferred embodiment of the present invention, the miRNA construct comprises a nucleotide sequence as set forth in SEQ ID NO: 7, corresponding to Tau-724.

[0043] As mentioned, the present inventors have found that, surprisingly, the combination of both Tau-166 and Tau-724 exhibit a good reduction in the expression of tau protein. An appropriate way of administering the miRNA constructs to a subject is by means of a viral vector, as typically known in the art, although a person of skill in the art will appreciate that other means of administration are feasible, such as intranasal administration. Correspondingly, it is another aspect of the invention to provide a viral vector comprising: i- a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 1 and a nucleotide sequence as set forth in SEQ ID NO: 2; and ii- a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 3 and a nucleotide sequence as set forth in SEQ ID NO: 4. The viral vector may be any such vector known in the art which would be appropriate for a proper administration of the miRNAs to a subject. For instance, the viral vector may be a lentiviral vector, or an adeno-associated viral vector.

[0044] In a particularly preferred embodiment of this aspect of the invention, the viral vector comprises a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 6 and a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 7.

[0045] It is yet another aspect of the invention to provide a pharmaceutical composition comprising the viral vector according to the invention, as described above.

[0046] The pharmaceutical composition of the present invention is intended to local application to the brain. Therefore, the pharmaceutical composition should be in a proper dosage form for such an administration, for instance, as an injectable composition.

[0047] The pharmaceutical composition according to the invention may additionally comprise other components typically used in such compositions, such as a pharmaceutically acceptable carrier and / or at least one pharmaceutically acceptable excipient. It is within the commonly expected knowledge of a person of skill in the art to prepare a proper pharmaceutical composition from the teachings provided herein.

[0048] In another embodiment of this aspect of the invention, the pharmaceutical composition is used for treating a tauopathy. Preferably, the tauopathy is selected from the group consisting of Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease. Preferably, the tauopathy is AD.

[0049] It is yet another aspect of the invention to provide a method for treating a tauopathy, comprising administering therapeutically effective amount of a pharmaceutical composition according to the invention to a subject in need thereof.

[0050] The term “therapeutically effective amount” refers to a dose of the pharmaceutical composition which is sufficient to produce the intended therapeutical effect on the subject, without generating avoidable secondary effect. The therapeutically effective amount to be administered depends on several factors, such as the tauopathy to be treated, the age, weight, gender, and general state of the subject, the severity of the condition, among others. It is within the expected knowledge for a person of skill in the art to determine an appropriate therapeutically effective amount in light of the particular conditions of each subject. The miRNA constructs of the invention allow for a therapeutically favorable response to be achieved with a single administration to specific brain nuclei of the selected viral vector. Therefore, in a particularly preferred embodiment of this aspect of the invention, the therapeutically effective amount of the pharmaceutical composition is administered a single time in specific brain regions affected by a pathological accumulation of tau protein.

[0051] In a particular embodiment of this aspect of the invention, the tauopathy is selected from the group consisting of Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease. Preferably, the tauopathy is AD.

[0052] It is yet another aspect of the invention to provide a use of the pharmaceutical composition of the invention to manufacture a medicament for the treatment of a tauopathy. Preferably, the tauopathy is selected from the group consisting of Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease. Preferably, the tauopathy is AD.

[0053] The present invention allows for a long-term silencing of the MAPT gene, by means of a single administration of the viral vector comprising the miRNA constructs of the invention, and in a localized manner (thus avoiding affecting brain regions unaffected by tau protein accumulation).

[0054] EXAMPLES

[0055] The invention will now be further described based on the following examples. It is to be understood that these examples are intended for illustrative purposes only, and by no means should be construed to be limiting the scope of the invention, which is only defined by the appended claims.

[0056] Example 1 - Design of miRNA constructs

[0057] 1. Selection of target sequences

[0058] To select the candidate sequences for designing miRNA constructs recognizing mRNA transcribed from MAPT, a free-access algorithm of Whitehead Institute for Biomedical Research, MIT, was used (http: / / sirna.wi.mit.edu).

[0059] From the initial candidate sequences, those complying with siRNA design rules published by different authors (Schwarz DS et al. 2003, Pei et al. 2006; compiled in Tafer H. 2014) were selected. From this analysis, 5 sequences of 21 nucleotides were obtained. After applying the strictest thermodynamic and specificity filters (BLAST, threshold), 2 sequences were finally selected. The target sequences are as follows (the numbers indicate position in the MAPT mRNA, starting from +1):

[0060] 166: AAAGCTGAAGAAGCAGGCATT (target Exon 2 / exon 3 junction - SEQ ID NO: 9)

[0061] 724: ACCTCCAAGTGTGGCTCATTA (target exon 11 - SEQ ID NO: 10)

[0062] 2. miRNA construct design

[0063] From each of these candidate sequences a miRNA construct was designed containing the arm regions of mouse miRNA 155, followed by the antisense sequence, the loop sequences, and the sense sequence. Nucleotides 10 and 11 were eliminated from the sense sequence to allow for the formation of a 3D structure optimizing the binding with the RISC system (this phenomenon was described by Pei et al 2006, but it is not included by default in design algorithms).

[0064] - Tau-166

[0065] Sense sequence: AAAGCTGAAAGCAGGCATT (SEQ ID NO: 1)

[0066] Antisense sequence: AATGCCTGCTTCTTCAGCTTT (SEQ ID NO: 2)

[0067] Loop sequence: GTTTTGGCCACTGACTGAC (SEQ ID NO: 5)

[0068] Full construct sequence:

[0069] ACCGGTGTCGACTTTAAAGGGAGGTAGTGAGTGGACCAGTGGATCCTGGAGGC TTGCTGAAGGCTGTATGCTGAATGCCTGCTTCTTCAGCTTTGTTTTGGCCACTG ACTGACAAAGCTGAAAGCAGGCATTCAGGACACAAGGCCTGTTACTAGCACTCA CATGGAACAAATGGCCCAGATCTGGCCGCACTCGAGATATCTAGAATTCACTAG TGAGCTC (SEQ ID NO: 6)

[0070] - Tau-724

[0071] Sense sequence: ACCTCCAAGTGGCTCATTA (SEQ ID NO: 3)

[0072] Antisense sequence: TAATGAGCCACACTTGGAGGT (SEQ ID NO: 4)

[0073] Loop sequence: GTTTTGGCCACTGACTGAC (SEQ ID NO: 5)

[0074] Full construct sequence:

[0075] ACCGGTGTCGACTTTAAAGGGAGGTAGTGAGTGGACCAGTGGATCCTGGAGGC TTGCTGAAGGCTGTATGCTGTAATGAGCCACACTTGGAGGTGTTTTGGCCACTG ACTGACACCTCCAAGTGGCTCATTACAGGACACAAGGCCTGTTACTAGCACTCA CATGGAACAAATGGCCCAGATCTGGCCGCACTCGAGATATCTAGAATTCACTAG TGAGCTC (SEQ ID NO: 7)

[0076] 3. Criteria used in the selection of the target sequences

[0077] Pattern of the duplex sequence: there are different patterns which bind to RISC. The most used one is N2[CG]N8[AUT]N8[AUT]N2.

[0078] In every case it is suggested to use 21 nucleotide sequences, avoiding successive sequences of 4 repeated nucleotides of the same base.

[0079] GC content in the sequence: a range of 30% to 50% is chosen (preferably 40% to 50%) Lower contents may destabilize the duplex and higher contents make the access to the RISC assembly more difficult.

[0080] Position in the mRNA: it is convenient to select 3 to 5 different target sequences, encompassing the 5’UTR and the codifying region (CDS). In practice, usually miRNAs directed to region 5’ are more effective.

[0081] Thermodynamic values of the duplex: the thermodynamic values for each duplex are calculated according to the model of Khvorova et al., in which the energy at the 5’ end of the sense strand (Es) and the energy at the 5’ end of the antisense strand (Eas) are considered. For the RISC complex to correctly load the antisense strand of the miRNA, the access of RISC by the 5’ antisense end must be favored, for which it is necessary that Eas < Es.

[0082] 4. Design of control miRNA construct

[0083] For the characterization assays, a miRNA construct (miRNA-SCR) with the following sequence was used as control.

[0084] ACCGGTGTCGACTTTAAAGGGAGGTAGTGAGTGGACCAGTGGATCCTGGAGGCTT GCTGAAGGCTGTATGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTG ACGTCTCCACGCAGTACATTTCAGGACACAAGGCCTGTTACTAGCACTCACATGGA ACAAATGGCCCAGATCTGGCCGCACTCGAGATATCTAGAATTCACTAGTGAGCTC (SEQ ID NO: 8)

[0085] Example 2 - In vitro assays

[0086] Lentiviral vectors. Artificial miRNAs were subcloned under the human synapsin promoter between Agel and EcoRI sites into a lentiviral vector backbone previously described (Avale et al., 2013; Espindola et al., 2018; Bordone et al., 2021 ; Damianich et al., 2021). Lentiviral particles were generated as previously described (Bordone et al., 2021 ; Damianich etal., 2021 ; Muniz et al., 2022). Briefly, HEK-293T cells were grown on DMEM, supplemented with 10% (v / v) fetal bovine serum (Natocor, Argentina), 0.5 mM L- glutamine, 100 U / ml penicillin and 100 pg / ml streptomycin. Cells at 80-85% confluence were co-transfected with a lentiviral shuttle vector (either Tau-miRNA166, Tau-miRNA724 or Tau-miRNASCR) together with helper vectors encoding packaging and envelope proteins (CMVA8.9 and CMV-VSVg, respectively). Viral particles were harvested from the culture medium 36 hours after transfection, treated with RNase-free DNase I (Invitrogen), filtered and concentrated by ultracentrifugation at 100,000 x g (Ti 90 rotor, Beckman). After performing titration as previously described (Avale et al., 2013), 10 pl aliquots of viral particles were stored at -80°C.

[0087] Cell culture and neuronal differentiation. Neurons were derived from hiPSCs. Briefly, irradiated murine embryonic fibroblasts (MEFs) were plated over gelatin-coated Petri dishes 24 h before hiPSC plating and maintained in DMEM complete (high-glucose DMEM, 10% FBS, 1 % Glutamax, 1 % penicillin-streptomycin). hiPSCs were grown at 37°C, 95% humidity, and 5% CO2in HES medium (KO DMEM, 20% KO serum replacement, 1 % Glutamax, 1 % non-essential amino acids, 0.1 % beta-mercaptoethanol, 4 ng / ml bFGF) to allow colony formation. When colonies reached optimal size, they were first transferred to a Petri dish and, after 12-18 h, to 25 cm2flasks and grown in suspension to allow embryoid body formation, which was induced by neural induction medium (NIM; DMEM / F12, 1 % N2supplement, 1 % nonessential amino acids, 280 Ul / ml heparin, and 1 % penicillin-streptomycin). Embryoid bodies were then transferred to laminin-coated six-well plates for neural rosette formation. After 7-14 d of growth, the neural rosettes were picked and transferred to 25 cm2flasks and maintained in NIM complete medium (2% B27 supplement, ascorbic acid) for up to 1 month, changing the growth medium every 2 days. Neural rosettes were picked and dissociated by an 8 min of accutase and trypsin treatment. The reaction was blocked by trypsin inhibitor and the suspension centrifuged for 5 min at 1000 rpm. The pellet was washed with DMEM / F12, disaggregated to singlecell and resuspended in neural differentiation media (NDM; Neurobasal, 1 % N2supplement, 2% B27 supplement, and 1 % penicillin-streptomycin). Cells were plated over poly-ornithine and laminin-coated coverslips into 24-well plates and maintained in 500 pl / well NDM complete medium (laminin, cAMP, ascorbic acid, BDNF, GDNF).

[0088] Neuron plating, transduction, and transfection. Plated neurons were maintained in culture, changing half of the medium every 3 d. On day in vitro 14 (DIV14), neurons were transduced with miRNAs in a multiplicity of infection (m.o.i) between 5 and 10, as described previously (Lacovich et al., 2017). After 12 hours, cells were topped up with 300 pl of fresh NDMc medium. Twenty-one days after LV transduction (on DIV35), neurons were transfected with 1 pg of pcDNA3-APP-YFP in a transfection mixture of OptiMEM and Lipofectamine 2000, as previously described (Lacovich et al., 2017). Two hours after transfection, the culture medium was replaced and, 48 h later (on DIV37), neurons were analyzed by imaging for transport analysis, patch-clamp recordings, fixed for immunocytochemistry, or processed to obtain RNA and protein for RT-qPCR and Western blot analyses, respectively.

[0089] RNA isolation from neurons in culture and detection of total tau mRNA. Total RNA was isolated from neurons using the AllPrep DNA / RNA mini kit (Qiagen) from high-density cultures at DIV37. Reverse transcription was performed with 0.5 pg of RNA with the TaqMan RT kit (Applied Biosystems) in a total volume of 10 pl. Reverse transcription was performed with the TaqMan RT kit (Applied Biosystems) with an equimolar ratio of oligo (dT) and random hexamers. Each reaction contained 0.5 pg of RNA in a total volume of 10 pL. Reverse transcription conditions were: 10 min at 25°C, 30 min at 48°C, and a final step of 5 min at 95°C.To perform the relative quantification of total tau by real time PCR, specific pairs of primers were used to amplify all six human tau mRNA transcripts isoforms: forward E7: 5’-AGCCAAGACATCCACACGTT-3’ (SEQ ID NO: 11) and reverse E8: 5’- ATCAGAGGGTCTGAGCTACCA-3’ (SEQ ID NO: 12). For normalization, GAPDH mRNA was detected using the following sequence of primers: 5’-GGTCTCCTCTGACTTCAACA- 3’ (forward) (SEQ ID NO: 13) and 5’-GTGAGGGTCTCTCTCTTCCT-3’ (reverse) (SEQ ID NO: 14). qPCR reactions were performed in triplicate with 25 ng of cDNA and 5 pl of Power SYBR® Green PCR Master Mix (Applied Biosystems) in a final volume of 10 pl using a MJ Research Opticon 2 real time PCR thermal cycler under the following cycling conditions: after initial denaturation at 95°C (10 min), 40 cycles at 95°C (10 s), the primers specific annealing temperature was 58°C (30 s) and elongation at 72°C (45s). Data was analyzed with the Opticon monitor 3 software (Biorad) to obtain the ACT per sample. Values for total tau mRNA contents were normalized to the GAPDH reference gene.

[0090] The housekeeping gene Cyclophilin B was used as to normalize qPCR analyses (forward: 5’-TGGAGATGAATCTGTAGGACGA-3’ (SEQ ID NO: 15) and reverse: 5’- GAAGTCTCCACCCTGGATCA-3’ (SEQ ID NO: 16)).

[0091] Sholl Analysis. Neurons were fixed in 4% paraformaldehyde at DIV 37 and mounted with Mowiol. Semi-automated Sholl analysis was done using the Simple Neurite Tracer (SNT) tool from the Neuroanatomy plugin in Imaged. Briefly, 8-bit images of hiPSC-derived neurons fluorescently labeled with MAP2 were used to determine dendrites and branches, and these were semi-automatically traced with SNT. After tracing, Sholl analysis was performed with the Neuroanatomy tool, where the radius step size of the rings was established and kept constant for all images. Four separate experiments were used for the analysis, with 10 to 12 neurons per condition (N=4; 45 neurons per condition in total). Data analysis was performed using GraphPad Prism.

[0092] Immunofluorescence, image collection, and morphology. Cells were washed with PBS and fixed with 4% paraformaldehyde and 4% sucrose in PBS for 30 min at 37°C. After fixation, cells were washed twice with PBS for 10 min and permeabilized with 0.1 % Triton X-100 for 10 min at room temperature. Cells were incubated at room temperature for 1 h using a blocking solution consisting of 3% BSA, 0.1 % Triton X-100, and 10% goat serum in PBS. Cells were then stained with primary antibodies in blocking solution and incubated overnight at 4°C. When using two primary antibodies, the staining was done sequentially. Cells were then rinsed in PBS and stained with secondary antibodies at room temperature for 2 h. Cells were stained for 30 min with Hoechst and mounted on slides with 70% glycerol. Primary antibodies used were as follows: antiMAP2 (1 :1000), and secondary antibodies against mouse and rabbit IgG conjugated to Alexa Fluor 564 (1 :400) or Alexa Fluor 488 (1 :400). Fixed cells were imaged with an inverted Zeiss LSM 780 confocal microscope using an oil immersion objective (40_ / 0.55 NA). Green fluorescence was excited by 488 nm line of the argon laser; the emission light was collected through the band-pass filter (505-530 nm). Red fluorescence was excited with the He / Ne laser (543 nm) and the emission light was filtered with a long-pass filter with a cutoff 560 nm.

[0093] Results

[0094] Tau-miRNA transduction resulted in a significant reduction of tau mRNA and protein levels (Fig. 1A and B). Arborization profiles were comparable between Tau-miRNA and control- miRNA revealed by Scholl analysis (Fig. 1 C).

[0095] Example 3 - In vivo assays

[0096] Mice. All animal procedures were designed in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals. Protocols were approved by ICAUC of INGEBI- CONICET and University of Buenos Aires. Mice were housed in standard conditions under 12 h dark / light cycle with ad libitum access to food and water. Htau transgenic mice, in a C57BL / 6 background, were obtained from Jackson Laboratories (Bar Harbour, Maine, United States; B6.Cg-Mapttm1 (EGFP) Kit Tg (MAPT)8cPdav / J. Stock number: 005491) and bred in house. To confirm the presence of the human MAPT transgene and the mouse Mapt - / - background, all mice used in this study were genotyped by PCR as previously described (Espindola et al., 2018; Damianich et al., 2021).

[0097] Experimental groups were injected with either Tau-miRNA166, Tau-miRNA724 or Tau- miRNASCR at three months of age. Mice were randomly allocated to receive either Tau- miRNA166, Tau-miRNA724 or Tau-miRNASCR. At 12 months of age in vivo analyses were performed, consisting of behavioral tests, positron emission tomography and in vivo electrophysiological recording. Biochemical analyses were performed postmortem as indicated further below. For protein extraction, mice were sacrificed by cervical dislocation and the injected area was dissected and stored at -80°C until use. For immunofluorescence array tomography analyses, mice were anesthetized and perfused transcardially with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4).

[0098] Stereotaxic injections. Lentiviral vectors were delivered into specific brain structures as previously described (Espindola et al., 2018) with minor modifications. Mice (males and females) aged 8-10 weeks (weight 25-30g) were anesthetized with isoflurane 0.5-2% (2% for induction, and 0.5-1 % for maintenance, Baxter) in medical grade oxygen with an air flow at 2.5 L min-1and placed into a stereotactic frame (Stoelting CO.). The skull was exposed and bregma was identified. A 10.0 pL Hamilton syringe coupled to a 36G stainless steel tube (Cooper needleworks, United Kingdom) was used to inject 1 .5 pL of lentiviral suspension (0.6 x 107TU / ml; 0.2 pL / min) per site of injection, following coordinates described in the mouse atlas (Paxinos and Franklin, 2013). LV suspension (108TU / ml) was infused bilaterally, at 4 sites into the mPFC, coordinates (in mm): AP= +2.3, LM= ±0.5, DV= -1 .8 and -2.2. Animals were kept at 37°C during the surgery until full recovery. Immediately after surgery, mice received analgesic (Aplonal; 1 mg / kg, s.c), repeated 24 h later. Any animal showing signs of pain or discomfort after surgery was sacrificed following the end point protocol.

[0099] Protein extraction and western blotting. Total protein was collected from neurons at DIV35 in lysis buffer containing 40 mM Tri-HCI (pH 7.5), 150 mM NaCI, 1 % Igepal (Sigma- Aldrich) and 1 x protease inhibitor cocktail (Sigma-Aldrich) and centrifuged for 10 min at 10,000 rpm at 4°C.

[0100] For protein extraction from mice brain, the PFC was dissected and homogenized with a buffer containing 50 mM Tris-HCI, 150 mM NaCI, 2mM EGTA (pH 7.4) and proteases and phosphatases inhibitor cocktail (Thermo Scientific). After homogenization with a motorized tissue grinder, protein extracts were centrifuged at 13500 rpm for 15 minutes at 4°C. Equal amounts of total protein (determined by Pierce BCA Protein Assay Kit, Thermo Scientific) were separated on 12% SDS-Polyacrylamide gels (prepared with Acrylamide and N,N'-Methylenebisacrylamide 30%) and transferred using a semi-dry transfer system to nitrocellulose membranes (BioRad). See-Blue Plus 2 (Invitrogen) was used as a molecular-weight marker. Membranes were blocked in 5% (w / v) non-fat dry milk (Sancor, Argentina), 0.05% v / v Tween 20 in TBS (milk / 1xTBS-T) for 1 h. After blocking, membranes were incubated overnight at 4°C with primary antibodies in a 1 / 10 diluted blocking solution. Primary antibodies used were directed either against total tau (1 : 10000; rabbit polyclonal; Dako, Denmark) or mouse p-actin (mouse monoclonal, 1 :10000; Abeam, United Kingdom). After washing 3 times in TBS containing 0.05% v / v Tween 20, blots were incubated with the appropriate secondary antibody for detecting total tau:goat anti-rabbit (1 :2000, Cell Signaling) for 2 h at room temperature. Proteins were visualized using ECL reagent (Thermo Scientific) exposing membranes on the GenegnomeXRQ (Syngene). Optical density was quantified using Imaged software (Rasband).

[0101] Fractionation of insoluble proteins was performed using 250 pg of mPFC protein extract, which was incubated with 1 % sarkosyl reagent (Sigma) for 1 hour in minimal agitation at room temperature, following protocol previously reported (Espindola et al., 2018). Protein extract with 1 % of sarkosyl reagent was ultracentrifuged at 39000 rpm (1 hour) at 20°C to obtain the pellet and then it was washed with sarkosyl 1 % by ultracentrifugation at the same conditions for 15 minutes. Pellet was resuspended for 1 hour at room temperature for western blotting.

[0102] The htau mouse model develops tauopathy phenotypes from 4 months old with severe cognitive decline occurring between 6 and 12 months (Muniz et al., 2022).

[0103] Administration performed in 3 months old mice was intended to provide proof of concept of target engagement of miRNAs to reduce tau pathology and their preventive efficacy of to preclude the neurodegenerative events and concomitant phenotypes. In turn, administration at 6 months old mice provides a readout of the therapeutic effect of miRNAs to stop the progression of cognitive decline in aged mice.

[0104] The results show that, when injected at 3 months old, 40% of Tau reduction was observed in the mPFC of Tau-miRNAs-injected aged hTau mice (Fig. 2A). Moreover, a decrease in insoluble Tau contents was detected (Fig. 2B), indicating that Tau-miRNAs effectively reduced pathological tau accumulation Tau in the mPFC of hTau mice. Novel object recognition. The test was carried out in senile htau mice (12 months old, after being injected with Tau-166 and Tau-724 at 3 or 6 months. As control, either htau mice injected with miRNA control or WT mice were used.

[0105] All mice tested were sibling cohorts aged 3, 6, 9 and 12 months, as indicated. Experiments were performed between 13:00h and 17:00h under dim illumination, in a separated behavioural room, where mice were transferred in advance. Behavioural experiments were analysed by ANY-maze (Stoelting Co.). All arenas and devices were cleaned between subjects to minimise odour cues.

[0106] The test was performed as previously described (Espindola et al., 2018) with minor modifications. Mice were individually habituated to the empty chamber (30x23x25cm) for 10 min. Then placed into the chamber with two identical objects for 10 min. Three hours later, mice were tested for 3 min in the same chamber with two objects in the same position, but one object replaced by a novel one with different shape, colour and form. Each object was randomly assigned as novel or familiar, for each mouse. Time spent exploring each object was recorded. Discrimination index was calculated as the time spent exploring the novel object related to the total time spent exploring both objects. Results for mice injected at 3 months of age are shown in Fig. 3, while results for mice injected at 6 months of age are shown in Fig. 6.

[0107] The results show that the WT mice (either control or injected with miRNA) spend more time with the novel object. Control htau mice at 12 months do not discriminate the novel object (they are at a 50% level indicating no preference for either object). The group of htau mice treated with miRNA recovers the preference for the novel object. This shows that the treatment with miRNA reverts the cognitive deficit when administered at 3 or 6 months of age.

[0108] Neuronal activity

[0109] Electrodes and data acquisition. Electrodes for extracellular recording were made from 4 coiled Nychrome wires of 12 pm in diameter (Kantal, Palm Coast). Wires were twisted together with a stirrer, at a constant speed, in order to obtain a tetrode arrangement. Each tetrode was introduced inside a stainless-steel cannula of 230 pm of external diameter. Impedance of each wire was adjusted between 0.5 to 0.8 MO by gold electro-deposition. Three cannulae were glued with cyanoacrylate in a triangle configuration and a separation of 250 pm. A copper wire attached to one of the cannula was used to ground the recording system. Signals were pre-amplified x10 and amplified x1000. Data was acquired with a National Instruments device at a sampling frequency of 30 KHz. Surgeries and electrophysiological recordings. Mice were deeply anesthetized with isoflurane (2% for induction, and 0.5-1 % for maintenance, Baxter) and placed into a stereotaxic frame. Throughout the experiment, eyes were covered with ointment to prevent drying. Body temperature was held constant at 37 °C using a controlled heating pad. The skull was exposed to clearly locate Bregma. A craniotomy was performed over the mPFC coordinates (AP:+ 2.1 mm, L: ± 0.5 mm, Bregma as reference). The meninges were cut with a needle and the tetrodes were lowered inside the brain. Tetrodes were lowered at a speed rate of 10-20 pm / sec. Stable spontaneous action potentials were sought up between +1 and +2.5 mm from the surface. Electrophysiological data was recorded at different positions (up to 7 recordings were acquired per animal), with durations ranging from 15 to 30 minutes each.

[0110] Electrophysiological recordings were made in the mPFC of anesthetized 12 months-old mice, 16 animals from the 3 months-old injected cohort (WT control, n=4; group, hTau control, n=5; hTau miRNA, n=7), and 14 from the 6 months-old injected cohort (WT control, n=4; group, hTau control, n=4; hTau miRNA, n=5).

[0111] Data processing and analysis. Analysis and statistical tests were implemented in MATLAB (The MathWorks Inc., USA). Raw signals were band filtered between 300 Hz and 6000 Hz. Spikes sorting was performed as follows. An automatic threshold was set at five times the standard deviation above the mean to detect the spike events. Detected spikes were partitioned into many clusters with a k-means method, and then were aggregated according to their interface energy for each pair. Clusters were manually split and merged according to their principal components until forming the units that were used for the subsequent analysis. Single units were classified as putative pyramidal neurons and interneurons based on their mean waveforms. Units with a time between the minimum and the next peak above 0.5 ms and a firing rate below 20 Hz were classified as putative pyramidal neurons, and the remaining as interneurons.

[0112] Rasters at 1 ms resolution containing a sequence of zeros (no spike event) and ones (spike event) were constructed for each isolated unit. On these rasters we computed the firing rate (spikes per second) of each neuron. For statistical mean differences between groups, we used the non-parametric Mann-Whitney U test.

[0113] Compared to aged-matched WT siblings, htau mice showed a significant increase in firing rates of pyramidal neurons between 6 to 12 months old (Fig. 4A and B), which was prevented when Tau-miRNAs were injected in the mPFC at 3 months old (Fig. 4C-E), and at 6 months old (Fig. 7). This data suggests that tau reduction precludes pyramidal neurons hyperexcitability due to tau mislocalization.

[0114] Positron Emission Tomography (PET). In vivo brain activity was analysed using tracer fluorinated glucose analog (18F-FDG), which localises in metabolically active tissues and accumulates in an activity-dependent manner. Images were taken for WT and htau mice at 12 months of age compared to 6 months of age mice of the same group.

[0115] Animals were starved during 4 h and then injected with 25 pCi / gr of18F-FDG i.p. and left undisturbed in an individual temperature-controlled (29 °C) cage for 30 min during radiopharmaceutical incorporation. Mice were then anaesthetised using a mixture of isoflurane and O2 (inhalation, 4.5% induction and 1 .5% maintenance dose) and maintained in a warm table (35°C) during the acquisition. Images were acquired using a preclinical PET TriFoil Lab-PET 4 (3.75 cm axial length) with a dual layer of LYSO and GSO crystals, assembled in phoswich pairs. Signal read out is based on an APD-Detection (Avalanche PhotoDiode). Image reconstruction was performed on emission data through 3D-OSEM (ordered subset expectation maximisation) iterative reconstruction (30 iterations). All images were co-registered and normalised to a18F-FDG template. The quantitative brain image of each mouse is normalized to the total cortex to avoid bias in the analysis. Intensity normalization was considered as a regressor variable for each factor using all-brain mean scaling (ANCOVA). Results are shown using a color scale representing a statistical parametric comparison between the groups, using the t-test (p < 0.05).

[0116] As previously reported (Muniz et al., 2022), reduction in glucose uptake in the prelimbic area of hTau mice was observed between 6 months 12 months. In Tau-miRNA injected mice, glucose uptake remained unchanged in the PFC prelimbic area suggesting that tau local reduction prevented neurodegeneration (Fig. 5).

[0117] Open field hyperactivity. This assay was carried out for mice injected at 6 months of age. Activity boxes (Med Associates Inc.) coupled to a computer interface (Activity Monitor software, Med Associates Inc.) were used to assess horizontal and vertical activity. Mice were placed in the center of the empty acrylic boxes (40 40 40 cm) and their trajectories were recorded for 30 min by disruption of infrared photobeams separated by 2.5 cm that cross the x-y plane at two z-levels. The videotrack was used to determine total distance traveled (cm). Result show that htau mice are hyperactive compared to WT, which is consistent with results observed in other mouse models of dementia. However, htau mice injected with miRNAs showed distance travelled activity similar to WT mice, suggesting the tau reduction into the PFC also has therapeutic effect over hyperactivity (Fig. 8).

[0118] REFERENCES

[0119] 1- Avale, M. E., Rodriguez-Martin, T., and Gallo, J.-M. (2013). Trans-splicing correction of tau isoform imbalance in a mouse model of tau mis-splicing. Hum. Mol. Genet. 22. doi:10.1093 / hmg / ddt108.

[0120] 2- Bordone MP, Damianich A, Bernardi A, Eidelman T, Sanz-Blasco S, Gershanik OS, et al. Fyn knockdown prevents levodopa-induced dyskinesia in a mouse model of Parkinson’s disease [Internet], eNeuro 2021 ; 8[cited 2021 Nov 15] Available from: https: / / pubmed.ncbi.nlm.nih.gov / 34099487.

[0121] 3- Damianich A, Facal CL, Muniz JA, Mininni C, Soiza-Reilly M, De Leon MP, et al. Tau mis-splicing correlates with motor impairments and striatal dysfunction in a model of tauopathy. Brain 2021 ; 144: 2302-9.

[0122] 4- Espindola, S. L., Damianich, A., Alvarez, R. J., Sartor, M., Belforte, J. E., Ferrario, J. E., et al. (2018). Modulation of Tau Isoforms Imbalance Precludes Tau Pathology and Cognitive Decline in a Mouse Model of Tauopathy. Cell Rep. 23, 709-715. doi:10.1016 / j.celrep.2018.03.079.

[0123] 5- Khvorova A, Reynolds A, Jayasena SD. Functional siRNAs and miRNAs exhibit strand bias. Cell. 2003;115(2):209-16.

[0124] 6- Lacovich V, Espindola SL, Alloatti M, Devoto VP, Cromberg LE, Carna ME, et al. Tau isoforms imbalance impairs the axonal transport of the amyloid precursor protein in human neurons. J Neurosci 2017; 37.

[0125] 7- Muniz JA, Facal CL, Urrutia L, Clerici-Delville R, Damianich A, Ferrario JE, et al. SMaRT modulation of tau isoforms rescues cognitive and motor impairments in a preclinical model of tauopathy. Front Bioeng Biotechnol 2022; 10: 1-13.

[0126] 8- Paxinos and Franklin's the Mouse Brain in Stereotaxic Coordinates. 2013. Academic Press.

[0127] 9- Pei Y, and Tuschl T. On the art of identifying effective and specific siRNAs. Nat Methods. 2006, 3:670-6.

[0128] 10- Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore PD. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003 115(2): 199-208.

[0129] 11- Tafer H. Bioinformatics of siRNA design. Methods Mol Biol. 2014;1097:477-90. doi: 10.1007 / 978-1 -62703-709-9_22. PMID: 24639173. 12- Xia et. al., 'Chapter 2. Thermodynamics of RNA Secondary Structure Formation' in RNA, pp 21-48.

Claims

CLAIMS1 . A microRNA (miRNA) construct which targets the human MAPT transcript, the miRNA construct comprising: i- a nucleotide sense sequence as set forth in SEQ ID NO: 1 and a nucleotide antisense sequence as set forth in SEQ ID NO: 2; or ii- a nucleotide sense sequence as set forth in SEQ ID NO: 3 and a nucleotide antisense sequence as set forth in SEQ ID NO: 4.

2. The miRNA construct of claim 1 , wherein the nucleotide sense and antisense sequences of the miRNA construct flank a loop sequence defined by the nucleotide sequence as set forth in SEQ ID NO: 5.

3. The miRNA construct of claim 1 or 2, wherein miRNA construct comprises a nucleotide sequence as set forth in SEQ ID NO: 6.

4. The miRNA construct of claim 1 or 2, wherein the miRNA construct comprises a nucleotide sequence as set forth in SEQ ID NO: 7.

5. A viral vector comprising: i- a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 1 and a nucleotide sequence as set forth in SEQ ID NO: 2; and ii- a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 3 and a nucleotide sequence as set forth in SEQ ID NO: 4.

6. The viral vector of claim 5, wherein the viral vector is a lentiviral vector.

7. The viral vector of claim 5, wherein the viral vector is an adeno-associated viral vector.

8. The viral vector of any one of claims 5 to 7, wherein the viral vector comprises a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 6 and a miRNA construct comprising a nucleotide sequence as set forth in SEQ ID NO: 7.

9. A pharmaceutical composition comprising the viral vector according to any of claims 5 to 8.

10. The pharmaceutical composition of claim 9, for use in treating a tauopathy.11 . The pharmaceutical composition for use according to claim 10, wherein the tauopathy is selected from the group consisting of Alzheimer’s disease (AD), frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease.

12. The pharmaceutical composition for use according to claim 11 , wherein the tauopathy is AD.

13. A method for treating a tauopathy, comprising administering therapeutically effective amount of a pharmaceutical composition according to claim 9 to a subject in need thereof.

14. The method of claim 13, wherein the tauopathy is selected from the group consisting of AD, frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease.

15. The method of claim 14, wherein the tauopathy is AD.

16. Use of a pharmaceutical composition according to claim 9 to manufacture a medicament for the treatment of a tauopathy.

17. The use of claim 16, wherein the tauopathy is selected from the group consisting of AD, frontotemporal dementia, progressive supranuclear paralysis, and Pick’s disease.

18. The use of claim 17, wherein the tauopathy is AD.

Images