Compounds and methods for reducing tubb4a expression

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of TUBB4A RNA in a cell or subject, and in certain instances reducing the amount of TUBB4A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom of a disease or disorder associated with TUBB4A. Such symptoms and hallmarks include hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

Description

[0001] COMPOUNDS AND METHODS FOR REDUCING TUBB4A EXPRESSION Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0475SEQ.xml, created on August 1, 2024, which is 30 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Field Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of TUBB4A RNA in a cell or a subject, and in certain instances reducing the amount of TUBB4A protein in a cell or a subject. Certain such compounds, methods, and pharmaceutical compositions are useful for preventing, treating, and / or ameliorating at least one symptom of a neurodegenerative disease or disorder associated with TUBB4A, such as TUBB4A-related leukodystrophies and Dystonia Type 4 (DYT4). Such symptoms include hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. Such neurodegenerative diseases and disorders include TUBB4A-related leukodystrophies such as infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H- ABC). Background The TUBB4A gene encodes the tubulin beta IVA (Tubb4A) protein, which together with α-tubulin, forms heterodimer subunits that assemble into microtubules. Tubb4A protein is found primarily in neurons and oligodendrocytes, with greatest levels of expression seen in mature myelinating oligodendrocytes. Mutations in the TUBB4A gene are associated with development of TUBB4A-related leukodystrophies, which encompass a spectrum of neurological disorders involving hypomyelination and in some cases, demyelination. Individuals affected by TUBB4A- related leukodystrophies have different combinations of signs and symptoms with varying severity. Symptoms of TUBB4A-related leukodystrophies include, for example, hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.   Among TUBB4A-related leukodystrophies are neurological disorders including, but not limited to, infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). Isolated hypomyelination with spastic quadriplegia begins in late childhood to early adulthood, and symptoms include mild hypomyelination, slowly progressive ataxia and spasticity, variable cerebellar atrophy, movement problems, dysarthria, and learning difficulty (Pizzino A., et al., Neurology.2014 Sept; 83(10):898-902). H-ABC begins in infancy or early childhood and is one of the more severe TUBB4A-related leukodystrophies. H-ABC symptoms include hypomyelination, cerebellar and basal ganglia atrophy, delayed development of motor skills, dystonia, uncontrolled movements of the limbs (choreoathetosis), rigidity, dysphonia, dysphagia, opisthotonos, ataxia, and seizures (Simons C., et al., Am. J. Hum. Genet., May 2013; 92:767-773; Sase S., et al., eLife, 2020; 9:e52986; van der Knaap, M.S. et al, Neurology, 2007; 69(2):166-171; Joyal K., et al, J. Neuropath. Exp. Neruol., 2019 January; 78(1): 3-9). Infantile onset TUBB4A-leukodystrophy includes symptoms such as poor vision, absent motor development, progressive spasticity, rigidity, dystonia, uncontrolled seizures, microcephaly, focal cortical dysplasia, better cognitive than motor function, and death in early childhood. Mutations in the TUBB4A gene are also associated with Dystonia Type 4 (DYT4). DYT4 first occurs in adulthood and is caused by a heterozygous mutation in the TUBB4A gene. DYT4 symptoms include “whispering dysphonia” (a progressive laryngeal dysphonia), dystonia, and gait ataxia (Hersheson, J., et al, Ann. Neurol., 2013; 73:546-553; Parker, N., J. Neurol. Neurosurg. Psychiat., 1985; 48: 218-224). Currently, there is a lack of acceptable options for treating neurodegenerative diseases and disorders associated with TUBB4A such as TUBB4A-related leukodystrophies (e.g., H-ABC, infantile onset TUBB4A-leukodystrophy, and isolated hypomyelination with spastic quadriplegia) and DYT4. There thus remains a need for therapies targeting diseases and disorders associated with TUBB4A. Therapeutics targeting TUBB4A may provide a new class of compounds for effective management of TUBB4A-related leukodystrophies and / or DYT4. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases and disorders. Summary of the Invention Provided herein are compounds, methods, and compositions for reducing the amount or activity of TUBB4A RNA, and in certain embodiments, reducing the amount of TUBB4A protein, in a cell or a subject. In certain embodiments, the subject has or is at risk for developing a neurodegenerative disease or disorder associated with TUBB4A. In certain embodiments, the subject has a TUBB4A-related leukodystrophy. In certain embodiments, compounds useful for reducing expression of TUBB4A RNA are oligomeric compounds. In certain embodiments, compounds useful for reducing expression of TUBB4A RNA are modified oligonucleotides. Also provided are methods useful for ameliorating at least one symptom of a neurodegenerative disease or disorder. In certain embodiments, the neurodegenerative disease or disorder is a disease or disorder associated with TUBB4A such as DYT4 and TUBB4A-related leukodystrophies (e.g., H-ABC, isolated hypomyelination with spastic quadriplegia, and infantile onset TUBB4A-leukodystrophy). In certain embodiments, the subject has a TUBB4A-related leukodystrophy or Dystonia Type 4 (DYT4). In certain embodiments, the symptom includes hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. Detailed Description of the Invention It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety. DEFINITIONS Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety. Unless otherwise indicated, the following terms have the following meanings: As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and comprises a 2’-β-D-deoxyribosyl sugar moiety, which is in the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). A 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil). As used herein, “2’-deoxy sugar moiety” means a 2’-H(H) deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2’-deoxy sugar moiety is a 2’-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl stereochemical configuration as found in naturally occurring deoxyribonucleic acids (DNA). As used herein, “2’-MOE” means a OCH2CH2OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’-MOE sugar moiety” means a sugar moiety with a OCH2CH2OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the β-D-ribosyl configuration. “MOE” means O-methoxyethyl. As used herein, “2’-MOE nucleoside” or “2′-OCH2CH2OCH3 nucleoside” or “ribo 2’-MOE” means a nucleoside comprising a 2’-MOE sugar moiety (or 2’-OCH2CH2OCH3ribosyl sugar moiety). As used herein, “2’-OMe” or “2’-O-methyl” means a 2’-OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’-O-methyl sugar moiety” or “2’-O-methyl sugar moiety” means a sugar moiety with a 2’- OCH3group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-OMe is in the β- D ribosyl stereochemical configuration. As used herein, “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety. As used herein, “2’-F” means a 2’-fluoro group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’- F sugar moiety” means a sugar moiety with a 2’-F group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the β-D-ribosyl configuration. As used herein, “2’-F nucleoside” means a nucleoside comprising a 2’-F sugar moiety. As used herein “2’-NMA” means a 2’-OCH2C(=O)-N(H)CH3group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’-NMA sugar moiety” means a sugar moiety with a 2’-OCH2C(=O)-N(H)CH3group in place of the 2’-OH group of a furanosyl sugar moiety. As used herein, “2’-NMA nucleoside” means a nucleoside comprising a 2’-NMA sugar moiety. As used herein, “2’-substituted nucleoside” means a modified nucleoside comprising a 2’-substituted furanosyl sugar moiety. As used herein, “2’-substituted sugar moiety” means a furanosyl sugar moiety wherein at least one 2'- substituent group is other than H or OH. A 2’-substituted sugar moiety includes a bicyclic sugar moiety where the second ring is joined to the furanosyl ring at the 2’-position. 2’-substituted sugar moieties include, but are not limited to, 2’-OMe sugar moieties, 2’-MOE sugar moieties, 2’-F sugar moieties, 2’-NMA sugar moieties, cEt sugar moieties, and LNA sugar moieties. As used herein, “stop site” refers to the 3’-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide when the oligonucleotide is hybridized to the target nucleic acid. As used herein, “start site” refers to the 5’-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide, when the oligonucleotide is hybridized to the target nucleic acid. As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached at the 5 position. A 5-methylcytosine is a modified nucleobase. As used herein, “administration” or “administering” means providing a pharmaceutical agent to a subject. As used herein, “ameliorate” in reference to a symptom of an associated disease, disorder, or condition means an improvement in or lessening of at least one symptom of the associated disease, disorder or condition. As used herein, “disease” includes disorders, conditions, and injuries. Amelioration may be the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. Progression, frequency, or severity of a symptom may be determined by subjective or objective measures known in the art and / or described herein. As used herein, “antisense activity” means any detectable and / or measurable change attributable (whether directly and / or indirectly) to the hybridization of an antisense oligonucleotide to its target nucleic acid. Herein, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such target nucleic acid compared to target nucleic acid levels and / or target protein levels in the absence of the antisense compound. For example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vitro assay, or for example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vivo assay. Antisense activity may be assessed in a standard assay. As used herein, “antisense agent” means an oligomeric compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a sense compound. As used herein, “antisense compound” means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group. As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region (a “targeting region”) that is complementary to a target nucleic acid and is capable of antisense activity. An antisense oligonucleotide may be paired with a second oligonucleotide (a “sense oligonucleotide”) that is complementary to the antisense oligonucleotide (for example, forming an oligomeric duplex) or may be an unpaired antisense oligonucleotide (herein, a single-stranded antisense oligonucleotide). Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising a furanosyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-geminal atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl sugar moiety. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and constrained ethyl (cEt) sugar moieties as defined herein. As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “blunt” or “blunt ended” in reference to an oligomeric duplex means that there are no terminal unpaired nucleotides (i.e., no overhanging nucleotides). One or both ends of an oligomeric duplex can be blunt. As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that is capable of binding to or interacting with a particular cell type or particular cell types. For example, a cell-targeting moiety may bind to a surface moiety, such as a surface receptor on a particular cell type. As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF. As used herein, “chirally controlled” in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration. As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage. As used herein, “cleavable moiety” means a bond or group of atoms comprising at least one bond that is cleaved under physiological conditions, for example, inside a cell or a subject. For example, a cleavable moiety may be cleaved inside a cell or sub-cellular compartment, such as an endosome or lysosome. A cleavable moiety may be cleaved by endogenous enzymes, such as nucleases. As used herein, “complementary” in reference to a first strand of linked nucleosides (e.g., an oligonucleotide or nucleic acid) and a second strand of linked nucleosides means that the nucleobases of the first strand of linked nucleosides and the nucleobases of the second strand of linked nucleosides are complementary nucleobases when the nucleobase sequences of the first and second strands of linked nucleosides are aligned. The complementary first and second strands of linked nucleosides may be, for example, regions of a single nucleic acid molecule (duplex regions that are self-complementary regions) or regions of separate nucleic acids (oligomeric duplexes). One or both of the first and second strands of linked nucleosides are for example, oligonucleotides or regions thereof, or cellular target nucleic acids or regions thereof. Not every pair of nucleosides of a complementary pair of first and second strands of linked nucleosides needs complementarity for the two strands to be “complementary.” Rather, some mismatches are tolerated. Where complementarity is expressed as a percent, such percent represents the percent of nucleobases within the identified first strand that are complementary to nucleobases within an equal length region of the second strand. Unless otherwise specified, “complementary” is assumed to be at least 70%. The complementary strands may be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if an oligonucleotide consisting of 20 nucleosides is 80% complementary to a nucleic acid, then 16 of the nucleobase pairs are complementary nucleobases, and there are 4 mismatches. If an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to a nucleic acid, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases, and there are 0-4 mismatches. As used herein, “fully complementary” or “100 % complementary” means that the nucleobase sequence of the first and second strands of linked nucleosides have complementary nucleobases at each nucleoside of the shorter of the two strands of nucleosides, or at each nucleoside if the two strands of nucleosides are the same length. As used herein, “complementary nucleobases” means nucleobases that form hydrogen bonds with one another  when two strands of linked nucleosides (e.g., an oligonucleotide and a target nucleic acid; or two oligonucleotides) are aligned. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases are known in the art. For example, hypoxanthine, the nucleobase of the nucleoside inosine (I) can pair with adenosine, cytosine, or uracil. Herein, hypoxanthine is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C). As used herein, “complementary region” in reference to a first strand of linked nucleosides (e.g., an oligonucleotide or a nucleic acid) is the range of nucleobases of the first strand of linked nucleosides that is complementary with a second strand of linked nucleosides. A “complementary region” may include a mismatch, but the terminal nucleobases of a “complementary region” of the first strand of linked nucleosides are complementary to the second strand of linked nucleosides. A “targeting region” of an oligonucleotide is a complementary region in which the nucleobase sequence of the region is complementary to the nucleobase sequence of a target region of a target nucleic acid. A “duplexing region” is a complementary region of an oligonucleotide having a nucleobase sequence that is complementary to the nucleobase sequence of a second oligonucleotide. A complementary region may be only a portion of the first and / or second strand of linked nucleosides or it may constitute the entire first and / or second strand. As used herein, “conjugate group” means a group of atoms directly or indirectly attached to an oligonucleotide that confers at least one property to the resulting conjugated oligonucleotide. A conjugate group comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide. As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule modifies one or more properties of such molecule compared to the identical molecule lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. As used herein, “constrained ethyl” or “cEt” or “cEt sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4’-carbon and the 2’-carbon of the β- D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)--O-2', and wherein the methyl group of the bridge is in the S configuration. As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety. As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a β-D-2’-deoxyribosyl sugar moiety. Each nucleoside of a deoxy region is selected from a 2’-β-D- deoxynucleoside, a bicyclic nucleoside, and a 2’-substituted nucleoside. A deoxy region supports RNase H activity. A deoxy region is the gap or internal region of a gapmer. As used herein, “DNA nucleoside” means a nucleoside comprising an unmodified DNA sugar moiety. A DNA nucleoside may be comprise a modified or unmodified nucleobase. A DNA nucleoside may comprise a uracil nucleobase or a modified nucleobase, or may be an abasic nucleoside. As used herein, “DNA sugar moiety” means an unmodified DNA sugar moiety. As used herein, “double-stranded” in reference to a strand of linked nucleosides (e.g., an oligonucleotide) or a region thereof, means that the strand of linked nucleosides or region thereof is paired with a complementary strand of linked nucleosides or a region thereof. In certain embodiments, the strand of linked nucleosides and the complementary strand of linked nucleosides are separate molecules. In certain embodiments, the double-stranded region is formed from a first region and a second region of a single molecule (e.g., a hairpin structure). As used herein, “duplex” or “duplex region” means the structure formed by hybridization of complementary base pairs between two strands of linked nucleosides or regions thereof (e.g., two separate oligonucleotides or an oligonucleotide and a target nucleic acid). For clarity, herein a “hairpin oligonucleotide” is a single strand of linked nucleosides that comprises a region that is double stranded and is not considered a duplex. As used herein, “gapmer” means a modified oligonucleotide comprising an internal region positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5’-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2’-β-D-deoxynucleoside. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2’-β-D-deoxynucleosides and wings comprising 2’-MOE nucleosides. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications. As used herein, “hybridization” means the process of two complementary regions of strands of linked nucleosides (e.g., oligonucleotides and / or nucleic acids) annealing together to form a duplex or a double-stranded region. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. As used herein, “internucleoside linkage” means the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, “unmodified internucleoside linkage” means a phosphodiester internucleoside linkage. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. A “phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. A “mesyl phosphoramidate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with NS(=O)2CH3. Unless otherwise indicated, and in the context of linked nucleosides each comprising a furanosyl sugar moiety, an internucleoside linkage joins the 3’-carbon of one furanosyl sugar moiety to the 5’-carbon of the other furanosyl sugar moiety. As used herein, “inverted nucleoside” means a nucleoside having a 3′ to 3′ and / or 5′ to 5′ internucleoside linkage. As used herein, “inverted sugar moiety” means a furanosyl sugar moiety having a 3′ to 3′ and / or 5′ to 5′ internucleoside linkage to the remainder of an oligonucleotide. As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked). As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide. As used herein, “mismatch” means a nucleobase of a first strand of linked nucleosides or region thereof (e.g., oligonucleotide, nucleic acid) that is not complementary with the corresponding nucleobase of a second strand of linked nucleosides or region thereof when the first and second nucleic acid strands are aligned. As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide. As used herein, “modified sugar moiety” means a group of atoms other than an unmodified sugar moiety that form the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA or the β-D-deoxyribosyl sugar in DNA. A modified sugar moiety is selected from a modified furanosyl sugar moiety, a modified deoxyfuranosyl sugar moiety, a cyclic sugar surrogate, a bicyclic sugar surrogate, an acyclic sugar surrogate, or a sugar mimic. As used herein, “non-bicyclic modified sugar moiety” means a modified furanosyl sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked nucleosides or a region thereof independent of any sugar or internucleoside linkage modification. As used herein, “the nucleobase sequence of” a reference SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each nucleobase, each sugar moiety, and each internucleoside linkage, independently, may be modified or unmodified, irrespective of presence or absence of modifications, indicated in the refenced SEQ ID NO. As used herein, “nucleoside” means an “unmodified nucleoside” or a “modified nucleoside”. As used herein, an “unmodified nucleoside” means a compound or subunit comprising an unmodified sugar moiety and an unmodified nucleobase. As used herein, a “modified nucleoside” means a compound or subunit comprising a sugar moiety and optionally a nucleobase, wherein the sugar moiety is modified and / or the nucleobase is modified or absent. As used herein, a “nucleoside mimic” means a compound or subunit comprising a sugar mimic, and optionally, a nucleobase. As used herein, “nucleoside overhang” or “overhang” refers to unpaired nucleosides at either or both ends of an oligomeric duplex. As used herein, “oligomeric agent” means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional features selected from among: (a) one or more additional modified or unmodified oligonucleotide, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; and (b) one or more conjugate group, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; and (c) one or more terminal group. Herein, where two oligonucleotides are described as being covalently attached to one another, such attachment is other than through a direct internucleoside linkage. Thus, a single, unbranched oligonucleotide comprising only direct internucleoside linkages cannot be described as two separate covalently linked oligonucleotides. As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 10-80 linked nucleosides. Unless otherwise indicated, when present, no more than 10% of the nucleosides of an oligonucleotide are abasic nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside and / or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester internucleoside linkages. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide to form an oligomeric duplex, or it may be unpaired. As used herein, “pharmaceutically acceptable diluent” means an ingredient in a pharmaceutical composition suitable for use in administering to a subject. Typically, a “diluent” lacks pharmacological activity but is necessary or desirable in preparing a pharmaceutical composition. For example, a diluent in an injectable composition can be a liquid, e.g., phosphate buffered saline (PBS), water, or saline solution. Certain carriers or diluents enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. A pharmaceutically acceptable carrier or diluent may be sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid. As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. As used herein “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemical present in cells or tissues and / or by physiologic conditions. The first form of the prodrug may be less active than the second form. As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. A pharmaceutical composition may show activity in a free uptake assay in certain cell lines. As used herein, “population” means a plurality of molecules of identical molecular formula. As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified. As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. An RNAi agent modulates the amount and / or activity, of a target nucleic acid. The term RNAi agent excludes antisense agents that act principally through RNase H. As used herein, “RNase H agent” means an antisense agent that acts, at least in part, through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNase H agents may be single-stranded or RNase H agents may be double-stranded. RNase H agents may comprise conjugate groups and / or terminal groups. An RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2. As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group. As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. As used herein, “single-stranded” in reference to a strand of linked nucleosides (e.g., an oligonucleotide) or a region thereof means that the strand of linked nucleosides or region thereof is unpaired and is not part of a duplex or part of a double-stranded region resulting from self-complementarity. Single-stranded nucleic acids (e.g., single stranded oligonucleotides) are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded. As used herein, “stabilized phosphate group” or “stabilized phosphate moiety” means a 5’-phosphate analog that is metabolically more stable than a 5’-phosphate as naturally occurs on DNA or RNA. As used herein, "sugar surrogate" means a group of atoms other than an unmodified sugar moiety that can form the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA or the β-D-deoxyribosyl sugar in DNA. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids. A modified sugar moiety may be selected from a modified furanosyl or modified deoxyfuranosyl sugar moiety, a cyclic sugar surrogate, a bicyclic sugar surrogate, an acyclic sugar surrogate, or a sugar mimic. As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that chiral center. The stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”). The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate internucleoside linkage or at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage, having a random stereochemical configuration. As used herein, a “strand” or “strand of linked nucleosides” means contiguous linked nucleosides connected via internucleoside linkages. A strand of linked nucleosides has a nucleobase sequence. As used herein, “subject” means a human or non-human animal. As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2’-OH(H) β-D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties are furanosyl or deoxyfuranosyl sugar moieties in the β-D-ribosyl stereochemical configuration, and have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position and 2 hydrogens, or a hydrogen and an OH at the 2’ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. As used herein, a “sugar surrogate nucleoside” means a nucleoside comprising a “cyclic sugar surrogate nucleoside” or a nucleoside comprising an “acyclic sugar surrogate nucleoside”. As used herein a “cyclic sugar surrogate nucleoside” is a nucleoside having Formula I: Wherein J is H, C1-C6alkyl, or C2-C6alkenyl; X is O, S, C(R1R2), N(R3), or X1-X2, wherein X1-X2is C(R1)=C(R2), C(R1R2)-C(R1R2), O-C(R1R2), C(R1R2)-O, S-C(R1R2), C(R1R2)-S, N(R3)-C(R1R2), or C(R1R2)-N(R3); Y is C(R1R2) or Y1-Y2, wherein Y1-Y2is C(R1)=C(R2), or C(R1R2)-C(R1R2); Z is C(G1G2) or Z1-Z2or Z1-Z2-Z3,,wherein Z1-Z2is C(G1)=C(R1), C(R1)=C(G1), C(G1G2)-C(R1R2), C(R1R2)- C(G1G2); wherein Z1-Z2-Z3is C(G1G2)-C(R1R2)-C(R1R2), C(R1R2)-C(G1G2)-C(R1R2), or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; each R1and R2is independently H, OH, C1-C6alkyl, or N(R4); wherein if R1is OH, then R2is not OH; each R3and R4is independently H, C1-C6alkyl, or C(=O)R5, wherein R5is C1-C6alkyl; each G1and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if G1is OH, then G2is not OH; each R6and R7is, independently, H, halogen, C1-C6alkyl or substituted C1-C6alkyl; each XGis O, S or N(E1); R8is H, halogen, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2-C6alkynyl, substituted C2-C6alkynyl or N(E2)(E3); E1, E2and E3are each, independently, H, C1-C6alkyl or substituted C1-C6alkyl; m is 0 or 1; p is 0 or 1; q is from 1 to 6; s is 0 or 1; j is 0 or 1; Bx is a nucleobase; and with the proviso that if X is O, Z is C(G1G2), and Q is CH, then m is 1. As used herein, a “cyclic sugar surrogate” means the sugar moiety of a cyclic sugar surrogate nucleoside. As used herein, an “acyclic sugar surrogate nucleoside” means a nucleoside having Formula II, Formula III, or Formula IV: Wherein: X is O, S, C(R4R5), N(E1), N(E1)-C(=O); each J1and J2are independently H or C1-C6alkyl; n is 0, 1 or 2; m is 0, 1, or 2; p is 0 or 1; o is 0 or 1; s is 0 or 1; R1is H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, or (CH2)qR8;R2, R3, and R4are each independently H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qR8; E1is H, C1-C6alkyl or substituted C1-C6alkyl; R4and R5are independently H, OH, C1-C6alkyl, or N(R7); wherein if R5is OH, then R6is not OH; R6R7is H, C1-C6alkyl, or C(=O)R8, wherein R8is C1-C6alkyl; R8is OH, halogen, methoxy, ethoxy, azido, C2-C6alkenyl, or C2-C6alkynyl, and q is 1, 2, or 3; and Bx is a nucleobase. As used herein, an “acyclic sugar surrogate” means the sugar moiety of an acyclic sugar surrogate nucleoside. As used herein, a “sugar mimic” means a group of atoms other than a furanosyl sugar moiety or a sugar surrogate (e.g., a cyclic sugar surrogate, or an acyclic sugar surrogate) forming the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA. As used herein, “sugar surrogate nucleoside” means a nucleoside comprising a cyclic sugar surrogate or nucleoside comprising an acyclic sugar surrogate. As used herein, “symptom” of a disease or disorder means any manifestation, indication, sign, or evidence of a disease that indicates the existence or extent of a disease or disorder. A symptom may be apparent to a subject or to a medical professional examining or testing said subject. A symptom may be apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests. A symptom may be an absence of a feature, such as failing to reach expected developmental milestones. Herein, symptoms include hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. As used herein, “target nucleic acid” and “target RNA” means a TUBB4A nucleic acid that an antisense oligonucleotide is designed to affect. As used herein, ”target RNA” means an TUBB4A RNA transcript and includes pre-mRNA and mRNA unless otherwise specified. As used herein, “target region” means a portion of a target nucleic acid (e.g., TUBB4A) to which an oligomeric compound is designed to hybridize. As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide. As used herein, “treating” or “treatment” with respect to a disease means administering an oligomeric agent to a subject having or at risk for developing such disease. Treating a disease may result in amelioration of at least one symptom of such disease. In certain embodiments, treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom such that a symptom of the disease is diminished, is no longer apparent, or is never apparent. As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves at least one symptom of a disease. As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). CERTAIN EMBODIMENTS The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide comprises a targeting region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an equal length target region of a TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Embodiment 2. The oligomeric agent of embodiment 1, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1. Embodiment 3. The oligomeric agent of embodiment 1 or embodiment 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3051-3070 of SEQ ID NO: 1. Embodiment 4. The oligomeric agent of any one of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the TUBB4A nucleic acid. Embodiment 5. An oligomeric agent comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 5, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Embodiment 6. The oligomeric agent of embodiment 5, wherein the modified oligonucleotide consists of 16 to 25 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. Embodiment 7. The oligomeric agent of embodiment 5 or embodiment 6, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. Embodiment 8. The oligomeric agent of any one of embodiments 5-7, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 5. Embodiment 9. The oligomeric agent of any one of embodiments 5-8, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a TUBB4A nucleic acid, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1. Embodiment 10. The oligomeric agent of any one of embodiments 5-9, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. Embodiment 11. The oligomeric agent of any one of embodiments 5-10, wherein the modified oligonucleotide consists of 20 linked nucleosides. Embodiment 12. The oligomeric agent of any one of embodiments 5-11, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside. Embodiment 13. The oligomeric agent of embodiment 12, wherein the at least one modified nucleoside comprises a modified sugar moiety. Embodiment 14. The oligomeric agent of embodiment 13, wherein the modified sugar moiety comprises a bicyclic sugar moiety. Embodiment 15. The oligomeric agent of embodiment 13 or embodiment 14, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH2- and -O-CH(CH3)-. Embodiment 16. The oligomeric agent of any one of embodiments 13-14, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety. Embodiment 17. The oligomeric agent of embodiment 16, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, or a β-D-deoxyxylosyl sugar moiety. Embodiment 18. The oligomeric agent of embodiment 16 or embodiment 17, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety. Embodiment 19. The oligomeric agent of any one of embodiments 5-18, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 20. The oligomeric agent of embodiment 19, wherein at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. Embodiment 21. The oligomeric agent of any one of embodiments 5-20, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage. Embodiment 22. The oligomeric agent of any one of embodiments 5-21, wherein the modified oligonucleotide comprises an internucleoside linkage motif (5’ to 3’) of soooossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Embodiment 23. The oligomeric agent of any one of embodiments 5-22, wherein the modified oligonucleotide comprises at least one modified nucleobase. Embodiment 24. The oligomeric agent of embodiment 23, wherein the modified nucleobase is 5- methylcytosine. Embodiment 25. The oligomeric agent of embodiment 24, wherein each cytosine is a 5-methylcytosine. Embodiment 26. The oligomeric agent of any one of embodiments 5-25, wherein one or more nucleosides of the modified oligonucleotide comprises an unmodified nucleobase. Embodiment 27. The oligomeric agent of any one of embodiments 5-26, wherein the modified oligonucleotide comprises a deoxy region. Embodiment 28. The oligomeric agent of embodiment 27, wherein each nucleoside of the deoxy region is a 2’- β-D-deoxynucleoside. Embodiment 29. The oligomeric agent of embodiment 27 or embodiment 28, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. Embodiment 30. The oligomeric agent of any one of embodiments 27-29, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. Embodiment 31. The oligomeric agent of any one of embodiments 27-30, wherein the deoxy region is flanked on the 5’-side by a 5’ external region consisting of 1-6 linked 5’ external region nucleosides and on the 3’-side by a 3’ external region consisting of 1-6 linked 3’ external region nucleosides; wherein the 3’-most nucleoside of the 5’ external region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’ external region comprises a modified sugar moiety. Embodiment 32. The oligomeric agent of embodiment 31, wherein each nucleoside of the 3’ external region comprises a modified sugar moiety. Embodiment 33. The oligomeric agent of embodiment 31 or embodiment 32, wherein each nucleoside of the 5’ external region comprises a modified sugar moiety. Embodiment 34. The oligomeric agent of embodiment 33, wherein the modified oligonucleotide has: a 5’ external region consisting of 5 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3’ external region consisting of 5 linked nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside. Embodiment 35. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation:mCesAeoTeoGeoAeomCdsTdsTdsTdsAdsAdsGdsmCdsTdsTdsmCeoAeomCesAesAe(SEQ ID NO: 6), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase; G = a guanine nucleobase; T = a thymine nucleobase; e = a 2’-MOE sugar moiety; d = a 2’-β-D-deoxyribosyl sugar moiety; s = a phosphorothioate internucleoside linkage; and o = a phosphodiester internucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group or a terminal group. Embodiment 36. The oligomeric agent of any one of embodiments 1-35, consisting of the modified oligonucleotide. Embodiment 37. The oligomeric agent of any one of embodiments 1-36, wherein the oligomeric compound comprises a conjugate group. Embodiment 38. The oligomeric agent of embodiment 37, wherein the conjugate group comprises a conjugate linker and a conjugate moiety. Embodiment 39. The oligomeric agent of embodiment 38, wherein the conjugate linker consists of a single bond. Embodiment 40. The oligomeric agent of any one of embodiments 38-39, wherein the conjugate linker is cleavable. Embodiment 41. The oligomeric agent of any one of embodiments 38-40, wherein the conjugate linker comprises 1-3 linker-nucleosides. Embodiment 42. The oligomeric agent of any one of embodiments 38-41, wherein the conjugate linker does not comprise any linker nucleosides. Embodiment 43. The oligomeric agent of any one of embodiments 38-42, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide. Embodiment 44. The oligomeric agent of any one of embodiments 38-42, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide. Embodiment 45. The oligomeric agent of any one of embodiments 1 to 44, wherein the oligomeric compound comprises a terminal group. Embodiment 46. The oligomeric agent of embodiment 45, wherein the terminal group is an abasic sugar moiety. Embodiment 47. The oligomeric agent of any one of embodiments 1-46, wherein the oligomeric compound is a singled-stranded oligomeric compound. Embodiment 48. A modified oligonucleotide according to the following chemical structure: NH2 salt. Embodiment 51. A modified oligonucleotide according to the following chemical structure: enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration. Embodiment 53. The chirally enriched population of embodiment 52, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration. Embodiment 54. The chirally enriched population of embodiment 52, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. Embodiment 55. The chirally enriched population of embodiment 52, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. Embodiment 56. The chirally enriched population of embodiment 52, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction. Embodiment 57. A population of oligomeric agents of any one of embodiments 1-47 or a population of modified oligonucleotides of any one of embodiments 48-51, wherein each of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. Embodiment 58. A pharmaceutical composition comprising an oligomeric agent of any one of embodiments 1- 47, a modified oligonucleotide of any one of embodiments 48-51, or a population of any one of embodiments 52-57, and a pharmaceutically acceptable diluent. Embodiment 59. The pharmaceutical composition of embodiment 58, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, water, or phosphate-buffered saline. Embodiment 60. The pharmaceutical composition of embodiment 58 or embodiment 59, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid. Embodiment 61. The pharmaceutical composition of any one of embodiments 58-60, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and phosphate-buffered saline. Embodiment 62. A method comprising administering to a subject an oligomeric agent of any one of embodiments 1-47, a modified oligonucleotide of any one of embodiments 48-51, a population of any one of embodiments 52-57, or a pharmaceutical composition of any one of embodiments 58-61. Embodiment 63. The method of embodiment 62, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of a disease or disorder associated with TUBB4A. Embodiment 64. The method of embodiment 62 or embodiment 63, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition reduces or slows progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. Embodiment 65. The method of any one of embodiments 62-64, wherein TUBB4A protein levels in the subject are reduced. Embodiment 66. The method of any one of embodiments 63-65, wherein the disease or disorder associated with TUBB4A is a neurodegenerative disease or disorder. Embodiment 67. The method of any one of embodiments 63-65, wherein the disease or disorder associated with TUBB4A is a TUBB4A-related leukodystrophy or Dystonia Type 4 (DYT4). Embodiment 68. The method of embodiment 67, wherein the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). Embodiment 69. A method of treating a disease or disorder associated with TUBB4A comprising administering to a subject having or at risk for developing a disease or disorder associated with TUBB4A a therapeutically effective amount of an oligomeric agent of any one of embodiments 1-47, a modified oligonucleotide of any one of embodiments 48-51, a population of any one of embodiments 52-57, or a pharmaceutical composition of any one of embodiments 58-61, thereby treating the disease or disorder associated with TUBB4A. Embodiment 70. The method of any one of embodiments 62-69, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of the disease or disorder associated with TUBB4A. Embodiment 71. The method of embodiment any one of embodiments 69-70, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces or slows progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. Embodiment 72. The method of any one of embodiments 69-71, wherein TUBB4A protein levels in the subject are reduced. Embodiment 73. The method of any one of embodiments 69-72, wherein the disease or disorder associated with TUBB4A is a TUBB4A-related leukodystrophy. Embodiment 74. The method of embodiment 73, wherein the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, Dystonia Type 4 (DYT4), and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). Embodiment 75. The method of any one of embodiments 69-74, wherein the subject is human. Embodiment 76. A method of reducing expression of TUBB4A in a cell comprising contacting the cell with an oligomeric agent of any one of embodiments 1-47, a modified oligonucleotide of any one of embodiments 48-51, a population of any one of embodiments 52-57, or a pharmaceutical composition of any one of embodiments 58-61. Embodiment 77. The method of embodiment 76, wherein the cell is a neuron or an oligodendrocyte. Embodiment 78. The method of embodiment 76 or embodiment 77, wherein the cell is a human cell. Embodiment 79. Use of an oligomeric agent of any one of embodiments 1-47, a modified oligonucleotide of any one of embodiments 48-51, a population of any one of embodiments 52-57, or a pharmaceutical composition of any one of embodiments 58-61 for treating a disease or disorder associated with TUBB4A. Embodiment 80. Use of an oligomeric compound of any one of embodiments 1-47, a modified oligonucleotide of any one of embodiments 48-51, a population of any one of embodiments 52-57, or a pharmaceutical composition of any one of embodiments 58-61 in the manufacture of a medicament for treating a disease or disorder associated with TUBB4A. Embodiment 81. The use of any one of embodiments 79-80, wherein the disease or disorder associated with TUBB4A is associated with an elevated level of TUBB4A. Embodiment 82. The use of any one of embodiments 79-81, wherein the disease or disorder associated with TUBB4A is a TUBB4A-related leukodystrophy or Dystonia Type 4 (DYT4). Embodiment 83. The use of embodiment 82, wherein the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). Oligomeric Agents and Oligomeric Compounds Certain embodiments provide oligomeric agents targeted to a TUBB4A nucleic acid. In certain embodiments, a TUBB4A nucleic acid has the sequence set forth in SEQ ID NO: 1 (Ensembl transcript ID ENSG00000104833.12, Ensembl release 109 – Feb 2023), incorporated herein by reference in its entirety. In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound. In certain embodiments, the oligomeric agent is an oligomeric duplex. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides, wherein the modified oligonucleotide comprises a targeting region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an equal length target region of a TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide comprises a targeting region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an equal length target region of a TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a TUBB4A nucleic acid. In certain embodiments, the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1. In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an TUBB4A nucleic acid, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3051-3070 of SEQ ID NO: 1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion within nucleobases 3051-3070 of SEQ ID NO: 1. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 5. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 15 to 25 linked nucleosides and having a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 5. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 5. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5. Certain embodiments provide an oligomeric agent comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence consisting of SEQ ID NO: 5. In any of the oligomeric compounds provided herein, the modified oligonucleotide can consist of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 15-25 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18-25 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18-22 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 19-20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In any of the oligomeric agents provided herein, at least one internucleoside linkage of the modified oligonucleotide can be a phosphorothioate internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising at least one phosphorothioate internucleoside linkage. In certain embodiments, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 9-18 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 10-14 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 13 phosphorothioate internucleoside linkages. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide can be a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising at least one, at least 2, at least 3, at least 4, at least 5, or at least 6 phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 1, 2, 3, 4, 5, 6 or 1-6 phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 1 phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 2 phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 6 phosphodiester internucleoside linkages. In any of the oligomeric agents provided herein, at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety or a 2’-OMe sugar moiety. In certain embodiments, the modified sugar moiety is a 2’-MOE sugar moiety. In any of the oligomeric agents provided herein, at least one nucleobase of the modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is a modified cytosine, such as, for example, 5- methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine. In any of the oligomeric agents provided herein, the modified oligonucleotide can comprise a deoxy region consisting of 5-12 contiguous 2’-deoxynucleosides. In certain embodiments, each nucleoside of the deoxy region is a 2’-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, the deoxy region consists of 10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is flanked on the 5’-side by a 5’ external region consisting of 1-6 linked 5’ external region nucleosides and on the 3’-side by a 3’ external region consisting of 1-6 linked 3’ external region nucleosides, wherein the 3’-most nucleoside of the 5’ external region comprises a modified sugar moiety, and the 5’-most nucleoside of the 3’ external region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 3’ external region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 5’ external region comprises a modified sugar moiety. In certain embodiments, each of the 5’ external region nucleosides and each of the 3’ external region nucleosides comprises a modified sugar moiety. In certain embodiments, each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside. In certain embodiments, the modified oligonucleotide has a 5’ external region consisting of 5 linked nucleosides, a deoxy region consisting of 10 linked nucleosides, and a 3’ external region consisting of 5 linked nucleosides, wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside. Compound No.1653044 Compound No.1653044 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides and having a nucleobase sequence of (from 5’ to 3’) CATGACTTTAAGCTTCACAA (SEQ ID NO: 5), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 (from 5’ to 3’) are 2’-β- D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8, to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine. Compound No.1653044 is represented by the following chemical notation (5’ to 3’):mCesAeoTeoGeoAeomCdsTdsTdsTdsAdsAdsGdsmCdsTdsTdsmCeoAeomCesAesAe(SEQ ID NO: 6), wherein, A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’ MOE sugar moiety, d = a 2’-β-D deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.. Compound No.1653044 is represented by the following chemical structure: cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, Compound 1653044 is a sodium salt or a potassium salt.

[0002] The sodium salt of Compound No.1653044 is represented by the following chemical structure: Provided herein are oligomeric agents comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotide, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate group, which may be covalently attached to any oligonucleotide of such oligomeric agent; and (c) one or more terminal group. In certain embodiments, provided herein are oligomeric agent comprising or consisting of an antisense modified oligonucleotide complementary to TUBB4A target RNA. In certain embodiments, provided herein are oligomeric agents comprising an oligomeric duplex comprising or consisting of a modified antisense oligonucleotide complementary to TUBB4A RNA, and a modified sense oligonucleotide complementary to the antisense oligonucleotide. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase or lacking a nucleobase) and / or at least one modified internucleoside linkage. Examples of certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides (antisense and / or sense) are described herein. A. Modified Nucleosides Modified nucleosides comprise a modified sugar moiety or a modified nucleobase (or lack a nucleobase) or both a modifed sugar moiety and a modified nucleobase (or lack a nucleobase). In certain embodiments, modified nucleosides comprising the following modifed sugar moieties and / or the following modifed nucleobases may be incorporated into modified antisense and / or sense oligonucleotides described herein. 1. Modified Sugar Moieties Modified sugar moieties include modified furanosyl sugar moieties, cyclic sugar surrogates, acyclic sugar surrogates, and sugar mimics. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties, such as furanosyl sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more substituent groups, including, but not limited to, substituents at the 2’, 3’, 4’, and / or 5’ positions. In certain embodiments, the modified furanosyl sugar moiety is a ribosyl sugar moiety that is not an unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety. In certain embodiments, one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, non-bicyclic modifed sugar moieties are 2’-substituted sugar moieties and comprise a substituent group at the 2’-position. Examples of substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: F, OCH3(“OMe” or “O-methyl”), and OCH2CH2OCH3(“MOE”). In certain embodiments, 2’-substituent groups are selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10alkoxy, O-C1-C10substituted alkoxy, O-C1-C10alkyl, O-C1-C10substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S- alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl, -O(CH2)2ON(CH3)2(“DMAOE”), or 2’- O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”). Synthetic methods for some of these 2’-substituent groups can be found in, e.g., Cook et al., U.S.6,531,584; and Cook et al., U.S.5,859,221. Certain embodiments of these 2’-substituent groups can be further substituted with one or more substituent groups independently selected from: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected from F, NH2, N3, OCF3,OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl. In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected from: F, NH2, N3, OCF3,OCH3, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)- N(H)CH3(“NMA”). In certain embodiments, a 2’-substituted sugar moiety non-bicyclic modified nucleoside comprises a non- bridging 2’-substituent group selected from: F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, a 2’-substituted sugar moiety of a modified nucleoside comprises 2’-substituent group selected from: F, OCH3, and OCH2CH2OCH3. In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by sterochemical configuration. For example, a 2’-deoxyfuranosyl sugar moiety (i.e., 2’-(H)H furanosyl sugar moiety) may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified furanosyl sugar moieties are described in, e.g., WO 2020 / 072991. A 2’- modified furanosyl sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. Modified furanosyl sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified. In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise a substituent group at the 4’- position. Examples of substituent groups suitable for the 4’-position of modified sugar furanosyl moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise a substituent group at the 3’- position. Examples of substituent groups suitable for the 3’-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise a substituent group at the 5’- position. Examples of substituent groups suitable for the 5’-position of modified sugar moieties include, but are not limited to, vinyl, alkoxy (e.g., methoxy), and alkyl (e.g., methyl (R or S), ethyl). In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise more than one non-bridging sugar substituent, for example, 2’-F-5’-methyl sugar moieties, such as described in Migawa et al., US 2010 / 0190837, or alternative 2’- and 5’-modified sugar moieties as described in Rajeev et al., US 2013 / 0203836. Certain modified furanosyl sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4’ and the 2’ furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include, but are not limited to: 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2-O-2’ (“LNA”), 4’-CH2-S-2’, 4’-(CH2)2-O-2’ (“ENA”), 4’-CH(CH3)-O-2’ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)-2’, 4’-CH(CH2OCH3)-O-2’ (“constrained MOE” or “cMOE”) and analogs thereof, 4’-C(CH3)(CH3)-O-2’ and analogs thereof, 4’-CH2-N(OCH3)-2’ and analogs thereof , 4’-CH2-O- N(CH3)-2’ , 4’-CH2-C(H)(CH3)-2’, 4’-CH2-C(=CH2)-2’ and analogs thereof ), 4’-C(RaRb)-N(R)-O-2’, 4’-C(RaRb)-O- N(R)-2’, 4’-CH2-O-N(R)-2’, and 4’-CH2-N(R)-O-2’, wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12alkyl. Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S.7,427,672; Swayze et al., U.S.7,741,457, and Swayze et al., U.S.8,022,193; Seth et al., U.S.8,278,283; Prakash et al., U.S.8,278,425; Seth et al., U.S.8,278,426). In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, H, a protecting group, hydroxyl, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7alicyclic radical, substituted C5-C7alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1and J2is, independently, H, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, acyl (C(=O)- H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12aminoalkyl, substituted C1-C12aminoalkyl, or a protecting group. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 5' and the 3' furanose ring atoms. Examples of such 5’ to 3’ bridging sugar substituents include, but are not limited to: 5'-(CH2)2-3' (bcDNA), 5'- (CH2)3-3' (bc4,3DNA), 5’-C(F)=CH-CH2-3’, and 5'-CH2-CHQ-3’, wherein Q is an attachment to an internucleoside linkage. Additional bicyclic sugar moieties are known in the art, see, for example: Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., U.S.8,080,644; Ramasamy et al., U.S.6,525,191; Seth et al., U.S.7,547,684; and Seth et al., U.S.7,666,854. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration. α-L-methyleneoxy (4’-CH2-O-2’) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified. In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’-substituted and 4’-2’ bridged sugars). In certain embodiments, modified sugar moieties are sugar surrogates selected from cyclic sugar surrogates and acyclic sugar surrogates. A cyclic sugar surrogate can be represented by Formula Ia: Formula Ia Wherein: J is H, C1-C6alkyl, or C2-C6alkenyl; X is O, S, C(R1R2), N(R3), C(R1)=C(R2), C(R1R2)-C(R1R2), O-C(R1R2), C(R1R2)-O, S-C(R1R2), C(R1R2)-S, N(R3)-C(R1R2), or C(R1R2)-N(R3); Y is C(R1R2), C(R1)=C(R2), or C(R1R2)-C(R1R2); Z is C(G1G2), Z1-Z2, or Z1-Z2-Z3, wherein Z1-Z2is C(G1)=C(R1), C(R1)=C(G1), C(G1G2)-C(R1R2), C(R1R2)- C(G1G2), and Z1-Z2-Z3is C(G1G2)-C(R1R2)-C(R1R2), C(R1R2)-C(G1G2)-C(R1R2), or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; each R1and R2is independently H, OH, C1-C6alkyl, or N(R4); wherein if R1is OH, then R2is not OH; each R3and R4is independently H, C1-C6alkyl, or C(=O)R5, wherein R5is C1-C6alkyl; each G1and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if G1is OH, then G2is not OH; each R6and R7is, independently, H, halogen, C1-C6alkyl or substituted C1-C6alkyl; each XGis O, S or N(E1); R8is H, halogen, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2-C6alkynyl, substituted C2-C6alkynyl or N(E2)(E3); E1, E2and E3are each, independently, H, C1-C6alkyl or substituted C1-C6alkyl; m is 0 or 1; p is 0 or 1; q is from 1 to 6; s is 0 or 1; j is 0 or 1; and with the proviso that if X is O, Z is C(G1G2), and Q is CH, then m is 1. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position and / or the 5’ position. In certain embodiments, cyclic sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a cyclic sugar surrogate comprises a six-membered tetrahydropyran (“THP”) where X in Formula Ia is O-C(R1R2), p is 1, Q is CH, Z is C(G1G2), and m is 0. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), altritol nucleic acid (G1=OH; G2=H; “ANA”), and fluoro HNA: (G1=F; G2=H; “FHNA”, see e.g., Elgi, et. al., J Am Chem (2011) 133(41):16642-16649, Swayze et al., U.S.8,088,904; and Swayze et al., U.S.8,440,803); FHNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran, or 3’- FHNA). Bx is a nucleobase moiety. In certain embodiments, cyclic sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported. As used here, the term “morpholino” means a sugar surrogate having Formula Ia, above, wherein X is O, Y and Z are each CH2, and Q is N: In certain embodiments, a morpholino may be modified, for example, by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.” In certain embodiments, sugar surrogates are acyclic sugar surrogates and have Formula IIa, IIIa, or IVa: X is O, S, C(R5R6), N(E1), N(E1)-C(=O); each J1and J2is independently H or C1-C6alkyl; n is 0, 1 or 2; m is 0, 1, or 2; o is 0 or 1; s is 0 or 1; R1is H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, or (CH2)qR7; R2, R3, and R4 are each independently H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qR7; E1is H, C1-C6alkyl or substituted C1-C6alkyl; R5and R6are independently H, OH, C1-C6alkyl, or N(R7); wherein if R5is OH, then R6is not OH; R7is H, C1-C6alkyl, or C(=O)R9, wherein R9is C1-C6alkyl; R8is OH, halogen, methoxy, ethoxy, azido, C2-C6alkenyl, or C2-C6alkynyl, and q is 1, 2, or 3. In certain embodiments, acyclic sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent Publication No.2011 / 0313020. In certain embodiments, acyclic sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides, having Formula IIa wherein n is 1, m and o are 0, s is 1, and J2, R2, and R3are each H, or the butyl as found in acyclic butyl nucleic acid, having Formula IIa wherein n is 2, m and o are 0, s is 1, and J2, R2, and R3are each H.In certain embodiments, acyclic sugar surrogates are also known as “C3 spacers” and have Formula IIa wherein n and o are 1; m and s are 0, and J1, J2, R1, and R3are each H. Further acyclic sugar surrogates include those described in Manoharan et al., U.S.10,913,767; US patent publication US 2021 / 0238595; and PCT publication WO 2023 / 109940. In certain embodiments, modified oligonucleotides include one or more sugar mimic, in which a group of atoms other than a “furanosyl sugar moiety” or a “sugar surrogate” form the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA. In certain embodiments, a sugar mimic is a portion of the backbone of a peptide nucleic acid, while the remainder of the backbone of the peptide nucleic acid is an internucleoside linkage. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262.   2. Modified Nucleobases   In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. In certain embodiments, modified adenine has structure (I):                   wherein: R1Ais absent or H; R2Ais H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6thioalkyl, substituted C1-C6thioalkyl, C1-C6alkyloxy, or substituted C1-C6alkyloxy; R6Ais H, N(Ra)(Rb), oxo, acetyl, formyl, or O-phenyl; Y7Ais N and R7Ais absent or is C1-C6alkyl; or Y7Ais C and R7Ais H, C1-C6alkyl, or CN(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R2Ais H, and R6Ais NH2(unmodified adenine). In certain embodiments, modified guanine has structure (II):   wherein: R2Gis N(Ra)(Rb); R6Gis oxo and R1Gis H, or R6Gis O-C1-C6alkyl or S-C1-C6alkyl and R1Gis absent; Y7Gis N and R7gis absent or is C1-C6alkyl; or Y7Gis C and R7Gis H, C1-C6alkyl, or CN(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gfrom H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7- membered heterocycle; excluding where Y7Gis N; Y8Gis C, R8Gis H, R2Gis NH2, and R6Gis =O (unmodified guanosine). In certain embodiments, modified thymine or modified uracil has structure (III): wherein: each X is independently O or S and R5Uis H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl, C1-C12alkyl, substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and unmodified thymine, respectively). In certain embodiments, modified cytosine has structure (IV):   S, R4Cis N(Ra)(Rb); R5Cis H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl, C1- C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2and R5Cis H (unmodified cytosine). As used herein, a “5- methylcytosine nucleobase” is a modified cytosine where X is O, R4Cis NH2, and R5Cis methyl. Hypoxanthine has structure (V): Hypoxanthine is considered a modified adenine, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, R2Ais H, and R6Ais oxo. In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C ^C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6- azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3- deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine- 2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443. Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, Rogers et al., U.S.5,134,066 ; Benner et al., U.S.5,432,272; Matteucci et al., U.S.5,502,177 ; Froehler et al., U.S.5,594,121; and Cook et al., U.S.5,681,941. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure I, modified guanine (G) having a structure represented by structure II, modified thymine (T) or modified uracil (U) having a structure represented by structure III, and modified cytosine (C) having a structure represented by structure IV. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and 5-methylcytosine (mC). In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U. 3. Modified Internucleoside Linkages In certain embodiments, oligomeric agents provided herein comprise or consist of a modified oligonucleotide comprising at least one modified internucleoside linkage. The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Herein, all internucleoside linkages between furanosyl sugar moieties are 3’ to 5’ internucleoside linkages unless otherwise indicated. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus- containing internucleoside linkages include, but are not limited to, phosphodiesters, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2- ), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)- N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, a modified internucleoside linkage is any of those described in WO 2021 / 030778, incorporated by reference herein. In certain embodiments, a modified internucleoside linkage has the formula: wherein for each such internucleoside linkage of a modified oligonucleotide: X is O R1is H, C1-C6alkyl, or substituted C1-C6alkyl; and T is SO2R2, C(=O)R3, or P(=O)R4R5, wherein: R2is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, substituted C1-C6alkyl, substituted C1-C6alkenyl substituted C1-C6alkynyl, and a conjugate group; R3is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3and a conjugate group; R4is selected from OCH3, OH, C1-C6alkyl, substituted C1-C6alkyl and a conjugate group; and R5is selected from OCH3, OH, C1-C6alkyl, and substituted C1-C6alkyl. In certain embodiments, a modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the formula: In internucleoside linkages have at least one chiral center. In such embodiments, a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates. The mesyl phosphoramidate internucleoside linkage comprises a chiral center. In certain embodiments, modified oligonucleotides comprise (Rp) and / or (Sp) mesyl phosphoramidates, which are shown in the following formulas, respectively, wherein “Bx” indicates a nucleobase:   . The In certain embodiments, modified oligonucleotides one or more of the following formulas, respectively, wherein “Bx” indicates a nucleobase:

[0003] Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising such internucleosidelinkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise mesyl phosphoramidate internucleoside linkages wherein all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each internucleoside linkage having a chiral center. Nonetheless, each individual internucleoside linkage having a chiral center of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and / or mesyl phosphoramidate internucleoside linkages, each independently in a particular, independently selected stereochemical configuration (e.g., Rp or Sp). In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 65%, 70%, 80, 90%, or 99% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise indicated, internucleoside linkages having chiral centers of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration. Certain internucleoside linkages having reduced charge (referred to as “neutral internucleoside linkages”) have been described. Such neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising comprising mixed N, O, S and CH2component parts. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, where a sugar moiety is linked 3′ to 3′ and / or 5′ to 5′, as shown below: , wherein nucleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide. In certain embodiments, inverted nucleosides lack a nucleobase (are abasic nucleosides). In certain such embodiments, additional features (e.g., a conjugate group) are attached to the inverted abasic nucleoside. A terminal inverted nucleoside can be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleosides are linked 2’ to 5’ rather than the 3’ to 5’ linkage. Such a linkage between two nucleosides is illustrated below. , wherein each Bx represents any nucleobase. B. Motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In certain embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). 1. Sugar Motifs In certain embodiments, modified oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, at least one nucleoside of an antisense oligonucleotide and / or a sense oligonucleotide comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of an antisense oligonucleotide and / or a sense oligonucleotide comprises a modified furanosyl sugar moiety or a sugar surrogate. In certain embodiments, a sugar moiety of an antisense oligonucleotide is modified, wherein the modified sugar moiety is selected from 2′-F, 2′-MOE, 2′-OMe, 2′-NMA, 2′-deoxy, and FHNA. In certain embodiments, a sugar moiety of a sense oligonucleotide is modified, wherein the modified sugar moiety is selected from 2′-F, 2′-MOE, 2′-OMe, and 2′-deoxy. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety and the oligonucleotide is referred to as a fully modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide is a 2′-substituted nucleoside comprising the same 2′-substituent. In certain embodiments, every other nucleoside of a fully modified oligonucleotide comprises the same 2′-substitutent, resulting in alternating 2′-substituents. In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside of the deoxy region is a deoxynucleoside. In certain embodiments, each nucleoside of the deoxy region is a 2’-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-12 or 7-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety. In certain embodiments, the deoxy region is flanked on the 5’-side by a 5’ external region consisting of linked 5’ external region nucleosides and on the 3’-side by a 3’ external region consisting of linked 3’external region nucleosides; wherein the 3’-most nucleoside of the 5’ external region is a modified nucleoside and the 5’-most nucleoside of the 3’ external region is a modified nucleoside. At least one nucleoside of the 5’ external region comprises a modified sugar moiety and at least one nucleoside of the 3’ external region comprises a modified sugar moiety. The three regions (the 5’ external region, the deoxy region, and the 3’ external region) form a contiguous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3’-most nucleoside of the 5’ external region and the sugar moiety of the 5’-most nucleoside of the 3’ external region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5’ external region, the deoxy region, and the 3’ external region. In certain embodiments, each nucleoside of the 5’ external region and each nucleoside of the 3’ external region comprises a modified sugar moiety. In certain embodiments, the nucleosides within the 5’ external region comprise the same sugar modification. In certain embodiments, the nucleosides within the 5’ external region comprise two or more different sugar modifications. In certain embodiments, the nucleosides within the 3’ external region comprise the same sugar modification. In certain embodiments, the nucleosides within the 3’ external region comprise two or more different sugar modifications. In certain embodiments, each nucleoside of the 3’ external region and each nucleoside of the 5’ external region comprises a modified sugar moiety. In certain embodiments, the 5’ external region and the 3’ external region of a modified oligonucleotide each independently comprises 1, 2, 3, 4, 5, 6, 7, 8 or 1-8 nucleosides. In certain embodiments, the 5’ external region comprises 1-7 nucleosides. In certain embodiments, the 5’ external region comprises 1-6 nucleosides. In certain embodiments, the 5’ external region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 5’ external region comprises 4, 5, or 6 nucleosides. In certain embodiments, the 3’ external region comprises 1-7 nucleosides. In certain embodiments, the 3’ external region comprises 1-6 nucleosides. In certain embodiments, the 3’ external region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3’ external region comprises 4, 5, or 6 nucleosides. In certain embodiments, each nucleoside within the 5’ external region and each nucleoside within the 3’ external region comprises a 2’-MOE sugar moiety, and each nucleoside within the deoxy region comprises a 2’-β-D- deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a 5’ external region consisting of 5 linked nucleosides, a deoxy region consisting of 10 linked nucleosides, and a 3’ external region consisting of 5 linked nucleosides, wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides comprises a 2’-MOE sugar moiety, and each nucleoside within the gap comprises 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, a modified oligonucleotide has a sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee; wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. 2. Nucleobase Motifs In certain embodiments, modified oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, at least one nucleobase is modified. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, each nucleobase is independently selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and hypoxanthine. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is independently selected from unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is independently selected from unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide. In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’- deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from a 2-thiopyrimidine and a 5-propynepyrimidine. 3. Internucleoside Linkage Motifs In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, at least one internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, at least one internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, at least one internucleoside linking group of a modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, each mesyl phosphoramidate internucleoside linkage is independently selected from a stereorandom mesyl phosphoramidate, (Sp) mesyl phosphoramidate, and (Rp) mesyl phosphoramidate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs. In certain embodiments, the modified oligonucleotide comprises an internucleoside linkage motif (from 5’ to 3’) of soooossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. C. Lengths It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In certain embodiments, modified oligonucleotides comprise 16 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides comprise 17 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides comprise 18 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides comprise 19 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides comprise 20 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides comprise 21 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides comprise 22 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides comprise 23 linked nucleosides having no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, modified oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16-25 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, modified oligonucleotides consist modified oligonucleotides consist of 18-22 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 19-20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 17 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 19 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 20 linked nucleosides. D. Modified Oligomeric Agents Provided oligomeric agents comprise one or more modifications (e.g., a modified sugar moiety, a modified nucleobase, a modified internucleoside linkage, and / or combinations thereof), incorporated into an oligonucleotide. In certain embodiments, a modified oligonucleotide is characterized by modification motif(s) and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having one or more modified sugar moiety and / or sugar motif, independently, is modified or unmodified and may or may not follow the modification pattern of the sugar modifications. For example, internucleoside linkages within regions of an oligonucleotide comprising certain sugar modifications may be the same or different from one another and may be the same or different from the internucleoside linkages of the region of the oligonucleotide comprising different sugar modifications. Likewise, such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications and independent of the internucleoside linkages. Unless specifically indicated, all modifications are independent of nucleobase sequence. E. Populations of Modified Oligonucleotides Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one particular phosphorothioate internucleoside linkage and / or mesyl phosphoramidate internucleoside linkage in a particular stereochemical configuration. F. Nucleobase Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides (or portions thereof) have a nucleobase sequence that is complementary to a second strand of linked nucleosides (e.g., another oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid). In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second strand of linked nucleosides or a region thereof. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second strand of linked nucleosides or region thereof. II. Oligomeric Duplexes Certain embodiments are directed to oligomeric agents comprising an oligomeric duplex. In certain embodiments, an oligomeric agent provided herein comprises a modified oligonucleotide having a targeting region having a nucleobase sequence complementary to a sequence in a TUBB4A target nucleic acid paired with a second oligonucleotide to form an oligomeric duplex. In some embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a TUBB4A target nucleic acid and a second oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, the second oligonucleotide is a modified oligonucleotide. In some embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a TUBB4A target nucleic acid and a second modified oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, the oligomeric duplex is part of an oligomeric agent, wherein the oligomeric agent comprises or consists of: (1) a first modified oligonucleotide, (2) a second oligonucleotide, and (3) optionally a terminal group and / or a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may be linked to a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may comprise a terminal group. Each modified oligonucleotide of an oligomeric duplex may include non-complementary or unpaired overhanging nucleosides. In certain embodiments, the two modified oligonucleotides have at least one mismatch relative to one another. In certain embodiments, an oligomeric duplex comprises: a first modified oligonucleotide containing a targeting region comprising at least 12 oligonucleotide subunits, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of a target region of a TUBB4A nucleic acid; and a second modified oligonucleotide containing a duplexing region comprising at least 12 oligonucleotide subunits, wherein the nucleobase sequence of the duplexing region of the second modified oligonucleotide is at least 80% complementary to the nucleobase sequence of a duplexing region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the targeting region of the first modified oligonucleotide comprises the same number of subunits as the target region of the TUBB4A nucleic acid; that is, there are no gaps or bulges. In certain embodiments, the duplexing region of the second modified oligonucleotide comprises the same number of subunits as the duplexing region of the first modified oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the nucleobase sequence of the duplexing region of the second modified oligonucleotide is at least 90%, at least 95%, at least 98% or 100% complementary to the nucleobase sequence of an equal length region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, modified furanosyl sugar moieties such as, for example, a non-bicyclic modified sugar moiety, such as a 2′-MOE sugar moiety, a 2′-F sugar moiety, a 2′-OMe sugar moiety, or a 2′-NMA sugar moiety; or a bicyclic sugar moiety, such as a furanosyl sugar moiety comprising a 4′-2′ bridge selected from -CH2-O- and -CH(CH3)- O-. In certain embodiments, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide comprises an unmodified DNA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2’-F sugar moiety, a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, and a 2’-NMA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′- NMA sugar moiety, and an unmodified DNA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′-NMA sugar moiety, and an unmodified DNA sugar moiety. In certain embodiments, in an oligomeric duplex provided herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, cyclic sugar surrogates, e.g., morpholino, hexitol nucleic acid (HNA), fluoro-hexitol nucleic acid (FHNA), and acyclic sugar surrogates, e.g., glycol nucleic acid (GNA) and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a cyclic sugar surrogate, which is FHNA. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′-NMA sugar moiety, an unmodified DNA sugar moiety, and FHNA. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, a 2′-NMA sugar moiety, an unmodified DNA sugar moiety, and FHNA. III. Oligomeric Agents In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotides, and optionally, one or more conjugate groups and / or terminal groups. In certain embodiments, an oligomeric agent comprises one or more modified oligonucleotides and one or more conjugate groups. In certain embodiments, an oligomeric agent comprises one or more modified oligonucleotides and one or more terminal groups. Conjugate groups comprise or consist of a conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. A conjugate group or a terminal group may be attached to the 3’ end of an oligonucleotide and / or the 5’ end of an oligonucleotide and / or at any internal position of an oligonucleotide. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups are attached through a modified sugar moiety or a modified internucleoside linkage. In certain embodiments, oligomeric agents comprise a modified oligonucleotide, a cell-targeting moiety, and a conjugate linker. A. Conjugate Groups A conjugate group comprises a conjugate moiety and a conjugate linker. In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, a conjugate moiety modified one or more properties of the attached oligonucleotide compared to the same oligonucleotide lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, a conjugate moiety imparts a new property on the attached oligonucleotide. In some embodiments, the conjugate group comprises a small molecue drug substance (e.g., an active pharmaceutical ingredient), an aliphatic chain, a lipid, a peptide, a protein, a hydrocarbon, a polyamine, a polyamide, a polyether, a thioether, an aptamer, an antibody, an antibody fragment, a VHH camelid antibody fragment, a VNAR shark antibody fragment, a vitamin, a fatty acid, a carbohydrate, an intercalator, a reporter molecule, or an alkyl moiety, e.g., a C22 alkyl, C20 alkyl, C17 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain optionally has one or more unsaturated bonds. In some embodiments, the conjugate group comprises a 6-palmitamidohexyl moiety or a 2-(hydroxymethyl)-6-palmitamidohexyl moiety. In certain embodiments, the conjugate group comprises a cell- targeting moiety.   In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620). In certain embodiments, a conjugate group is a lipid having the following structure: . described herein. For example, in one non- monomethoxytrityl (MMT)-protected 5′ or (3′)-amino-modified oligonucleotide intermediates are generated using the phosphoramidate monomer coupling method and detritylated as described in U.S. Patent No.10,450,342. The 5′ (or 3′) MMT-protected amino group may be linked to the oligonucleotide through a linker group such as an alkyl phosphate group, and the MMT group may be removed from the oligonucleotide via solution-phase detritylation conducted at certain temperatures and pH. In certain embodiments, the detritylated oligonucleotide is then reacted with a conjugate group (e.g., a GalNAc3) to generate a conjugated oligonucleotide. 1. Conjugate Moieties Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes. In certain embodiments, a conjugate moiety comprises a small molecule drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. In certain embodiments, conjugate moieties are selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate moieties are selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds. 2. Conjugate Linkers In certain embodiments, an oligomeric agent comprises an oligonucleotide (modified or unmodified) and a conjugate group, wherein the conjugate group comprises or consists of a conjugate moiety and a conjugate linker. Conjugate moieties are attached to the oligonucleotide through the conjugate linker. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, a conjugate linker comprises pyrrolidine. In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker- nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N- isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds. Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside. In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric agents comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric agent has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group. In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine. 3. Cell-Targeting Moieties In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate moiety comprises or consists of a cell-targeting moiety. In certain embodiments, a cell-targeting moiety is capable of interacting with a cell surface receptor on a cell. In certain embodiments, a cell-targeting moiety is capable of interacting with a cell surface moiety on a cell. In certain embodiments, a cell-targeting moiety is capable of binding a cell surface receptor on a cell. In certain embodiments, a cell-targeting moiety is capable of binding a cell surface moiety on a cell. In certain embodiments, an oligomeric agent comprising a cell-targeting moiety is capable of being internalized by the cell when the cell-targeting moiety interacts with and / or binds a cell surface receptor and / or cell surface moiety. In certain embodiments, a cell surface receptor is not expressed ubiquitously (e.g., the cell surface receptor is undetectable in at least one tissue of a human subject), and a cell-targeting moiety selectively delivers an oligomeric agent, a modified oligonucleotide, or an oligomeric duplex to a tissue of interest or a cell of interest. By way of non-limiting example, the tissue of interest may be brain tissue. By way of non-limiting example, the cell of interest may be any one or more of neurons and oligodendrocytes. In certain embodiments, the cell-targeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011 / 131693, WO 2014 / 064257. In certain embodiments, a cell-targeting moiety has an affinity for the type 1 transferrin receptor (TfR1) (also referred to herein as TfR1 and CD71). In certain embodiments, a cell-targeting moiety comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the cell-targeting moiety comprises a protein or peptide capable of binding TfR1. In certain embodiments, the cell-targeting moiety comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art including but not limited to those described in WO 1991 / 004753; WO 2013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 2016 / 179257; WO 2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO 2020 / 132584; WO 2020 / 028864; US 7,208,174; US 9,034,329; and US 10,550,188. In certain embodiments, a fragment of an anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv. In certain embodiments, the conjugate group comprises a non-antibody protein or peptide capable of binding TfR1. In certain embodiments, the protein or peptide capable of binding TfR1 can be any known in the art including but not limited to those described in WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; WO 2022 / 026555; WO 2023 / 027125; WO 2023 / 022234; and US 10,138,483. In certain embodiments, the peptide is a cyclic peptide, as described in WO 2021 / 167107. In certain embodiments, the peptide is a bicyclic peptide known as a ‘bicycle ligand’ selected from those described in WO 2022 / 101633 and WO 2023 / 056388, each of which is incorporated by reference herein. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 can be any known in the art including but not limited to those described in WO 2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198. B. Certain Terminal Groups In certain embodiments, an oligomeric agent comprises one or more modified oligonucleotides and one or more terminal groups. Examples of a terminal group include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a stabilized phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified, wherein one or more groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’-end of the oligonucleotide and / or at the 5’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 5’- end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’-end of the oligonucleotide and one or more terminal groups is attached at the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’-end of the oligonucleotide and / or at the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’-end of the oligonucleotide and a terminal group is attached at the 5’-end of the oligonucleotide. In certain such embodiments, the oligomeric agent comprises a modified oligonucleotide linked to a terminal group comprising a stabilized 5’-phosphate. In certain embodiments, in an oligomeric duplex provided herein, a terminal group comprising a stabilized phosphate moiety is attached at the 5′-end of the modified oligonucleotide. The stabilized phosphate moiety results in stabilization of a 5′-phosphate moiety of the 5′-terminal nucleoside of the modified oligonucleotide, relative to the stability of an unmodified 5′-phosphate of a nucleoside under biologic conditions. The stabilized phosphate group results in stabilization of a 5’-phosphate moiety of the 5’-terminal nucleoside of an oligonucleotide, relative to the stability of an unmodified 5’-phosphate of an unmodified nucleoside under biologic conditions. Such stabilization of a 5’-phosphate group includes but is not limited to resistance to removal by phosphatases. In certain embodiments, the stabilized phosphate group comprises is a cyclopropyl phosphonate or an (E)-vinyl phosphonate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates, 5’-methylphosphonate, and 5’ cyclopropyl phosphonate. IV. Antisense Activity In certain embodiments, oligomeric agents comprise an antisense oligonucleotide that is capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric agents are antisense agents. In certain embodiments, antisense oligonucleotides selectively affect one or more target nucleic acid. Such antisense oligonucleotides comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity. In certain embodiments, hybridization of an antisense agent to a target nucleic acid results in recruitment of a protein, e.g., RNase H or Argonaute, that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated. In certain antisense activities, an antisense oligonucleotide is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense oligonucleotides result in cleavage of the target nucleic acid by Argonaute. Antisense oligonucleotides that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA). In certain embodiments, RNAi agents are capable of RISC-mediated modulation of a target nucleic acid in a cell. In certain embodiments, antisense oligonucleotides are deemed to have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by at least 50% in the standard in vitro cell assay. In certain embodiments, such compounds RNAi agents reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. As used herein, “standard in vitro assay” means the in vitro assays described in Examples 2 and 3 and reasonable variations thereof. In certain embodiments, RNAi agents selectively affect one or more target nucleic acid. Such RNAi agents comprise a modified oligonucleotide having a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity. In certain embodiments, an RNAi agent comprsies a modifeid oligonucleotide that does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in alteration of translation of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or a subject. IV. Certain Target Nucleic Acids In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to the nucleobase sequence of an equal length target region of a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is a non- coding RNA. In certain embodiments, the target non-coding RNA is selected from a long non-coding RNA, a short non- coding RNA, an intronic RNA molecule. A. Complementarity / Mismatches to the Target Nucleic Acid and Duplex Complementarity In certain embodiments, modified oligonucleotides are complementary to the nucleobase sequence of a target region of a target nucleic acid over the entire length of the modified oligonucleotide. In certain embodiments, modified oligonucleotides are at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to a target region of the target nucleic acid. In certain embodiments, modified oligonucleotides are at least 80% complementary to a target region of the target nucleic acid over the entire length of the modified oligonucleotide and comprise a region that is 100% or fully complementary to a target region of the target nucleic acid. In certain embodiments, the targeting region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length. It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst.93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more mismatched nucleobases relative to the target region of the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, modified oligonucleotides are at least 80% complementary to the target region of the target nucleic acid over the entire length of the modified oligonucleotide and comprise no more than one to three mismatches with target nucleic acid. In certain embodiments, modified oligonucleotides comprise a targeting region that is at least 80% complementary to a target region of the target nucleic acid over the entire length of the targeting region, and the targeting region comprises no more than one to three mismatches with the target region. In certain embodiments, a mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3’-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3’-end of the wing region. B. TUBB4A In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to an equal length target region of a target nucleic acid, wherein the target nucleic acid is TUBB4A. In certain embodiments, TUBB4A nucleic acid has the sequence set forth SEQ ID NO: 1 (the cDNA of Ensembl transcript IF ENSG00000104833.12, Ensembl release 109 – Feb 2023). In certain embodiments, contacting a cell with an oligomeric agent comprising a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of SEQ ID NO: 1 reduces the amount of TUBB4A RNA, and in certain embodiments reduces the amount of TUBB4A protein. In certain embodiments, the oligomeric agent consists of the modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide and one or more terminal group(s). In certain embodiments, the oligomeric agent consists of a modified oligonucleotide, a conjugate group, and one or more terminal group(s). In certain embodiments, the modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and a conjugate group. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and one or more terminal group(s). In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide, a conjugate group, and one or more terminal group(s). In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of a TUBB4A nucleic acid. In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of a TUBB4A nucleic acid, and a sense oligonucleotide comprising a duplexing region that is complementary to the antisense oligonucleotide, or a region thereof. In certain embodiments, modified oligonucleotides described herein are complementary to a target region of a TUBB4A nucleic acid over the entire length of the modified oligonucleotide. In certain embodiments, modified oligonucleotides are at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to an equal length portion of the TUBB4A nucleic acid. In certain embodiments, modified oligonucleotides are at least 80% complementary to a target region of the TUBB4A nucleic acid over the entire length of the modified oligonucleotide and comprise a targeting region that is 100% or fully complementary to the target region of the TUBB4A nucleic acid. In certain embodiments, a targeting region of a modified oligonucleotide is from 6 to 20, 10 to 18, 14 to 18, 16 to 20, or 18 to 20 nucleobases in length. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases. In certain embodiments, the targeting region constitutes at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleosides subunits of the modified oligonucleotide. In certain embodiments, the targeting region constitutes all of the nucleosides subunits of the modified oligonucleotide. In certain embodiments, the targeting region of the modified oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to a target region of the TUBB4A nucleic acid. In certain embodiments, the targeting region of the modified oligonucleotide is 100% complementary to a target region of the TUBB4A nucleic acid.    In certain embodiments, the target nucleic acid is an endogenous TUBB4A RNA molecule. In certain embodiments, the TUBB4A nucleic acid encodes TUBB4A protein. In certain embodiments, the TUBB4A nucleic acid is a precursor to a nucleic acid that encodes TUBB4A protein. In certain such embodiments, the TUBB4A nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic, and untranslated regions. In certain embodiments, the TUBB4A RN is a mature mRNA. In certain embodiments, the TUBB4A nucleic acid is a pre-mRNA. In certain embodiments, contacting a cell with an oligomeric agent described herein complementary to SEQ ID NO: 1 reduces the amount of TUBB4A RNA in the cell. In certain embodiments, contacting a cell with an oligomeric agent described herein complementary to SEQ ID NO: 1 reduces the amount of TUBB4A protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, contacting a cell in a subject with an oligomeric agent described herein complementary to SEQ ID NO: 1 ameliorates one or more symptoms of a neurodegenerative disease or disorder associated with TUBB4A. In certain embodiments, the neurodegenerative disease or disorder associated with TUBB4A is TUBB4A-related leukodystrophy. In certain embodiments, the symptom is any of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. In certain embodiments, an oligomeric agent described herein complementary to SEQ ID NO: 1 is capable of reducing the detectable amount of TUBB4A RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard cell assay. In certain embodiments, an oligomeric agent described herein complementary to SEQ ID NO: 1 is capable of reducing the detectable amount of TUBB4A protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound described herein complementary to SEQ ID NO: 1, is capable of reducing the detectable amount of TUBB4A RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound described herein complementary to SEQ ID NO: 1, is capable of reducing the detectable amount of TUBB4A protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. C. Certain Target Nucleic Acids in Certain Tissues In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of a TUBB4A nucleic acid, wherein the TUBB4A nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments the pharmacologically relevant cell is an TUBB4A-expressing cell. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include the putamen, the white matter, the cerebellum, brainstem, spinal cord, cortex, and the basal ganglia. Such cells include neurons and oligodendrocytes. V. Certain Methods and Uses Certain embodiments provided herein relate to methods of reducing or inhibiting TUBB4A expression or activity, which can be useful for treating, preventing, or ameliorating a disease or disorder associated with overexpression of TUBB4A in a subject, by administration of an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which comprise a modified oligonucleotide having a nucleobase sequence complementary to a TUBB4A nucleic acid. In certain embodiments, the disease or disorder is a neurodegenerative disease or disorder associated with TUBB4A. In certain embodiments, the disease or disorder is associated TUBB4A. In certain embodiments, the disease or disorder associated with TUBB4A is a TUBB4A-related leukodystrophy or Dystonia Type 4 (DYT4). In certain embodiments, the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A- leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). In certain embodiments, a method comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region having a nucleobase sequence a complementary to an equal-length target region of a TUBB4A nucleic acid. In certain embodiments, the subject has or is at risk for developing a neurodegenerative disease or disorder associated with TUBB4A. In certain embodiments, the subject has or is at risk for developing a TUBB4A-related leukodystrophy or DYT4. In certain embodiments, a method of treating a neurodegenerative disease or disorder associated with TUBB4A comprises administering to a subject a therapeutically effective amount of an oligomeric agent comprising a modified oligonucleotide comprising a targeting region having a nucleobase sequence a complementary to an equal-length target region of a TUBB4A nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk for developing a neurodegenerative disease or disorder associated with TUBB4A. In certain embodiments, the disease or disorder is associated with an elevated level of TUBB4A in the subject. In certain embodiments, the subject has or is at risk for developing a TUBB4A-related leukodystrophy or DYT4A. In certain embodiments, the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). In certain embodiments, at least one symptom of the neurodegenerative disease or disorder associated with TUBB4A is ameliorated. Exemplary symptoms include, but are not limited to, include hypomyelination, demyelination, dysphonia, dystonia, gait ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. In certain embodiments, a method of reducing expression of TUBB4A nucleic acid, for example RNA, or reducing the expression of TUBB4A protein in a cell comprises administering to the subject an oligomeric agent comprising a modified oligonucleotide comprising a targeting region having a nucleobase sequence a complementary to an equal-length target region of a TUBB4A nucleic acid. In certain embodiments, administering the oligomeric agent inhibits expression of TUBB4A in the brain or the spinal cord of the subject. In certain embodiments, the subject has a neurological disease or disorder associated with TUBB4A. In certain embodiments, the subject has or is at risk for TUBB4A-related leukodystrophy or DYT4. In certain embodiments, a method of inhibiting expression of TUBB4A nucleic acid in a cell comprises contacting the cell with an oligomeric agent comprising a modified oligonucleotide comprising a targeting region having a nucleobase sequence a complementary to an equal-length target region of a TUBB4A nucleic acid, thereby inhibiting expression of TUBB4A nucleic acid in the cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron or oligodendrocyte. In certain embodiments, the cell is obtained from a subject, e.g., a subject that has or is at risk for developing a disease or disorder associated with TUBB4A. In certain embodiments, the cell is in a subject having a disease or disorder associated with TUBB4A. In certain embodiments, the cell is in a subject having or at risk for a TUBB4A-related leukodystrophy or DYT4. Certain embodiments are drawn to an oligomeric agent comprising a modified oligonucleotide comprising a targeting region having a nucleobase sequence a complementary to an equal-length target region of a TUBB4A nucleic acid, for use in treating a disease or disorder associated with elevated TUBB4A signaling, or with over-expression of TUBB4A. In certain embodiments, the disease or disorder is TUBB4A-related leukodystrophy or DYT4. In certain embodiments, an oligomeric agent is for use in improving a symptom of a disease or disorder associated with TUBB4A- related leukodystrophy or DYT4. In certain embodiments, the symptom is selected from hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. In certain embodiments, an oligomeric agent is for use in reducing TUBB4A expression in a subject. Certain embodiments are drawn to an oligomeric agent comprising a modified oligonucleotide comprising a targeting region having a nucleobase sequence a complementary to an equal-length target region of a TUBB4A nucleic acid, for the manufacture or preparation of a medicament for treating a disease or disorder associated with TUBB4A. In certain embodiments, the disease or disorder is TUBB4A-related leukodystrophy or DYT4. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving symptoms or hallmarks associated with TUBB4A. In certain embodiments, the symptom or hallmark is selected from hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for use in reducing TUBB4A expression in a subject. In any of the methods or uses described herein, the oligomeric agent can (e.g., an oligomeric agent comprising a modified oligonucleotide, antisense oligonucleotide, or oligomeric duplex) be any described herein. VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric agents. In certain embodiments, the one or more oligomeric agents comprises or consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric compounds, oligomeric duplexes, or antisense agents each consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric agent comprises or consists of consists of or comprises an antisense oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and an oligomeric agent. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agents and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agents and phosphate- buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of an oligomeric agent and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and water. In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and water. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and water. In certain embodiments, the water is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and water. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and water. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and water. In certain embodiments, the water is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and PBS. In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and PBS. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and PBS. In certain embodiments, the PBS is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and PBS. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and aCSF. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and aCSF. In certain embodiments, the aCSF is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and aCSF. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and aCSF. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and aCSF. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agents and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In certain embodiments, oligomeric agents may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent encompass any pharmaceutically acceptable salts of the oligomeric agent, esters of the oligomeric agent, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric agents, upon administration to an subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric agents, prodrugs thereof, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body. In certain embodiments, oligomeric agents are lyophilized and isolated as sodium salts. In certain embodiments, the sodium salt of an oligomeric agent is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises saline, water, PBS, or aCSF. In certain embodiments, the sodium salt of an oligomeric compound, oligomeric duplex, or antisense agent is mixed with PBS. In certain embodiments, the sodium salt of an oligomeric agent is mixed with aCSF. In certain embodiments, the sodium salt of the oligomeric agent is a sodium salt of a modified oligonucleotide. Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric agent, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue. In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used. In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents disclosed herein to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody. In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose. In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation. In certain instances, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, oligomeric agents provided herein are in aqueous solution with sodium. In certain embodiments, oligomeric agents are in aqueous solution with potassium. In certain embodiments, oligomeric agents are in PBS. In certain embodiments, oligomeric agents are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve a desired pH. Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of an oligomeric agent in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where an oligomeric agent is in solution comprising sodium (e.g., saline), the oligomeric agent may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the sodium ions are not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of a number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1653044. When an oligomeric agent comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric agent. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose. In certain embodiments, where an oligomeric agent is in a solution, such as aCSF, comprising sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or fully de- protonated and in association with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of the dose. In certain embodiments, when an oligomeric agent comprises a conjugate group, the mass of the conjugate group may be included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose. Nonlimiting disclosure and incorporation by reference Each of the literature and patent publications listed herein is incorporated by reference in its entirety. While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety. The sequence listing accompanying this filing identifies each nucleic acid sequence as either “RNA” or “DNA” as required; however, one of skill in the art will readily appreciate that designation of “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (5-methyl uracil)) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified sugar moieties having 2’-substituent(s) that are neither OH nor H. One of skill in the art will readily appreciate that labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds. Herein, the description of compounds as having “the nucleobase sequence of” a SEQ ID NO. describes only the nucleobase sequence. Accordingly, absent additional description, such description of compounds by reference to a nucleobase sequence of a SEQ ID NO. does not limit sugar or internucleoside linkage modifications or presence or absence of additional substituents such as a conjugate group. Further, absent additional description, the nucleobases of a compound “having the nucleobase sequence of” a SEQ ID NO. include such compounds having modified forms of the identified nucleobases as described herein. Herein, the description of compounds by chemical notation (subscripts and / or superscripts to indicate chemical modifications) without reference to a specific Compound No. include only each noted modification, but may include additional substituents, such as a conjugate group, unless otherwise indicated. For example, the chemical notation of “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesylphosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound may include additional substituents, such as a conjugate group. Herein, where a specific compound (e.g., with reference to a Compound No.) is described (as in the examples) by chemical notation, each nucleobase, sugar, and internucleoside linkage of such specific compound is modified only as indicated. Accordingly, in the context of a description of a specific compound having a particular Compound No., “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesylphosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound does not include additional substituents. Herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within a nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or may be indicated in text accompanying a sequence (e.g., in separate text that appears within or above or below a table of compounds). Where a specific compound is described herein by way of a drawn chemical structure, each nucleobase, sugar, and internucleoside linkage of such a specific compound includes only the modifications indicated in the drawn chemical structure. One of skill will appreciate, however, that drawn compounds may exist in equilibrium between tautomeric forms and / or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to capture all such forms of such compounds. While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description. The compounds described herein include variations in which one or more atoms are replaced with a non- radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to:2H or3H in place of1H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O, and33S,34S,35S, or36S in place of32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging. EXAMPLES The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high- affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated. Example 1: Design of a modified oligonucleotide complementary to human TUBB4A RNA A modified oligonucleotide complementary to a human TUBB4A RNA was designed and synthesized. The modified oligonucleotide in the table below is a 5-10-5 MOE gapmer with a mixed PS / PO internucleoside linkage motif. The modified oligonucleotide in the table below is 20 linked nucleosides in length, wherein the sugar motif for the modified oligonucleotide is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein “e” represents a ribo 2’-MOE sugar moiety, and “d” represents a 2’-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soooossssssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage, and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5- methylcytosine. “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (ENSEMBL ID ENSG00000104833.12, Ensembl release 109 – Feb 2023). Table 1 5-10-5 MOE gapmer with a mixed PS / PO internucleoside linkage motif complementary to human TUBB4A RNA SEQ ID SEQ ID Compound SEQ ID NO: 1 NO: 1 Sequence (5' to 3') Example 2: Eff single dose Modified oligonucleotides complementary to human TUBB4A nucleic acid were tested for their single dose effects on TUBB4A RNA in vitro. SH-SY5Y cells seeded at 10,000 cells / well and differentiated for ten days in 10 µM retinoic acid, were treated with modified oligonucleotide at 15 µM (15,000 nM) by free uptake for 4 days. Total RNA was isolated from the cells and TUBB4A RNA levels were measured by quantitative real-time RTPCR. TUBB4A RNA levels were measured by human primer-probe set RTS54615 (forward sequence CCTTCGGTCAGATCTTTCGG, designated herein as SEQ ID NO: 2; reverse sequence CCTCCTTCCGGACTACGTC, designated herein as SEQ ID NO: 3; probe sequence TGTAGTGCCCCTTTGCCCAGTT, designated herein as SEQ ID NO: 4). TUBB4A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of TUBB4A RNA is presented in the table below as percent TUBB4A RNA relative to the amount of TUBB4A RNA in untreated control cells (% UTC) Table 2 Reduction of TUBB4A RNA by a 5-10-5 MOE gapmer with mixed PS / PO internucleoside linkages at a concentration of 15,000 nM in differentiated SH-SY5Y cells ) Example 3: Dose-dependent inhibition of human TUBB4A by a modified oligonucleotide in vitro, multiple doses The modified oligonucleotide selected from the example above was tested at various doses in differentiated SH-SY5Y cells. SH-SY5Y cells seeded at 10,000 cells / well and differentiated for ten days in 10 µM retinoic acid, were treated with modified oligonucleotide at concentrations indicated in the table below by free uptake for 4 days. Total RNA was isolated from the cells and TUBB4A RNA levels were measured by quantitative real-time RTPCR. Human TUBB4A primer-probe set RTS54615 (described herein above) was used to measure RNA levels. TUBB4A RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of TUBB4A RNA is presented in the table below as percent TUBB4A RNA relative to the amount of TUBB4A RNA in untreated control cells (% UTC). The half maximal inhibitory concentration (IC50) of the modified oligonucleotide is also presented in the table below. Table 3 Dose-dependent reduction of human TUBB4A RNA in differentiated SH-SY5Y cells by a modified oligonucleotide TUBB4A RNA (% UTC) Compound No. IC50 (µM) 240 nM 1200 nM 6000 nM 30000 nM Example 4: Activity of modified oligonucleotides targeting TUBB4A in transgenic mice, 2-week Modified oligonucleotides described above were tested in TUBB4A transgenic mice (Taconic Biosciences) for their effects on TUBB4A mRNA. The TUBB4A transgenic mice used in this study were engineered to bear a constitutive humanization of the Tubb4a gene via CRISPR / Cas9 mediated gene editing. The strategy was based on Ensembl transcript ENSMUST00000071135.6 (mouse) and GENBANK transcript NM_006087.4 (human). Exon 1 contains the translation initiation codon. Mouse genomic sequence from exon 1 to 4 including the 5’ and 3’ untranslated regions (UTR) was replaced with the human counterpart. The D249N mutation was introduced into exon human exon 4. TUBB4A transgenic mice were divided into groups of 4. Each mouse received a single ICV bolus of 700 µg of modified oligonucleotide. A group of 4 mice received PBS as a negative control. Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RTPCR analysis of TUBB4A RNA using human primer probe set RTS54614 (forward sequence CAGTGCGGCAACCAGAT, designated herein as SEQ ID NO: 7 ; reverse sequence CACGTTGATCCTCTCCAGTT, designated herein as SEQ ID NO: 8; probe sequence TGCCATGTTCGTCACTGATAACCTCC, designated herein as SEQ ID NO: 9) and human primer probe set RTS54615 (described herein above). TUBB4A RNA is presented as the percent of TUBB4 RNA relative to the amount of TUBB4A RNA in PBS treated animals (%control), normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 10; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 11; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 12). Table 4 Reduction of TUBB4A mRNA in transgenic mice treated with 700 µg of modified oligonucleotide TUBB4 RNA (%control) 5 Example 5: Effect of modified oligonucleotides targeting TUBB4A in transgenic mice, 2-week Modified oligonucleotides described above were tested in the TUBB4A transgenic mice described herein above for their effects on TUBB4A mRNA. TUBB4A transgenic mice were divided into groups of 3-4. Each mouse received a single ICV bolus of modified oligonucleotide at various doses indicated in the table below. A group of 3 mice received PBS as a negative control. Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RTPCR analysis of TUBB4A RNA using human primer probe set RTS54614 (described herein above) and human primer probe set RTS54615 (described herein above). TUBB4A RNA is presented as the percent of TUBB4A RNA relative to the amount of TUBB4A RNA in PBS treated animals (%control), normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (described herein above). The half maximal effective dose (ED50) of each modified oligonucleotide was calculated using GraphPad Prism 10 software (GraphPad Software, San Diego, CA). Table 5 Dose-dependent effect of modified oligonucleotides on the level of TUBB4A mRNA μg)

Claims

CLAIMS:

1. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide comprises a targeting region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an equal length target region of a TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

2. The oligomeric agent of claim 1, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO:

1.

3. The oligomeric agent of claim 1 or claim 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 3051-3070 of SEQ ID NO:

1.

4. The oligomeric agent of any one of claims 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of the TUBB4A nucleic acid.

5. An oligomeric agent comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 5, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

6. The oligomeric agent of claim 5, wherein the modified oligonucleotide consists of 16 to 25 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:

5.

7. The oligomeric agent of claim 5 or claim 6, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:

5.

8. The oligomeric agent of any one of claims 5-7, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO:

5.

9. The oligomeric agent of any one of claims 5-8, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a TUBB4A nucleic acid, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO:

1.

10. The oligomeric agent of any one of claims 5-9, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

11. The oligomeric agent of any one of claims 5-10, wherein the modified oligonucleotide consists of 20 linked nucleosides.

12. The oligomeric agent of any one of claims 5-11, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

13. The oligomeric agent of claim 12, wherein the at least one modified nucleoside comprises a modified sugar moiety.

14. The oligomeric agent of claim 13, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

15. The oligomeric agent of claim 13 or claim 14, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH2- and -O-CH(CH3)-.

16. The oligomeric agent of claim 13, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

17. The oligomeric agent of claim 16, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, or a β-D-deoxyxylosyl sugar moiety.

18. The oligomeric agent of claim 16 or claim 17, wherein the non-bicyclic modified sugar moiety is a 2’- MOE sugar moiety.

19. The oligomeric agent of any one of claims 5-18, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

20. The oligomeric agent of claim 19, wherein at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

21. The oligomeric agent of any one of claims 5-20, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.

22. The oligomeric agent of any one of claims 5-21, wherein the modified oligonucleotide comprises an internucleoside linkage motif (5’ to 3’) of soooossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

23. The oligomeric agent of any one of claims 5-22, wherein the modified oligonucleotide comprises at least one modified nucleobase.

24. The oligomeric agent of claim 23, wherein the modified nucleobase is 5-methylcytosine.

25. The oligomeric agent of claim 24, wherein each cytosine is a 5-methylcytosine.

26. The oligomeric agent of any one of claims 5-25, wherein one or more nucleosides of the modified oligonucleotide comprises an unmodified nucleobase.

27. The oligomeric agent of any one of claims 5-26, wherein the modified oligonucleotide comprises a deoxy region.

28. The oligomeric agent of claim 27, wherein each nucleoside of the deoxy region is a 2’-β-D- deoxynucleoside.

29. The oligomeric agent of claim 27 or claim 28, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6- 10 linked nucleosides.

30. The oligomeric agent of any one of claims 27-29, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.

31. The oligomeric agent of any one of claims 27-30, wherein the deoxy region is flanked on the 5’-side by a 5’ external region consisting of 1-6 linked 5’ external region nucleosides and on the 3’-side by a 3’ external region consisting of 1-6 linked 3’ external region nucleosides;wherein the 3’-most nucleoside of the 5’ external region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’ external region comprises a modified sugar moiety.

32. The oligomeric agent of claim 31, wherein each nucleoside of the 3’ external region comprises a modified sugar moiety.

33. The oligomeric agent of claim 31 or claim 32, wherein each nucleoside of the 5’ external region comprises a modified sugar moiety.

34. The oligomeric agent of claim 33, wherein the modified oligonucleotide has: a 5’ external region consisting of 5 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3’ external region consisting of 5 linked nucleosides; wherein each of the 5’ external region nucleosides and each of the 3’ external region nucleosides is a 2’-MOE nucleoside.

35. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation:mCesAeoTeoGeoAeomCdsTdsTdsTdsAdsAdsGdsmCdsTdsTdsmCeoAeomCesAesAe(SEQ ID NO: 6), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase; G = a guanine nucleobase; T = a thymine nucleobase; e = a 2’-MOE sugar moiety; d = a 2’-β-D-deoxyribosyl sugar moiety; s = a phosphorothioate internucleoside linkage; and o = a phosphodiester internucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

36. The oligomeric agent of any one of claims 1-35, consisting of the modified oligonucleotide.

37. The oligomeric agent of any one of claims 1-36, wherein the oligomeric compound comprises a conjugate group.

38. The oligomeric agent of claim 37, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

39. The oligomeric agent of claim 38, wherein the conjugate linker consists of a single bond.

40. The oligomeric agent of any one of claims 38-39, wherein the conjugate linker is cleavable.

41. The oligomeric agent of any one of claims 38-40, wherein the conjugate linker comprises 1-3 linker- nucleosides.

42. The oligomeric agent of any one of claims 38-40, wherein the conjugate linker does not comprise any linker nucleosides.

43. The oligomeric agent of any one of claims 38-42, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide.

44. The oligomeric agent one of any one of claims 38-42, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide.

45. The oligomeric agent one of any one of claims 1 to 44, wherein the oligomeric compound comprises a terminal group.

46. The oligomeric agent of claim 45, wherein the terminal group is an abasic sugar moiety.

47. The oligomeric agent of any one of claims 1-46, wherein the oligomeric compound is a singled- stranded oligomeric compound.or51. A modified oligonucleotide according to the following chemical structure:oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

53. The chirally enriched population of claim 52, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration.

54. The chirally enriched population of claim 52, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

55. The chirally enriched population of claim 52, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

56. The chirally enriched population of claim 52, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.

57. A population of oligomeric agents of any one of claims 1-47 or a population of modified oligonucleotides of any one of claims 48-51, wherein each of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

58. A pharmaceutical composition comprising an oligomeric agent of any one of claims 1-47, a modified oligonucleotide of any one of claims 48-51, or a population of any one of claims 52-57, and a pharmaceutically acceptable diluent.

59. The pharmaceutical composition of claim 58, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, water, or phosphate-buffered saline.

60. The pharmaceutical composition of claim 58 or claim 59, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid.

61. The pharmaceutical composition of any one of claims 58-60, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and phosphate-buffered saline.

62. A method comprising administering to a subject an oligomeric agent of any one of claims 1-47, a modified oligonucleotide of any one of claims 48-51, a population of any one of claims 52-57, or a pharmaceutical composition of any one of claims 58-61.

63. The method of claim 62, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of a disease or disorder associated with TUBB4A.

64. The method of claim 62 or claim 63, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition reduces or slows progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

65. The method of any one of claims 62-64, wherein TUBB4A protein levels in the subject are reduced.

66. The method of any one of claims 63-65, wherein the disease or disorder associated with TUBB4A is a neurodegenerative disease or disorder.

67. The method of any one of claims 63-65, wherein the disease or disorder associated with TUBB4A is a TUBB4A-related leukodystrophy or Dystonia Type 4 (DYT4).

68. The method of claim 67, wherein the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC).

69. A method of treating a disease or disorder associated with TUBB4A comprising administering to a subject having or at risk for developing a disease or disorder associated with TUBB4A a therapeutically effective amount of an oligomeric agent of any one of claims 1-47, a modified oligonucleotide of any one of claims 48-51, apopulation of any one of claims 52-57, or a pharmaceutical composition of any one of claims 58-61, thereby treating the disease or disorder associated with TUBB4A.

70. The method of any one of claims 62-69, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of the disease or disorder associated with TUBB4A.

71. The method of claim any one of claims 69-70, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces or slows progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, atrophy of cerebellar and / or basal ganglia, poor vision, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

72. The method of any one of claims 69-71, wherein TUBB4A protein levels in the subject are reduced.

73. The method of any one of claims 69-72, wherein the disease or disorder associated with TUBB4A is a TUBB4A-related leukodystrophy.

74. The method of claim 73, wherein the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, Dystonia Type 4 (DYT4), and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC).

75. The method of any one of claims 69-74, wherein the subject is human.

76. A method of reducing expression of TUBB4A in a cell comprising contacting the cell with an oligomeric agent of any one of claims 1-47, a modified oligonucleotide of any one of claims 48-51, a population of any one of claims 52-57, or a pharmaceutical composition of any one of claims 58-61.

77. The method of claim 76, wherein the cell is a neuron or an oligodendrocyte.

78. The method of claim 76 or claim 77, wherein the cell is a human cell.

79. Use of an oligomeric agent of any one of claims 1-47, a modified oligonucleotide of any one of claims 48-51, a population of any one of claims 52-57, or a pharmaceutical composition of any one of claims 58-61 for treating a disease or disorder associated with TUBB4A.

80. Use of an oligomeric compound of any one of claims 1-47, a modified oligonucleotide of any one of claims 48-51, a population of any one of claims 52-57, or a pharmaceutical composition of any one of claims 58-61 in the manufacture of a medicament for treating a disease or disorder associated with TUBB4A.

81. The use of any one of claims 79-80, wherein the disease or disorder associated with TUBB4A is associated with an elevated level of TUBB4A.

82. The use of any one of claims 79-81, wherein the disease or disorder associated with TUBB4A is a TUBB4A-related leukodystrophy or Dystonia Type 4 (DYT4).

83. The use of claim 82, wherein the TUBB4A-related leukodystrophy is selected from infantile onset TUBB4A-leukodystrophy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC).

Images