Novel cell-free mirna biomarkers in maternal blood for detection of single ventricle defects in fetal hearts

Abstract

Provided are noninvasive methods for detecting a single ventricle heart defect (SVHD) in an unborn fetus. Also provided are methods of diagnosing the risk of SVHD in a fetus, and methods for treating SVHD. Finally, kits and systems for detecting SVHD are disclosed as well.

Description

NOVEL CELL-FREE MIRNA BIOMARKERS IN MATERNAL BLOODFOR DETECTION OF SINGLE VENTRICLE DEFECTS IN FETALHEARTSCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Serial No. 63 / 531,774, filed August 9, 2023, the contents of which are hereby incorporated by reference into the present disclosure in its entirety.BACKGROUND

[0002] Congenital heart disease (CHD) is the most common type of birth defects and a leading cause of birth defect-related deaths in the United States. Among all CHD, single ventricle heart defects (SVHDs) are the most severe form and nearly always require surgical interventions within days after birth. Through a series of complex surgical procedures, patients with SVHDs can survive but ultimately have only one functional ventricle: either the left or right ventricle is hypoplastic. There are two major types of SVHDs according to the anatomical position of hypoplastic ventricles: hypoplastic left heart syndrome (HLHS) and hypoplastic right heart syndrome (HRHS). Cellular and molecular etiologies of SVHDs are mostly unknown due to lack of reproducible experimental models.

[0003] Current diagnosis of SVHDs in fetuses heavily relies on fetal echocardiography. This complex imaging technologies requires experienced physicians and technicians along with expensive equipment, which inevitably elevates the burden of health care costs and deepens the risk of healthcare inequity for socio-economically disadvantaged groups.SUMMARY OF THE DISCLOSURE

[0004] In one aspect, provided herein is a method for detecting single ventricle heart defect in a fetus comprising, or consisting essentially of, or yet further consisting of: measuring the expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b-3p in a biological sample from a pregnant mother of the fetus comprising, or consisting essentially of, or yet further consisting of cell-free miRNA; and detecting single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to a reference value.

[0005] Also provided herein is a method for detecting single ventricle heart defect in a fetus comprising, or consisting essentially of, or yet further consisting of: measuring the expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, miR889- 3p, and / or miR-487b-3p in a biological sample from a pregnant mother of the fetus, the biological sample comprising, or consisting essentially of, or yet further consisting of cell- free miRNA; and detecting single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to a reference value.

[0006] Further provided is a method for diagnosing the risk for single ventricle heart defect in a fetus in utero comprising, or consisting essentially of, or yet further consisting of: measuring the expression level of at least one microRNA (miRNA) selected from miR-433- 3p, miR-134-5p, or miR-487b-3p in a biological sample form a pregnant mother of the fetus comprising, or consisting essentially of, or yet further consisting of cell-free miRNA; comparing the expression level of at least one miRNA to a reference value; and diagnosing that the fetus has or at a higher risk for single ventricle heart defect when the expression level of the at least one miRNA is elevated as compared to the reference value.

[0007] In another aspect, a method for diagnosing the risk for single ventricle heart defect in a fetus in utero is provided, the method comprising, or consisting essentially of, or yet further consisting of: measuring the expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, miR889-3p, and / or miR-487b-3p in a biological sample form a pregnant mother of the fetus comprising, or consisting essentially of, or yet further consisting of cell-free miRNA; comparing the expression level of at least one miRNA to a reference value; and diagnosing that the fetus has or at a higher risk for single ventricle heart defect when the expression level of the at least one miRNA is elevated as compared to the reference value. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.

[0008] Another aspect of the disclosure is directed to a method for treating single ventricle heart defect in a fetus in need thereof comprising, or consisting essentially of, or yet further consisting of administering to the mother of the fetus a treatment comprising, or consisting essentially of, or yet further consisting of open heart surgery, or the administration of an miRNA mimic inhibitor against miR-433-3p, miR-134-5p, and / or miR-487b-3p when a biological sample from the mother of the fetus comprising, or consisting essentially of, or yet further consisting of miRNA has an elevated expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b-3p.

[0009] In one embodiment, a method is provided for treating single ventricle heart defect in a fetus in need thereof comprising, or consisting essentially of, or yet further consisting of administering to the mother of the fetus a treatment comprising, or consisting essentially of, or yet further consisting of open heart surgery, or the administration of an miRNA mimic inhibitor against miR-433-3p, miR-134-5p, miR889-3p, and / or miR-487b-3p when a biological sample from the mother of the fetus comprising, or consisting essentially of, or yet further consisting of miRNA has an elevated expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, miR889-3p, and / or miR-487b-3p. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.

[0010] In a further embodiment, a method is provided for treating single ventricle heart defect in a fetus comprising, or consisting essentially of, or yet further consisting of: measuring the expression level of at least one microRNA (miRNA) selected from miR-433- 3p, miR-134-5p, or miR-487b-3p in a biological sample form the pregnant mother of a fetus comprising, or consisting essentially of, or yet further consisting of cell-free miRNA; detecting single ventricle heart defect in the fetus when the expression level of at least one miRNA is elevated as compared to a reference value; and administering to the fetus a treatment comprising, or consisting essentially of, or yet further consisting of an open heart surgery or a miRNA mimic inhibitor against miR-433-3p, miR-134-5p, and / or miR-487b-3p.

[0011] A further aspect of the disclosure is directed to a method for treating single ventricle heart defect in a fetus comprising, or consisting essentially of, or yet further consisting of: measuring the expression level of at least one microRNA (miRNA) selected from miR-433- 3p, miR-134-5p, miR889-3p, and / or miR-487b-3p in a biological sample from the pregnant mother of a fetus comprising, or consisting essentially of, or yet further consisting of cell-free miRNA; detecting single ventricle heart defect in the fetus when the expression level of at least one miRNA is elevated as compared to a reference value; and administering to the fetus a treatment comprising, or consisting essentially of, or yet further consisting of an open heart surgery or a miRNA mimic inhibitor against miR-433-3p, miR-134-5p, miR889-3p, and / or miR-487b-3p. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.

[0012] Additionally provided is a kit for use in a method as disclosed herein, comprising, or alternatively consisting essentially of, or yet further consisting of optional instructions for useand at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b- 3p.

[0013] In another embodiment, a kit is provided for use in a method as disclosed herein, comprising, or alternatively consisting essentially of, or yet further consisting of optional instructions for use and at least one microRNA (miRNA) selected from miR-433-3p, miR- 134-5p, miR889-3p, and / or miR-487b-3p.

[0014] Another aspect of the disclosure is directed to a system for analyzing cell-free miRNA (cf-miRNA) to detect the risk of single ventricle heart defect in a fetus, the system comprising one or more processors configured to: (a) retrieve sequence reads cf-miRNA fragments obtained from a biological sample from a pregnant woman; (b) determine sequence reads that correspond to at least one cf-miRNA selected from miR-433-3p, miR-134-5p, or miR-487b-3p; (c) determine the expression level of at least one of miR-433-3p, miR-134-5p, and miR-487b-3p; (d) compare the expression level to a reference value; and (e) detect a high risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to the reference value.

[0015] In a further aspect, a system is provided for analyzing cell-free miRNA (cf-miRNA) to detect the risk of single ventricle heart defect in a fetus, the system comprising one or more processors configured to: (a) retrieve sequence reads cf-miRNA fragments obtained from a biological sample from a pregnant woman; (b) determine sequence reads that correspond to at least one cf-miRNA selected from miR-433-3p, miR-134-5p, miR889-3p, and / or miR-487b- 3p; (c) determine the expression level of at least one of miR-433-3p, miR-134-5p, miR889- 3p, and / or miR-487b-3p; (d) compare the expression level to a reference value; and (e) detect a high risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to the reference value. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell free RNA (cf RNA) isolated from maternal plasma.BRIEF DESCRIPTION OF THE FIGURES

[0016] FIGS. 1A-1N: shows prenatal detection of single ventricle heart defects in developing fetuses using cell-free RNA from maternal blood. (FIG. 1A) Schematic overview of the rationale and experimental design. (FIG. IB) Echocardiogram of a developing fetus with HLHS during the second trimester of gestation shows a miniscule left ventricle with little to no blood flow entering the lower left chamber and left to right shunting across the atrialseptal defect. (FIG. 1C) Fetal echocardiogram during the second trimester of development of a heart with HRHS (PA-IVS) depicts a poorly developed right ventricle with poor hemodynamics into the chamber, as compared to the left ventricle. (FIG. ID) A representative immunofluorescence image of human iPSC-CMs reveals expression of a- ACTININ and cardiac TNNT2 that are organized into intercalated sarcomere structures. Nuclei are counterstained with DAPI. Scale bar: 50 pm. (FIG. IE) Cell proliferative ability of DI 5 iPSC-CMs from healthy, HLHS, and HRHS patients are evaluated in the baseline and in the presence of CHIR99021. Ki67+ TNNT2+ cells are considered proliferating cardiomyocytes. Nuclei are counterstained with DAPI. Scale bars: 100 pm. (FIGS. IF - 1G) Quantitative analysis of TNNT2+Ki67+ proliferating iPSC-CMs from healthy (n=3), HLHS (n=3), and PA-IVS (n=3) patients in baseline (F) and in the presence of CHIR99021 (FIG. 1G). Student’s t-test. *p<0.05. (FIG. 1H) Volcano plot indicates differentially expressed miRNAs in the supernatants of iPSC-CMs from HRHS and control subjects (adjusted p<0.05 and fold change>2). (FIG. II) Heatmap clustering shows candidate miRNAs are elevated in the maternal blood of pregnant women carrying fetuses with HLHS or HRHS. (FIGS. 1 J - IK) Real-time qPCR data confirm that miR-134-5p (FIG. 1J) and miR-487b-3p (FIG. IK) are upregulated in the intracellular compartments and supernatants of SVHD iPSC-CMs, and elevated in the maternal blood plasma of pregnant women who carry fetuses with SVHDs. Student’s t-test, *p<0.05, *p<0.01. (FIG. IL) Qiagen Ingenuity pathway analysis reveals target genes and associated biological pathways that are potentially regulated by miR-487b- 3p. (FIG. IM) Immunofluorescence staining shows proliferating cardiomyocytes in human iPSC-CMs transfected with the mock, scramble, miRNA mimic, and inhibitor of miR-487b- 3p. Scale bars: 100 pm. (FIG. IN) Quantitative analysis of proliferating cardiomyocytes in the population of iPSC-CMs transfected with the mock, scramble, miRNA mimic, and inhibitor of miR-487b- 3p. Student’s t-test and one-way ANOVA, *p<0.05, *p<0.01, ****p<0.0001. Each experiment was repeated at least 3 times. All data are shown as mean ± SEM.

[0017] FIG. 2 : Block diagram of the system in accordance with the aspects of the disclosure. CPU: Central Processing Unit (“processor”).DETAILED DESCRIPTIONDefinitions

[0018] As it would be understood, the section or subsection headings as used herein is fororganizational purposes only and are not to be construed as limiting and / or separating the subject matter described.

[0019] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods, devices, and materials are now described. All technical and patent publications cited herein are incorporated herein by reference in their entirety. Nothing herein is to be construed as an admission that the disclosure is not entitled to antedate such disclosure by virtue of prior disclosure.

[0020] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1 : A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London);Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology; Manipulating the Mouse Embryo: A Laboratory Manual, 3rd edition (Cold Spring Harbor Laboratory Press (2002)); Sohail (ed.) (2004) Gene Silencing by RNA Interference: Technology and Application (CRC Press).

[0021] As used in the specification and claims, the singular form “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a plurality of cells, including mixtures thereof.

[0022] As used herein, the term “comprising” is intended to mean that the compounds, agents, compositions and methods include the recited elements, but not exclude others. “Consisting essentially of’ when used to define compounds, agents, compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants, e.g., from the isolation and purification method and pharmaceutically acceptable carriers, preservatives, and the like. “Consisting of’ shall mean excluding more than trace elements of other ingredients. Embodiments defined by each of these transition terms are within the scope of this technology.

[0023] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (-) by increments of 1, 5, or 10%. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term “about.” It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.

[0024] The term “about,” as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 20%, 10%, 5%, 1 %, 0.5%, or even 0.1 % of the specified amount.

[0025] As used herein, comparative terms as used herein, such as high, low, increase, decrease, reduce, or any grammatical variation thereof, can refer to certain variation from the reference. In some embodiments, such variation can refer to about 10%, or about 20%, or about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 1 fold, or about 2 folds, or about 3 folds, or about 4 folds, or about 5 folds, or about 6 folds, or about 7 folds, or about 8 folds, or about 9 folds, or about 10 folds, or about 20 folds, or about 30 folds, or about 40 folds, or about 50 folds, or about 60 folds, or about 70 folds, or about 80 folds, or about 90 folds, or about 100 folds or more higher than the reference. In some embodiments, such variation can refer to about 1%, or about 2%, or about 3%, or about 4%, or about 5%, or about 6%, or about 7%, or about 8%, or about 0%, or about 10%, or about 20%, or about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 75%, or about 80%, or about 85%, or about 90%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the reference.

[0026] As will be understood by one skilled in the art, for any and all purposes, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Furthermore, as will be understood by one skilled in the art, a range includes each individual member.

[0027] “Optional” or “optionally” means that the subsequently described circumstance may or may not occur, so that the description includes instances where the circumstance occurs and instances where it does not.

[0028] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0029] “Substantially” or “essentially” means nearly totally or completely, for instance, 95% or greater of some given quantity. In some embodiments, “substantially” or “essentially” means 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.

[0030] The terms or “acceptable,” “effective,” or “sufficient” when used to describe the selection of any components, ranges, dose forms, etc. disclosed herein intend that said component, range, dose form, etc. is suitable for the disclosed purpose.

[0031] A “composition” is intended to mean a combination of active agent and another compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.

[0032] Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri, tetraoligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid components, which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.

[0033] A composition as disclosed herein can be a pharmaceutical composition. A “pharmaceutical composition” is intended to include the combination of an active agent with a carrier, inert or active, making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo.

[0034] “Pharmaceutically acceptable carriers” refers to any diluents, excipients, or carriers that may be used in the compositions disclosed herein. Pharmaceutically acceptable carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances, such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, Mack Publishing Company, a standard reference text in this field. They may be selected with respect to the intended form of administration, that is, oral tablets, capsules, elixirs, syrups and the like, and consistent with conventional pharmaceutical practices.

[0035] The compositions used in accordance with the disclosure can be packaged in dosage unit form for ease of administration and uniformity of dosage. The term "unit dose" or "dosage" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the composition calculated to produce the desired responses in association with its administration, i.e., the appropriate route and regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the result and / or protection desired. Precise amounts of the composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the subject, route of administration, intended goal of treatment (alleviation of symptoms versus cure), and potency, stability, and toxicity of the particular composition. Upon formulation, solutions are administered in a manner compatible with thedosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described herein.

[0036] A combination as used herein intends that the individual active ingredients of the compositions are separately formulated for use in combination and can be separately packaged with or without specific dosages. The active ingredients of the combination can be administered concurrently or sequentially.

[0037] An “effective amount” is an amount sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications, or dosages. Such delivery is dependent on a number of variables including the time period for which the individual dosage unit is to be used, the bioavailability of the therapeutic agent, the route of administration, etc. It is understood, however, that specific dose levels of the therapeutic agents disclosed herein for any particular subject depends upon a variety of factors including the activity of the specific agent employed, bioavailability of the agent, the route of administration, the age of the animal and its body weight, general health, sex, the diet of the animal, the time of administration, the rate of excretion, the drug combination, and the severity of the particular disorder being treated and form of administration. In general, one will desire to administer an amount of the agent that is effective to achieve a serum level commensurate with the concentrations found to be effective in vivo. These considerations, as well as effective formulations and administration procedures are well known in the art and are described in standard textbooks.

[0038] “Therapeutically effective amount” of an agent refers to an amount of the agent that is an amount sufficient to obtain a pharmacological response; or alternatively, is an amount of the agent that, when administered to a patient with a specified disorder or disease, is sufficient to have the intended effect, e.g., treatment, alleviation, amelioration, palliation or elimination of one or more manifestations of the specified disorder or disease in the patient. A therapeutic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically effective amount may be administered in one or more administrations.

[0039] As used herein, the phrase “derived from” means isolated from, purified from, or engineered from, or any combination thereof.

[0040] In some embodiments, the terms “first” “second” “third” “fourth” or similar in a component name are used to distinguish and identify more than one component sharing certain identity in their names. For example, “first treatment” and “second treatment” are used to distinguishing two treatments.

[0041] As used herein, “treating” or “treatment” of a disease in a subject refers to (1) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (z.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable. When the disease is a cardiac disease, the following clinical end points are non-limiting examples of treatment: improvement of cardiac output, consistency in cardiac output; or establishment of regular cardiac rhythm. In one aspect, treatment excludes prophylaxis.

[0042] As used herein, the term “animal” refers to living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term “mammal” includes both human and non-human mammals.

[0043] The term “subject,” “host,” “individual,” and “patient” are as used interchangeably herein to refer to animals, typically mammalian animals. Any suitable mammal can be treated by a method described herein. Non-limiting examples of mammals include humans, non- human primates (e.g., apes, gibbons, chimpanzees, orangutans, monkeys, macaques, and the like), domestic animals (e.g., dogs and cats), farm animals (e.g., horses, cows, goats, sheep, pigs) and experimental animals (e.g., mouse, rat, rabbit, guinea pig). In some embodiments, a mammal is a human. A mammal can be any age or at any stage of development (e.g., an adult, teen, child, infant, or a mammal in utero). A mammal can be male or female. In some embodiments, a subject is a human. In some embodiments, a subject has or is diagnosed of having or is suspected of having a cancer.

[0044] As used herein, the phrase “second trimester” refers to between week 14 and 27 (e.g., week 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24) of pregnancy.

[0045] In one embodiment, the term “disease” or “disorder” as used herein a congenital heart disease, e.g., a single ventricle heart defect.

[0046] The term “contacting” means direct or indirect binding or interaction between two or more. A particular example of direct interaction is binding. A particular example of an indirect interaction is where one entity acts upon an intermediary molecule, which in turn acts upon the second referenced entity. Contacting as used herein includes in solution, in solid phase, in vitro, ex vivo, in a cell and in vivo. Contacting in vivo can be referred to as administering, or administration.

[0047] “Administration” or “delivery” of a drug or a composition containing same can be performed in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician or in the case of animals, by the treating veterinarian. Suitable dosage formulations and methods of administering the agents are known in the art. Route of administration can also be determined and method of determining the most effective route of administration are known to those of skill in the art and will vary with the composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and target cell or tissue. Non-limiting examples of route of administration include oral administration, intraperitoneal, infusion, nasal administration, inhalation, injection, and topical application. In some embodiments, administering or a grammatical variation thereof also refers to more than one doses with certain interval. In some embodiments, the interval is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year or longer. In some embodiments, one dose is repeated for once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times or more.

[0048] The term administration shall include without limitation, administration by oral, parenteral (e.g., intramuscular, intraperitoneal, intravenous, intravascular, intraperitoneal, intracerebroventricular (ICV), intrathecal, intracistemal injection or infusion, intracranial,ocular, intradermally, percutaneously, subcutaneous injection, or implant), intratum orally, by inhalation spray nasal, intratracheal, vaginal, rectal, sublingual, urethral (e.g., urethral suppository) or topical routes of administration (e.g., gel, ointment, cream, aerosol, etc.) and can be formulated, alone or together, in suitable dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, excipients, and vehicles appropriate for each route of administration. The disclosure is not limited by the route of administration, the formulation or dosing schedule.

[0049] An agent of the present disclosure can be administered for therapy by any suitable route of administration. It will also be appreciated that the optimal route will vary with the condition and age of the recipient, and the disease being treated.

[0050] Administration or treatment in “combination” refers to administering two agents such that their pharmacological effects are manifest at the same time. Combination does not require administration at the same time or substantially the same time, although combination can include such administrations.

[0051] The terms "oligonucleotide" or "polynucleotide" or "portion," or "segment" thereof refer to a stretch of polynucleotide residues which is long enough to use in PCR or various hybridization procedures to identify or amplify identical or related parts of miRNA, mRNA or DNA molecules. The polynucleotide compositions of this invention include miRNA, RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

[0052] As used herein, the term "miRNA" refers to microRNAs, small non-coding RNA molecules, which in some examples contain approximately 22 nucleotides (e.g., between 21- 24 nucleotides) and are found in plants, animals, and some viruses. miRNAs are known to have roles in RNA silencing and post-transcriptional regulation of gene expression. These highly conserved RNAs regulate gene expression by binding to the 3 '-untranslated regions (3'-UTR) of specific mRNAs. For example, each miRNA is thought to regulate multiple genes, and since hundreds of miRNA genes are predicted to be present in higher eukaryotes. miRNAs tend to be transcribed from several different loci in the genome. These genes encode long RNAs with a hairpin structure that, when processed by a series of RNaselll enzymes (including Drosha and Dicer), form a miRNA hybrid typically ~22 nt in length with 2 nt overhangs at the 3' end.

[0053] As used herein, the phrase “miRNA mimic inhibitor” refers to an RNA that can specifically inhibit the function of a corresponding miRNA. For instance, an miRNA mimic inhibitor against miR-433-3p inhibits the function of miR-433-3p; an miRNA mimic inhibitor against miR-134-5p inhibits the function of miR-134-5p; an miRNA mimic inhibitor against miR-889-3p inhibits the function of miR-889-3p and an miRNA mimic inhibitor against miR- 487b-3p inhibits the function of miR-487b-3p. In some embodiments, an miRNA mimic inhibitor is a single stranded RNA. In some embodiments, an miRNA mimic inhibitor is chemically modified. In some embodiments, the miRNA mimic inhibitor is a MirVana™ mimic inhibitor from Thermo Fisher / Invitrogen.

[0054] As used herein, the term “cell free nucleic acid” refers to nucleic acids or nucleic acid fragments that circulate in a pregnant mother's body (e.g., in a body fluid such as the bloodstream) and originate from one or more cells from the pregnant mother or the fetus.

[0055] As used herein, the term “cell-free RNA,” or “cfRNA,” refers to RNA or RNA fragments that circulate in a pregnant mother's body (e.g., in a body fluid such as the bloodstream) and originate from one or more cells from the pregnant mother or the fetus.

[0056] As used herein, the term “cell-free miRNA,” or “cf-miRNA,” refers to microRNAs or microRNA fragments that circulate in a pregnant mother's body (e.g., in a body fluid such as the bloodstream) and originate from one or more cells from the pregnant mother or the fetus. In some embodiments, cf-miRNA can be detected and quantified in a biological sample from a pregnant mother using one of the methods described in Siddika, Tarana, and Ilka U. Heinemann (Frontiers in bioengineering and biotechnology 8 (2021): 619583), which isenclosed herein in its entirety. In some embodiments, cf-miRNA can be detected from a biological sample from a pregnant mother using a detection method selected from a hybridization-based detection method, a PCR-based detection method, an enzyme-based detection method (e.g., Invader assay), or an activity-based method (e.g., using luciferasebased miRNA reporter assay, GFP-based miRNA reporter assay). In some embodiments, cf- miRNA can be detected from a biological sample from a pregnant mother using a detection method selected from next generation sequencing (NGS), miRNA-seq, RNA-seq, Northern blot, microarray, RT-qPCR, qPCR, Invader assay, luciferase-based miRNA reporter assay, or GFP-based miRNA reporter assay.

[0057] The term “sequence read” as used herein refers to a nucleotide sequence obtained from or read from a nucleic acid obtained from a subject. Sequence reads can be obtained through various methods known in the art. Generally, sequence reads are obtained postamplification (e.g., polymerase chain reaction, such as bridge amplification) of a nucleic acid fragment that is obtained or enriched from a test sample.

[0058] As used herein, the phrase “measuring miRNA expression level” refers to quantifying the amount of miRNA present in a sample using any known method in the art or described herein. Examples of methods to measure miRNA include microRNA sequencing (miRNA- seq), RNA sequencing (RNA-seq), Northern blotting, microarray, quantitative polymerase chain reaction (qPCR or real-time PCR), and reverse transcription PCR (RT-qPCR).

[0059] As used herein, the term “biological sample” refers to a sample obtained from a biological subject (e.g., a pregnant woman), including sample of biological tissue or fluid origin obtained in vivo or in vitro. Such samples can be, but are not limited to, body fluid (e.g., blood, blood plasma, serum, or urine), organs, tissues, fractions, cells isolated from mammals including, humans and cell organelles. Biological samples also may include sections of the biological sample including tissues (e.g., sectional portions of an organ or tissue). Biological samples may also include extracts from a biological sample. Biological samples may comprise proteins, carbohydrates or nucleic acids (e.g., miRNAs).

[0060] As used herein, “reference value” refers to a value measured from a healthy person or an average value measured from a healthy group of people. In the case of an miRNA expression level, a “reference value” refers to the expression level of the same miRNA in a healthy person or the average expression level of the same miRNA in a healthy group of people. For example, if miR-433-3p is measured, the measured reference value is theexpression level of miR-433-3p from a mother carrying a fetus without the disease or defect, or the average expression level of miR-433-3p in a group of mothers carrying fetus without the disease or defect. If two or more miRNA is measured, e.g., miR-443-3p and miR-134-5p, the reference value comprises the expression levels of the same miRNAs (e.g. miR-443-3p and miR-134-5p) in a mother carrying a healthy fetus without the disease or defect or the average of the expression levels of the same miRNAs (e.g., miR-443-3p and miR-134-5p) in a group of women carrying healthy fetus without the disease or defect. In some embodiments, “reference value” is a standard given value previously derived from a healthy person or a healthy group of people.

[0061] As used herein, “elevated as compared to a reference value” means that a given or measured value is higher than a reference value. In some embodiments, a given or measured value is “elevated as compared to a reference value” when it is 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 or more times a reference value. In some embodiments, a given or measured value is “elevated as compared to a reference value” when it is 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more increased in value as compared to a reference value.

[0062] As used herein, the phrase “higher risk” refers to an increase of a risk for having a disease, e.g., at least 1.5 times, 2 times, 3 times or more, when compared to the risk of a normal patient (i.e., the risk of a normal patient of the same age and sex).

[0063] As used herein, the phrase “lower risk” refers to a decrease of a risk for having a disease, e.g., at least 1.5 times, 2 times, 3 times or more lower, when compared to the risk of a normal patient (i.e., the risk of a normal patient of the same age and sex).

[0064] As used herein, a “Norwood procedure” refers to a surgery to create a new functional systemic circuit in patients with heart defects with single ventricle physiology (“univentricular hearts”). In some embodiments, Norwood procedure is the first of three surgeries to treat single ventricle heart defects. In case of a hypopastic left heart syndrome, Norwood procedure comprises using the right ventricle as the main blood pumping mechanism into the systemic and pulmonary circulation. In some embodiments, a connection between left and right atria is established via atrial septectomy. Next, a connection between the right ventricle and aorta is forged with the reconstruction of the narrowed outflow track using a tissue graft from the distal main pulmonary artery. Lastly, an aortopulmonary shunt is created connecting the aorta to the main pulmonary artery to provide pulmonary blood flow.

[0065] As used herein, a “Glenn procedure” refers to a surgery to treat heart defects with single ventricle physiology. In some embodiments, the Glenn procedure is the second of three surgeries to treat single ventricle heart defects. In some embodiments, the Glenn procedure comprises connecting the superior vena cava to the right pulmonary artery (“bidirectional SVC-pulmonary shunt” to separate the systemic and pulmonary circulation).

[0066] As used herein, a “Fontan procedure” refers to a palliative surgical procedure used in patients with univentricular hearts. In some embodiments, the Fontan procedure comprises diverting the venous blood from the inferior vena cava (IVC) and superior vena cava (SVC) to the pulmonary arteries.

[0067] As used herein, a “Hybrid procedure” refers to a palliative surgical procedure used in patients with univentricular hearts. In some embodiments, Hybrid procedure is the first surgery to treat single ventricle heart defects. In some embodiments, the Hybrid procedure comprises bilateral pulmonary artery banding (which limits the amount of blood which flows to the lungs) and ductal stenting (PAB / DS) (a stent in the ductus arteriosus allows it to remain open to supply blood to the body).

[0068] As used herein, the phrase “single ventricle heart defect” (SVHD) or “univentricular heart defect” (UHD) refers to a congenital heart defect in which one of the ventricles is underdeveloped or absent.

[0069] As used herein, the phrase “Hypoplastic left heart syndrome” refers to a congenital heart defect when parts of the left side of the heart (mitral valve, left ventricle, aortic valve, and aorta) do not develop completely.

[0070] As used herein, the phrase “Hypoplastic right heart syndrome” refers to a congenital heart defect in which the structures on the right side of the heart, particularly the right ventricle, are underdeveloped.

[0071] As used herein, “size fractionation” refers to separation of substances in a mixture on the basis of their molecular size. In some embodiments, size fractionation comprises a gel electrophoresis, e.g., a polyacrylamide gel electrophoresis.

[0072] As used herein, the term “capture probe” or “nucleic acid capture probe” refers to a nucleic acid that comprises at least one sequence that is complementary to at least one sequence of the target nucleic acid. In some embodiments, the nucleic acid capture probe is deoxyribonucleic acid (DNA).

[0073] As used herein, “nested polymerase chain reaction” or “nested PCR” refers to a modification of polymerase chain reaction intended to reduce non-specific binding in products due to the amplification of unexpected primer binding sites. In some embodiments, nested polymerase chain reaction comprises two sets of primers, used in two successive runs of polymerase chain reaction, the second set intended to amplify a secondary target within the first run product. In some embodiments, the nested PCR is carried out as described in van Pelt-Verkuil et al. (Principles and technical aspects of PCR amplification. Springer Science & Business Media, 2008), which is incorporated herein in its entirety.

[0074] As used herein, “cycling probe reaction” refers to a molecular biological technique for detecting specific DNA sequences under isothermal conditions. In some embodiments, cycling probe reaction uses a sequence specific chimeric probe which hybridizes to a complementary target DNA sequence and becomes a substrate for RNase H. Cleavage occurs at the RNA internucleotide linkages and results in dissociation of the probe from the target, thereby making it available for the next probe molecule. In cycling probe reaction, the amplification of the signal is linear, in contrast to the exponential amplification of the target DNA in PCR.

[0075] As used herein, “ligase chain reaction” (LCR) refers to a method of DNA amplification. The ligase chain reaction (LCR) is an amplification process that differs from PCR in that it involves a thermostable ligase to join two probes or other molecules together which can then be amplified by standard polymerase chain reaction (PCR) cycling (Barany, 1991). Each cycle results in a doubling of the target nucleic acid molecule. A key advantage of LCR is greater specificity as compared to PCR.[1] Thus, LCR requires two completely different enzymes to operate properly: ligase, to join probe molecules together, and a thermostable polymerase (e.g., Taq polymerase) to amplify those molecules involved in successful ligation. The probes involved in the ligation are designed such that the 5’ end of one probe is directly adjacent to the 3’ end of the other probe, thereby providing the requisite 3’-OH and 5’-PO4 group substrates for the ligase.

[0076] As used herein, “reverse transcription polymerase chain reaction” (RT-PCR) refers to a laboratory technique combining reverse transcription of RNA into DNA (in this context called complementary DNA or cDNA) and amplification of specific DNA targets using polymerase chain reaction (PCR).Modes for Carrying Out the Disclosure

[0077] Prenatal detection of congenital heart disease is primarily dependent on fetal echocardiograph that requires experienced physicians and highly skilled technicians along with expensive equipment, which are less likely to be accessible in rural areas and developing countries. By leveraging deep sequencing and patient-specific induced pluripotent stem cell (iPSCs), Applicant has identified several cell-free miRNA that are elevated in the maternal blood of pregnant women carrying fetuses with single ventricle heart defects. These candidate miRNAs are upregulated in the secretome of proliferating iPSC-derived cardiomyocytes originated from patients with single ventricle heart defects and suppress human cardiomyocyte proliferation. Because adult cardiomyocytes in pregnant women rarely divide, the cardiomyocyte proliferation-associated cell-free miRNAs are likely released from developing hearts in fetuses. Together, Applicant has found that cell-free miRNAs in the maternal blood of pregnant women that can be utilized to predict single ventricle heart defects in developing fetuses.Methods for Detecting Single Ventricle Heart Defect in a Fetus

[0078] An aspect of the disclosure is directed to a method for detecting single ventricle heart defect in a fetus in utero comprising, or alternatively consisting of, or further consisting of: measuring the expression level of at least one microRNA (miRNA), or at least two or all three miRNA selected from miR-433-3p (HGNC: 32026 NCBI Gene: 574034 Ensembl: ENSG00000207569 OMIM®: 611711 miRBase: hsa-mir-433), miR-134-5p (HGNC: 31519 NCBI Gene: 406924 Ensembl: ENSG00000207993 OMIM®: 610164 miRBase: hsa-mir- 134), or miR-487b-3p (miR-487b-3p) in a biological sample from a pregnant mother of the fetus comprising cell-free miRNA; and detecting single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to a reference value. In some embodiments, the method further comprises, or alternatively consists of, or yet further consists of not detecting single ventricle heart defect in utero when the expression level of the at least one miRNA is not elevated when compared to the reference value.

[0079] In some embodiments, the reference value is derived from the expression level of the at least one miRNA or at least two or all three miRNA (i.e., at least one miRNA selected from miR-433-3p, miR-134-5p, or miR-487b-3p) in a group of pregnant women carrying healthy fetuses. In some embodiments, the reference value is derived from an averageexpression level of at least one miRNA or at least two or all three miRNA selected from miR- 433-3p, miR-134-5p, or miR-487b-3p in a group of pregnant women carrying healthy fetuses.

[0080] An alternative aspect of the disclosure is directed to a method for detecting single ventricle heart defect in a fetus in utero comprising, or alternatively consisting of, or further consisting of: measuring the expression level of at least one microRNA (miRNA), or at least two, or at least three miRNA, or all four selected from miR-433-3p (HGNC: 32026 NCBI Gene: 574034 Ensembl: ENSG00000207569 OMIM®: 611711 miRBase: hsa-mir-433), miR-889-3p (Genbank Ref No. 030595.1); miR-134-5p (HGNC: 31519 NCBI Gene: 406924 Ensembl: ENSG00000207993 OMIM®: 610164 miRBase: hsa-mir-134), or miR-487b-3p (miR-487b-3p) in a biological sample from a pregnant mother of the fetus comprising cell- free miRNA; and detecting single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to a reference value. In some embodiments, the method further comprises, or alternatively consists of, or yet further consists of not detecting single ventricle heart defect in utero when the expression level of the at least one miRNA is not elevated when compared to the reference value. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.

[0081] In some embodiments, the reference value is derived from the expression level of the at least one miRNA or at least two or three, or all four miRNA (i.e., at least one miRNA selected from miR-433-3p, miR-889-3p, miR-134-5p, or miR-487b-3p) in a group of pregnant women carrying healthy fetuses. In some embodiments, the reference value is derived from an average expression level of at least one miRNA or at least two or at least three, or all four miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR-487b- 3p in a group of pregnant women carrying healthy fetuses.

[0082] In some embodiments, the single ventricle heart defect is hypoplastic left heart syndrome (HLHS) or hypoplastic right heart syndrome (HRHS).

[0083] In some embodiments, the measuring comprises, or alternatively consists of, or yet further consists of a method selected from miRNA-seq, RT-PCR, hybridization, cycling probe reaction, polymerase chain reaction, nested polymerase chain reaction, or ligase chain reaction.

[0084] In some embodiments, the fetus is at least in the second trimester of development. In some embodiments, the fetus has had 14 weeks of development in utero. In some embodiments, the fetus is developed between the second trimester and the birth.

[0085] In some embodiments, the biological sample comprises, or alternatively consists of, or yet further consists of at least one enriched miRNA, or at least two, or at least three, or all four miRNA, selected from miR-433-3p, miR-134-5p, miR-889-3p,and miR-487b-3p. In some embodiments, the at least one miRNA is enriched comprising a method selected from a capture probe or size fractionation. In some embodiments, the size fractionation comprises running isolated RNA on a denaturing polyacrylamide gel and extracting appropriate section of the gel for RNA isolation and subsequent sequencing.

[0086] In some embodiments, the biological sample is selected from a plasma sample, a blood sample, a saliva sample, an amniotic fluid sample, a cystic fluid sample, a spinal fluid sample, a brain fluid sample, a urine sample, a sweat sample, or a tear sample. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.Methods for Diagnosing the Risk for Single Ventricle Heart Defect in a Fetus

[0087] An aspect of the disclosure is directed to a method for diagnosing the risk for single ventricle heart defect in a fetus in utero comprising, or alternatively consisting of, or further consisting of: measuring the expression level of at least one microRNA or at least two or all three miRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b-3p in a biological sample form a pregnant mother of the fetus comprising cell-free miRNA; comparing the expression level of at least one miRNA to a reference value; and diagnosing that the fetus has or at a higher risk for single ventricle heart defect when the expression level of the at least one miRNA (or at least two or all three miRNA) is elevated as compared to the reference value. In some embodiments, the method further comprises, or alternatively consists of, or yet further consists of diagnosing that the fetus is not at high risk for single ventricle heart defect when the expression level of the at least one miRNA (or at least two or all three miRNA) is not elevated when compared to the reference value.

[0088] Another aspect of the disclosure is directed to a method for diagnosing the risk for single ventricle heart defect in a fetus in utero comprising, or alternatively consisting of, or further consisting of: measuring the expression level of at least one microRNA or at least two or at least three, or all four miRNA (miRNA) selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR-487b-3p in a biological sample form a pregnant mother of the fetus comprising cell-free miRNA; comparing the expression level of at least one miRNA to a reference value; and diagnosing that the fetus has or at a higher risk for single ventricle heart defect when the expression level of the at least one miRNA (or at least two or all three miRNA) is elevated as compared to the reference value. In some embodiments, the method further comprises, or alternatively consists of, or yet further consists of diagnosing that the fetus is not at high risk for single ventricle heart defect when the expression level of the at least one miRNA (or at least two or at least three miRNA, or all four) is not elevated when compared to the reference value.

[0089] In some embodiments, the reference value is derived from the expression level of the at least one miRNA or at least two or all three miRNA (i.e., at least one or at least two, or at least three miRNA, or all four selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR- 487b-3p) in a group of pregnant women carrying healthy fetuses. In some embodiments, the reference value is an average expression level of at least one miRNA selected from at least one, or at least two, or at least three, or all four miRNA selected from miR-433-3p, miR-134- 5p, miR-889-3p, or miR-487b-3p in a group of pregnant women carrying healthy fetuses.

[0090] In some embodiments, the single ventricle heart defect is hypoplastic left heart syndrome (HLHS) or hypoplastic right heart syndrome (HRHS).

[0091] In some embodiments, the measuring comprises, or alternatively consists of, or yet further consists of a method selected from miRNA-seq, RT-PCR, hybridization, cycling probe reaction, polymerase chain reaction, nested polymerase chain reaction, or ligase chain reaction.

[0092] In some embodiments, the fetus is at least in the second trimester of development. In some embodiments, the fetus has had 14 weeks of development in utero. In some embodiments, the fetus is developed between the second trimester and the birth.

[0093] In some embodiments, the biological sample comprises, or alternatively consists of, or yet further consists of enriched miRNA selected from at least one or at least two or at least three, or all four miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, and miR- 487b-3p. In some embodiments, the at least one miRNA is enriched comprising a method selected from a capture probe or size fractionation. In some embodiments, the size fractionation comprises, or alternatively consists of, or yet further consists of running isolatedRNA on a denaturing polyacrylamide gel and extracting appropriate section of the gel for RNA isolation and subsequent sequencing.

[0094] In some embodiments, the biological sample is selected from a plasma sample, a blood sample, a saliva sample, an amniotic fluid sample, a cystic fluid sample, a spinal fluid sample, a brain fluid sample, a urine sample, a sweat sample, or a tear sample. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.Methods of Treatment

[0095] In one aspect, provided is a method of treating a fetus suffering from SVHD.

[0096] A method for treating single ventricle heart defect in a fetus comprising, or alternatively consisting of, or further consisting of: measuring the expression level of at least one or at least two or all three microRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b-3p in a biological sample form the pregnant mother of a fetus comprising cell- free miRNA; detecting single ventricle heart defect in the fetus when the expression level of at least one miRNA is elevated as compared to a reference value; and administering to the fetus a treatment comprising an open heart surgery or a miRNA mimic inhibitor against at least one, or at least two or all three miRNA selected from miR-433-3p, miR-134-5p, and / or miR-487b-3p.

[0097] In some embodiments, the method comprises, or alternatively consists of, or yet further consists of administering, for example an effective amount of, an miRNA mimic inhibitor (e.g., a mimic inhibitor against at least one or at least two or all three miRNA selected from miR-433-3p, miR-134-5p, or miR-487b-3p) directed to the one or more elevated miRNA, to the subject (e.g., fetus diagnosed to have SVHD, or a newborn who has SVHD, or a toddler who has SVHD). In further embodiments, the method comprises, or alternatively consists of, or yet further consists of administering, for example an effective amount of, more than one miRNA mimic inhibitor (e.g., more than one mimic inhibitor against at least one or at least two or all three miRNA selected from miR-433-3p, miR-134- 5p, and / or miR-487b-3p, or a combination thereof) as disclosed herein to the subject. In yet further embodiments, the more than one miRNA mimic inhibitors can be administered in one composition or different compositions. In some embodiments, the more than miRNA mimic inhibitors are administered in different compositions concurrently. In some embodiments, the more than miRNA mimic inhibitors are administered in different compositions sequentially.In further embodiments, each of the two sequential administrations can be about 1 hour apart, about 2 hours apart, about 3 hours apart, about 4 hours apart, about 5 hours apart, about 6 hours apart, about 7 hours apart, about 8 hours apart, about 9 hours apart, about 10 hours apart, about 11 hours apart, about 12 hours part, about 1 day apart, about 2 days apart, about 3 days apart, about 4 days apart, about 5 days apart, about 6 days apart, about 7 days apart, about 2 weeks apart, about 3 weeks apart, about 4 weeks apart, about 5 weeks part, about 6 weeks apart, about 7 weeks apart, about 2 months apart, or longer. In some embodiments, the same or different routes of administrations can be used for the sequential administrations.

[0098] In one aspect, this disclosure is directed to a method for treating single ventricle heart defect in a fetus in need thereof comprising, or alternatively consisting of, or further consisting of administering to the mother of the fetus a treatment comprising open heart surgery, or the administration of an miRNA mimic inhibitor against one or more of the elevated miR-433-3p, miR-134-5p, miR-889-3p, and / or miR-487b-3p when a biological sample from the mother of the fetus comprising miRNA has an elevated expression level of at least one or at least two, or all three, or all four microRNA (miRNA) selected from miR- 433-3p, miR-134-5p, miR-889-3p, or miR-487b-3p.

[0099] A method for treating single ventricle heart defect in a fetus comprising, or alternatively consisting of, or further consisting of: measuring the expression level of at least one or at least two or all three microRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b-3p in a biological sample form the pregnant mother of a fetus comprising cell- free miRNA; detecting single ventricle heart defect in the fetus when the expression level of at least one miRNA is elevated as compared to a reference value; and administering to the fetus a treatment comprising an open heart surgery or a miRNA mimic inhibitor against at least one, or at least two or all three miRNA selected from miR-433-3p, miR-134-5p, and / or miR-487b-3p, wherein the inhibitor is directed to the miRNA that is elevated.

[0100] A method for treating single ventricle heart defect in a fetus comprising, or alternatively consisting of, or further consisting of: measuring the expression level of at least one or at least two, or at least three, or all four microRNA (miRNA) selected from miR-433- 3p, miR-134-5p, miR-889-3p, or miR-487b-3p in a biological sample form the pregnant mother of a fetus comprising cell-free miRNA; detecting single ventricle heart defect in the fetus when the expression level of at least one miRNA is elevated as compared to a reference value; and administering to the fetus a treatment comprising an open heart surgery or a miRNA mimic inhibitor against at least one, or at least two, or at least three, or all fourmiRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, and / or miR-487b-3p, , wherein the inhibitor is directed to the miRNA that is elevated.

[0101] In some embodiments, the open heart surgery comprises, or alternatively consists of, or yet further consists of the Norwood procedure, the Glenn procedure, the Fontan procedure, and / or the Hybrid procedure or a combination thereof.

[0102] In some embodiments, the method comprises, or alternatively consists of, or yet further consists of administering, for example an effective amount of, an miRNA mimic inhibitor that inhibits the miRNA that is elevated (e.g., a mimic inhibitor against at least one or at least two, or at least three miRNA, or all four selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR-487b-3p) as disclosed herein to the subject (e.g., fetus diagnosed to have SVHD, or a newborn who has SVHD, or a toddler who has SVHD). In further embodiments, the method comprises, or alternatively consists of, or yet further consists of administering, for example an effective amount of, more than one miRNA mimic inhibitor (e.g., more than one mimic inhibitor against at least one or at least two or at least three, or all four miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, and / or miR-487b-3p, or a combination thereof) as disclosed herein to the subject. In yet further embodiments, the more than one miRNA mimic inhibitors can be administered in one composition or different compositions. In some embodiments, the more than miRNA mimic inhibitors are administered in different compositions concurrently. In some embodiments, the more than miRNA mimic inhibitors are administered in different compositions sequentially. In further embodiments, each of the two sequential administrations can be about 1 hour apart, about 2 hours apart, about 3 hours apart, about 4 hours apart, about 5 hours apart, about 6 hours apart, about 7 hours apart, about 8 hours apart, about 9 hours apart, about 10 hours apart, about 11 hours apart, about 12 hours part, about 1 day apart, about 2 days apart, about 3 days apart, about 4 days apart, about 5 days apart, about 6 days apart, about 7 days apart, about 2 weeks apart, about 3 weeks apart, about 4 weeks apart, about 5 weeks part, about 6 weeks apart, about 7 weeks apart, about 2 months apart, or longer. In some embodiments, the same or different routes of administrations can be used for the sequential administrations. The RNAs can be delivered using methods known in the art, e.g., using lipid nanoparticles, e.g., via Lipofectamine RNAiMax Transfection Reagent (ThermoFisher Scientific, https: / / www.thermofisher.com / us / en / home / life-science / cell-culture / transfection / transfection- reagents / lipofectamine-rnaimax- reagent.html?gclid=CjOKCQjwwaelBhC_ARIsAK4JfrztKd8-FOku5nG8fDzuWlmlx5R3tTNJPS10LXKL- bbLYLlFlSvsO7QaAnZ8EALw_wcB&ef_id=CjOKCQjwwaelBhC_ARIsAK4JfrztKd8- FOku5nG8fDzuWlmlx5R3tTNJPS10LXKL- bbLYLlFlSvs07QaAnZ8EALw_wcB:G:s&s_kwcid=AL!3652!3 !552917785801 !p! !g! !rnai% 20transfection!2058097103 !75756884323&cid=bid_clb_tfx_r01_co_cp0000_pjt0000_bid00 000_0se_gaw_nt_pur_con&gad_source=l, last accessed on July 31 2024).

[0103] In some embodiments, the method comprises, or alternatively consists of, or yet further consists of administering, for example an effective amount of, the one or more miRNA or first and second compositions of a kit as disclosed herein to the subject. In further embodiments, the first composition and the second composition are administered to the subject concurrently or sequentially. In the embodiments where the first composition and the second composition are administered sequentially, the two administrations are about 1 hour apart, about 2 hours apart, about 3 hours apart, about 4 hours apart, about 5 hours apart, about 6 hours apart, about 7 hours apart, about 8 hours apart, about 9 hours apart, about 10 hours apart, about 11 hours apart, about 12 hours part, about 1 day apart, about 2 days apart, about 3 days apart, about 4 days apart, about 5 days apart, about 6 days apart, about 7 days apart, about 2 weeks apart, about 3 weeks apart, about 4 weeks apart, about 5 weeks part, about 6 weeks apart, about 7 weeks apart, about 2 months apart, or longer. In some embodiments, the same or different routes of administrations can be used for the sequential administrations.

[0104] In some embodiments, the reference value is derived from the expression level of the at least one miRNA (i.e., at least one at least one or at least two or at least three miRNA or all four selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR-487b-3p) in a group of pregnant women carrying healthy fetuses. In some embodiments, the reference value is an average expression level of at least one at least one or at least two or at least three or all four miRNAs selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR-487b-3p in a group of pregnant women carrying healthy fetuses.

[0105] In some embodiments, the single ventricle heart defect is hypoplastic left heart syndrome (HLHS) or hypoplastic right heart syndrome (HRHS).

[0106] In some embodiments, the measuring comprises, or alternatively consists of, or yet further consists of a method selected from miRNA-seq, RT-PCR, hybridization, cycling probe reaction, polymerase chain reaction, nested polymerase chain reaction, or ligase chain reaction.

[0107] In some embodiments, the fetus is at least in the second trimester of development. In some embodiments, the fetus has had 14 weeks of development in utero. In some embodiments, the fetus is developed between the second trimester and the birth.

[0108] In some embodiments, the biological sample comprises, or alternatively consists of, or yet further consists of at least one or at least two or at least three or all four enriched miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, and / or miR-487b-3p. In some embodiments, the at least one miRNA is enriched comprising a method selected from a capture probe or size fractionation. In some embodiments, the size fractionation comprises, or alternatively consists of, or yet further consists of running isolated RNA on a denaturing polyacrylamide gel and extracting appropriate section of the gel for RNA isolation and subsequent sequencing.

[0109] In some embodiments, the biological sample is selected from a plasma sample, a blood sample, a saliva sample, an amniotic fluid sample, a cystic fluid sample, a spinal fluid sample, a brain fluid sample, a urine sample, a sweat sample, or a tear sample. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.

[0110] In some embodiments, the subject is a mammal. In further embodiments, the subject is a human. In some embodiments, the subject is a fetus. In some embodiments, the subject is a newborn. In some embodiments, the subject is less than one year old baby. In some embodiments, the subject is a toddler between 12 and 36 months of age.[OHl] In some embodiments, the method is used as a first line therapy, or a second line therapy, or a third line therapy, or a fourth line therapy. In some embodiment, the method can be combined with another form of cardiac therapy.Kits

[0112] In one aspect, provided is a kit comprising, or alternatively consisting essentially of, or yet further consisting of instructions for use; and at least one oligonucleotide for detecting at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b-3p.

[0113] In one aspect, provided is a kit comprising, or alternatively consisting essentially of, or yet further consisting of instructions for use; and at least one oligonucleotide for detecting at least one or at least two or at least three or all four microRNA (miRNA) selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR-487b-3p.

[0114] In some embodiments, the first composition further comprising a carrier, such as a pharmaceutically acceptable carrier. Additionally or alternatively, the second composition further comprising a carrier, such as a pharmaceutically acceptable carrier.

[0115] In some embodiments, the kit is for use in treating a SVHD in a subject in need thereof, such as in a method as disclosed herein.

[0116] In another aspect, provided is a kit for use in a method as disclosed herein. The kit comprises, or alternatively consists essentially of, or yet further consists of instructions for use and one or more of at least one oligonucleotide for detecting at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, or miR-487b-3p as disclosed herein.

[0117] In a further aspect, provided is a kit for use in a method as disclosed herein. The kit comprises, or alternatively consists essentially of, or yet further consists of instructions for use and one or more of at least one oligonucleotide for detecting at least one microRNA or at least two or at least three or all four (miRNA) selected from miR-433-3p, miR-134-5p, miR- 889-3p, or miR-487b-3p as disclosed herein.

[0118] Other components can be further included in the kit, such as a dilute of the at least one oligonucleotide, a device for administration (such as a syringe), or a container suitable for storing and shipping the contents of the kit.Systems

[0119] Another aspect of the disclosure is directed to a system for analyzing cell-free miRNA (cf-miRNA) to detect the risk of single ventricle heart defect in a fetus, the system comprising one or more processors configured to: (a) retrieve sequence reads cf-miRNA fragments obtained from a biological sample from a pregnant woman; (b) determine sequence reads that correspond to at least one or at least two or all three cf-miRNA selected from miR- 433-3p, miR-134-5p, or miR-487b-3p; (c) determine the expression level of at least one of miR-433-3p, miR-134-5p, and miR-487b-3p; (d) compare the expression level to a reference value; and (e) detect a high risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to the reference value. In some embodiments, the method further comprising: (f) detect a low risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is not elevated as compared to the reference expression level. In some embodiments, the system further comprises recommending a treatment when a high risk of single ventricle heart defect in the fetus is detected.

[0120] Another embodiment of the disclosure is directed to a system for analyzing cell-free miRNA (cf-miRNA) to detect the risk of single ventricle heart defect in a fetus, the system comprising one or more processors configured to: (a) retrieve sequence reads cf-miRNA fragments obtained from a biological sample from a pregnant woman; (b) determine sequence reads that correspond to at least one or at least two or at least three or all four cf-miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, or miR-487b-3p; (c) determine the expression level of at least one or at least two or at least three or all four of miR-433-3p, miR- 134-5p, miR-889-3p, or miR-487b-3p; (d) compare the expression level to a reference value; and (e) detect a high risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to the reference value. In some embodiments, the method further comprising: (f) detect a low risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is not elevated as compared to the reference expression level. In some embodiments, the system further comprises recommending a treatment when a high risk of single ventricle heart defect in the fetus is detected. In a yet further aspect, the treatment is administered based on the diagnosis. Examples of such are provided herein.

[0121] In some embodiments, the recommended treatment comprises an open heart surgery or a miRNA mimic inhibitor against miR-433-3p, miR-134-5p, miR-889-3p, and / or miR- 487b-3p.

[0122] In some embodiments, the open heart surgery comprises, or alternatively consists of, or yet further consists of the Norwood procedure, the Glenn procedure, the Fontan procedure, and / or the Hybrid procedure or a combination thereof.

[0123] In some embodiments, the recommended treatment comprises, or alternatively consists of, or yet further consists of administering, for example an effective amount of, an miRNA mimic inhibitor that inhibits the miRNA that is elevated (e.g., a mimic inhibitor against miR-433-3p, miR-134-5p, miR-889-3p, and / or miR-487b-3p) as disclosed herein to the subject (e.g., fetus diagnosed to have SVHD, or a newborn who has SVHD, or a toddler who has SVHD). In further embodiments, the method comprises, or alternatively consists of, or yet further consists of administering, for example an effective amount of, more than one miRNA mimic inhibitor (e.g., more than one mimic inhibitor against miR-433-3p, miR-134- 5p, miR-889-3p, and / or miR-487b-3p, or a combination thereof) as disclosed herein to the subject. In yet further embodiments, the more than one miRNA mimic inhibitors can be administered in one composition or different compositions. In some embodiments, the morethan miRNA mimic inhibitors are administered in different compositions concurrently. In some embodiments, the more than miRNA mimic inhibitors are administered in different compositions sequentially. In further embodiments, each of the two sequential administrations can be about 1 hour apart, about 2 hours apart, about 3 hours apart, about 4 hours apart, about 5 hours apart, about 6 hours apart, about 7 hours apart, about 8 hours apart, about 9 hours apart, about 10 hours apart, about 11 hours apart, about 12 hours part, about 1 day apart, about 2 days apart, about 3 days apart, about 4 days apart, about 5 days apart, about 6 days apart, about 7 days apart, about 2 weeks apart, about 3 weeks apart, about 4 weeks apart, about 5 weeks part, about 6 weeks apart, about 7 weeks apart, about 2 months apart, or longer. In some embodiments, the same or different routes of administrations can be used for the sequential administrations.

[0124] In some embodiments, the reference value is derived from the expression level of the at least one miRNA (i.e., at least one or at least two or at least three or all four miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, and / or miR-487b-3p) in a group of pregnant women carrying healthy fetuses. In some embodiments, the reference value is an average expression level of at least one or at least two or at least three or all four miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, and / or miR-487b-3p in a group of pregnant women carrying healthy fetuses.

[0125] In some embodiments, the single ventricle heart defect is hypoplastic left heart syndrome (HLHS) or hypoplastic right heart syndrome (HRHS).

[0126] In some embodiments, the measuring comprises, or alternatively consists of, or yet further consists of a method selected from miRNA-seq, RT-PCR, hybridization, cycling probe reaction, polymerase chain reaction, nested polymerase chain reaction, or ligase chain reaction.

[0127] In some embodiments, the fetus is at least in the second trimester of development. In some embodiments, the fetus has had 14 weeks of development in utero. In some embodiments, the fetus is developed between the second trimester and the birth.

[0128] In some embodiments, the biological sample comprises, or alternatively consists of, or yet further consists of at least one or at least two or at least three or all four enriched miRNA selected from miR-433-3p, miR-134-5p, miR-889-3p, and miR-487b-3p. In some embodiments, the at least one miRNA is enriched comprising a method selected from a capture probe or size fractionation. In some embodiments, the size fractionation comprises,or alternatively consists of, or yet further consists of running isolated RNA on a denaturing polyacrylamide gel and extracting appropriate section of the gel for RNA isolation and subsequent sequencing.

[0129] In some embodiments, the biological sample is selected from a plasma sample, a blood sample, a saliva sample, an amniotic fluid sample, a cystic fluid sample, a spinal fluid sample, a brain fluid sample, a urine sample, a sweat sample, or a tear sample. In one aspect, the biological sample comprises, or consists essentially of, or consists of cell-free miRNA (cf miRNA) isolated from maternal plasma.

[0130] Another aspect of the disclosure is directed to a system comprising a CPU, a display, a network interface, a user interface, a memory, a program memory and a working memory (FIG. 2), where the system is programmed to execute a program, software, or computer instructions directed to methods or processes of the instant disclosure.

[0131] The term "memory" as used herein comprises program memory and working memory. The program memory may have one or more programs or software modules. The working memory stores data or information used by the CPU in executing the functionality described herein.

[0132] The term "processor" may include a single core processor, a multi-core processor, multiple processors located in a single device, or multiple processors in wired or wireless communication with each other and distributed over a network of devices, the Internet, or the cloud. Accordingly, as used herein, functions, features or instructions performed or configured to be performed by a "processor", may include the performance of the functions, features or instructions by a single core processor, may include performance of the functions, features or instructions collectively or collaboratively by multiple cores of a multi-core processor, or may include performance of the functions, features or instructions collectively or collaboratively by multiple processors, where each processor or core is not required to perform every function, feature or instruction individually. The processor may be a CPU (central processing unit). The processor may comprise other types of processors such as a GPU (graphical processing unit). In other aspects of the disclosure, instead of or in addition to a CPU executing instructions that are programmed in the program memory, the processor may be an ASIC (application-specific integrated circuit), analog circuit or other functional logic, such as a FPGA (field-programmable gate array), PAL (Phase Alternating Line) or PLA (programmable logic array).

[0133] The CPU is configured to execute programs (also described herein as modules or instructions) stored in a program memory to perform the functionality described herein. The memory may be, but not limited to, RAM (random access memory), ROM (read-only memory) and persistent storage. The memory is any piece of hardware that is capable of storing information, such as, for example without limitation, data, programs, instructions, program code, and / or other suitable information, either on a temporary basis and / or a permanent basis.

[0134] The following examples are included to demonstrate some embodiments of the disclosure. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Experimental MethodsExperimental Method No. 1 - Cell-free microRNAs (miRNA) as Markers for Single Ventricle Heart Defects

[0135] Cell-free DNA and RNA in the maternal blood are able to serve as noninvasive diagnosis during pregnancy to detect genetic abnormalities in fetuses and predict fetal and maternal health and disease. In this study, Applicant leveraged deep sequencing of cell-free RNA and patient-specific induced pluripotent stem cells (iPSCs) to identify prospective cell- free RNA that could be utilized as maternal biomarkers for predicting single ventricle heart diseases (SVHDs) in developing fetuses during gestation (FIG. 1A).

[0136] Under an IRB-approved protocol at Nationwide Children’s Hospital, 23 pregnant women who were carrying single ventricle (SV) or healthy fetuses at 20-40 weeks of gestation were recruited. Of them, 11 carried healthy fetuses and 12 carried SV fetuses (n=9 for hypoplastic left heart syndrome (HLHS) and n=3 for hypoplastic right heart syndrome (HRHS) and hypoplastic right heart syndrome (HRHS). Echocardiograms were used to screen and diagnose SV phenotypes of HLHS or HRHS in fetuses, respectively (FIGS. 1B- 1C). All pregnant women were healthy and did not have congenital cardiovascular abnormalities. After obtaining consent forms, 10 ml of blood was collected from each pregnant woman and the plasma layer was extracted by centrifugation. Cell-free miRNAs were extracted from the plasma and then subjected to deep miRNA sequencing (miRNA- seq). In total, cell-free miRNA profiles from 2 cohorts (n=9 for cohort 1 and n=8 for cohort2) of maternal blood samples of pregnant women were surveyed. As the majority of cell- free miRNAs in the blood were originated from the tissues of pregnant women rather than the fetus, different lifestyles and demographic conditions between pregnant women dominated the variance in the transcriptional profiles of cell-free miRNAs.

[0137] Next, patient-specific iPSCs were used to biologically calibrate potential cell-free miRNAs that were present in the maternal blood. Subjects with HLHS (n=3) and HRHS (n=3) and their unaffected family members were recruited, and respective iPSC lines were derived. Subsequently, proliferating cardiomyocytes from HLHS / HRHS and control iPSCs were generated and evaluated their proliferation ability. A typical sarcomere structure with intercalated TNNT2 and a-actinin was present in HLHS / HRHS iPSC-derived cardiomyocytes (iPSC-CMs) (FIG. ID). At the baseline level, HLHS and HRHS iPSC-CMs displayed reduced cardiomyocyte proliferation ability, evidenced by the lower percentage of Ki67+TNNT2+ cardiomyocytes in the population (FIGS. 1E-1F).

[0138] Next, CHIR99021 that activates WNT signaling was applied to stimulate cardiomyocyte proliferation. Though CHIR99021 promoted cardiomyocyte proliferation, both HLHS and HRHS iPSC-CMs displayed lower percentages of proliferating cardiomyocytes compared to controls (FIG. 1G). These results suggest that patient iPSC- CMs could recapitulate the cardiac proliferation defects that may contribute to hypoplastic ventricular growth in fetal hearts.

[0139] As adult cardiomyocytes in pregnant women rarely divide, secretive miRNAs that are associated with cardiomyocyte proliferation are likely released from the developing fetal heart. To further identity miRNAs that are associated with embryonic cardiomyocyte proliferation, supernatants from proliferating iPSC-CMs (DI 4-20) were collected, cell-free miRNAs were extracted, and analyzed using miRNA- seq. Compared to healthy controls, supernatants from HLHS and HRHS iPSC-CMs displayed higher levels of a number of miRNAs, including miR-433-3p, miRNA-134-5p, and miRNA-487b-3p (FIG. 1H). Next, differentially expressed miRNAs (DEmiRNAs) were used in the supernatants of proliferating iPSC- CMs to calibrate DEmiRNAs in the blood plasma of pregnant women carrying fetuses with HLHS or HRHS. After calibration, 4 candidate cell-free miRNAs that were differentially expressed in the blood of pregnant women with HLHS or HRHS fetuses compared to those with normal fetuses were identified (FIG. II). Real time qPCR was performed to confirm that miR-487-3p, miR-433-3p, and miR-134-5p were elevated in the supernatants and intracellular compartments of proliferating iPSC-CMs from HLHS orHRHS patients compared to those from healthy controls (FIGS. 1 J-1K). Finally, levels of these cell-free miRNAs were found to be upregulated in the pregnant women carrying HLHS or HRHS fetuses compared to those carrying normal fetuses.

[0140] Applicant then utilized miRNA target prediction database (miRDB) to predict the potential gene targets of these candidate miRNAs. Interestingly, downstream target genes of miR-487b-3p are associated with cell cycle progression, mitosis, proliferation of cardiomyocytes, and congenital heart disease (FIG. IL). To evaluate biological function of miR-487b-3p, Applicant employed mirVana miRNA mimics (Thermo Fisher Scientific) for overexpression and miRNA inhibitor for downregulation. miR-487b-3p mimic or inhibitor was delivered to DI 5 proliferating human iPSC-CMs via Lipofectamine RNAiMax Transfection Reagent and the percentage of dividing cardiomyocytes was observed 3 days post transfection. Upregulation of miR-487b-3p by mirVana mimic significantly suppressed cardiomyocyte proliferation and reduced the percentage of TNNT2+ Ki67+ iPSC-CMs in the population (FIGS. 1M-1N). In contrast, iPSC-CMs treated with the inhibitor of miR-487b-3p displayed less significant effect on cardiomyocyte proliferation compared to those treated with the scramble miRNA (FIG. IN). These results suggest an inhibitory role of miR-487b- 3p in human cardiomyocyte proliferation.

[0141] In conclusion, Applicant has identified candidate cell-free miRNAs in the maternal blood of pregnant women for detection of single ventricle heart defects in developing fetuses. Applicant leveraged patient-specific iPSCs to validate their elevated presence in the secretome of proliferating cardiomyocytes and elucidate their roles in modulating human cardiomyocyte proliferation. These cell-free miRNAs can serve as early noninvasive biomarkers to predict single ventricle heart defects in developing fetuses during gestation.

[0142] Exemplary miRNA Sequences

[0143] miR-487b-3p: AAUCGUACAGGGUCAUCCACUU (SEQ ID NO: 1)

[0144] miR-433-3p: AUCAUGAUGGGCIICCUCGGT JGU (SEQ ID NO: 2)

[0145] miR-134-5p: UGUGACUGGUUGACCAGAGGGG (SEQ ID NO: 3)

[0146] miR-889-3p: UUAAUAUCGGACAACCAUUGU (SEQ ID NO: 4)Equivalents

[0147] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs.

[0148] The present technology illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising,” “including,” “containing,” etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the present technology claimed.

[0149] Thus, it should be understood that the materials, methods, and examples provided here are representative of preferred aspects, are exemplary, and are not intended as limitations on the scope of the present technology.

[0150] It should be understood that although the present invention has been specifically disclosed by certain aspects, embodiments, and optional features, modification, improvement and variation of such aspects, embodiments, and optional features can be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this disclosure.

[0151] The present technology has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the present technology. This includes the generic description of the present technology with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0152] In addition, where features or aspects of the present technology are described in terms of Markush groups, those skilled in the art will recognize that the present technology is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0153] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each wereincorporated by reference individually. In case of conflict, the present specification, including definitions, will control.

[0154] Other aspects are set forth within the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method for treating single ventricle heart defect in a fetus in need thereof comprising administering to the mother of the fetus a treatment comprising open heart surgery, or the administration of an miRNA mimic inhibitor against the one or more elevated miR-433-3p, miR-134-5p, mi-R-889-3p and / or miR-487b-3p when a biological sample from the mother of the fetus comprising miRNA has an elevated expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, mi-R-889-3p, and / or miR- 487b-3p.

2. A method for treating single ventricle heart defect in a fetus comprising: measuring the expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, mi-R-889-3p, or miR-487b-3p in a biological sample from the pregnant mother of a fetus comprising cell-free miRNA; detecting single ventricle heart defect in the fetus when the expression level of at least one miRNA is elevated as compared to a reference value; and administering to the fetus a treatment comprising an open heart surgery or a miRNA mimic inhibitor against the one or more elevated miR-433-3p, miR-134-5p, mi-R-889-3p, and / or miR-487b-3p.

3. The method of claim 1 or 2, wherein the open heart surgery comprises the Norwood procedure, the Glenn procedure, the Fontan procedure, and / or the Hybrid procedure or a combination thereof.

4. The method of any one of claims 1-2, wherein the reference value is derived from the expression level of at least one miRNA in a group of pregnant women carrying healthy fetuses.

5. The method of any one of claims 1-4, wherein the single ventricle heart defect is hypoplastic left heart syndrome (HLHS) or hypoplastic right heart syndrome (HRHS).

6. The method of any one of claims 1-5, wherein the measuring comprises a method selected from miRNA-seq, RT-PCR, hybridization, cycling probe reaction, polymerase chain reaction, nested polymerase chain reaction, or ligase chain reaction.

7. The method of any one of claims 1-6, wherein the fetus is at least in the second trimester of development.

8. The method of any one of claims 1-7, wherein the biological sample comprises enriched miRNA selected from miR-433-3p, miR-134-5p, mi-R-889-3p, and / or miR-487b- 3p.

9. The method of claim 8, the at least one miRNA is enriched comprising a method selected from a capture probe or size fractionation.

10. The method of any one of claims 1-9, wherein the biological sample is selected from a plasma sample, a blood sample, a saliva sample, an amniotic fluid sample, a cystic fluid sample, a spinal fluid sample, a brain fluid sample, a urine sample, a sweat sample, or a tear sample.

11. A method for detecting single ventricle heart defect in a fetus comprising: measuring the expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, mi-R-889-3p or miR-487b-3p in a biological sample from a pregnant mother of the fetus comprising cell-free miRNA; and detecting single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to a reference value.

12. The method of claim 11, further comprising not detecting single ventricle heart defect in utero when the expression level of the at least one miRNA is not elevated when compared to the reference value.

13. A method for diagnosing the risk for single ventricle heart defect in a fetus in utero comprising: measuring the expression level of at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, mi-R-889-3p, or miR-487b-3p in a biological sample form a pregnant mother of the fetus comprising cell-free miRNA; comparing the expression level of at least one miRNA to a reference value; and diagnosing that the fetus has or at a higher risk for single ventricle heart defect when the expression level of the at least one miRNA is elevated as compared to the reference value.

14. The method of claim 13, further comprising diagnosing that the fetus is not at high risk for single ventricle heart defect when the expression level of the at least one miRNA is not elevated when compared to the reference value.

15. The method of any one of claims 1-14, wherein the reference value is derived from the expression level of at least one miRNA in a group of pregnant women carrying healthy fetuses.

16. The method of any one of claims 1-15, wherein the single ventricle heart defect is hypoplastic left heart syndrome (HLHS) or hypoplastic right heart syndrome (HRHS).

17. The method of any one of claims 1-16, wherein the measuring comprises a method selected from miRNA-seq, RT-PCR, hybridization, cycling probe reaction, polymerase chain reaction, nested polymerase chain reaction, or ligase chain reaction.

18. The method of any one of claims 11-17, wherein the fetus is at least in the second trimester of development.

19. The method of any one of claims 11-18, wherein the biological sample comprises enriched miRNA selected from miR-433-3p, miR-134-5p, mi-R-889-3p, and / or miR-487b- 3p.

20. The method of claim 19, the at least one miRNA is enriched comprising a method selected from a capture probe or size fractionation.

21. The method of any one of claims 11-20, wherein the biological sample is selected from a plasma sample, a blood sample, a saliva sample, an amniotic fluid sample, a cystic fluid sample, a spinal fluid sample, a brain fluid sample, a urine sample, a sweat sample, or a tear sample.

22. A kit comprising oligonucleotides for detecting at least one microRNA (miRNA) selected from miR-433-3p, miR-134-5p, mi-R-889-3p, and / or miR-487b-3p; and instructions for use.

23. A system for analyzing cell-free miRNA (cf-miRNA) to detect the risk of single ventricle heart defect in a fetus, the system comprising one or more processors configured to:(a) retrieve sequence reads cf-miRNA fragments obtained from a biological sample from a pregnant woman;(b) determine sequence reads that correspond to at least one cf-miRNA selected from miR-433-3p, miR-134-5p, mi-R-889-3p, or miR-487b-3p;(c) determine the expression level of at least one of miR-433-3p, miR-134-5p, mi-R- 889-3p, or miR-487b-3p;(d) compare the expression level to a reference value; and(e) detect a high risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is elevated as compared to the reference value.

24. The system of claim 23, further comprising: (f) detect a low risk of single ventricle heart defect in the fetus when the expression level of the at least one miRNA is not elevated as compared to the reference expression level.

25. The system of claim 24, further comprising recommending a treatment when a high risk of single ventricle heart defect in the fetus is detected.

26. The system of claim 25, wherein the treatment comprises an open heart surgery or a miRNA mimic inhibitor against miR-433-3p, miR-134-5p, mi-R-889-3p, and / or miR-487b- 3p.

27. The system of claim 26, wherein the open heart surgery comprises the Norwood procedure, the Glenn procedure, the Fontan procedure, and / or the Hybrid procedure or a combination thereof.

28. The system of any one of claims 23-27, wherein the reference value is derived from the expression level of at least one miRNA in a group of pregnant women carrying healthy fetuses.

29. The system of any one of claims 23-28, wherein the single ventricle heart defect is hypoplastic left heart syndrome (HLHS) or hypoplastic right heart syndrome (HRHS).

30. The system of any one of claims 23-29, wherein the determining the expression level comprises a method selected from miRNA-seq, RT-PCR, hybridization, cycling probe reaction, polymerase chain reaction, nested polymerase chain reaction, or ligase chain reaction.

31. The system of any one of claims 23-30, wherein the fetus is at least in the second trimester of development.

32. The system of any one of claims 23-31, wherein the biological sample comprises enriched miRNA selected from miR-433-3p, miR-134-5p, mi-R-889-3p, and / or miR-487b- 3p.

33. The system of claim 32, the at least one miRNA is enriched comprising a method selected from a capture probe or size fractionation.

34. The system of any one of claims 23-33, wherein the biological sample is selected from a plasma sample, a blood sample, a saliva sample, an amniotic fluid sample, a cystic fluid sample, a spinal fluid sample, a brain fluid sample, a urine sample, a sweat sample, or a tear sample.

Images