Genetically modified bacteria for multi-modal secretion of a neoantigen

EP4761753A2Pending Publication Date: 2026-06-24BACCINE LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024772411
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-21
Filing Date
2024-08-19
Publication Date
2026-06-24

AI Technical Summary

Technical Problem

Current cancer immunotherapy approaches face challenges in effectively targeting and treating tumors, particularly in individuals who are refractory to conventional treatments, due to cancer cells' ability to evade the immune system and dampen immune responses.

Method used

Genetically modified Gram-negative bacteria are engineered to express and export cancer-associated antigens using multiple secretion systems, including Type III and Type V secretion pathways, to enhance immune activation and tumor-specific antigen presentation.

Benefits of technology

This approach leads to improved antitumor effects, reduced systemic side effects, and enhanced colonization of tumors by the bacteria, resulting in increased immune activation and specific targeting of cancer cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000055_0000
    Figure 00000055_0000
  • Figure 00000055_0001
    Figure 00000055_0001
  • Figure 00000055_0002
    Figure 00000055_0002
Patent Text Reader

Abstract

A vaccine and methods of treatment thereof, wherein the vaccine comprises a recombinant Gram-negative bacteria genetically modified to express a first antigen fusion peptide comprising a neoantigen or series thereof, said neoantigen or series thereof associated with a first secretion signal from a double membrane-spanning secretion system and a second antigen fusion peptide comprising a homologous neoantigen or series thereof, associated with a second secretion signal from an outer membrane-spanning secretion system. The Gram-negative bacteria may be further modified for quadmodal transport. Specifically, the fusion peptides include signal peptides are each associated with a Type III (T3SS) and a Type V (T5SS) secretion system.
Need to check novelty before this filing date? Find Prior Art

Description

GENETICALLY MODIFIED BACTERIA FOR MULTI-MODALSECRETION OF A NEOANTIGENRELATED APPLICATIONS

[0001] The instant application claims priority to U.S. Provisional Application No. 63 / 533,275 filed Aug. 17, 2023, and U.S. Provisional Application No. 63 / 556,139 filed Feb. 21 , 2024, the entire contents of each of which are expressly incorporated by reference herein in their entireties.FIELD OF THE INVENTION

[0002] The present invention relates to recombinant bacteria genetically modified to express and export cancer-associated antigens, related vaccines, and methods of treatment thereof.BACKGROUND OF THE INVENTION

[0003] Certain tumors are challenging to treat based on conventional methods. Tumors have been known to employ advanced mechanisms for evading host immune responses such as downregulating antigen presentation on MHC class I molecules or expressing suppressive molecules to resist cytotoxic T Lymphocyte recognition and attack.

[0004] One of the most promising therapeutic strategies is that of immunotherapy which is directed at boosting, improving and restoring immune system function in order to fight cancer. Whilst immunotherapies are successful to a degree, there remains substantial challenges to overcome. One of the leading challenges is that a large proportion of individuals remain refractory to immunotherapy, apparently due to the ability of cancer cells to ‘hide’ from the immune system as well as the challenge of cancer cells having the ability to dampen the response of the immune system. Thus, there is a significant need for methods that can improve the efficacy of immunotherapy treatments in individuals who otherwise would be refractory to said treatment.

[0005] In vivo therapeutic cancer vaccine strategies based on bacterial vectors that directly deliver antigens, have been developed in academic laboratories. A bacteria may be genetically modified to express and secrete a disease antigen. USPatent No. 8,357,373 relates to methods for stimulating an immune response using an antigen delivery system based on avirulent Salmonella typhimurium which employs a SopE Type III secretion signal to deliver the full-length cancer testis antigen, NY-ESO-1 upon oral administration of the bacteria. US Patent No. 7,842,289 discloses Gram-positive Listeria to treat cancer by presentation on the cell wall or alternatively, by secretion of cancer-associated antigens. P.C.T. Application No. PCT / US2021 / 065011 discloses commensal bacterium delivered by a topical, enteral, parenteral and inhalation route, wherein the bacteria are genetically modified to have either an outer cell wall display signal such as a sortase-derived signal sequence peptide and / or a single step secretion signal such as a Sec or Tat signal sequence. US Patent No. 8,669,091 discloses a bacterium modified to include a fusion protein having an antigenic component, a toxin module and either of an outer surface display signal or a secretion signal.

[0006] Systemic administration of recombinant bacteria can serve as a targeting and tumor-local delivery vehicle - colonizing to the tumor site and delivering therapeutic, as well as an adjuvant, stimulating the immune system. Adjuvant are known to nonspecifically prime the immune system.

[0007] However, little is known about the optimum balance between nonspecific priming of the immune system and systemic clearance of bacteria. Especially in the case of cancer subjects being administered pathogenic bacteria, many recombinant bacteria in development are dramatically attenuated with respect to Pathogen- associated molecular patterns (PAMP) like LPS, flagellin, and peptidoglycan, in order to minimize risk of systemic toxicity. Thus, although cancer vaccines have been in development for decades, new approaches for optimizing effects of cancer vaccines on tumors are desired.SUMMARY OF THE INVENTION

[0008] The invention is based, at least in part, on the discovery that the various export and presentation pathways employed by Gram-negative bacteria during export of non-native antigens in the context of a host circulatory system, differentially upregulate specific pathways of the host immune system, increase the rate of bacterial clearance from the host circulatory system, enhance extent of colonization of a tumor and enhance an anti-tumor effect in cancer mouse models.

[0009] The inventors have discovered that duplicate secretion by distinct bacterial secretion systems of homologous neoantigens or concatemers thereof result in a preferred immune system related profile and circulatory bacterial load clearance profile, which is expected to result in more limited systemic side effects. The inventors have discovered that presenting a tumor-specific antigen to the immune system within a host circulatory system by displaying the tumor-specific antigen on the bacterial cell surface and / or by secretion from a bacteria using the Type II or Type III secretion systems is less effective than employing a double membrane- spanning secretion system as well as an outer membrane spanning secretion system, and specifically a Type III and a Type V secretion pathway. The enhanced systemic clearance is directly related to the reduced total weight loss, reduced splenomagaly and faster recovery time compared with a neoantigen associated with a single secretion system or duplicate secretion by Type II secretion system and a surface display (OmpA) signal. Genetically modifying Gram-negative bacteria to export a tumor-specific antigen by two or more distinct secretion systems in a bacteria, and specifically using at least the double membrane-spanning secretion system as well as the outer membrane-spanning secretion system, increases the antitumor effect in a cancer model, reduces percent weight loss of the host after systemic administration of the bacteria, reduces in bacterial load in blood, and upregulates tumor-local Gamma delta cells and tumor specific CD8+ at the tumor.

[0010] Further advantages were observed in treatment of cancer when displaying a tumor-specific antigen by employing a quadruple transport strategy, that is employing the outer cell membrane display system as well as secretion using the double membrane-spanning secretion system (for example, Type III), the outer membrane-spanning secretion system (for example, Type V) and an inner membrane spanning system (Type II). More specifically, genetically modifying the bacteria with multiple copies of polynucleotides encoding a non-native peptide (e.g. neoantigen belonging to a host tumor) and further associating the multiple copies with multiple transport signals to direct transport to surface display as well as the Type II, Type III and Type V secretion systems, was found to be advantageous. Effects include improved antitumor effect, reduction in percent weight loss of host after systemic administration of the bacteria, reduction in extent of splenomegaly, reduction in bacterial load in blood, and enhanced tumor local antigen-specific CD8+ T cells.These effects were present even with simultaneous and constitutive expression of these non-native fusion peptides.

[0011] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0012] Thus, is a first aspect, there is provided a vaccine comprising a recombinant Gram-negative bacteria genetically modified to express two or more distinct fusion peptides comprising: a first antigen fusion peptide comprising a cancer associated antigen or series thereof, said antigen or series thereof associated with a first secretion signal from a double membrane-spanning secretion system; and a second antigen fusion peptide comprising the cancer associated antigen or series thereof, associated with a second secretion signal from an outer membrane- spanning secretion system.

[0013] In some embodiments, the cancer associated antigen is a neoantigen. In some embodiments, the double membrane-spanning secretion system is a Type III secretion system and the outer membrane-spanning secretion system is a Type V secretion system. In preferred embodiments, cancer associated antigen is a neoantigen, the double membrane- spanning secretion system is a Type III secretion system and the outer membrane- spanning secretion system is a Type V secretion system. In some embodiments, the neoantigen is matched to a tumor of a host subject. In other embodiments, the matched neoantigen forms part of a series which further includes a non-specific tumor antigen. In further embodiments, the neoantigen comprises a cancer driver mutation.

[0014] In some embodiments, the recombinant Gram-negative bacteria is a pathogenic bacteria and / or recognized by host pattern recognition receptors.

[0015] In some embodiments, the vaccine is a composition comprising the recombinant Gram-negative bacteria and pharmaceutically acceptable excipients for injection.

[0016] In accordance with other embodiments, the recombinant Gram-negative bacteria is genetically modified to express a third antigen fusion peptide comprisingthe cancer associated antigen or series thereof, said antigen associated with a third transport signal from a distinct transport system selected from a list consisting of a Type I secretion system, a Type IV secretion system and an outer membrane display system. In accordance with yet further embodiments, the recombinant Gramnegative bacteria is genetically modified to express a fourth antigen fusion peptide comprising the cancer associated antigen or series thereof, said antigen associated with a fourth transport signal from a distinct transport system, said transport system selected from a list consisting of: a Sec or Tat pathway associated with a Type II secretion system, Type I secretion signal, Type IV secretion signal and a cell wall display system. In accordance with a preferred embodiment, the distinct transport systems are each of a cell wall display system, a Type II secretion system, a type III secretion system and a Type V secretion system.

[0017] In some embodiments, one or more prokaryotic expression cassettes encode the distinct fusion peptides and are operably linked to a constitutive prokaryotic promoter.

[0018] In accordance with additional embodiments, the recombinant Gramnegative bacteria is further genetically modified to reduce virulence, reduce toxicity, reduce pathogenicity, increase tumor-colonization, and / or decrease antibiotic resistance. For example, the recombinant Gram-negative bacteria may be genetically modified to include a null mutation of three of the following: stm3120, aadA, adl and aac6 as disclosed in PCT / IL2023 / 050876.

[0019] In accordance with additional embodiments, the recombinant bacteria is genetically modified to express an immunomodulator peptide having a direct or indirect inducible expression, including an exogenously induced expression.

[0020] In accordance with other embodiments, a single bacterial population coexpresses the first and second and optionally the third and fourth fusion peptides.

[0021] In another aspect, there is provided, a method of treating cancer in a subject in need thereof comprising: systemically administering to a subject with cancer a vaccine according to any one or more aspects or embodiments .

[0022] In accordance with other embodiments, the vaccine further comprises an additional microbial strain being a commensal bacterium.

[0023] In another aspect, there is provided, a method of treating cancer in a subject in need thereof comprising: systemically administering to a subject with cancer a vaccine comprising Gram negative bacteria, genetically modified to direct multiple modes of secretion of a cancer associated antigen or series thereof, wherein the multiple modes of secretion include a double membrane-spanning secretion system and an outer membrane-spanning secretion system. In some embodiments, upon systemic clearance or / and specific colonization of a tumor and / or an enhanced immune related activity, the method further comprises providing a second therapy to the tumor.

[0024] In accordance with some embodiments, systemic administration is by parenteral administration.

[0025] In accordance with some embodiments, the second therapy is selected from a therapeutic, radiation, chemotherapy, bacterial strain or surgical removal of a tumor.

[0026] In accordance with some embodiments, the therapeutic is an immunomodulator, such as a checkpoint inhibitor, administered to the patient or engineered into a bacteria for tumor local expression.

[0027] In accordance with some embodiments, the bacterial strain is a commensal bacterium.

[0028] In accordance with some embodiments, the second therapy is coadministered.

[0029] In accordance with some embodiments, the Gram negative bacteria is genetically modified to provide a transient presence in the circulatory system and extended colonization of a tumor in a subject for a period of at least 20 days.

[0030] In accordance with some embodiments, Gram negative bacteria is genetically modified to result in reduced bacteremia in a host. The reduced bacteremia for 90% of mice is less than 50 colony forming units / gram in blood, less than 40 CFU / gram / mL or less than 20 CFU / gram / mL

[0031] In accordance with some embodiments, the multiple modes of transport comprise of a Type III and a Type V secretion system.

[0032] In accordance with some embodiments, systemically administering to a subject with cancer results in an enhanced immune related activity comprising upregulating Gamma Delta T-Cells in a host.

[0033] In accordance with some embodiments, the second therapy is a checkpoint inhibitor and an enhanced an immune related activity comprises upregulation of antigen-specific T-cells at a tumor, metastasis, a tumor draining lymph node or spleen thereof compared to a response to a or bacteria which does not express a neoantigen.

[0034] In accordance with some embodiments, systemically administering the vaccine to the host results in selective colonization of a tumor by the live Gram negative bacteria in mice by a 100 fold or more enrichment of bacterial load on day 9 relative to a dose at administration.

[0035] In accordance with some embodiments, systemically administering to the subject results in generation of antigen specific T-cells localized at the tumor, a metastasis, a tumor draining lymph node or spleen thereof. The antigen-specific T- cells may be antigen-specific or neoantigen-specific CD8 T-cells.

[0036] In accordance with some embodiments, the cancer is selected from the list consisting of: colorectal cancer, pancreatic cancer, lung cancer (squamous lung, and lung adenocarcinoma), ovarian cancer, mesothelioma, glioblastoma, gastric cancer, hepatocellular cancer, renal cell cancer, prostate cancer, cervical cancer, breast cancer, pancreatic cancer, bladder cancer, cervical cancer, bone cancer and melanoma. In accordance with some embodiments, the cancer type is metastatic cancer.

[0037] In a further aspect, there is provided, a method of upregulating Gamma Delta T-Cells in a host comprising systemically administering a recombinant Gramnegative bacteria genetically modified to express two or more distinct fusion peptides comprising: a first antigen fusion peptide comprising a cancer associated antigen, (such as a neoantigen) or series thereof, said antigen associated with a first secretion signal from a double membrane- spanning secretion system; and a second antigen fusion peptide comprising the cancer associated antigen, (such as a neoantigen), or series thereof, associated with a second secretion signal from an outer membranespanning secretion system. In preferred embodiments, the double membrane-spanning secretion system is a Type III secretion system; and the outer membranespanning secretion system is a Type V secretion system.BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Some embodiments of the invention are herein described by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

[0039] FIG. 1 depicts a schematic illustration of the recombinant bacteria of the present invention at the time of administration and upon tumor homing.

[0040] FIGs. 2A and 2B depicts a graph and bar graph showing the effects of attenuation of Salmonella Typhimurium STM3120 via deletion of antibiotic resistance or infectivity associated genes on relative mouse weight and humor homing capacity.

[0041] FIGs. 3A, 3B and 3C depict a schematic view of the location and details relating to the multiple insertions of the neoantigen cassettes of some of the embodiments of the present invention. In some cases, the description relates to fewer component than depicted, in which case, an identical schematic minus the component can be envisioned.

[0042] FIG. 3D depicts further details relating to specific insertions, and specifically to the distinct fusion peptides according to embodiments of the present invention.

[0043] FIG. 3E depicts the amino acid sequences of exemplary antigens and transport signal sequences according to the standard one letter code established by the International Union of Pure and Applied Chemistry (IUPAC), according to embodiments of the present invention.

[0044] FIG. 4A show Western blot analysis of bacteria genetically modified for expression and multimodal transport of neoantigen cassettes.

[0045] FIG. 5A depicts a violin plot of the immune mediated anti-tumor effect that is obtained when bacteria express and secrete a tumor-specific neoantigen by multiple secretion systems on Day 17.RECTIFIED SHEET (RULE 91) ISA / EP

[0046] FIG. 5B depicts a bar graph of the percentage of ADPGK specific CD8 T cells out of CD45+ cells resulting from exposure to bacteria genetically modified to have multi-modal transport of the ADPGK neoantigen.

[0047] FIG. 5C depicts a graph showing weight loss relative to day 0 (% weight loss) after administration of bacteria according to some of the embodiments, from day 0 to day 8 in an MC38 mice model.

[0048] FIGs. 6A ,6B, and 6E depict a bar graph showing that mice treated with a bacteria genetically modified to express a tumor-related neoantigen (AG) transported by four distinct transport modes had reduced splenomegaly in MC38 and B16-OVA models compared with bacteria which does not express neoantigen expression and compared to bacteria genetically modified to express a tumor-related neoantigen (AG) transported by one or two distinct transport modes in MC38 mice models.

[0049] FIGs. 6C and 6D depict a graph of weight loss relative to day 0 after bacteria administration from day 0 day 10.

[0050] FIGs. 7 depicts a bar graph showing the bacterial load in tumors, systemic organs and blood at day 9 following injection of bacteria to MC38 tumor bearing mice. Data shows that bacteria expressing neoantigens with all 4 presentation modes or with a combination of type III and type V secretion mode have an improved clearance profile from systemic organs and blood.

[0051] FIG. 8 depicts bar graphs showing immune cell profiles in tumors and spleens at days 9-10 following injection of bacteria presenting neoantigen with 1 specific presentation mode, a combination of 2 presentation modes or all 4 presentation modes. FIG. 8A shows that highest levels of neoantigen specific CD8 T-cells are induced following the injection of bacteria expressing the neoantigen with all 4 modes of presentation. FIGs. 8B and 8C show the levels of exhausted CD8 (B) and CD4 (C) in spleens following the injection of bacteria with neoantigen expression presented in one mode, 2 modes or all 4. FIG. 8D shows high levels of neoantigen specific CD8 T-cells in spleens mediated by the presentation of the neoantigen with type III secretion system. FIG. 8E shows induced levels of gamma delta T cells in tumors that is mediated by the combined presentation of the neoantigen with type III and type V secretion.RECTIFIED SHEET (RULE 91) ISA / EP

[0052] The present invention, in some embodiments thereof, relates to vaccines, genetically modified bacteria, and methods of treatment using genetically modified bacteria for multi-modal transport of heterologous antigens and more specifically cancer-associated antigens.

[0053] In Gram-negative bacteria, secretion machineries may span an outer membrane, a periplasm membrane, an inner membrane or all of the inner, periplasm membranes and outer membranes.

[0054] As used herein, Type II secretion system may be referred to as T2SS. Type III secretion system may be referred to as T3SS and so forth.

[0055] Referring to FIG. 3D, 310 is the intracellular space of a bacteria, while 311 is the periplasm and 312 is outside the bacterial call. Double membrane-spanning secretion systems which span the inner and outer membranes as depicted in FIG. 3D, 303 include, but are not limited to, a type I secretion system (T1 SS), a type III secretion system (T3SS), a type IV secretion system (T4SS), a type VI secretion system (T6SS), and a resistance-nodulation-division (RND) family of multi-drug efflux pumps (Costa et al., 2015), incorporated herein by reference. Double membrane-spanning secretion systems generally transport peptides from the bacterial cytoplasm directly into the extracellular space or into the target cell.

[0056] In contrast, some secretion systems, such as T2SS (see FIG. 3D, 302), T5SS, T8SS, and T9SS employ a two-step pathway to first transfer proteins through the inner membrane, using the Sec system and the TAT system, which spans the inner membrane such that peptides are translocated into the periplasm by inner membrane-spanning transporters. Subsequently, they may transport via the outer membrane.

[0057] Outer membrane-spanning secretion systems include, but are not limited to, a type V autotransporter secretion system (T5SS), a curli secretion system, and a chaperone-usher pathway for pili assembly (Costa et al., 2015), as depicted in FIG. 3D, 304. In the case of the type V secretion pathway, the N-terminal signal peptide is recognized by and binds to the Sec molecules on the inner membrane of the cell, and is transported to the periplasm where the N-terminal signal peptide is recognized and cleaved by signal peptidases in the periplasm and subsequently, transported to a Bam complex to export via the outer membrane into the extracellular space. It isreported that type V secretion system indirectly inhibits the function of some of the double membrane- spanning secretion systems. (Luo, Y, 2023)

[0058] The inventors have discovered that attenuated bacteria, such as tumorhoming bacteria, which have been genetically modified for multi-modal secretion of cancer-associated antigens, such as a neoantigens, and specifically by at least bimodal secretion by a double membrane- spanning secretion system (e.g., T3SS) as well as an outer membrane- spanning secretion system (e.g., T5SS) may provide value in the general area of cancer treatment. The inventors have further discovered that quadmodal transport have additional advantages in pathogenic bacteria. As will be shown, attenuated pathogenic bacteria genetically modified for example, by chromosomal integration or plasmid modification to encode neoantigen fusion peptides, each encoded by homologous polynucleotide sequences encoding a neoantigen or series thereof and further linked to distinct transport signals, may provide significant value in reducing tumor growth, immune system activation and / or systemic clearance.

[0059] In addition, the inventors have discovered a method of systemic clearance or / and specific colonization of tumor and / or an enhanced immune related activity and / or tumor reduction by parenteral administration, and especially systemic exposure of an injectable form of the genetically modified bacteria which are modified to transport heterologous cancer-associated antigens such as neoantigens via multiple and distinct prokaryotic transport systems, and at least specifically by bimodal secretion or quadmodal transport mentioned above.

[0060] Further, the inventors have discovered a treatment for treating cancer by administering attenuated pathogenic bacteria genetically modified as described above.

[0061] Before disclosing specific embodiments of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0062] An exemplary embodiment is illustrated in example, FIG. 1A and 1 B, which depicts a schematic illustration of a recombinant tumor-homing bacteria of an embodiment of the present invention. An attenuated form of a pathogenic species ofbacteria, genetically modified to express a cancer antigen cassette (e.g., neoantigen cassette) and deliver the neoantigen fusion peptide outside of the bacterial cell whether cell wall anchored (i.e., surface display) or secreted by multiple methods including for example multiple secretion pathways which are typically employed by a Gram-Negative bacterium to delivery prokaryotic peptides. In FIG. 1A, depicting a preferred embodiment, wherein the recombinant bacteria 101 , at the time of administration to a subject, constitutively expresses the neoantigen cassettes. In one embodiments, the neoantigen or series thereof is expressed and transported to the outer membrane of the cell wall 105 for example, by means of incorporation within the amnio acid sequence of an outer cell membrane. A homologous neoantigen or series thereof is also secreted 108 by means of the Type 111 secretion system typically secreted into a target cell and / or the Type V secretion system, typically secreted out of the bacteria. After administration, and after a period of time to allow for tumor homing, the neoantigens or series thereof continue with display on the outer membrane of the cell and / or multi-modal secretion, and delivery local to the tumor.

[0063] Thus, in a first aspect, the recombinant bacteria are genetically modified for multi-modal transport of heterologous or non-native peptides (e.g., cancer associated antigens including those disclosed in PCT / IL2023 / 050876 or specifically neoantigens) which are capable of inducing an antigen-specific immune response in a subject. In some embodiments, the peptides are cancer-associated antigens such as neoantigens. In some embodiments, attenuated pathogenic bacteria are genetically modified to express multiple homologous neoantigen peptides each linked to a transport signal from a distinct transport system.

[0064] It will be appreciated that the terms, genetically modified, genetically engineered and recombinant are generally used herein interchangeably, unless otherwise apparent.

[0065] The genetically modified bacteria of the present invention may serve any one or more of the following roles: 1 ) as an adjuvant, non-specifically stimulating the immune system 2) as tumor-specific stimulant for immune system activation during a systemic boosting phase and 3) optionally as a targeting vehicle - homing to the tumor site to deliver an immunomodulating payloads.

[0066] It will also be appreciated that the terms, tumor associated antigen and cancer associated antigen are generally used herein interchangeably, unless otherwise apparent. In addition, although cancer associated or tumor antigens are mentioned throughout this application, they may be replaced with an antigen to an alternative disease or condition in the subject such as an autoimmune disease or infection with a similar effect. Thus, in some embodiments of the present invention a first antigen fusion peptide comprising a disease-specific antigen or series thereof, associated with a first secretion signal from a Type III secretion system; and a second antigen fusion peptide comprising a homologous disease-specific antigen or series thereof, associated with a second secretion signal from a Type V secretion system.

[0067] In order that the disclosure may be more readily understood, the following terms used through the application will be first defined. These definitions should be read in the context of the disclosure and understood by a person of ordinary skill in the art. Additional definitions may be dispersed throughout the detailed description.Multi-Modal Transport

[0068] Multi-modal transport generally refers to multiple bacterial transport mechanisms used to transport a peptide from inside the bacterium. Although multiple pathways exist, they each aim for the similar goal of export from the intracellular environment of the bacteria. Each secretion pathway is tied to the Gram-negative duplicate membrane structure and can be distinguished from Gram positive bacteria.

[0069] Various methods of transport in Gram negative bacteria include cell surface presentation, or multiple pathways for secretion such as the Type III secretion system. The terms “signal peptide", “transport signal” and "signal sequence" may be used interchangeably. As used herein, unless otherwise specified and depending on the context, a signal sequence may be an amino acid sequence or the nucleotide sequence encoding the amino acid sequence, depending on context, which encodes the signal peptide. The sequence can be linked to nucleic acid sequence, protein or peptide set forth herein.

[0070] It will be readily understood by those skilled in the art and it is intended here, that when reference is made to particular signal sequence listings, such reference includes sequences which substantially correspond to its complementary sequence and those described including allowances for minor sequencing errors,single base changes, deletions, substitutions and the like, such that any such sequence variation corresponds to the nucleic acid sequence of the signal peptide or other peptide / protein to which the relevant sequence listing relates.

[0071] Signal peptides belong to the different transport systems and direct delivery intracellularly and / or on the bacterial surface (i.e., genetic surface display). Signal peptides typically direct localization of a protein such that it is secreted from, or positioned on, the outer membrane of the bacteria. For example, a signal peptide may direct localization of a protein such that it is positioned on the outer membrane by facilitating surface display of the protein or peptide on the external membrane of the bacteria. In addition to surface positioning, the signal peptides used herein may facilitate secretion of the protein from the cell in which it is produced. Signal peptides sequences may be cleaved from the remainder of the peptide, often referred to as the mature peptide, upon secretion from the cell however, in some cases, there is no protease cleavage site between the transport signal and the neoantigen. Typically, the recombinant bacteria cell engineered to express the fusion peptide or protein linked to the secretion signal is a bacterium having a functional secretion system of that signal.

[0072] The terms “transport signal" may be linked at the amino terminus (i.e., C or N-terminus) of a protein or peptide, but may also be positioned in the center of the peptide, for example in the case of tethering to an external surface of an outer cell membrane protein. Transport signals typically direct localization of a peptide such that it is secreted from, or positioned on, the outer membrane of the bacteria by facilitating surface display of the peptide on the outer membrane of the bacteria. The transport signal used herein may facilitate secretion of the protein from the cell in which it is produced. In the context of the present invention, a transport signal may be categorized as belonging to a transport system selected from: surface display, Type II, Type III or Type V. The various transport systems refer to the specialized protein system, which directs the export of a protein, or alternatively, a surface display system. Type II and Type V secretion systems may alternatively be referred to as two-step secretion system, while the Type III secretion system may alternatively be referred to as a one-step secretion, typically secreted directly into a host cell. Transport signals sequences may be cleaved from the remainder of the peptide, upon secretion from the cell however, in some cases, there is no protease cleavagesite between the transport signal and the neoantigen. FIG 3D and 3E provide structure, function and amino acid sequences for some of the embodiments of the present invention.

[0073] Transport by way of bacterial display of a recombinantly produced cancer- associated antigen on its external surface (See FIG. 3D, 301 ) may be achieved using a bacterial surface display or surface display system. Examples of bacterial surface display systems include outer membrane protein systems (e.g., LamB, FhuA, Ompl, OmpA, OmpC, OmpT, eCPX derived from OmpX, OprF, and PgsA), surface appendage systems (e.g., F pillin, FimH, FimA, FliC, and FliD), lipoprotein systems (e.g., INP, Lpp-OmpA, PAL, Tat-dependent, and TraT), and virulence factor-based systems (e.g., AIDA-1 , EaeA, EstA, EspP, MSP1 a, and invasin). Exemplary surface display systems are described, for example, in van Bloois, E., 2011 , which is hereby incorporated by reference. In some embodiment of the present invention, the bacteria may be engineered to display a tumor-specific antigen on the external loop of an outer membrane protein A (OmpA).

[0074] Secretion signals associated with the bacterial type III secretion system are known by those skilled in the art and may include the Ssphl , Ssph2, MISSSSIS, MISSSSSI, SicP-SptP, SigE-SopB, invB-SopA, SptP, SipA, SipB, SipC, SipD, InvJ, SpaO, AvrA, and SopE proteins of Salmonella, the YopE, YopH, YopM and YpkA proteins of Yersinia spp., the Ipa proteins of Shigella, and the ExoS proteins of Pseudomonas aeruginosa and have been engineered as fusion proteins and peptides and are well recognized in the art. In some embodiments, the secretion signals of bacterial type III secretion systems are selected from sspH2, sspH1 , sigE- sopB and sipB. For example, of nucleotide sequences encoding signal sequences include those of the type 3 secretion system (e.g. MISSSSIS) sequence (DNA sequence: ATGATCAGCTCTAGTTCAATCAGC or the MISSSSSI sequence (DNA sequence: ATGATCAGCTCTAGTTCAAGCATC). In some embodiments, herein the neoantigen polynucleotide associated with a polynucleotide encoding a transport signal from a Type III system does not include a cleavage site or linker between the neoantigen polynucleotide and the polynucleotide encoding a transport signal.

[0075] Secretion signals associated with the type V secretion systems are known by those skilled in the art in include for example, the PET autotransporter. Type V may utilize an N-terminal Sec-dependent peptide tag (inner membrane) and C-terminal tag (outer-membrane). This system uses the Sec-system to get from the cytoplasm to the periplasm. The C-terminal tag then inserts into the outer membrane forming a pore of the beta-barrel structure ahead of the linker sequence through which the “passenger protein” threads through. Once across the outer membrane, the neoantigen or series thereof is released from the membrane-embedded C- terminal tag by either an autocatalytic, or a membrane-bound protease.

[0076] The Type II secretion system is a trans envelope machine, which may span both the inner and periplasm membrane of the bacterial cell envelope. Genetically modified bacteria may incorporate both a signal sequence for transfer of a peptide into the periplasmic space or out of the periplasm space. As used herein, the Type II secretion system is meant to relate only the system for transporting a peptide into the periplasm space such as the sec or tat pathway secretion portion associated with the type II secretion system such as PelB sequence, a pectate lyase B of Erwinia carotovora CE. Other relevant signals will be recognized by those skilled in the art. Some examples include the following signal sequences: pelB, ompA, PSP (Sec family), yebF, DsbA, STII, LamB signal peptide. The signal sequence consists of the 22 N-terminal amino acid residues which can be attached to any protein resulting in a transfer of such a fused protein to the periplasmic space. In some embodiments, a neoantigen polynucleotide associated with a Type II secretion signal is encoded by a single or series of neoantigens having more than 80 amino acids.

[0077] Secretion signals associated with the Type I and Type IV secretion system are known in the art and may also be employed in some embodiments of the present invention.

[0078] In some embodiments of the present invention, the tumor antigen or neoantigen polynucleotide is associated with a polynucleotide encoding a transport signal from a transport system. In this context, an antigen polynucleotide may be associated with a transport signal in one of a number of ways such as on a terminus end of the sequence. For the presentation of a neoantigen on a cell surface (i.e., external membrane), a neoantigen polynucleotide sequence may be incorporated within the coding sequence of an outer membrane protein (such as ompA) to generate an in-frame fusion protein resulting in a modified outer membrane protein with the addition of the neoepitope within an external loop of the protein. In this case, the transport signal is in fact the outer membrane protein which includes theembedded neoantigen. As will be recognized by those skilled in the art, the transport signals are typically in-frame with the neoantigen polynucleotide.

[0079] In some embodiments, the transport systems associated each copy of a specific antigen is specifically a Type III secretion system and a Type V secretion system. In other embodiments, the transport systems associated each copy of a specific antigen is specifically a Type III secretion system, a Type V secretion system, a Type II secretion system, and a surface-display system.

[0080] It will be readily understood by those skilled in the art and it is intended here, that when reference is made to particular signal sequence listings, such reference includes sequences which substantially correspond to its complementary sequence and those described including allowances for minor sequencing errors, single base changes, deletions, substitutions and the like, such that any such sequence variation corresponds to the nucleic acid sequence of the signal peptide or other peptide / protein to which the relevant sequence listing relates.Cancer-associated antigen

[0081] The term "heterologous” throughout refers to a peptide or protein of interest produced using bacteria that do not have an endogenous copy of the DNA enabling it to express the peptide or protein of interest. The bacteria have rather, been genetically altered by the introduction of the appropriate nucleic acid sequences whether by plasmic or chromosomal integration. The recombinant peptide or protein will not be found in association with peptides or proteins and other subcellular components normally associated with the cells producing the peptide or protein.

[0082] The term cancer-associated antigens are well known in the art and is a broad term referring to an antigenic substance (e.g. peptide) produced in tumor cells or in the tumor microenvironment which is capable of triggering an immune response in the host such as a cytotoxic T Lymphocyte response (e.g., CD8+ T cell and / or CD4 + T cell response) against a tumor cell. Tumor-specific antigens are a subset of tumor antigens that are exclusively expressed by tumor cells. They are typically short peptides corresponding to one or more antigenic determinants of a protein which is expressed (e.g., selectively) in a tumor cell, (also referred to as a tumor antigen). The cancer-associated antigen typically binds to a class I or II MHC receptor thus forming a ternary complex that can be recognized by a T-cell bearing a matching T-cellreceptor binding to the MHC / peptide complex with appropriate affinity. Peptides binding to MHC class I molecules are typically about 8-14 amino acids in length. T- cell epitopes that bind to MHC class II molecules are typically about 12-30 amino acids in length. In the case of peptides that bind to MHC class II molecules, the same peptide and corresponding T cell epitope may share a common core segment but differ in the overall length due to flanking sequences of differing lengths upstream of the amino-terminus of the core sequence and downstream of its carboxy terminus, respectively. A T-cell epitope may be classified as an antigen if it elicits an immune response.

[0083] In the context of the present invention, the cancer-associated antigen, tumor-specific antigens and the neoantigens refer to heterologous antigens, i.e. antigens which are not endogenous to the respective bacteria or antigens which are not expressed by the respective bacteria in nature but are genetically integrated into the bacteria by means of standard molecular biotechnological methods. In preferred embodiments of the present invention, the cancer-associated antigen is a heterologous peptide to the bacteria and the host cells but is native to the host cancer tumor cells.

[0084] Tumor-specific antigens including neoantigens, include a heterologous antigenic determinant that induces a cytotoxic T Lymphocyte response against a tumor cell. In the case to a neoantigen, the antigenic determinant is a neoepitope. An epitope is the specific part of an antigen that is recognized by the immune system. The determinant is typically a short peptide corresponding to one or more antigenic determinants of a protein which is expressed (e.g., selectively) in a tumor cell. In a particularly preferred embodiment of the present invention, the cancer-associated antigen is a neoantigen.Neoantigen

[0085] In some embodiments, the neoantigen or series thereof includes at least one neoantigen which is not a host tumor specific neoantigen.

[0086] In preferred embodiments, the neoantigen or series thereof includes at least one host tumor specific neoantigen. Determining a host tumor specific neoantigen is known in the art and may involve providing a tumor specimen from the subject and a non-tumor specimen from the same subject; identifying sequencedifferences between the genome, exome and / or transcriptome of the tumor specimen and the genome, exome and / or transcriptome of the non-tumor specimen; and engineering peptides or a polypeptide comprising epitopes incorporating the sequence differences identified.

[0087] As used herein the term "neoantigen" is an epitope that has at least one alteration that makes it distinct from the corresponding wildtype, parental antigen, e.g., via mutation in a tumor cell or post-translational modification specific to a tumor cell. The mutation is typically oncogenic and may have caused a loss or a gain of function of its original cellular functions. As used herein, a neoantigen can refer to a polypeptide sequence or a nucleotide sequence. A mutation can include a frameshift or non-frameshift deletion, missense or nonsense substitution, splice site alteration, genomic rearrangement or gene fusion, or any genomic or expression alteration giving rise to a neoORF.

[0088] In some embodiments, a neoantigen may be a mutant APC antigen being QATEAERSF. Examples of BRCA mutated epitopes are YIHTHTFYV and SQIWNLNPV. An examples of a universal HLA-DR-binding T helper synthetic epitope (AKFVAAWTLKAAA) is the pan DR-biding epitope (PADRE), which is a 13 amino acid peptide that activates CD4+ T cells. Another contemplated cancer- associated neoantigen is the GL261 neoantigen (mlmp3 D81 N, sequence AALLNKLYA).A neoantigen may have a heteroclitic epitope which is a slight modification leading to a stronger immune response. A neoantigen may alternatively have a cryptic or typically hidden epitope derived from the cancer-specific antigen.

[0089] The tumor-specific antigen typically binds to a class I or II MHC receptor thus forming a ternary complex that can be recognized by a T-cell bearing a matching T-cell receptor binding to the MHC / peptide complex with appropriate affinity. Peptides binding to MHC class I molecules are typically about 8-14 amino acids in length. T- cell epitopes that bind to MHC class II molecules are typically about 12-30 amino acids in length. In the case of peptides that bind to MHC class II molecules, the same peptide and corresponding T cell epitope may share a common core segment but differ in the overall length due to flanking sequences of differing lengths upstream of the amino-terminus of the core sequence and downstream of its carboxy terminus, respectively. A T-cell epitope may be classified as an antigen if it elicits an immune response. Examples are generally known from the literature and lists are referencedin U.S. Patent No. 8,669,091 and PCT / IL2023 / 050876, both incorporated by reference herewith in their entireties.

[0090] In various embodiments, each respective neoantigen polynucleotide or amino acid sequence (whether single or series) is associated with a single transport signal.

[0091] In a first aspect, there is provided, a vaccine comprising: a pharmaceutically acceptable carrier and live recombinant bacteria, genetically modified to express two or more distinct antigen fusion peptides. The distinct antigen fusion peptides include: a first antigen fusion peptide comprising an antigen or series thereof, associated with a first secretion signal from a first secretion system; and a second antigen fusion peptide comprising the antigen or series thereof, associated with a second secretion signal from a second secretion system, and wherein the first and second secretion systems are distinct. The secretion systems may be selected from the list of Type I secretion system, Type II secretion system, Type III secretion system, Type IV secretion system and Type V secretion system. Preferably, the secretion systems are selected from the list consisting of: Type III secretion system and a Type V secretion system. In some embodiments, the bacteria is a pathogenic type. In some embodiments, the bacteria is a commensal type. In some embodiments, the bacteria is gram-negative bacteria. In some embodiments, the bacteria is a single strain genetically modified to express both fusion peptides. In an alternative embodiment, the bacteria is multiple strain genetically modified to express both fusion peptides. In some embodiments, the bacteria is a tumor homing bacterium. In some embodiments, the antigen is tumor specific such as a neoantigen. In some embodiments, the first and second secretion systems are selected from a Type I secretion system, a Type II secretion system, a Type III secretion system and a Type V secretion system. In a preferred embodiment, the first and second secretion systems are selected from a Type III secretion system and a Type V secretion system.

[0092] In another aspect, there is provided a vaccine including: a pharmaceutically acceptable carrier and live recombinant Gram-negative bacteria genetically modified to express two or more distinct antigen fusion peptides comprising: a first antigen fusion peptide comprising a tumor-specific antigen or series thereof, associated with a first secretion signal from a Type III secretion system; and a second antigen fusionpeptide comprising the tumor-specific antigen or series thereof, associated with a second secretion signal from a Type V secretion system.

[0093] In some embodiments of this aspect, a third antigen fusion peptide is expressed. The third fusion peptide includes a homologous tumor-specific antigen or series thereof, associated with a third transport signal from a distinct transport system selected from a list consisting of Type I secretion system, Type IV secretion system and surface display system. In some preferred embodiments of this aspect, a fourth antigen fusion peptide is expressed. The fourth fusion peptide includes a homologous tumor-specific antigen or series thereof, associated with a fourth transport signal from a distinct transport system selected from a list consisting of Type I secretion signal, Type IV secretion signal and surface display system.

[0094] In another aspect, there is provided a vaccine including: a pharmaceutically acceptable carrier and live recombinant Gram-negative bacteria genetically modified to express four or more distinct antigen fusion peptides comprising: a first antigen fusion peptide comprising a tumor-specific antigen or series thereof, associated with a first transport signal from a Type III secretion system; a second antigen fusion peptide comprising a homologous tumor-specific antigen or series thereof, associated with a second transport signal from a Type V secretion system; a third antigen fusion peptide comprising a tumor-specific antigen or series thereof, associated with a third transport signal enabling the cancer- associated antigen to be expressed on the outer membrane protein of the protein (e.g. by incorporating it into an ompA protein, as described herein above); and a fourth antigen fusion peptide comprising a homologous tumor-specific antigen or series thereof, associated with a fourth transport signal from a Type II secretion system. In some embodiments, the antigen peptides are configured to be transported by multiple transport systems consisting of a Type III, Type V, Type II and outer membrane transport system.

[0095] As illustrated in FIG. 3A, 3B and 3C, the multiple insertions of homologous neoantigen cassettes are presented.Vaccines

[0096] In another aspect there is provided a composition comprising a pharmaceutically acceptable carrier and a Gram negative bacteria genetically modified to express a first neoantigen fusion peptide comprising a neoantigen orseries thereof, said antigen associated with a first secretion signal from a double membrane- spanning secretion system; and a second neoantigen fusion peptide comprising a homologous neoantigen or series thereof, associated with a second secretion signal from an outer membrane- spanning secretion system. The double membrane- spanning secretion system may be a Type III secretion system; and the outer membrane- spanning secretion system may be a Type V secretion system. In some embodiments, additional fusion peptides may comprise a homologous neoantigen or series thereof associated with a surface display system and a Sec pathway associated with a Type II secretion system. In this context, the Gramnegative bacteria may include a single bacterial population genetically modified to express two or more fusion peptides described herein, or multiple bacterial populations, each population genetically modified to express one or more of the fusion peptides described herein. For example, a first population may be genetically modified to include the first prokaryotic expression cassette, and a second population may include the second prokaryotic expression cassette. The prokaryotic expression cassettes may be in the form of a plasmid or as a chromosomally integrated sequence. Each prokaryotic expression cassette may encode the fusion peptides described herein.

[0097] In various embodiments, the bacteria is specifically live, meaning that it continue to express and secrete peptides as well as multiple.

[0098] Multiple bacterial populations may include a native commensal bacterium in addition to the recombinant Gram-negative bacteria.

[0099] Because the bacteria of the vaccine of the present invention may serve as an adjuvant, the use of additional adjuvant in the vaccine composition may be irrelevant. In one embodiment, the vaccine is devoid of adjuvant (other than the bacteria itself). In another embodiment, the vaccine includes an adjuvant additional to the bacteria. A number of adjuvants are available commercially from various sources and some are approved for human use. For example, Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.) or Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.), Amphigen (oil-in-water), Alhydrogel (aluminum hydroxide), or a mixture of Amphigen and Alhydrogel, Monophosphorylated lipid A (MPL).Genetically Modified Bacteria

[0100] The term "Gram-negative bacteria" are bacteria that do not retain the crystal violet dye in the Gram staining protocol. The bacteria (e.g., Gram negative bacteria) may be aerobic or anaerobic bacteria. In some embodiments, multiple Gram-negative bacteria strains express each of the distinct fusion peptides. In other embodiments, a single strain of Gram-negative bacteria has been genetically modified to co-express multiple fusion peptides. For example, the bacteria may be genetically modified to co-express the first and second fusion peptide. Alternatively the bacteria may be genetically modified to co-express the first, second, third and fourth fusion peptide In some embodiments, the bacteria is be genetically modified to a single prokaryotic expression cassette encoding the first and second fusion peptides.

[0101] In various embodiments of the present invention, recombinant Gramnegative bacteria is a tumor homing bacterium.

[0102] In various embodiments, the recombinant Gram-negative bacteria is a pathogenic bacterium before attenuation. The term “pathogenic bacteria” refer to bacteria not typically found in human natural microbiome on the skin, gastrointestinal tract, etc. Examples of pathogenic bacterium include, but are not limited to, Salmonella spp., Yersinia spp., Bordetella spp., Escherichia coli, Shigella spp., Burkholderia mallei, Burkholderia pseudomallei and Pseudomonas aeruginosa, Citrobacter, Klebsiella, Neisseria, and Pseudomonas.

[0103] In some embodiments, the pathogenic bacteria is recognized by host pattern recognition receptors. Pattern recognition receptors, refers to a host’s first defense against pathogenic agents like bacteria. There are currently over 10 identified members of this receptor family which include the Toll-like receptors. This family is part of a newly discovered family of receptors expressed by cells of the innate immune system, including macrophages, dendritic cells, and NK cells. The major role for these receptors is to cause cell activation and trigger antimicrobial defenses. In some embodiments, the Gram-negative bacteria express intact or slightly attenuated Pathogen-associated molecular patterns (PAMP) such as LPS, flagellin, and peptidoglycan which allows for recognition by host pattern recognition receptors leading to activation of the innate immune system. It is believed that thepathogenic nature and / or the activation of the innate immune system for example, at the time of administration, may specifically contribute to some of the advantages of the present invention.

[0104] In various embodiments of the present invention, the recombinant Gramnegative bacteria is selected from the list consisting of: Salmonella spp., Yersinia spp., Bordetella spp., Escherichia coli, Shigella spp., Burkholderia mallei, Burkholderia pseudomallei and Pseudomonas aeruginosa. For example, it may be a Salmonella and / or Pseudomonas. In various embodiments, the bacteria is a Salmonella enterica such as Salmonella Typhimurium. Salmonella Typhimurium may include a mutation, deletion, reduced expression, or a less active product of the gene stm3120.

[0105] In certain embodiments, the attenuated bacteria are Salmonella enterica. In some embodiments, the bacteria is Salmonella Typhimurium - e.g., the Salmonella Typhimurium attenuated strain VNP20009, Salmonella Typhimurium 14028 strain STM3120 (also referred to herein as STM3120 strain), Salmonella Typhimurium 14028 strain STM1414, Pseudomonas aeruginosa (strain CHA-OST) and / or Bacillus Subtillis (strain PY79). In some embodiments, the Salmonella Typhimurium has no mutation or reduction in expression conferring purine-auxotrophy (e.g., mutation affecting the pur I gene)

[0106] In various embodiments of the present invention, the bacteria are capable of homing to a tumor site. In some embodiments, bacteria are genetically engineered (i.e. modified) to increase tumor-colonization. As used herein, “engineered to increase tumor-homing” or “engineered to increase tumor-colonization” is meant to include genetically engineered bacterium which results in at least one of: increased numbers of colony forming units within the solid tumor compared to its parental strain; increased serum half-life compared to its parental strain; increased numbers of colony forming units within the solid tumor compared to its parental strain; and reduced immune elimination following repeated dosing compared to its parental strain. In another embodiment, the bacteria (e.g., Gram negative bacteria) which are capable of homing to (and / or colonizing) a tumor are present in a tumor microbiome of the subject.

[0107] In certain aspects, the recombinant bacteria is genetically modified to include multiple prokaryotic expression cassettes. In some embodiments, the multiple prokaryotic expression cassettes are present on a plasmid or chromosomally integrated. In some embodiments, the multiple expression cassettes may be chromosomally integrated prokaryotic expression cassettes.

[0108] In various embodiments, the bacteria is genetically modified by chromosomal integration without negatively impacting the viability of the bacteria before administration to a subject. In preferred embodiments, the prokaryotic expression cassettes are chromosomally integrated without negatively impacting the viability of the bacteria before administration to a subject.

[0109] In various embodiments, the bacteria is genetically modified by chromosomal integration to include two or more, three or more, four or more prokaryotic expression cassettes. As used herein, prokaryotic expression cassettes are configured to be expressed within a prokaryotic cell. A prokaryotic expression cassette is organized to include a bacterial promoter, transport signal and protein / peptide or alternatively promoter, protein / peptide and transport signal or transport signal promoter, protein / peptide in N and C-terminus position. In some embodiments, the bacteria is modified so that a native or heterologous prokaryotic promoter is associated with each of the respective prokaryotic expression cassettes.

[0110] In some embodiments, the bacteria are modified such that the prokaryotic expression cassettes are in frame with a bacterial promoter. In some embodiments, the bacteria are modified such that prokaryotic expression cassettes are chromosomally integrated. In other embodiments, the bacteria are modified such that the prokaryotic expression cassettes are in a plasmid. In some embodiments, the bacteria is modified so the prokaryotic promoter is constitutively active. For example, the bacteria may be modified such that the neoantigen fusion protein is constitutively expressed. In some embodiments, each homologous antigen polynucleotide is operably linked to a constitutive prokaryotic promoter.

[0111] In various embodiments, the prokaryotic promoter is constitutively active. For example, the bacteria may be modified so the neoantigen protein is constitutively expressed. In various embodiments, the bacteria is an attenuated pathogenic- bacteria, preferably a tumor homing attenuated pathogenic-bacteria. Examples ofcontemplated constitutive promoters are known to those skilled in the art and include, but are not limited to PagC, Ssph2, sicA, pLac, J23105, J23119, J23109 promoters.

[0112] In some embodiments, the pathogenic Gram-negative bacteria is said to be attenuated. As used herein, the term "attenuated" refers to a bacteria rendered to be less virulent compared to the native bacteria, thus, becoming less virulent. Preferably, the ability to home to a tumor is not reduced by the attenuation, such that colonizing ability is not reduced by more than 80 %, more preferably 70 %, more preferably 60 % more preferably 50 %, more preferably 40 %, more preferably 30 %, more preferably 20 %, more preferably 10 % as compared to non-attenuated (native bacteria) following i.v. administration (e.g., in a mouse model).

[0113] In some embodiments, the recombinant bacterium is further modified to reduce virulence, reduce toxicity, reduce pathogenicity, increase tumor-colonization, and / or decrease antibiotic resistance. For example, the bacteria may include a mutation, deletion, reduced expression, or a less active product of the gene stm3120. Suitable genes may include but are not limited to at least one of the following: arginine deiminase (adl); Alternative names: NP_463327.1 or locus tag STM4467; L-asparaginase II (ansB); Alternative names: NP_462022.1 or locus tag STM3106; Aminoglycoside resistance protein (aadA): Alternative names: NP_460230.1 or locus tag STM1264; AAC(6’)-laa (aac6); Alternative names: NP_460578.1 or locus tag STM1619; Tetrathionate reductase A (ttrA). Alternative names: NP_460348.1 or locus tag: STM1383. In another example, the recombinant bacterium may be further modified to include a mutation, null mutation or expression reduction of at least one gene selected from the group consisting of arginine deaminase (adl), Aminoglycoside (3") (9) adenylyltransferase (aadA), L-asparaaginase II (asnB), AAC(6’)-laa (aac6) and Tetrathionate reductase A (ttrA) as compared to nonattenuated bacteria of the species Salmonella enterica. In some embodiments the bacteria is genetically modified to include a mutation, deletion or expression reduction (e.g., express a reduced amount or a less active product of stm3120, adl and ttrA as compared to non-attenuated bacteria of the species Salmonella enterica. In a preferred embodiment, the bacteria is modified to include a deletion of the genes: stm3120, arginine deaminase (adl), Aminoglycoside (3") (9) adenylyltransferase (aadA), and AAC(6’)-laa (aac6) as compared to non-attenuated bacteria of the species Salmonella enterica. In some embodiments, the Salmonella Typhimuriumincludes genomic mutation, deletions, or expression reduction in one of the following genes: arginine deiminase (adl) and tetrathionate reductase A (ttrA). In another embodiments, although Salmonella enterica is referred to in this group of embodiments, it is to be recognized that any bacteria having homologous genes can be similarly modified with genomic mutation, deletions, or expression reduction as described herein.

[0114] In various embodiments of the present invention, although Salmonella enterica is referred to in this group of embodiments, it is to be recognized that any bacteria having homologous genes can be similarly modified with genomic mutation, deletions, or expression reduction as described herein.

[0115] The bacteria may be made deficient of one or more of the above-mentioned target genes by methods known in the art.

[0116] According to another embodiment, the bacteria are genetically modified to increase tumor-colonization. As used herein, “engineered for tumor- colonizing” is meant to include genetically engineered bacterium which results in at least one of: increased numbers of colony-forming units within the solid tumor compared to its parental strain, increased serum half-life compared to its parental strain, increased numbers of colony forming units within the solid tumor compared to its parental strain; and reduced immune elimination following repeated dosing compared to its parental strain.

[0117] In some embodiments, one or more of the abovementioned genomic mutations are used for chromosomal integration of the prokaryotic polynucleotide cassettes. In another embodiment, two or more prokaryotic expression cassettes are chromosomally integrated. In another embodiment, three or more prokaryotic expression cassettes are chromosomally integrated. In another embodiment, four or more prokaryotic expression cassettes are chromosomally integrated. In addition, despite the multiple insertions of polynucleotides encoding heterologous or Eukaryotic peptides, there was minimal effect on fitness in vitro or minimal negative impact on the viability of the bacteria used before administration to a subject.

[0118] Genetically modified to express the fusion peptides typically refers to genetically modified with at least one DNA molecule having one or more prokaryotic expression cassettes. In some embodiments, the one or more prokaryotic expressioncassettes may be in an auto-replicative vector (i.e., a plasmid). In some embodiments, the one or more prokaryotic expression cassettes may be chromosomally integrated. In various embodiments, the distinct antigen fusion peptides are each encoded by an antigen polynucleotide. Each fusion peptide may include a single or series of tumor specific antigen (e.g., neoantigen).

[0119] As will be readily appreciated by a skilled artisan, methods for producing the bacteria may include three main processing steps: organism banking, organism production, and preservation.Series of Antigens

[0120] The series of antigens and specifically series of neoantigens may refer to a single, repeated single or multitude of distinct neoantigens such that it is a polyepitopic polypeptide comprising a plurality of neo-epitopes.

[0121] In some embodiments, a neoantigen series may be two or more, three or more, or four or more neoantigens in a series. The neoantigen series may include between 1 and 15, 1 and 10, 1 and 7, 1 and 5, 1 and 4 or 1 and 3 neoantigens in a series. In some embodiments, no linker nor cleavage site exists between each individual neoantigen nucleotide sequence. The neoantigen cassette may include nucleotides encoding additional amino acids which do not adversely affect the secretory function of the signal peptide or do not adversely affect the function of the heterologous immunomodulatory protein.

[0122] When applied to cancer-associated antigen, additional amino acids may be included which separate the signal peptide from the heterologous cancer-associated antigen in order to provide a favored steric configuration to promote the secretion process.

[0123] The polynucleotide encoding a series of antigens may be a concatemer of antigens, that is a long continuous DNA molecule that contains multiple copies of the same DNA sequence linked. The polynucleotide encoding a series of antigens may further be a tandem minigene comprising 6 to 24 minigenes that encode antigen polypeptides containing a mutated amino acid residue flanked on their N- and C- termini by 12 amino acids. In some embodiments, the series does not include a cleavage site nor linker between each respective antigen.

[0124] In some embodiments, the antigen polypeptides includes part of a more general series which further includes a non-specific tumor antigen. In this case a mixture of specific and non-specific tumor antigens forms part of the antigen polypeptide.

[0125] In preferred embodiments, the series of neoantigens are tumor-specific to a solid tumor of the target host cancer subject being treated.

[0126] In preferred embodiments, the series of tumor specific antigens or neoantigen comprises a cancer driver mutation such as an oncogene.

[0127] Examples of tumor-specific antigens are known in the art. Examples include: [3-catenin, BRCA1 , BRCA2, cyclin dependent kinas 4 (CDK4), chronic myelogenous leukemia tumor antigen 66 (CML66), fibronectin, melanoma antigen recognized by T-cells 2 (MART-2), P53 (multiple types), Ras (KRAS, NRAS, HRAS),TGF-p receptor type II (TGF-pRII), EML4-ALK, PIK3CA, BRAF, Neuroblastoma Breakpoint Family Member 10 (NBPF10), IDH1 , IDH2, Golgi Apparatus Membrane Protein TVP23 Homolog C (TVP23C), EGFR, PTEN, E6 and E7 from HPV, DNMT3A, ERBB2, ESR1 , FLT3, FGFR3, Calreticulin frameshift (CALR fs), GNA11 , GNAQ, MYD88, SF3B1 . Additional amino acid sequences are provided in FIG. 3E.

[0128] In some embodiments, each antigen polynucleotide is expressed constitutively by being operably linked to a constitutive prokaryotic promoter. In some embodiments, each antigen polynucleotides encode a single antigen, such as a tumor specific antigen including a neoantigen. In some embodiments, each antigen polynucleotide encode a series of neoantigens. In some embodiments, the series of neoantigens or polyepitopic polypeptide does not include a cleavage site nor linker between each respective neoantigen. In some embodiments, each neoantigen polynucleotide is a tandem minigene which includes a different sequence of nucleotides while the encoded amino acid sequence remains the same. In some embodiments, each of the neoantigen polynucleotides encode a series of reordered neoantigens relative to the other neoantigen polynucleotide.

[0129] The term homologous neoantigen refers to a similar single or series of neoantigens. A homologous single nucleotide polynucleotide is similar in that it may involve codon shuffling, without effecting the amino acid sequence. A homologousseries of neoantigens may involve a polynucleotide or amino acid sequence encoding a series of reordered neoantigens, otherwise known as a tandem minigene. For example, if the first prokaryotic expression cassette includes three neoantigen polynucleotide encoding A-B-C, then a homologous series of neoantigens may include the same three neoantigen polynucleotide in a different order, such as B-A- C.

[0130] In some embodiments, the homologous series or concatemer of neoantigens may involve either or both codons shuffling as well as a reordered neoantigens. In some embodiments, when a number of different homologous neoantigen polynucleotides are chromosomally integrated, each neoantigen polynucleotide codon sequence is preferably distinct. The term homologous neoantigen polynucleotide emphasizes that the neoantigen is effectively being expressed in duplicate,, although each single or homologous neoantigen concatemer is associated with a distinct transport signal.

[0131] Each single of series of tumor specific antigen (e.g., neoantigen) is further associated with a transport signal.

[0132] Multi-modal transport of heterologous cancer-associated antigens (e.g., neoantigens) and tumor-local delivery of an immunomodulator

[0133] In a further aspect, the recombinant bacteria disclosed above are further genetically modified for tumor-local delivery of one or more immunomodulators. Thus, in certain embodiments, the genetically modified tumor homing bacteria are administered systemically and selectively home to a tumor or a tumor microenvironment where they are configured to deliver an immunomodulating peptide.

[0134] The present invention, in some embodiments thereof, relates to vaccines, genetically modified bacteria, and methods of treatment using bacteria genetically modified for multi-modal transport of heterologous cancer-associated antigens (e.g., neoantigens) as well as tumor-local delivery of an immunomodulator. The recombinant bacteria are further genetically modified to express heterologous immunomodulators or a set thereof, by an induced, locally delivered, or timing- controlled system. In some embodiments, the recombinant bacterium is genetically modified to include a polynucleotide encoding an immune modulating peptide.

[0135] In some embodiments, the tumor homing bacteria are genetically modified to include a regulating expression cassette as well as one or more inducible prokaryotic expression cassettes. The one or more inducible prokaryotic expression cassette may include: a directly or indirectly inducible promoter that is not associated with the prokaryotic expression cassette in nature, and associated with an immunomodulator expression cassette, said immunomodulator expression cassette comprising a polynucleotide encoding a single or series of immunomodulator peptides, wherein the inducible promoter is induced by a small molecule that is safe to administer to a subject, and wherein each polynucleotide encoding an immunomodulator peptide is associated with a ribosomal binding site (supporting a polycistronic mRNA conformation) and optionally associated with a polynucleotide encoding a transport signal from a transport system.

[0136] The immune modulating peptide may be operably linked to a promoter induced directly or indirectly by salicylic acid, acetylsalicylic acid or derivatives thereof. In some embodiments, the recombinant bacteria is genetically modified such that the immunomodulator peptide is exogenously induced. Exogenously induced refers to a means for inducing from outside the host ie., by administered a small molecule for example.

[0137] In various embodiments of the present invention, the vaccine with the recombinant bacteria is further genetically modified to express an immunomodulator peptide having a direct or indirect inducible expression. For example, a regulating expression cassette encoding a regulator; and one or more inducible prokaryotic expression cassettes including: a directly or indirectly inducible promoter associated with an immunomodulator prokaryotic expression cassette is provided. The immunomodulator prokaryotic expression cassette may include a polynucleotide encoding a single or series of immunomodulator peptides. The immunomodulator prokaryotic expression cassette refers to a first DNA construct encoding an inducible bacterial promoter and a second DNA construct encoding one or more immunomodulators and a transport signal. The immunomodulator prokaryotic expression cassette further incudes an additional prokaryotic expression cassette encoding a positive regulator, such as a SaIR or NahR polynucleotide.

[0138] In some embodiments, the inducible promoter may be induced by a small molecule that is safe to administer to a subject, and wherein each respectivepolynucleotide encoding an immunomodulator peptide is associated with a ribosomal binding site. Each of the respective polynucleotide encoding an immunomodulator peptide is associated with a polynucleotide encoding a transport signal from a transport system.

[0139] In some embodiments, the inducible promoter and regulator are exogenously induced by acetylsalicylic acid or derivative thereof. For example, the transcription regulator may be in the cis or trans position. In a preferred embodiment, the exogenously induced transcription regulator is a positive regulator, such as SaIR or NahR which are activated by acetylsalicylic acid and wherein the regulating expression cassette or transcription regulator is in trans position relative to the one or more inducible prokaryotic expression cassettes. In a further preferred embodiment, a ratio of a number of inducible prokaryotic expression cassettes to the regulating expression cassette is 2:1 or more.

[0140] In some embodiments, the inducible promoter and regulator are induced by a small molecule that is safe for humans, including but not limited to, araC-pBAD (induced by L-arabinose), Lacl-pLac (induced by IPTG), SalR-pSal or nahR-pSal (induced by acetyl salicylic acid (ASA)). In some embodiments, the small molecule is a salicylate, salicylic acid or derivative thereof such as acetyl salicylic acid. In some embodiments, the inducer is regulated by a salicylic acid, acetylsalicylic acid or derivative thereof. In a preferred embodiment, the inducer is acetylsalicylic acid. In a preferred embodiment, the heterologous positive regulator is SaIR or NahR. As illustrated in FIG. 6, the pSal promoter is inactive when acetyl salicylic acid (ASA) is absent. Once acetyl salicylic acid is administered, the saIR regulator is activated by acetyl salicylic acid (ASA) which activates the promoter.

[0141] In various embodiments, an inducible prokaryotic expression cassette, such as the immunomodulator expression cassette or the prokaryotic expression cassette encoding the neoantigen fusion peptide is inserted at the ad I, ttrA or Stm3120 locus or homology thereof. In some embodiments, the immunomodulator expression cassette may be inserted at the adl locus or homology thereof. In some embodiments, the immunomodulator expression cassette may be inserted at the Stm3120 locus or homology thereof. In some embodiments, the immunomodulator expression cassette may be inserted at the ttrA locus or homology thereof.Method of Treatment

[0142] In another aspect, there is provided, a method of treating a cancer of a subject in need thereof comprising administering to the subject an effective amount of the vaccine disclosed herein, thereby treating the cancer or providing adjuvant or neoadjuvant therapy. In some embodiments, administering to the subject is by parenteral administration (e.g., injection or intravenous infusion).

[0143] As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition. According to a particular embodiment, the term preventing refers to substantially preventing the appearance of clinical or aesthetical symptoms of a condition. Particular subjects which are treated are mammalian subjects - e.g., humans. According to a particular embodiment, the subject has been diagnosed as having cancer or is suspected of having cancer.

[0144] Particular subjects which are treated are mammalian subjects including humans.

[0145] In another aspect, there is provided, a method of treating a cancer of a subject in need thereof comprising administering to the subject an effective amount of the vaccine comprising: a pharmaceutically acceptable carrier and live recombinant bacteria, for example a pathogenic bacterium, said bacteria genetically modified to express two or more distinct antigen fusion peptides. The distinct antigen fusion peptides include: a first antigen fusion peptide comprising an antigen or series thereof, associated with a first secretion signal from a first secretion system: and a second antigen fusion peptide comprising the antigen or series thereof, associated with a second secretion signal from a second secretion system, and wherein the first and second secretion systems are distinct, thereby treating the cancer. In preferred embodiments, the first secretion system is an inner and outer spanning system and the second secretion system is an outer membrane spanning system.

[0146] In various embodiments, administering refers to administering systemically, for example via the bloodstream where it is circulated systemically.

[0147] In another aspect, there is provided, a method of treating a cancer to a cancer subject in need thereof comprising: systemically administering to a cancersubject host a vaccine comprising live Gram negative bacteria genetically modified to employ multiple modes of bacterial transport to export a tumor-specific antigen or series thereof; and upon systemic clearance or / and specific colonization of a tumor and / or an enhanced related activity delivering a second therapy. The second therapy may refer to therapeutic, radiation, chemotherapy, bacterial strain or surgical removal of a tumor. For example, the therapeutic may be an immunomodulator. The therapeutic may be administered to the host or alternatively genetically integrated into the bacteria.

[0148] In some embodiments, the immunomodulator is a checkpoint inhibitor. Typical checkpoint inhibitors will be recognized in the art include but are not limited to: ipilimumab, pembrolizumab, nivolumab, atezolizumab, avelumab, durvalumab, pidilizumab, AMP-224, MPDL3280A, MDX-1105, MEDI-4736, arelumab, tremelimumab, IMP321 , MGA271 , BMS-986016, lirilumab, urelumab, PF- 05082566, IPH2101 , MEDI-6469, CP-870,893, Mogamulizumab, Varlilumab, Galiximab, AMP- 514, AUNP 12, Indoximod, NLG-919, INCB024360 (Incyte) and combination thereof.

[0149] In some embodiments of the present method, the systemic administration is by parenteral administration and preferably systemic parenteral administration.

[0150] As described above, the multiple modes of secretion preferably involve two or more distinct transport systems and especailly a type III and Type V seretion system.

[0151] In some embodiments of the present method, the treating a cancer includes acting as an adjuvant or neoadjuvant therapy to a cancer subject.

[0152] In some embodiments, specific colonization of a tumor may be measured by an average bacterial load at 9 days after administration in mice of less than 5000 CFU / gr / mL in spleen, lung or liver.

[0153] In some embodiments, a blood clearance rate in a subject is at an average bacterial load in blood at 9 days in mice of less than 75 CFU / gr / mL. In some embodiments, the extent of blood clearance of 90thpercentile of mice treated with

[0154] In some embodiments of the present method, treating a cancer includes upregulating or enhancing the Gamma Delta T-Cells in a host. This may be especially beneficial for cancers having HLA class I defects.

[0155] In some embodiments of the present method, treating a cancer includes enhancing a response to treatment by a checkpoint inhibitor.

[0156] In some embodiments, the method involves a vaccine including a live Gram-negative bacteria which expresses intact Pathogen-associated molecular patterns (PAMP), such as LPS, flagellin, or peptidoglycan. In some embodiments, the method involves a vaccine which further includes an additional microbial strain being a commensal bacterium.

[0157] In some embodiments of the present method, the systemically administering the vaccine to a host result in selective colonization of a tumor by the live Gram-negative bacteria in mice by a 100-fold or more enrichment of bacterial load in tumors after 24h relative to dose at administration.

[0158] In some embodiments of the present method, the systemically administering the vaccine to a host result in selective colonization of a tumor by the live Gram-negative bacteria in mice by a 10A4 fold or more enrichment in tumors after 7 days relative to dose at administration.

[0159] In some embodiments of the present method, the live Gram-negative bacteria is administered at a single or multiple dose of less than 10A8 CFU / kg such as a of 10A4 to 10A8 CFU / kg or 10A5 to 10A7 CFU / kg.

[0160] In some embodiments of the present method, the systemically administering to the host results in generation of antigen specific T-cells localized at the tumor or a metastasis or tumor draining lymph nodes or spleen thereof. In some embodiments, the generation of antigen-specific T-cells is enhanced compared to a response to an immunomodulator (e.g. aPD1 ) or bacteria which does not express a neoantigen. The antigen-specific T-cells may be antigen and preferably neoantigen specific CD8 T-cells. The generation of antigen-specific T-cells outside of the circulatory system may be a sustained immune response in the subject.

[0161] In some embodiments of the present method, the vaccine further includes a commensal bacterium.

[0162] In some embodiments of the present method, the tumor is a solid tumor selected from colorectal cancer, pancreatic cancer, lung cancer, ovarian cancer,mesothelioma, glioblastoma, gastric cancer, hepatocellular cancer, renal cell cancer, prostate cancer, cervical cancer, breast cancer and melanoma.

[0163] In some embodiments, subsequent to administering a dose of bacteria, the method further includes waiting a period of time for tumor-colonization of the bacteria in a cancer tumor and / or reducing a systemic bacterial load; and administering an inducer. In some embodiments, the inducer is a salicylate or salicylic acid.

[0164] In some embodiments, administering an inducer is periodically administered. In some embodiments, administering an inducer is readministering an acetylsalicylic acid after a period of time with negligible amounts of immunomodulator expression or secretion. In some embodiments, wherein administering an inducer at least 18 days after administering a dose of bacteria provides induced expression and / or secretion of a peptide. In some embodiments, induction is provided after day 18, post administration. In some embodiments, administering to the subject provides systemic exposure of the vaccine.

[0165] As used herein treating a cancer of a subject in need thereof may refer to reducing a tumor volume (e.g., a solid tumor volume), or providing an adjuvant or neoadjuvant therapy.

[0166] Treatment may refer to any effect which may trigger an immune response in the host such as inducing an antigen specific immune response against the neoantigen when administered to a subject in need thereof, (e.g., a CD8+ cellular immune response). Alternatively, treating a cancer may involve recruitment of antitumor cytotoxic T cells, neutralizing immune suppressive cells, or activation of exhausted tumor microenvironment immune cells.

[0167] In one embodiment the immune response is an increase in the production of CD8+T cells and / or CD4 +T cells. In some embodiments, a tetramer assay involving staining of specific CD8 T cell clones (extracted form vaccinated mice recognizing a specific neoepitope presented on MHCI) is used to evaluate the induction of an anti-tumor response following treatment.

[0168] In some embodiments, an effective amount of the vaccine is a prophylactically effective amount of the vaccine and treating the cancer is preventing reoccurrence of a cancer.

[0169] In some embodiments, the exogenously inducible transcription regulator is in cis position. In some embodiments, the exogenously inducible transcription regulator is in a trans position relative to one or more inducible prokaryotic expression cassettes encoding heterologous peptides.

[0170] In some embodiments of the present invention, there is provided tumorhoming bacterium, genetically modified for exogenously inducible immunomodulation. The tumor homing bacterium may be genetically modified for exogenously inducible immunomodulation using a regulating expression cassette and an inducible DNA construct or prokaryotic expression cassette.

[0171] As used herein the term “about” refers to ± 10 %

[0172] The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".

[0173] The term “consisting of” means “including and limited to”. The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

[0174] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0175] In a first aspect, there is provided a recombinant bacterium being a tumor homing, gram-negative bacterium, genetically modified to include one or more prokaryotic expression cassettes comprising: a first and a second homologous neoantigen polynucleotide, each encoding a single or series of neoantigens, each of the first and the second homologous neoantigen polynucleotides being associated with a polynucleotide encoding a transport signal from a distinct transport system, said transport system being a bacterial secretion system selected from a Type III secretion system and a Type V secretion system.

[0176] Embodiment 2: the recombinant bacterium of aspect 1 , genetically modified to include a third homologous neoantigen polynucleotide associated with a polynucleotide encoding a transport signal from a distinct transport system.

[0177] Embodiment 3: The recombinant bacterium of Embodiment 2, wherein the distinct transport system is an outer cell wall display system or a Type II secretion system.

[0178] Embodiment 4: The recombinant bacterium of any one of embodiments 1 to 3, wherein each neoantigen polynucleotide is operably linked to a constitutive prokaryotic promoter.

[0179] Embodiment 5: The recombinant bacterium of any one of embodiments 1 to 4, wherein each neoantigen polynucleotides encode a series of neoantigens.

[0180] Embodiment 6: The recombinant bacterium of embodiment 5, wherein the series of neoantigens does not include a cleavage site nor linker between each respective neoantigen.

[0181] Embodiment 7: The recombinant bacterium of any one of embodiments 1 to 6, wherein the prokaryotic expression cassettes are chromosomally integrated without negatively impacting the viability of the bacteria before administration to a subject.

[0182] Embodiment 8: The recombinant bacterium of any one of embodiments 1 to 7, further modified to reduce virulence, reduce toxicity, reduce pathogenicity, increase tumor-homing, and / or decrease antibiotic resistance.

[0183] Embodiment 9: The recombinant bacterium of embodiment 8, further modified to include a mutation, null mutation or expression reduction of at least one gene selected from the group consisting of arginine deaminase (adl), Aminoglycoside (3") (9) adenylyltransforase (aadA), L-asparaaginase II (asnB), AAC(6')-laa (aac6) and Tetrathionate reductase A (ttrA) as compared to nonattenuated bacteria of the species Salmonella enterica.

[0184] Embodiment 10: The recombinant bacterium of embodiment 9, modified to include a null mutation of three of the following: stm3120, aadA, adl and aac6.

[0185] Embodiment 11 : The recombinant bacterium of any one of embodiments 1 to 10, wherein the recombinant bacteria is genetically modified to express an immunomodulator peptide having direct or indirect inducible expression.

[0186] Embodiment 12: The bacterium of any one of embodiments 1 to 11 , wherein the bacterium is a Salmonella Typhimurium.

[0187] Embodiment 13: The bacterium of any one of any one of embodiments 1 to 12, 1 to 35, wherein the expression cassettes are in an auto-replicative vector (plasmid).

[0188] Embodiment 14: The bacterium of any one of aspects 1 to 13, wherein the expression cassettes are chromosomally integrated.

[0189] Embodiment 15: A vaccine comprising a bacterium according to any one of embodiments 1 to 15 and one or more pharmaceutically acceptable carriers or excipients.

[0190] The contents of all cited references and patents are hereby incorporated by reference in their entirety. The invention is explained in more detail by means of the following examples without, however, being restricted thereto.

[0191] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub combination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0192] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.EXAMPLESGENERAL MATERIALS AND METHODSPlasmids and DNA fragments for genomic insertions:

[0193] To generate DNA fragments with homologous arms for the genomic integration of neoantigens, amplified fragments (promoter, secretion signal, neoantigen and homologous arms) were assembled into a linear fragment using NEBbuilder, followed by PCR amplification of the assembled fragment.Neoantigens:Neoantigens were inserted to the backbone plasmids by NEBuilder cloning kit, when episomal expression is tested, or integrated into the bacterial genome using the two- step scar-less lambda red recombineering method.Bacteria:

[0194] The attenuated Salmonella Typhimurium strain STM3120 (Reference : PMID -20231149) was modified through standard plasmid transformation methods or genetically engineered using the two-step scar-less lambda red recombineering method.

[0195] Plasmids were transformed by electroporation. Briefly, bacteria were cultured to OD of 0.6-0.8, washed 3 times with Hepes 1 mM and suspended in 10% glycerol in DDW. Suspension was electroporated with 0.2 cm, cuivette (BioRad, EC2) and moved to 1 ml cold SOC. Following 1 hour incubation in 37 °C, bacteria were seeded on LB agar plate containing ampicilin. Selected colonies were verified by Sanger sequencing and Western blot.

[0196] Scar-less engineering process consists of the introduction of a cassette that expresses the TetA and SacB genes. This insertion rendered the bacteria sensitive to sucrose (sacB gene) and resistant to tetracycline (TetA gene) and can be accordingly selected. In the second step, tetA-sacB cassette is replaced with a sequence of interest rendering the bacteria sensitive to tetracyline and resistant to sucrose (loss of sacB gene). The bacterial strains with successful integration can accordingly be counter-selected using sucrose. This method enables the bacterial genome to be engineered with insertions or knockouts without leaving any unwanted DNA sequences (“scars”) in the bacterial genome.Freezing working stocks of Salmonella typhimurium:

[0197] Exponentially growing culture (OD 0.6-0.8) was washed twice in cold PBS. Bacteria pellet was suspended in 25 % glycerol in PBS. A sample from the bacterialstock was serially diluted and seeded on LB agar plate, while the rest of the pool was aliquoted and stored in - 80 °C. To verify viability of bacteria, a frozen aliquot was defrosted and seeded on LB agar plate. Recovery rate following freezing was quantified by calculating the ratio of frozen / fresh CFU count. Calculation of bacteria dosage in mice experiment was based on the CFU count of the frozen culture.Mice models:

[0198] B16-OVA mouse melanoma cell line (106) or MC38 mouse CRC cell line (105) were injected s.c. to the right flank of 7 weeks C57BL / 6 females. Tumor volume was calculated as widthA2*length / 2.

[0199] Bacteria quantification in systemic organs and tumor:

[0200] Slices of tumors and organs were suspended in sterile tubes containing LB and metal beads. Following vortex for 10 minutes at max speed, 200 pl of sup, were seeded on LB plates and incubated over night at 37 °C. Attenuated strains

[0201] Knock-out strains were generated using the two-step scar-less lambda red recombineering method. As a first step, lambda red recombineering was used to introduce a cassette that expresses the TetA and SacB genes. This insertion rendered the bacteria sensitive to sucrose (sacB gene) and resistant to tetracycline (TetA gene) and can be accordingly selected. In the second step, tetA-sacB cassette was replaced with a sequence of interest rendering the bacteria sensitive to tetracyline and resistant to sucrose (loss of sacB gene). The bacterial strains with successful integration can accordingly be counter-selected using sucrose. This method enables the bacterial genome to be engineered with insertions or knockouts without leaving any unwanted DNA sequences (“scars”) in the bacterial genome.

[0202] Various combinations of knock-out strains including STM3120 KO in combinations with one or more knockouts of the following genes : adl, aadA, aac6, and ttrA were generated and their toxicity and colonizing capacity was evaluated and compared to STM3120- strain. Reduction in bacterial toxicity was observed (measured by body weight loss) together with minor reduction in tumor colonization (FIGs 2A-B).Example 1 : Attenuation of STM3120 by deleting antibiotic resistance or infectivity associated genesTo obtain an attenuated strain, the Salmonella Typhimurium 14028 strain STM3120 (referred herein as “Salmonella Typhimurium STM3120” strain as disclosed in Arrach et al., 2010) was further modified and multiple target genes were deleted using standard techniques. Following deletions of genes, the toxicity and homing capacity was tested for the different attenuated strains.

[0203] Over-night cultures were diluted 1 :100 and grown to exponential growth (OD 0.6-0.8). Bacteria were pelleted, washed twice in cold PBS, suspended in 25 % glycerol in PBS and frozen at - 80 °C in aliquots for experiments in mice. Aliquots were thawed and diluted to desired concentration in PBS. Bacterial concentration of frozen stocks were measured by standard CFU assays or with a Bactobox (SBT instruments).

[0204] C57BL / 6 mice were injected with 10A5 MC38 cells in the right flank. When tumors reached a volume of ~100mmA3, mice receive intravenous (i.v.) injections with 10A6 CFU of STM3120-, STM3120-aac6-, STM3120-ansB-, STM3120- ttrA-, or STM3120-ttrA-adl-. (Note that represents knock out. Results are depicted in FIG. 2A and FIG. 2B

[0205] Graph shows the relative body weight of the mice following injection of bacteria (day 0). While no significant change is observed, the strains with further attenuations seem to recover faster than STM3120-.

[0206] Graph shows the homing capacity of the bacteria. After 9 days, tumors were resected and vigorously shaken in 1 ml LB and a metal ball. Supernatant was diluted and seeded on LB plates and colonies were counted following 24 hrs incubation at 37°C. CFU was normalized to the dilution factor and tissue mass. We detect a mild reduction in homing capacity with the attenuated strains.Example 2: Expression and multi-modal transport of homologous neoantigen cassettes

[0207] A schematic illustration of the bacteria genome of Salmonella Typhimurium and location of insertion and design of multiple prokaryotic expression cassettes having neoantigens is depicted in FIG. 3A, 3B and 3C. As illustrated, a first cassettes is composed of homology arms to the endogenous ompA gene, a neoantigen sequence (or series of neoantigen sequences) which is inserted in-frame in the coding sequence (CDS) of the gene (third trans-membranal loop, position G133) toobtain a functional protein with presentation of the neoantigen on the bacterial cell wall. Within another site, aac6 site, a homologous neoantigen sequence (or series of neoantigen sequences) is fused to sspH1 secretion signal (Type III secretion system - T3SS) and a pagC promoter driving its expression, as illustrated in FIG. 3A. In FIG. 3B, an additional homologous neoantigen polynucleotide is incorporated such that in total, two neoantigen cassettes are inserted at the aac6 site; wherein one neoantigen polynucleotide is fused to sspH1 (Type III secretion signal, secreted into another cell) and another neoantigen polynucleotide is fused to the passenger domain of the PET autotransporter gene (Type V secretion signal - T5SS, secreted outside of the bacteria). Each neoantigen cassette was associated with a promoter (pagC promoter for Type III and synthetic J23105 promoter for Type V) to drive expression. In FIG. 3C, one additional copy of a homologous neoantigen cassette, this time, fused to pelB secretion signal (sec pathway associated with Type II secretion system which is secreted out of the bacteria), is incorporated for a total of four copies of a homologous neoantigen cassette. This copy is inserted downstream of the ompA gene without an additional promoter to rely on ompA promoter regulation. An RBS sequence was inserted before the sequence for efficient translation.

[0208] Salmonella Typhimurium strain STM3120 was genetically modified with the insertion of multiple expression cassettes, illustrated in FIG. 3C, and expression and secretion was evaluated on a Western Blot in FIG. 4. Bacterial lysates were prepared by diluting over-night cultures 1 : 100, growing the cultures to ODeoo 1 . Bacterial pellets were resuspended in protein loading buffer and reducing agent, boiled and loaded on Bis-Tris gels (4-20%). Bacterial supernatants were prepared from 2 ml cultures at ODeoo 1 , supernatants were filtered (0.22 urn pore size) and protein was concentrated with protein precipitation kit (A&A Biotechnology) according to the manual. All the resulting protein was loaded on the gel. Western blot was run under standard conditions, dry transfer (4 min, 20V) on PVDF blots (iBlot2, Invitrogen). Blocking and Antibody binding steps were done using Licor Intercept (TBS) Blocking Buffer and Antibody diluent and results were visualized with Licor OdysseaM. (1 ) Replacement of the endogenous outer membrane protein A (ompA) with a modified version of ompA containing an addition of a coding sequence for a 27 aa long ADPGK neoantigen peptide within the ompA gene to be presented on the third external loop of the protein. This leads to a shift in size for the ompA protein from 37.5 kDa to 40.5kDa, as can be observed in a Western blot of bacterial lysates (A). (2) Insertion of a cassette for the expression of an 81 aa long ADPGK neoantigen, with pelB (T2SS) secretion signal and an HA tag. The expression of the peptide (9.9 kDa) was validated (B) however, the secreted protein was below the detection threshold. (3) Insertion of the ADPGK neoantigen (27 aa) with sspH1 secretion signal (T3SS, 26.8kDa) under pagC promoter for which expression was detected in bacterial lysate and supernatant(C) (D). Insertion of the ADPGK neoantigen (27 aa) into the Pet autotransporter (T5SS 23kDa) under J23105 promoter for which expression was detected in bacterial lysate and supernatant. Most of the protein was detected in the secreted compartment and only a very faint band could be detected in bacterial lysate, indicating a very effective secretion. A Flag tag was added to both at the C- terminus and visualized with an antibody for Flag.

[0209] PM1 - Bacteria strain with all 4 versions of ADPGK neoantigen. No - Background strain without the ADPGK insertion as a negative control. T3SS - bacterial strain with ADPGK inserted with sspH1 only, a ompA - ompA detection antibody, a Flag - Flag tag detection antibody, a HA - HA tag detection antibody, a EF-TU - EF-Tu protein detection antibody as positive control for bacterial protein detection.

[0210] FIG. 4A demonstrates the simultaneous expression, as well as Type III and Type V mediated secretion of heterologous peptide ADPGK in Salmonella Typhimurium STM3120 bacteria. The bacteria were genetically modified with the insertion of a single neoantigen secretion cassette including bacterial promoter pagC, Type III secretion signal sspH1 and ADPGK -FLAG or with multiple neoantigen secretion cassettes including bacterial pagC promoter, Type III secretion signal sspH1 and ADPGK- FLAG as well as J23105 promoter, a ribosome binding site (RBS) and Type V secretion system PET-ADPGK-FLAG (labeled as T5SS). Simultaneous expression and secretion of ADPGK mediated by T3SS and T5SS is observed following Western Blot on bacterial lysates (expressed) in C and filtered supernatants (secretion) in D.Example 3: Immune-mediated anti-tumor effect is obtained when bacteria express and secrete a tumor-specific neoantigen

[0211] C57BL / 6 mice were injected with 10A5 MC38 cells in the right flank. When tumors reached a volume of ~100mmA3, mice received intravenous (i.v.) injections with 10A6 CFU of:

[0212] STM3120 (no ADPGK) or STM3120 genetically engineered to secrete the tumor-specific neoantigen ADPGK, using either two or three transport systems. The two transport systems being surface display and secreted with T3SS (type III secretion system) (ompA, T3), labeled as wADPGK+3sADPGK. The three transport systems being surface display, secreted with T3SS and secreted with T5SS (ompA, T3, T5), labeled as wADPGK + 3sADPGK + 5sADPGK.

[0213] Mice received weekly administration of 150ug anti-PD1 , i.p. Graph shows violin plots of sizes of tumors following treatment at day 17 post bacteria injection.

[0214] As depicted in FIG. 5A, a significant effect is observed following administration of bacteria that express and secrete the tumor-specific neoantigens with a trend of increased efficacy when expressing multiple modes of neoantigen delivery.

[0215] .STM-ADPGK : STM expressing ADPGK at 3 loci, presented on the cell wall, secreted with T3SS and secreted with T5SS (ompA, T3, T5), STM-OVA : STM expressing the unrelated neoantigen OVA at 2 loci, presented on the external cell wall and secreted with T3SS or no bacteria. At day 3 post-bacterial injection, mice were treated with aPD1 (150ug / mouse, i.p). At day 10, mice were sacrificed and cell suspensions from spleens were subjected to ADPGK-specific tetramer staining (n = 3-5). The graph depicted in FIG. 5B shows the percentage of ADPGK-specific CD8 T cells out of CD45+ cells. * - p < 0.05, * * - p<0.01 (Mann Whitney test). Error bars represent the standard error

[0216] 6-week-old female C57 / BL6 mice were inoculated into their right flank with 10A5 MC38 tumor cells. When tumors reached a size of about 100mm2, mice were injected intravenously with 10A6 CFU of bacteria expressing a tumor-relevant neoantigen displayed by 1 , 2 or 4 transport modes. The graph depicted in FIG. 5C show the percent of change in weight relative to day 0 during the first ten days after bacteria administration. A decrease in weight loss is noted in bacteria engineered to secrete neoantigen by both Type III and Type V secretion systems and well as by four presentation modes being surface display, Type II, Type III and Type V.Moreover, a highly improved recovery in weight is observed in mice receiving bacteria expressing neoantigen with all 4 presentation modes.Example 4: Effect on Safety of Multiple Modes of Transport of a Tumor- Related Antigen

[0217] Toxicity of bacteria can be assessed by several parameters, such as spleen size, weight loss and presence of bacteria in the periphery at a non-tumoral site.

[0218] 6-week-old female C57 / BL6 mice were inoculated into their right flank with 10A5 MC38 tumor cells (FIG. 6A) or 10A6 B16-OVA tumor cells (FIG. 6B). When tumors reached a size of about 100mmA2, mice were injected intravenously with 10A6 CFU of bacteria genetically modified according to FIG. 3C, to express multiple fusion peptides, each having the same tumor-related antigen but associated with one of four different transport signals. As controls, mice were injected with PBS or 10A6 CFU bacteria expressing no antigen. At day 10, after bacteria administration, spleens were harvested, and their weight was assessed.

[0219] Reduced splenomegaly in mice treated with neoantigen-expressing bacteria (MC38 and B16-OVA model) was observed. FIG. 6A and FIG. 6B depict bar graphs showing that mice treated with a bacterial strain genetically modified to express a tumor-related neoantigen (AG) expressed by four distinct secretion modes had reduced splenomegaly. Although spleen weight is increased after treatment with neoantigen expressing bacteria compared with the PBS control group, the increase is to a decreased extent compared with treatment with bacteria that do not express neoantigen. This indicates decreased toxicity and increased safety compared with bacteria that do not express neoantigen.Example 5: Effect on Weight Loss for Quadrupel-modal Transport of Tumor- Related Antigen

[0220] 6-week-old female C57 / BL6 mice were inoculated into their right flank with 10A5 MC38 tumor cells or B16-OVA tumor cells. When tumors reached a size of about 100mmA2, mice were injected intravenously with 10A6 CFU of bacteria genetically modified to express four distinct fusion peptides, each having the same tumor-relevant neoantigen but associated with four distinct transport signals. As controls, mice were injected with PBS or 10A6 CFU bacteria expressing no antigen.

[0221] Graphs of both models, MC38 tumor cells (FIG. 6C) and B16-OVA tumor cells (FIG. 6D) show decreased weight loss relative to day 0 during the first ten days after bacteria administration for bacteria expressing four distinct fusion peptides compared with bacteria without neoantigen expression. In both cases, the recovery time is also significantly improved.Example 6: Effect on Spleen Weight of Multi-modal Transport of Tumor- Related Antigen

[0222] 6-week-old female C57 / BL6 mice were inoculated into their right flank with 10A5 MC38 tumor cells. When tumors reached a size of about 100mmA3, mice were injected intravenously with 10A6 CFU of bacteria expressing a tumor-relevant neoantigen presented by 4 transport modes, 1 -2 secretion modes or without any neoantigen expression. At day 10, after bacteria administration, spleens were harvested, and their weight was assessed.

[0223] FIG. 6E shows that treatment with bacteria expressing tumor-relevant neoantigen presented by four transport modes results in mild splenomegaly compared with bacteria expressing no antigen or with one or two transport modes.Example 7: Effect on systemic clearance of Multiple Modes of Transport of a Tumor-Related antigen

[0224] 6-week-old female C57 / BL6 mice were inoculated into their right flank with 10A5 MC38 tumor cells. When tumors reached a size of about 100mmA3, mice were injected intravenously with 10A6 CFU of bacteria engineered to express: i. fusion peptides ADPGK associated with OmpA (cell wall or surface display) and ADPGK associated with a signal from Type II secretion system; ii. fusion peptide ADPGK associated with a signal from Type III secretion system and ADPGK associated with a signal from the Type V secretion system or iii. fusion peptide ADPGK associated with surface display signal OmpA, a signal from the Type II, Type III and Type V secretion systems (all 4 transport modes). At day 9 after bacteria administration, mice were sacrificed and tumor, spleen, lung, liver and blood were collected and weighed. Tissue was homogenized by 10minutes of vigorous shaking with a metal ball. Before seeding the tissue on LB plates, each tissue was diluted according to its own characteristics (tumor: 105-106times, blood: no dilution, other organs: no or 10'time dilution). 200ul of those dilutions were seeded and 24h colonies were counted. CFUper gr was calculated by multiplying the colony count by the dilution factor, divided by tumor net mass. This result was multiplied by a factor of 5 to express the final counts per ml.

[0225] Results presented in FIG. 7 show that engineering bacteria with fusion peptides associating a neoantigen with a surface display signal OmpA and Type II secretion system are not enough to reduce bacterial presence in the periphery. However, associating a neoantigen with a signal from the Type III and Type V secretion system, or further expressing additional peptides associating the neoantigen with further transport signals such as Type 11 and surface display, resulted in reduced bacteremia so that 90th percentile of mice have less than 50 CFU / gram / mL of bacteria in their blood.Example 8: Effect of Multi-modal Transport on Immune System Profile

[0226] 6-week-old female C57 / BL6 mice were inoculated into their right flank with 10A5 MC38 tumor cells. When tumors reached a size of about 100mmA3, mice were injected intravenously with 10A6 CFU of bacteria expressing a tumor-relevant neoantigen displayed by a single, double or quadruple transport mode. Ten days after treatment with bacteria, the spleen and tumor were harvested as well as tumordraining of lymph nodes (TdLN). Organs were processed to a single cell suspension. Erythrocytes in the spleen were depleted by using ACK Lysis buffer.

[0227] Prior to antibody staining, non-specific binding was blocked by using anti- CD16 / 32 antibodies for 10min at 4°C at a concentration of 5ug / ml diluted in FACS Buffer (PBS, 5uM EDTA, 10% FCS) containing Brilliant Stain Buffer to avoid nonspecific Brilliant dye interactions.

[0228] After ten minutes, cells were stained with combinations of the following antibodies: anti-mouse CD45-BV510, CD11 b-BV605, Ly6G-PerCP5.5, CD103- PeCy7, Ly6C AlexFluor700, F4 / 80 APC-Cy7, CD11 c-FITC, CD206-PE, l-A / l-E- BV421 , CD172-APC, TCR chain-BV605, CD4-PerCP5.5, NK1.1 -PeCy7, CD19- AlexaFluor700, CD8-APCeFluor780, CD44-FITC, PD1 -PE, CD62L-BV421 , FoxP3- APC, CD107a-PeCy7, Tim3-PE, cKit-AlexaFluor700, anti-mouse TCR y / d-FITC, H- 2D-b Adpgk Neoepitope Tetramer-APC. All antibodies were purchased from Biolegend®. Antibodies were incubated for 30min at 4°C at a concentration of 1 - 2ug / ml, diluted in FACS buffer. Intracellular staining for FoxP3 was performedaccording to the eBioscience™ Foxp3 / Transcription Factor Staining Buffer protocol. ADPGK-Tetramer was kindly provided by NIH and incubated for 60min at 4°C at a concentration of 6.7ug / ml and diluted in FACS buffer containing 50nM Dasatinib. Stained cells were acquired by a CytoFLEX LX flow cytometer, data was analyzed by FlowJo software. Immune populations were defined as follows: Macrophages were identified as CD45+CD11 b+F4 / 80+, the markers l-A / l-E and CD206 were used to distinguish between M1 (I-A / I-E+ CD206-) and M2 (CD206+) macrophages. pDCs were identified as CD45+ CD172+ CD11 c+ Ly6C+ MHClow, neutrophils as CD45+CD11 b+Ly6G+, CD4 T cells as CD45+CD3+TCRab+TCRyd-CD4+, CD8 T cells as CD45+CD3+TCRab+TCRyd-CD8+, yd T cells as CD45+CD3+ TCRab- TCRyd+. Statistical data was analyzed with the GraphPad Prism9.5.1 software, p values were calculated by the Mann-Whitney test, with Values < 0.05 being considered significant.

[0229] Results of the immune profiling show, as seen in FIG. 8 that highest levels of neoantigen specific CD8 T-cells in the tumors are induced following the injection of bacteria expressing the neoantigen with all 4 modes of presentation. In the spleen, the highest levels of neoantigen specific CD8 T-cells are detected when bacteria present the neoantigen with type III secretion system. Reduced levels of exhausted CD8 (B) and CD4 (C) in spleens are observed following the injection of bacteria with neoantigen expression presented with all 4 modes. Induction of gamma delta T cell levels in tumors is observed with bacteria expressing the combined of the neoantigen with type III and type V secretion.CFU=colony forming units; IV=intravenous; “A” is meant to indicate “to the power of”

[0230] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. It is the intent of the applicant(s) that all publications, patents, and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent, or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation, or identification of any reference in this application shall not be construed asan admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is / are hereby incorporated herein by reference in its / their entirety.REFERENCESArrach N, Cheng P, Zhao M, Santiviago CA, Hoffman RM, McClelland M. High- throughput screening for salmonella avirulent mutants that retain targeting of solid tumors. Cancer Res. 2010 Mar 15;70(6):2165-70. doi: 10.1158 / 0008-5472. CAN- 09-4005. PMID: 20231149; PMCID: PMC4103738. van Bloois, Edwin, et al. "Decorating microbes: surface display of proteins on Escherichia coli." Trends in biotechnology 29.2 (2011 ): 79-86.Costa, T., Felisberto-Rodrigues, C., Meir, A. et al. Secretion systems in Gramnegative bacteria: structural and mechanistic insights. Nat Rev Microbiol 13, 343-359 (2015). https: / / doi.org / 10.1038 / nrmicro3456Luo Y, Chen Z, Lian S, Ji X, Zhu C, Zhu G, Xia P. The Love and Hate Relationship between T5SS and Other Secretion Systems in Bacteria. Int J Mol Sci. 2023 Dec 24;25(1 ):281. doi: 10.3390 / ijms25010281 . PMID: 38203452; PMCID: PMC1 0778856

Claims

CLAIMS1. A vaccine comprising a recombinant Gram-negative bacteria genetically modified to express two or more distinct fusion peptides comprising: a. a first antigen fusion peptide comprising a neoantigen or series thereof, said neoantigen or series thereof associated with a first secretion signal from a double membrane-spanning secretion system; and b. a second antigen fusion peptide comprising a homologous neoantigen or series thereof, associated with a second secretion signal from an outer membrane-spanning secretion system.

2. The vaccine according to claim 1 , wherein the double membrane-spanning secretion system is selected from the list consisting of: a type I secretion system (T1 SS), a type III secretion system (T3SS), a type IV secretion system (T4SS), a type VI secretion system (T6SS), and a resistance- nodulation-division (RND) family of multi-drug efflux pumps.

3. The vaccine according to claim □, wherein the double membrane-spanning secretion system is a Type III secretion system.

4. The vaccine according to claims 1 to 3, wherein the outer membrane-spanning secretion system is selected from a list consisting of: a type V secretion, autotransporter system (T5SS), a curli secretion system, and a chaperoneusher pathway for pili assembly.

5. The vaccine according to claim 4, wherein the outer membrane-spanning secretion system is a type V secretion.

6. The vaccine according to claim 5, wherein the double membrane-spanning secretion system is a Type III secretion system; and the outer membranespanning secretion system is a Type V secretion system.

7. The vaccine according to any one of claims 1 to 6, wherein the recombinantGram-negative bacteria is a pathogenic bacteria and / or recognized by host pattern recognition receptors.

8. The vaccine according to any one of claims 1 to 7, wherein the recombinantGram-negative bacteria is selected from a list consisting of: Salmonella spp., Yersinia spp., Bordetella spp., Escherichia coli, Shigella spp., Burkholderia mallei, Burkholderia pseudomallei and Pseudomonas aeruginosa.

9. The vaccine according to any one of claims 1 to 8, wherein the recombinantGram-negative bacteria is genetically modified to further express a third antigen fusion peptide comprising a homologous neoantigen or series thereof associated with a third transport signal from a distinct transport system, wherein the distinct transport system is selected from a list consisting of a Type I secretion system, a Type IV secretion system and an outer cell membrane display system.

10. The vaccine according to claim 9, wherein the recombinant Gram-negative bacteria is genetically modified to further express a fourth antigen fusion peptide comprising a homologous neoantigen or series thereof and a fourth transport signal from a distinct transport system, wherein the distincttransport system is selected from a list consisting of: a Sec or Tat pathway associated with a Type II secretion system, Type I secretion signal, Type IV secretion signal and an outer cell membrane display system.11 . The vaccine according to claim 10, wherein the secretion or transport systems are each of an outer cell membrane display system, a Sec pathway associated with a Type II secretion system, a type III secretion system and a Type V secretion system.

12. The vaccine according to any one of claims 1 to 11 , wherein one or more prokaryotic expression cassettes encoding the fusion peptides are operably linked to a constitutive prokaryotic promoter.

13. The vaccine according to any one of claims 1 to 12, wherein the neoantigen forms part of a series which further includes a non-specific tumor antigen.

14. The vaccine according to any one of claims 1 to 13, wherein the neoantigen comprises a cancer driver mutation.

15. The vaccine according to any one of claims 1 to 14, wherein the neoantigen is specific to a tumor of a host subject.

16. The vaccine according to any one of claims 1 to 15, wherein a single prokaryotic expression cassette encodes the first and second fusion peptides.

17. The vaccine according to any one of claims 1 to 16, wherein the recombinantGram-negative bacteria is genetically modified to include a null mutation of three of the following: stm3120, aadA, adl and aac6.

18. The vaccine according to any one of claims 1 to 17, wherein a single bacterial population co-expresses the first and second fusion peptides and optionally the third and fourth fusion peptides.

19. Use of the vaccine according to any one of claim 1 to 18, in the treatment or prevention of cancer wherein the method comprises systemically administering the vaccine to a subject in need thereof and optionally providing a second therapy to a tumor.

20. Use according to claims 19, wherein systemically administering is by parenteral administration.

21. Use according to any one of claims 19 or 20, wherein the second therapy is co-administered.

22. Use according to any one of claims 19 to 21 wherein, providing a second therapy to the tumor is subsequent to systemic clearance or / and selective colonization of a tumor and / or an enhanced immune related activity.

23. Use according to any one of claims 19 to 22, wherein the second therapy is selected from a therapeutic, radiation, chemotherapy, bacterial strain or surgical removal of a tumor.

24. Use according to claim 23, wherein the therapeutic is an immunomodulator administered to the subject or genetically integrated into a bacterial genome and configured for tumor local expression.

25. Use according to any one of claims 19 to 24, wherein systemically administering the vaccine provides for a transient presence of the pathogenic Gram negative bacteria in the circulatory system and extended colonization of a tumor in a subject for a period of at least 20 days.

26. Use according to any one of claims 19 to 25, wherein the bacterial load in circulating blood is less than a 50CFU / gram / mL for 90% of subjects.

27. Use according to any one of claims 18 to 26, wherein an enhanced an immune related activity comprises upregulation of Gamma Delta T-Cells in a host.

28. Use according to any one of claims 19 to 27, wherein the second therapy is a checkpoint inhibitor and an enhanced an immune related activity comprises upregulation of neoantigen-specific T-cells at a tumor, metastasis, a tumor draining lymph node or spleen thereof compared to a response to a or bacteria which does not express a neoantigen.

29. Use according to claim 28, wherein the neoantigen-specific T-cells are neoantigen-specific CD8 T-cells.

30. Use according to any one of claims 19 to 29, wherein the cancer is selected from a list consisting of: colorectal cancer, pancreatic cancer, lung cancer, (specifically squamous lung, and lung adenocarcinoma), ovarian cancer, mesothelioma, glioblastoma, gastric cancer, hepatocellular cancer, renal cell cancer, prostate cancer, cervical cancer, breast cancer, pancreatic cancer, bladder cancer, cervical cancer, bone cancer and melanoma.

31. Use according to any one of claims 19 to 30, wherein the cancer is a metastatic cancer.

32. Use according to any one of claims 19 to 31 , wherein the subject is human.