Vaccine antigen
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- THE MACFARLANE BURNET INST FOR MEDICAL RES & PUBLIC HEALTH LTD
- Filing Date
- 2024-08-15
- Publication Date
- 2026-06-24
AI Technical Summary
Current COVID-19 vaccines face challenges in addressing emerging viral variants due to mutations in the spike protein, leading to reduced efficacy and the need for frequent updates. Additionally, there is a need for improved vaccine antigens with enhanced stability, melting temperature, immunogenicity, antigenicity, and production yield.
The development of a coronavirus vaccine antigen comprising a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond and a C-terminal truncation in the stem region, which stabilizes the prefusion conformation and enhances thermal stability and immunogenicity.
The proposed vaccine antigen achieves improved stability, enhanced immune response, and increased production yield, addressing the limitations of current vaccines in dealing with viral variants and maintaining efficacy over time.
Smart Images

Figure IMGF000092_0001 
Figure IMGF000099_0001 
Figure IMGF000104_0001
Abstract
Description
[0001] VACCINE ANTIGEN FIELD The field of the specification relates broadly to coronavirus vaccine (CoV) antigens and methods of using and manufacturing CoV antigens. The invention also relates to vaccines, kits, devices and strips comprising the CoV antigen. The invention also relates to ribonucleic acids encoding a S protein monomer of a coronavirus vaccine (CoV) antigen and methods of using and manufacturing the ribonucleic acid. The invention also relates to vectors, lipid nanoparticles, RNA vaccines, kits, devices and strips comprising the ribonucleic acid. BACKGROUND The COVID-19 pandemic has caused ~ 770 million infected cases and ~ 7 million deaths, since December 2019. SARS-CoV-2, the coronavirus that causes COVID-19, acquires mutations in its surface spike (S) glycoprotein over time that can enhance transmissibility and enable evasion from protective antibodies induced by prior infection and / or vaccination. Since the start of the pandemic in late 2019, a viral variant periodically emerges that eventually dominates the pandemic by replacing the previous dominant variant (referred to as variants of concern, VOCs). In addition to the ancestral lineage, four successive variant lineages have dominated the pandemic for a period of ~ 6 months before being replaced by a subsequent variant: Alpha (Dec 20-Jul 21), Delta (Apr 20-Feb 22), Omicron BA.1 (Nov 21-May 22), and Omicron BA.2 (Jan-Jul 22). More recent VOCs are sublineages of Omicron BA.2: BA.4 / BA.5 (May 22-Feb 23), BQ.1 (Sep 22-Mar 23), XBB sublineages (Oct 22-23), the current dominant BA.2.86-derived strains, including JN.1, KP.1, KP.2 and KP.3 (Oct 23-present) S is the sole target of protective neutralizing antibodies (NAbs) and thus forms the basis of current licensed SARS CoV-2 vaccines, which deliver full-length S either as mRNA (Pfizer-BioNTech and Moderna) or as recombinant protein reconstituted in an adjuvanted nanoparticle (Novavax). COVID-19 vaccines have saved over 20 million lives since their roll out. To address the emergence of VOCs and variants of interest (VOIs) COVID-19 vaccines are being periodically updated with newly emerged VOC sequences (for example BA.1 in 2022 and BA.4 and XBB in 2023), however a new VOC has usually emerged by the time the vaccine update is rolled out. S is a trimeric integral membrane protein with a membrane spanning sequence at its C- terminal end. The spike comprises S1, the ACE2 receptor-binding subunit, and S2, which mediates virus-cell membrane fusion. S1 and S2 are derived from the trimeric S precursor following cleavage by furin in the producer cell. The S1-S2 trimer of heterodimers forms a well- ordered head domain, with a trio of receptor binding domains (RBDs) at the apex and the S2 trimer towards the bottom (Ke et al., 2020). A 64-amino acid-long stem provides a flexible link between the head domain and membrane spanning sequence, providing orientational mobility to the head when on virions (Turonova et al., 2020). The RBD contains the ACE2 receptor-binding motif (RBM) and is located at the top of the trimer, distal to the viral envelope. On virions, the RBD can be observed in an ‘up’ RBM- exposed conformation or ‘down’ RBM-occluded conformation. The RBD is the immunodominant target of NAbs elicited by infection and / or vaccination but is also the major site where mutations have accumulated in omicron lineage variants (e.g.15, 16 and 22 mutations in BA.1, BA.4 / BA.5, and XBB.1.5 RBDs, respectively). First generation therapeutic NAbs that target epitopes overlapping the RBM have lost their effectiveness against omicron BA.2 lineage subvariants due to mutations in the RBM that also improve ACE2-binding affinity (e.g. K417N, E484K / A, N501Y). Furthermore, the accumulation of mutations in XBB subvariants is associated with increased resistance to serum from vaccinated individuals who have received ancestral S sequences, and in cases where breakthrough infection has occurred with earlier omicron subvariants (Malato et a.,l 2023 and Uraki et al., 2023). The N-terminal domain of S1 (NTD) contains a NAb ‘supersite’ but this is less immunogenic than the RBD. Point mutations, deletions and insertions occurring in the supersite can also lead to escape from NAbs. The S2 subunit is a class I fusion glycoprotein comprising the fusion peptide, a hydrophobic heptad repeat sequence 1 (HR1), a central coiled coil (CH), a second heptad repeat sequence (HR2) within the stem and a membrane-spanning sequence. Following receptor attachment, S2 is cleaved by the TMPRSS2 protease at the cell surface or by cathepsin L following endocytosis to liberate the fusion peptide and enable full fusion activation. The S glycoprotein mediates membrane fusion via a class I mechanism whereby an activation trigger (ACE2-binding by S1, TMPRSS2 cleavage of S2) causes the S2 subunit of the metastable pre- fusion trimer to refold into a stable trimer of hairpins, bringing the N-terminal fusion peptide and C-terminal membrane spanning sequences together such that their associated membranes fuse. S2 contains highly conserved NAb epitopes in the fusion peptide and stem that can elicit antibodies with broad pan-coronavirus neutralizing activity. Current licensed SARS CoV-2 vaccines deliver full-length S either as mRNA (Pfizer- BioNTech, Moderna) or as recombinant protein reconstituted in an adjuvanted nanoparticle (Novavax). The advent of a simple method for producing stable soluble S trimers that can be stored and distributed without the need of an ultracold chain would fill a significant gap in the current arsenal of COVID-19 vaccines. Stabilization of the trimeric quaternary assembly has been achieved by replacing the membrane spanning sequence with a trimerization clamp derived from a foreign, often immunogenic protein. Unfortunately, off-target antibody responses to a trimerization clamp in a Phase I clinical trial halted further development of this vaccine modality. It was previously observed that the S2 glycoprotein subunit contains a central coiled coil with an unusual 3-4 repeat of inward-facing positions mostly occupied by polar residues that mediate few inter-helical contacts in the prefusion trimer. It was found that insertion of bulkier hydrophobic residues (Val and Ile, respectively) to fill a cavity next to Ala1016 and Ala1020 in the 3-4 repeat was associated with increased thermal stability of a prefusion-stabilized S trimer derived from the omicron BA4 / 5 isolate (PCT / AU2022 / 050429 and PCT / AU2022 / 050880). This A1016V / A1020I (VI) glycoprotein variant (S2P.BA45.VI-1208), comprising the entire head domain and stem (residues 16-1208) maintained trimerization following a freeze thaw cycle despite lacking an external trimerization clamp but was obtained in low yield (Poumbourios et al., 2023). Thus, there is a need for improved antigens for eliciting immune responses to coronaviruses. In particular, vaccine antigens with one or more of improved stability, melting temperature, immunogenicity, antigenicity and production yield. SUMMARY OF THE DISCLOSURE In an aspect, the present invention provides a coronavirus (CoV) vaccine antigen comprising a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond. In an embodiment, the non-endogenous inter-protomer disulfide bond is formed between cysteines selected from: i) cysteines at a position corresponding to amino acid numbers 914 and 1123 of SEQ ID NO: 1 or SEQ ID NO: 2 (L23), ii) cysteines at a position corresponding to amino acid numbers 571 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (D17), and iii) cysteines at a position corresponding to amino acid numbers 570 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (I1). In an aspect, the present invention provides a coronavirus (CoV) vaccine antigen comprising a CoV S protein trimer with a C-terminal truncation in the stem region. In an aspect, the present invention provides a protein nanoparticle comprising the coronavirus (CoV) vaccine antigen as described herein. In an aspect, the present invention provides a virus-like particle comprising the coronavirus (CoV) vaccine antigen as described herein. In an aspect, the present invention provides a deoxyribonucleic acid encoding the coronavirus vaccine antigen as described herein. In an aspect, the present invention provides a vector comprising the deoxyribonucleic acid as described herein. In an aspect, the present invention provides a host cell comprising the deoxyribonucleic acid as described herein or the vector as described herein. In an aspect, the present invention provides a method of producing the coronavirus (CoV) vaccine antigen as described herein comprising culturing the host cell as described herein in culture medium to produce the vaccine antigen. In an aspect, the present invention provides a vaccine comprising the coronavirus (CoV) vaccine antigen as described herein, or the protein nanoparticle as described herein, or the virus- like particle as described herein, or the deoxyribonucleic acid as described herein, or the vector as described herein. In an aspect, the present invention provides a vaccine comprising the coronavirus (CoV) vaccine antigen as described herein, or the protein nanoparticle as described herein, or the virus- like particle as described herein. In an aspect, the present invention provides a method of inducing an immune response to a coronavirus (CoV) in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of enhancing the immune response to coronavirus (CoV) in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing the likelihood of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing, or reducing the likelihood or severity of a symptom of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of reducing the severity and / or duration of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing viral shedding in a human individual infected with a coronavirus (CoV), the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides vaccine antigen as described herein or the vaccine as described herein for use in one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. In an aspect, the present invention provides kit, device, surface or strip comprising the coronavirus (CoV) vaccine antigen as described herein. In an aspect, the present invention provides use of the coronavirus (CoV) vaccine antigen as described herein in the manufacture of a medicament for one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. In an aspect, the present invention provides a method of increasing S protein trimer yield comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In an aspect, the present invention provides a method of stabilizing a CoV S protein trimer in a prefusion conformation comprising modifying the CoV S protein trimer to comprise at least one non-endogenous inter-protomer disulfide bond. In an aspect, the present invention provides a method of increasing the melting temperature of a CoV S protein trimer comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In an aspect, the present invention provides a method of increasing the melting temperature of a CoV S protein trimer stabilised in the prefusion conformation comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In an aspect, the present invention provides a method of enhancing neutralising antibody responses comprising modifying the CoV S protein trimer to comprise at least one inter-protomer disulfide bond and / or modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond. In an embodiment, the non-endogenous inter-protomer disulfide bond is formed between cysteines selected from: i) cysteines at a position corresponding to amino acid numbers 914 and 1123 of SEQ ID NO:1 or SEQ ID NO:2 (L23), ii) cysteines at a position corresponding to amino acid numbers 571 and 967 of SEQ ID NO:1 or SEQ ID NO:2 (D17), and iii) cysteines at a position corresponding to amino acid numbers 570 and 967 of SEQ ID NO:1 or SEQ ID NO:2 (I1). In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen is a CoV S protein trimer and wherein the S protein monomer of the CoV S protein trimer has a C-terminal truncation in the stem region. In an aspect, the present invention provides a vector comprising the ribonucleic acid as described herein. In an aspect, the present invention provides a lipid nanoparticle comprising the ribonucleic acid as described herein. In an aspect, the present invention provides a host cell comprising the ribonucleic acid as described herein or the vector as described herein. In an aspect, the present invention provides a method of producing a coronavirus vaccine comprising culturing the host cell as described herein in culture medium to produce the ribonucleic acid described herein. In an aspect, the present invention provides a RNA vaccine comprising the ribonucleic acid as described herein, or the vector as described herein, or the lipid nanoparticle as described herein. In an aspect, the present invention provides a method of inducing an immune response to a CoV in a subject, the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of enhancing the immune response to CoV in a subject, the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing the likelihood of a CoV infection in a subject, the method comprising delivering ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing, or reducing the likelihood or severity of a symptom of a CoV infection in a subject, the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of reducing the severity and / or duration of a CoV infection in a subject, the method comprising delivering the RNA vaccine ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing viral shedding in a human individual infected with a CoV, the method comprising delivering the RNA vaccine ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a ribonucleic acid as described herein or the RNA vaccine as described herein in one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. In an aspect, the present invention provides a kit, device, surface or strip comprising the coronavirus (CoV) ribonucleic acid as described herein. In an aspect, the present invention provides use of the CoV ribonucleic acid as described herein in the manufacture of a medicament for one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. Any embodiment herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise. For instance, as the skilled person would understand examples of non-endogenous inter-protomer disulfide bonds outlined above for the vaccine antigen of the invention equally apply to the ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen. The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein. Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter. The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying figures. BRIEF DESCRIPTION OF THE FIGURES Figure 1 Shows the alignment of the S2P.BA45-1273 amino acid sequence (SEQ ID NO: 2) with that of the corresponding ancestral Hu-1 reference sequence (SEQ ID NO: 1). The amino acid numbering convention is that of Hu-1 and is used throughout this document. The N-terminal domain (NTD) is highlighted in light grey. The receptor-binding domain (RBD) is highlighted in black. ACE2 receptor binding residues within the RBD (i.e. the receptor binding motif, RBM) are in bold text and highlighted in white. The stem region is highlighted in dark grey. Figure 2 Shows the linear schematic of spike showing key structural and functional elements. A) the full-length SARS CoV-2 spike. B) the spike ectodomain comprising the head (amino acids 16-1139) and stem region (amino acids 1140-1207). L: leader peptide; NTD: N- terminal domain; RBD: receptor binding domain; RBM: ACE2 receptor-binding motif; H681RRAR, furin cleavage site; FP: fusion peptide; HR1: heptad repeat 1; CH: central helix; MSS: membrane spanning sequence; tPAL: tissue-plasminogen activator leader; P681GSAS: furin site ablation mutation; 2P: K986P / V987P mutation; VI: A1016V / A1020I mutation. Figure 3 Shows amino acid sequence of expected mature S2P.BA45.VI-1208 glycoprotein (amino acids 16-1208). The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-Gly-Ser-His8 sequence added to spike amino acid 1208 have not been included. Figure 4 Shows DNA sequences corresponding to the expected mature S2P.BA45.VI-1208 glycoprotein. The DNA sequences encoding non-native N-terminal tPAL and linking amino acids (AlaSer), and the C-terminal Gly-Ser-Gly-Ser-His8 sequence have not been included. Figure 5 Shows the 3D structure of the SARS CoV-2 S trimer in the ‘3RBD down’ conformation (drawn with coordinates in PDB ID 6XR8). Shown is the trimeric head domain that is linked via the stem to the membrane spanning sequence. External trimerization clamps derived from foreign proteins (e.g. T4 foldon) are often added to Q1208 (thereby replacing the native membrane anchor) to stabilize the trimeric spike ectodomain in soluble form. Two lengths of the coiled coil at the top of the stem have been resolved in cryo-EM structures of the spike trimer. The last resolved residues are S1147 (e.g. PDB ID 6VSB) or P1162 (e.g. PDB ID 6XR8). The remainder of the stem is flexible and therefore has not been resolved at high resolution. Figure 6 Shows sequences of the stem region of coronaviruses. A) Amino acid sequence of the SARS CoV-2 spike glycoprotein stem, amino acids 1140-1207 (SEQ ID NO: 137). Hydrophobic repeat residues are shaded in grey, potential N-linked glycosylation sites in black. Stem truncation points described in this document are indicated with vertical lines and the C-terminal amino acid is underlined and numbered. B) Alignment of stem sequences of betacoronaviruses (SEQ ID NOs: 137-142). Identical amino acids are shaded dark grey, similar amino acids are shaded light grey. Potential N-linked glycosylation sites in black. SARS CoV-2 stem truncation points analysed in this study are indicated with vertical lines and the C-terminal amino acid is numbered. Figure 7 Shows the amino acid sequences of expected mature S2P.BA45.VI glycoprotein stem truncation mutants. The Gly-Ser-His6 sequence added to the C-terminal amino acid of the spike truncation mutants has not been included. Figure 8 Shows DNA sequences corresponding to the expected mature S2P.BA45.VI glycoprotein stem truncation mutants. The DNA sequence encoding non-native N-terminal tPAL and linking amino acids (AlaSer), and the C-terminal Gly-Ser-His6 sequence have not been included. Figure 9 Shows the biochemical characteristics of secreted prefusion-stabilized omicron BA.4 / BA.5 trimers containing the VI mutation (S2P.BA45.VI) terminating at S1147, K1157, D1165, N1192, D1199, L1200, Q1201, G1204 and Q1208. A) Superose 6 size exclusion chromatography (SEC) of total secreted spike protein obtained from 50 ml of Expi293F culture by affinity purification on TALON resin. The molecular weight markers are thyroglobulin (669 kDa), ferritin (440 kDa), aldolase (158 kDa) and ovalbumin (43 kDa). B) SEC of purified trimeric Spike. The fractions within the dotted vertical lines in A) were pooled, concentrated and then re- chromatographed following a freeze (-80°C)-thaw cycle. The vertical dashed lines indicate the elution volume. C) Melting temperature of purified Spike trimers determined by differential scanning fluorimetry (DSF). D) Yield, elution volume and Tm of purified trimers. Figure 10 Shows the SDS-PAGE of purified spike trimers shown in Figure 9 in the absence (left panel) and presence (right panel) of reducing agent (betamercaptoethanol). The number of the C-terminal amino acid of each spike construct is shown above each lane. S, spike protein. Figure 11 Shows the plot of trimer yield and Tm as a function of C-terminal length. Data from Figure 9. Figure 12 Shows the antigenic characteristic of purified spike trimers determined in biolayer interferometry with neutralizing ligands directed to the NTD: C1520, RBM: ACE2-Fc, Omi-18 and Omi-42; RBD excluding the RBM: S2H97, SP1-77; FP: COV44-79; and to residues 1149-1167 of the stem: CV3-25. The neutralizing ligands were immobilized on anti-human IgG Fc capture biosensors and the spike trimers were in the analyte phase. Association was for the first 300 sec and dissociation was for the second 300 sec. The C-terminal amino acid of spike constructs is shown to the left of each panel. Top line 30 nM spike. Middle line 10 nM spike. Bottom line 3 nM spike. Figure 13 Shows the relative binding of spike ligands to S2P.BA45.VI stem truncation mutants. Response (nm) at binding equilibrium (Req) is plotted as a function of C- terminal length. The C-terminal amino acid of spike constructs is shown at the bottom of each panel. The data are from Figure 12. Figure 14 Shows the location of paired Cys substitutions in the omicron BA.4 S6P trimer. The model was drawn with PYMOL using the coordinates PDB ID 7XNQ. The amino acid pairs that were replaced with Cys are shown in CPK and identified by the code used in Table 2. Figure 15 Shows the amino acid sequences of expected mature S2P.BA45.VI-1147 Cys substitution mutants. The mutants are coded according to Table 2 and Figure 14. SARS CoV-2 omicron BA.4 / omicron BA.5 sequences are shown. The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 16 Shows the DNA sequences corresponding to the expected mature S2P.BA45.VI-1147 Cys substitution mutants. The mutants are coded according to Table 2 and Figure 13. Only SARS CoV-2 omicron BA.4 / omicron BA.5 sequences are shown. The DNA sequences encoding the non-native N-terminal tPAL and linking amino acids (AlaSer), and the C-terminal Gly-Ser-His6 sequence have not been included. Figure 17 Shows the biochemical characteristics of secreted Cys-substituted S2P.BA45.VI-1147 proteins. A) Superose 6 size exclusion chromatography (SEC) of total secreted S2P.BA45.VI-1147 proteins following affinity purification using TALON resin. B) SEC of purified trimeric Spikes. The fractions within the dotted vertical lines in A) were pooled, concentrated and then re-chromatographed following a freeze (-80°C)-thaw cycle. The molecular weight markers are thyroglobulin (669 kDa) and ferritin (440 kDa), C) Melting temperature of purified Spike trimers determined in DSF. D) trimer yield and Tm. Figure 18 Shows the SDS-PAGE of purified S2P.BA45.VI-1147, I1, D17 and L23 spike trimers in the absence (left panel) and presence (right panel) of reducing agent (betamercaptoethanol). S2P3: 3 spike monomers are disulfide linked; S2P2: 2 spike monomers are disulfide linked; S2P1: spike monomer. Figure 19 Shows the amino acid sequences of expected mature S2P.BA45.VI-1192 and S2P.BA45.VI-1204 Cys substitution mutants. The mutants are coded according to Table 2 and Figure 14. The non-native N-terminal tPAL and linking amino acids (AlaSer), and C- terminal Gly-Ser-His6 sequence have not been included. Figure 20 Shows the DNA sequences corresponding to the expected mature S2P.BA45.VI-1192 and S2P.BA45.VI-1204 Cys substitution mutants. The mutants are coded according to Table 2 and Figure 13. The DNA sequences encoding the non-native N-terminal tPAL and linking amino acids (AlaSer), and the C-terminal Gly-Ser-His6 sequence have not been included. Figure 21 Shows the Biochemical characteristics of secreted S2P.BA45.VI-1192 and S2P.BA45.VI-1204 proteins carrying the D17, I1 and L23 mutations. A) Superose 6 SEC of total secreted S2P.BA45.VI-1192 spike variants following affinity purification using TALON resin. The molecular weight markers are thyroglobulin (669 kDa), ferritin (440 kDa), aldolase (158 kDa). B) The fractions within the dotted vertical lines in A) were pooled, concentrated and then subjected to DSF to obtain Tms. inset: yields of trimer from 50 ml of culture, elution volume and Tms are listed. C) SDS-PAGE under nonreducing and reducing conditions. dsl-Spike, disulfide- linked spike; mon-spike; spike monomer. D) Superose 6 SEC of total secreted S2P.BA45.VI- 1204 spike variants following affinity purification using TALON resin. E) DSF of S2P.BA45.VI- 1204 spike trimers obtained from D) Inset: trimer yield / 50 ml culture, elution volume and Tm is listed. F) Non-reducing and reducing SDS-PAGE of purified S2P.BA45.VI-1204 spike variant trimers. dsl-Spike: disulfide-linked spike. mon-Spike: Spike monomer. Figure 22 Shows the antigenic characteristics of purified S2P.BA45.VI-1192 spike trimers bearing the D17 and I1 mutations determined in biolayer interferometry with neutralizing ligands directed to the NTD: C1520, RBM: ACE2-Fc, Omi-18 and Omi-42; RBD excluding the RBM: S2H97, SP1-77; FP: COV44-79; and to residues 1149-1167 of the stem: CV3-25. The neutralizing ligands were immobilized on anti-human IgG Fc capture biosensors and the spike trimers were in the analyte phase. Association was for the first 300 sec and dissociation was for the second 300 sec. Top line indicates the 30 nM spike, middle line indicates the 10 nM spike and bottom line indicates the 3 nM spike. The orientation of the ACE2 extracellular domain (ECD) and Fab segment of IgG molecules in relation to the RBM (shown in CPK) and RBD flanks is shown at left adjacent to the corresponding ligand’s designation. Figure 23 Shows the amino acid sequences of expected mature S2P.BA45.AA-1192 glycoproteins carrying the D17, I1 and L23 mutations in which the A1016V / A1020I (VI) mutation was reverted to Ala1016 / Ala1020 (AA). The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 24 Shows the DNA sequences corresponding to the expected mature S2P.BA45.AA-1192 glycoproteins carrying the D17, I1 and L23 mutations in which the A1016V / A1020I (VI) mutation was reverted to Ala1016 / Ala1020 (AA). The DNA sequence encoding the C-terminal Gly-Ser-His6 sequence has not been included. Figure 25 Shows the biochemical characteristics of secreted S2P.BA45.AA-1192 glycoproteins carrying the D17, I1 and L23 mutations in which the A1016V / A1020I (VI) mutation is reverted to Ala1016 / Ala1020. A) Superose 6 SEC of total secreted S2P.BA45.AA- 1192 spike variants following affinity purification using TALON resin. B) SEC of purified trimeric Spikes. The fractions within the dotted vertical lines in A were pooled, concentrated and then re- chromatographed following a freeze (-80°C)-thaw cycle. C) Melting temperature of purified Spike trimers determined by DSF. inset: yields of trimer from 50 ml of culture and Tms are listed. D) SDS-PAGE under nonreducing and reducing conditions. m, markers; dsl-Spike, disulfide-linked spike; mon-spike; spike monomer. Figure 26 Shows the effects of betamercaptoethanol on the Tm of D17 and I1-1192 constructs with and without the VI mutation determined by DSF. Figure 27 Shows the comparison of the reactivity of purified S2P.BA45.VI-1192 and S2P.BA45.AA-1192 spike trimers bearing the D17 and I1 with neutralizing ligands in BLI. The neutralizing ligands were immobilized on anti-human IgG Fc capture biosensors and the spike trimers (30 nM) were in the analyte phase. Association was for the first 300 sec and dissociation was for the second 300 sec. Figure 28 Shows the amino acid sequences of expected mature S2P.BA45-1192 spike glycoproteins in which the D17 and I1 mutations were combined with L23 to give DL and IL, respectively. The non-native N-terminal tPAL and linking amino acids (AlaSer), and C- terminal Gly-Ser-His6 sequence have not been included. Figure 29 Shows the DNA sequences corresponding to the expected mature S2P.BA45-1192 spike glycoproteins in which the D17 and I1 mutations were combined with L23 (DL and IL, respectively). The DNA sequence s encoding the non-native N-terminal tPAL and linking amino acids (AlaSer), and the C-terminal Gly-Ser-His6 sequence have not been included. Figure 30 Shows the biochemical characteristics of secreted S2P.BA45-1192 glycoproteins in which the D17 and I1 mutations were combined with L23 in the presence and absence of the VI mutation. A) Superose 6 SEC of total secreted S2P.BA45.VI-1192 spike variants following affinity purification using TALON resin. B) SEC of purified trimeric Spikes. The fractions within the dotted vertical lines in A) were pooled, concentrated and then re- chromatographed following a freeze (-80°C)-thaw cycle. nd: not determined. C) Melting temperature of purified Spike trimers determined by DSF. nd: not determined. inset: yields of trimer from 50 ml of culture and Tms are listed. D) SDS-PAGE under non-reducing and reducing conditions. m, markers; dsl-Spike, disulfide-linked spike; mon-spike; spike monomer. Figure 31 Shows the amino acid sequences of expected mature spike glycoproteins carrying the D17 and I1 mutations in which the 2P mutation has been reverted to the native amino acids Lys986Val987 (SnoP). The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 32 Shows the DNA sequences corresponding to the expected mature expected mature spike glycoproteins carrying the D17 and I1 mutations in which the 2P mutation has been reverted to the native amino acids, Lys986Val987 (SnoP). The DNA sequences encoding the non-native N-terminal tPAL and linking amino acids (AlaSer), and the C-terminal Gly-Ser-His6 sequence have not been included. Figure 33 Shows the biochemical characteristics of secreted omicron BA45.VI- 1192 and BA45.AA-1192 glycoproteins in which the 2P mutation has been reverted to the native amino acids Val986Lys987 (referred to as SnoP). A) Superose 6 SEC of total secreted omicron BA4 / 5 S2P and SnoP glycoproteins following affinity purification using TALON resin. B) SEC of purified trimeric Spikes. The fractions within the dotted vertical lines in A) were pooled, concentrated and then re-chromatographed following a freeze (-80°C)-thaw cycle. C) Melting temperature of purified Spike trimers determined by DSF. D) inset: yields of trimer from 50 ml of culture and Tms are listed. Figure 34 Shows the SDS-PAGE under nonreducing and reducing conditions of omicron BA45.VI-1192 and BA45.AA-1192 glycoproteins in which the 2P mutation has been reverted to the native amino acids Val986Lys987 (SnoP). m, markers; dsl-Spike, disulfide-linked spike; mon-spike; spike monomer. Figure 35 Shows the amino acid sequences of full-length spike glycoproteins (amino acids 1-1273) carrying the D17, I1, L23, DL and IL in addition to the 2P and furin site mutations. ‘VI’ indicates that the VI mutation is present. Figure 36 Shows the DNA sequences corresponding to full-length spike glycoproteins (amino acids 1-1273) carrying the D17, I1, L23, DL and IL in addition to the 2P and furin site mutations. ‘VI’ indicates that the VI mutation is present. Figure 37 Shows the SDS-PAGE / western blot analysis of S2P.BA45.VI-1273 glycoproteins containing the D17, I1, L23, DL and IL Cys mutations derived from transfected 293T cell lysates under non-reducing (left) and reducing (right) conditions. VI: constructs containing Val and Ile at amino acid positions 1016 and 1020, respectively. If VI is not indicated, the proteins have Ala at positions 1016 and 1020. The samples were electrophoresed on 3-8% SDS-PAGE gels, transferred to nitrocellulose and blotted with rabbit anti-S1 and anti- rabbit IRDye 800. m, markers; dsl-Spike, disulfide-linked spike; mon-spike; spike monomer. Figure 38 Shows binding of ACE2-Fc and human monoclonal NAbs to S2P.BA45.VI-1273, D17.VI-1273 and I1.VI-1273 glycoproteins expressed on the surface of transfected 293T cells as determined by FACS. A) The transfected cells were gently detached from culture plates and the intact cells were stained with ACE2-Fc and various human monoclonal NAbs and AlexaFluor-conjugated anti-human immunoglobulin. The cells were counterstained with LIVE / DEAD stain to enable the exclusion of dead cells from analyses. EGFP / S2P.BA45.VI-1273 variant glycoprotein double-positive cells that were outside the negative population of cells were analysed for fluorescence intensity. HCV1 is an HCV-specific NAb and is used as an isotype (IgG1) control. B) Shows the geometric means of the fluorescence intensity in the histograms shown in Figure 38A. Figure 39 Shows the amino acid sequences of expected mature S6P.BA45.AA-1192 glycoproteins carrying the D17 and I1 mutations. ‘VI’ indicates that the VI mutation is present. The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 40 Shows the amino acid sequences of expected mature S6P.BA45.AA-1192 glycoproteins carrying the D17 and I1 mutations. ‘VI’ indicates that the VI mutation is present. The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 41 Shows the biochemical characteristics of secreted S2P.BA45-1192 and S6P.BA45-1192 glycoproteins carrying the D17 and I1 mutations. A) Superose 6 SEC of total secreted S2P.BA45-1192 and S6P.BA45-1192 spike variants following affinity purification using TALON resin. B) SEC of purified trimeric Spikes. The fractions within the dotted vertical lines in A were pooled, concentrated and then re-chromatographed following a freeze (-80°C)- thaw cycle. C) Melting temperature of purified S2P.BA45-1192 (dashed line) and S6P.BA45- 1192 (solid line) trimers determined by DSF. Melting temperatures are indicated above the graphs. D) SDS-PAGE under nonreducing (top panel) and reducing (bottom panel) conditions. m, markers; dsl-Spike, disulfide-linked spike; mon-spike; spike monomer. Figure 42 Shows the antigenic characteristic of purified S6P.BA45-1192 spike trimers determined in biolayer interferometry with neutralizing ligands directed to the NTD: C1520, RBM: ACE2-Fc, Omi-18, Omi-42, SA55; RBD excluding the RBM: S2H97, SP1- 77, S309; and to the stem: CV3-25, CC99-103, CC95-108. The neutralizing ligands were immobilized on anti-human IgG Fc capture biosensors and the spike trimers were in the analyte phase. Association was for the first 300 sec and dissociation was for the second 300 sec. Top black line 30 nM spike. Middle line 10 nM spike. Bottom grey line 3 nM spike. Figure 43 Projection of ACE2 and RBM directed NAb epitopes on open and closed spike trimers. Amino acids contributing to epitopes are shown in CPK mode. The coordinates used to draw open and closed structures are PDB ID 6VSB and 6XR8, respectively. The 3D models were drawn with PyMOL. Figure 44 Shows the K18-hACE2 mouse immunization-virus challenge protocol. Figure 45 Shows the replication of Omicron BA.5 virus in mice immunized 3 times with experimental vaccines after infection with 104TCID50 of SARS CoV-2 BA.5 virus. Virus titres in the nasal turbinates (NT) and lungs of 8 mice per group obtained on day 4 postinfection are expressed as log10 TCID50 (50% tissue culture infectious dose) / mL (NTs) and log10 TCID50 / organ (lungs). Horizontal bars represent geometric mean titres, and symbols represent titres from individual mice. The lower limit of detection is 100.5 TCID50 per mL for the NTs and 100.8 TCID50 per organ for lungs. *** P < 0.001; **** P < 0.0001 versus vehicle group; Kruskal- Wallis test with Dunn’s post test Figure 46 Shows antibody responses in mice after 2 (week 6) and 3 (week 8) immunizations with the experimental vaccines indicated above the graphs. A) Neutralisation assays performed in high-throughput format with authentic SARS-CoV-2 omicron BA.5 virus. The geometric mean neutralization ID50 of the control group receiving 3 doses of 50% Addavax-PBS was <1 / 20 (dotted line). B) ELISA binding titres to the BA.5 RBD and C) to S6P.BA45.AA-1192 trimers. The endpoint was determined as 50-times background luciferase activity obtained in the absence of primary antibody. The horizontal dotted line is the geometric mean binding titre of the control group receiving 3 doses of 50% Addavax-PBS. A Wilcoxon rank test was used to determine whether the differences in ID50s and binding titres observed with week 6 and week 8 sera are significant: ns, not significant; *, P < 0.05; **, P < 0.01: ***, P < 0.001; ****, P < 0.0001. Figure 47 Lists the amino acid changes present in omicron BA.5, XBB.1.5, BA.2.86 and JN.1 spike glycoproteins relative to the ancestral Hu-1 spike glycoprotein. Del: deletion; ins: insertion. Amino acid numbering is according to the Hu-1 reference sequence. Figure 48 Shows the neutralization activity of sera obtained after 3 immunizations with experimental vaccines. The authentic SARS-CoV-2 variants used in the neutralization assays are shown above the graphs. The vehicle control and vaccine groups are indicated below the x axis. Neutralisation assays performed in high-throughput format. Horizontal bars are the geometric mean ID50s for each immunogen group. The geometric mean neutralization ID50 of the control (vehicle) group receiving 3 doses of 50% Addavax-PBS was <1 / 20 for all viral variants (dotted line). A Kruskal-Wallis test was used to determine whether the differences in ID50s observed between animal groups are significant: ns, not significant; *, P < 0.05; **, P < 0.01: ***, P < 0.001; ****, P < 0.0001. Figure 49 Shows ELISA binding titres of sera obtained after 3 immunizations with experimental vaccines to RBDs derived from ancestral, Omicron BA.5, XBB and JN.1 variants. The variant RBDs are indicated above the graphs and the vehicle control and vaccine groups are indicated below the x axis. The endpoint was determined as 50-times background luciferase activity obtained in the absence of primary antibody. The horizontal bars are the geometric means. A Kruskal-Wallis test was used to determine whether the differences in binding titres are significant. ns, not significant; *, P < 0.05; **, P < 0.01: ***, P < 0.001; ****, P < 0.0001. Figure 50 Shows ELISA binding titres of sera obtained after 3 immunizations with experimental vaccines to NTDs derived from ancestral, Omicron BA.5, and JN.1 variants. The variant NTDs are indicated above the graphs and the vehicle control and vaccine groups are indicated below the x axis. The endpoint was determined as 50-times background luciferase activity obtained in the absence of primary antibody. The horizontal bars are the geometric means. A Kruskal-Wallis test was used to determine whether the differences in binding titres are significant. ns, not significant; *, P < 0.05; **, P < 0.01: ***, P < 0.001; ****, P < 0.0001. Figure 51 Shows ELISA binding titres of sera obtained after 3 immunizations with experimental vaccines to Spike protein fragments. A) Stem synthetic peptide (S amino acids 1138-1165); B) maltose-binding protein-(S amino acids 1138-1208) chimeric protein; C) synthetic fusion peptide (S amino acids 808-832). The vehicle control and vaccine groups are indicated below the x axis. The endpoint was determined as 50-times background luciferase activity obtained in the absence of primary antibody. The horizontal bars are the geometric means. A Kruskal-Wallis test was used to determine whether the differences in binding titres are significant. ns, not significant; *, P < 0.05; ****, P < 0.0001. Figure 52 Summarises the data presented in Figures 45-51 (excluding Figure 46). The lines within each graph link the geometric mean TCID50s (viral load in tissue) ID50s (virus neutralization titre) or binding titre (right hand side panels). Individual symbols represent titres of individual animals. A Kruskal-Wallis test with Dunn’s post-test was used to determine whether the differences in binding titres of animal groups immunised with glycoprotein vaccine are significantly different to the vehicle control group. ns, not significant; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. Figure 53 Shows the amino acid sequences of expected omicron BA.2.86 mature spike glycoproteins carrying the D17 and I1 mutations in addition to the 6P mutation. The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 54 Shows the DNA sequences of expected omicron BA.2.86 mature spike glycoproteins carrying the D17 and I1 mutations in addition to the 6P mutation. The non- native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 55 Shows the biochemical characteristics of secreted S6P.BA286-1192 glycoproteins carrying the D17 and I1 mutations. A) Superose 6 SEC of total secreted S6P.BA286-1192 spike variants following affinity purification using TALON resin. B) SEC of purified trimeric Spikes following a freeze (-80°C)-thaw cycle. C) Melting temperature of purified S6P.BA286-1192 trimers determined by DSF. Melting temperatures are indicated above the graphs. D) SDS-PAGE under nonreducing and reducing conditions. m, markers; dslS, disulfide- linked spike; monS; spike monomer. Figure 56 Shows the antigenic characteristics of purified S6P.BA286 -1192 spike trimers bearing the D17 and I1 mutations determined in BLI with neutralizing ligands. Ligands are directed to the NTD: C1520, RBM: ACE2-Fc, Omi-18 and Omi-42; RBD excluding the RBM: S2H97, SP1-77; and to residues 1149-1167 of the stem: CV3-25, CC95-108, CC99- 103. The neutralizing ligands were immobilized on anti-human IgG Fc capture biosensors and the spike trimers (30 nM) were in the analyte phase. Association was for the first 300 sec and dissociation was for the second 300 sec. Dashed grey line: S6P.BA286.AA-1192; solid black line S6P.BA286.D17.AA-1192; solid grey line: S6P.BA286.I1.VI-1192. Figure 57 Shows a maximum likelihood phylogenetic tree of sarbecovirus spike amino acid sequences. The spike sequences segregate into 4 clades: 1a which includes SARS CoV; 1b, which includes SARS CoV-2, 2 and 3. The amino acid identity of representative isolates from each clade (enclosed by grey box) relative to omicron BA.5 is shown. Clades 1a, 1b and 3 utilise ACE2 as an entry receptor whereas clade 2 viruses do not due to a deletion in the RBD. The tree was constructed using MEGA X. Figure 58 Shows the location of D17- and I1-equivalent mutational targets in spike 3D structures. A) D17 and I1 mutational targets in the SARS CoV-2 spike (PDB ID 6XR8). B), C), D) close up of the D17 and I1 mutational targets in PRD-0038 (PDB ID 8U29), WIV1 (PDB ID 8TC0) and BANAL-20-236 (PDB ID 8I3W), respectively. Figure 59 Shows the amino acid sequences of expected omicron PRD-0038 mature spike glycoproteins carrying the D17 and I1 mutations in addition to the 6P mutation. The non-native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 60 Shows the DNA sequences of expected PRD-0038 mature spike glycoproteins carrying the D17 and I1 mutations in addition to the 6P mutation. The non- native N-terminal tPAL and linking amino acids (AlaSer), and C-terminal Gly-Ser-His6 sequence have not been included. Figure 61 Shows the biochemical characteristics of secreted S6P.PRD-1192 glycoproteins carrying the D17 and I1 mutations. A) Superose 6 SEC of total secreted S6P.BA286-1192 spike variants following affinity purification using TALON resin. B) Melting temperatures of purified S6P.BA286-1192 trimers determined by DSF. Melting temperatures are indicated above the graphs. C) SDS-PAGE under nonreducing and reducing conditions. m, markers; dslS, disulfide-linked spike; monS; spike monomer. Figure 62 Shows the antigenic characteristics of purified S6P.PRD-1192 spike trimers bearing the D17 and I1 mutations determined in BLI with neutralizing ligands. Ligands are directed to the RBD: CR3022, and stem: CV3-25, S2P6, CC40.8, CC95-108, CC99- 103. The neutralizing ligands were immobilized on anti-human IgG Fc capture biosensors and the spike trimers were in the analyte phase. Association was for the first 300 sec and dissociation was for the second 300 sec. Thick black line: 30 nM analyte, thick grey line, 10 nM analyte, thin grey line, 3 nM analyte. KD values are shown at the top right of each sensogram. Figure 63 Shows the biochemical characteristics of secreted S6P.BA286-1192 glycoproteins carrying the D17 and I1 mutations expressed from mRNA. A) Superose 6 SEC of total secreted S6P.BA286-1192 spike variants following affinity purification using TALON resin. B) Melting temperatures of purified S6P.BA286-1192 trimers determined by DSF. Melting temperatures are indicated above the graphs. C) SDS-PAGE under nonreducing and reducing conditions. m, markers; dslS, disulfide-linked spike; monS; spike monomer. Figure 64 Shows the antigenic characteristics of purified S6P.BA286-1192 spike trimers bearing the D17 and I1 mutations expressed from mRNA and determined in BLI with neutralizing ligands. Ligands are directed to the NTD: C1520, RBM: ACE2-Fc, Omi-18 and Omi-42; RBD excluding the RBM: S2H97, SP1-77; and to residues 1149-1167 of the stem: CV3-25. The neutralizing ligands were immobilized on anti-human IgG Fc capture biosensors and the spike trimers were in the analyte phase. Association was for the first 300 sec and dissociation was for the second 300 sec. Dashed grey line: S6P.BA286.AA-1192; solid black line S6P.BA286.D17.AA-1192; solid grey line: S6P.BA286.I1.VI-1192. Figure 65 Shows amino acid sequences of full-length spike glycoproteins (amino acids 1-1273) carrying the D17 and I1 mutations, in addition to the 6P and furin site mutations. ‘VI’ indicates that the VI mutation is present. Figure 66 Shows DNA sequences of full-length spike glycoproteins (amino acids 1-1273) carrying the D17 and I1 mutations, in addition to the 6P and furin site mutations. ‘VI’ indicates that the VI mutation is present. Figure 67 Shows expression of full-length membrane-anchored S6P-1273 spike proteins from mRNA and DNA as revealed by western blotting. mRNA encoding S6P.BA286- 1273 glycoproteins carrying the D17 and I1 mutations and DNA encoding S6P.BA45-1273 glycoproteins carrying the D17 and I1 mutations were transfected into 293T cells. At 48 h post infection, the cells were lysed and subjected to SDS-PAGE under nonreducing or reducing conditions followed by western blotting with sera from a guinea pig immunised with Spike trimer. The blot was revealed with peroxidase conjugated anti-guinea pig immunoglobulin and chemiluminescence. m, markers; dslS, disulfide-linked spike; monS; spike monomer. Figure 68 Shows binding of ACE2-Fc and human monoclonal NAbs to S6P.BA45.AA-1273, S6P.BA45.D17.AA-1273 and S6P.BA45.I1.VI-1273 glycoproteins expressed on the surface of transfected 293T cells as determined by flow cytometry. A) The transfected cells were gently detached from culture plates and the intact cells were stained with ACE2-Fc and various human monoclonal NAbs and AlexaFluor-conjugated anti-human immunoglobulin. The cells were counterstained with LIVE / DEAD stain to enable the exclusion of dead cells from analyses. EGFP / S6P.BA45-1273 variant glycoprotein double-positive cells that were outside the negative population of cells were analysed for fluorescence intensity. HC33.1 is an HCV-specific NAb and is used as an isotype (IgG1) control. B) Shows the geometric means of the fluorescence intensity in the histograms shown in Figure 60A. Figure 69 Shows binding of ACE2-Fc and human monoclonal NAbs to S6P.BA45.AA-1273, S6P.BA45.D17.AA-1273 and S6P.BA45.I1.VI-1273 glycoproteins expressed from mRNA on the surface of transfected 293T cells as determined by flow cytometry. A) The mRNA transfected cells were gently detached from culture plates and the intact cells were stained with ACE2-Fc and various human monoclonal NAbs and AlexaFluor- conjugated anti-human immunoglobulin. The cells were counterstained with LIVE / DEAD stain to enable the exclusion of dead cells from analyses. EGFP / S6P.BA45-1273 variant glycoprotein double-positive cells that were outside the negative population of cells were analysed for fluorescence intensity. HC33.1 is an HCV-specific NAb and is used as an isotype (IgG1) control. B) Shows the geometric means of the fluorescence intensity in the histograms shown in Figure 61A. Figure 70 Shows how D17 and I1 mutations affect the ability of S6P.BA45-1273 to mediate entry of luciferase reporter HIV pseudotypes into 293-AC2 cells. Luciferase reporter HIV particles were pseudotyped with wild type or S6P variants by transfection of 293T cells. At 48 h post transfection, the virus containing supernatants were used to infect 293-ACE2 cells. The 293-ACE2 cells were lysed 72 h later and luciferase activity determined. The data are the means ± standard error of the means from 3 independent transfections. ns, not significant; *, P < 0.05; **, P < 0.01 S6P.BA45.AA-1273 (S6P) versus S6P.BA45.D17.AA-1273 (S6P.D17.AA), S6P.BA45.D17.VI-1273 (S6P.D17.VI), S6P.BA45.I1.AA-1273 (S6P.I1.AA), S6P.BA45.I1.VI- 1273 (S6P.I1.VI). KEY TO SEQUENCE LISTING DISCUSSION OF EMBODIMENTS Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Any materials and methods similar or equivalent to those described herein can be used to practice or test the present disclosure. Practitioners are particularly directed to Ausubel et al., Current Protocols in Molecular Biology, Supplement 47, John Wiley & Sons, New York, 1999; Colowick and Kaplan, eds., Methods In Enzymology, Academic Press, Inc.; Weir and Blackwell, eds., Handbook of Experimental Immunology, Vols. I-IV, Blackwell Scientific Publications, 1986; Kontermann and Dubel (Ed), Antibody Engineering,Vol 1-2, Ed., Springer Press, 2010) for definitions and terms of the art and other methods known to the person skilled in the art. Reference to any prior art in this specification is not, and should not be taken as, acknowledgement or any form of suggestion that this prior art forms part of the common general knowledge in any country. The term "and / or", e.g., "X and / or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning. As used herein, the term “about”, unless stated to the contrary, refers to + / - 10%, more preferably + / - 5%, even more preferably + / - 1%, of the designated value. Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. As used herein, the singular form "a", "an" and "the" include singular and plural references unless the context indicates otherwise. Each embodiment in this specification is to be applied mutatis mutandis to every other embodiment unless expressly stated otherwise. Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO: 1), <400>2 (SEQ ID NO: 2), etc. A sequence listing is provided after the claims. The sequence of Coronavirus Spike (S) protein from the ancestral Hu-1 strain is described by Wu et al., 2020 and in NCBI Reference Sequence: YP_009724390.1. This strain may also be referred to as "wild-type", “ancestral” and "parental" strain herein. As used herein “antigen” refers to a substance capable of stimulating an immune response. As used herein, “protomer” refers to the basic structural unit of an oligomeric protein (e.g. the S protein monomer of an S protein trimer). In some embodiments, protomers can be chemically linked (e.g. via disulfide bond) to form or stabilise part of an oligomeric structure (e.g. three S protein monomers can be linked to form S protein trimer oligomeric structure). It would be clear to a person skilled in the art that an S protein trimer comprises three protomers. As used herein, “endogenous” refers to developing or originating within a virus. As used herein, “non-endogenous” refers to something that has not developed or originated within a virus (e.g. something that a virus has been altered to comprise e.g. something that is man-made). As used herein, “melting temperature” refers to the temperature at which 50% of a protein is unfolded. Temperature can break the chemical interactions that hold a protein structure in shape. Accordingly, melting temperature can be used to reflect or indicate the stability of a protein. In an embodiment, melting temperature can be determined using differential scanning fluorimetry (DSF). As used herein, “signal sequence” refers to the residues corresponding to 1 to 15 of SEQ ID NO: 1 or SEQ ID NO: 2. As used herein, “N-terminal domain” or “NTD” refers to the residues corresponding to 16 to 305 of SEQ ID NO: 1 or SEQ ID NO: 2. As used herein, the “receptor binding domain” or “RBD” refers to the residues corresponding to 335 to 415, 418 to 433, and 507 to 520 of SEQ ID NO: 1 or SEQ ID NO: 2. As used herein, “receptor binding motif“ or “RBM:” refers to the residues corresponding to 417, 446, 449, 453, 455, 456, 475, 486, 487, 489, 493, 496, 498, 500, 501, 502 and 505 of SEQ ID NO: 1 or SEQ ID NO: 2. As used herein, “flanks of the RBD” refers to the portion of the RBD that supports the RBM at the apex. As used herein, “stem region” refers to the residues corresponding to 1140 to 1207 of SEQ ID: NO: 1. In an embodiment, the stem region comprises the residues corresponding to 1140 to 1204 of SEQ ID NO: 1 or SEQ ID NO: 2. As used herein, “trimerization sequence” refers to a sequence found at the C terminal region of the S-protein monomers which facilitates trimerization of the S protein trimer. In some embodiments, the trimerization domain is a heterologous sequence, not found within coronaviruses. In one embodiment, the trimerization sequence is a heterologous sequence, not found within SARS-COV2. In some embodiments, the trimerization sequence is the trimeric foldon domain of bacteriophage T4 fibritin or a modified version thereof. In some embodiments, the trimerization sequence is a coiled-coil, an artificial coiled-coil or a modified coiled-coil. In some embodiments, the trimerization sequences was designed de novo. In some embodiments, the trimerization sequence is a trimeric foldon domain of bacteriophage T4 fibritin or a modified version thereof. In some embodiments, the trimerization sequence is a native CoV trimerization sequence (in some embodiments this is the native transmembrane domain). In some embodiments, the trimerization sequence comprises or consists of residues 1209 to 1256 of the S protein monomer. In some embodiments, the trimerization sequence comprises or consists of residues 1217 to 1237 of the S protein monomer. As used herein, “truncation” refers to shortening a molecule by removing a portion of it. In an embodiment, the molecule is a protein and the truncation is at the C-terminal end of the protein sequence. In some embodiments, the truncation removes at least part of the trimerization sequence. As used herein, the term “increase” or “increases” or “increased” or “increasing” refers to having a higher or greater level of a given parameter compared to the level of a given parameter at baseline or compared to a control. As used herein, “a control” refers to a standard of comparison for checking the results of a survey or experiment. In an embodiment, the control is a vaccine antigen lacking one or more of: i) the non-endogenous inter-promoter disulfide bond, ii) the C-terminal truncation in the stem region and iii) the structural modification which reduces the size of the alanine cavity in the coiled- coil region of the S protein trimer. In an embodiment, the control is a vaccine antigen lacking the non-endogenous inter-promoter disulfide bond. In an embodiment, the control is a vaccine antigen lacking the C-terminal truncation in the stem region. In an embodiment, the control is a vaccine antigen lacking the structural modification which reduces the size of the alanine cavity in the coiled-coil region of the S protein trimer. As used herein, the term “reduce” or “reduces” or “reduced” or “reducing” refers to having a lower or lesser level of a given parameter compared to the level of a given parameter at baseline or compared to a control. As used herein, the term “epitope” refers to particular peptide sequences on a molecule that are antigenic, such that they elicit a specific immune response. An epitope is the region of an antigen to which B and / or T cells respond. An antibody can bind to a particular antigenic epitope which may be formed both from contiguous amino acids or non-contiguous amino acids. As used herein, the “yield of the trimer” or the “trimer yield” refers to micrograms of pure trimeric spike protein obtained from 50 ml of cell culture. Coronavirus "Coronavirus" or "CoV" are enveloped, positive sense, single-stranded RNA viruses. There are two subfamilies of Coronaviridae, Letovirinae and Orthocoronavirinae. In one embodiment, the CoV is selected from the genera alphacoronavirus (alphaCoV), betacoronavirus (betaCoV), gammacoronavirus (gammaCoV) and deltacoronavirus (deltaCoV). In one embodiment, the alphaCoV is selected from coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63), transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), feline infectious peritonitis virus (FIPV) and canine coronavirus (CCoV). In an embodiment, the CoV is a betacoronavirus. In one embodiment, the betaCoV is selected from human coronavirus HKU1 (HCoV-HKU1), Human coronavirus OC43 (HCoV-OC43), Severe acute respiratory syndrome-related coronavirus (SARS-CoV), Severe acute respiratory syndrome-related coronavirus-2 (SARS-CoV-2), Middle-East respiratory syndrome-related coronavirus (MERS-CoV), murine hepatitis virus (MHV) and / or bovine coronavirus (BCoV). In one embodiment, the CoV is capable of infecting a human. In one embodiment, the CoV capable of infecting a human is selected from: SARS-CoV-2, HCoV-OC43, HCoV-HKU1, HCoV-229E, HCoV-NL63, SARS-CoV, and MERS-CoV or a subtype or variant thereof. In one embodiment, the CoV is SARS-CoV-2 or a subtype or variant thereof. In an embodiment, SARS-CoV-2 is SARS-CoV-2 hCoV-19 / Australia / VIC01 / 2020. In one embodiment, SARS-COV-2 comprises the sequences as described in NCBI Reference Sequence: NC_045512.2. In one embodiment, SARS-CoV-2 comprises the sequence as described in GenBank: MN908947.3 or a variant thereof. Examples of SARS-CoV-2 variants are described, for example, in Shen et al., 2020, Tang et al., 2020, Phan et al., 2020, Khan et al., 2020, Foster et al., 2020, Vasireddy et al., 2021, Winger et al., 2021, Sanyaolu et al., 2021, Ou et al., 2022 and Fernandes et al., 2022. In an embodiment, the SARS-CoV-2 is an omicron variant or a subtype or variant thereof. In an embodiment, the SARS-CoV-2 is an non-omicron variant. In an embodiment, the SARS- CoV-2 is a delta variant or a subtype or variant thereof. In one embodiment, the CoV variant is at least 90% identical to the parental strain. In one embodiment, the variant is at least 92% identical to the parental strain. In one embodiment, the variant is at least 93% identical to the parental strain. In one embodiment, the variant is at least 94% identical to the parental strain. In one embodiment, the variant is at least 95% identical to the parental strain. In one embodiment, the variant is at least 96% identical to the parental strain. In one embodiment, the variant is at least 97% identical to the parental strain. In one embodiment, the variant is at least 98% identical to the parental strain. In one embodiment, the variant is at least 99% identical to the parental strain. In an embodiment, the parent strain (also referred to as the ancestral strain) is Hu-1 strain is described by Wu et al., 2020. In some embodiments, the parental strain is SARS-CoV-2 hCoV-19 / Australia / VIC01 / 2020. In some embodiment, the parental strain is BetaCoV / Ancestral / WIV04 / 2019. In an embodiment, the CoV is a “Variant of Interest” also referred to as a “VOI”. As used herein a VOI is a variant of a CoV that is associated with genetic changes that are predicted or known to affect virus characteristics such as transmissibility, disease severity, immune escape, diagnostic or therapeutic escape; and identified to cause significant community transmission or multiple disease clusters (in the case of SARS-CoV-2 COVID19 clusters), in multiple countries with increasing relative prevalence alongside increasing number of cases over time, or other apparent epidemiological impacts to suggest an emerging risk to global public health. In an embodiment, the CoV is a “Variant of Concern” also referred to as a “VOC”. As used herein a VOC is a variant of a CoV that is associated with one or more of the following changes at a degree of global public health significance: increase in transmissibility or detrimental change in epidemiology (in the case of SARS-CoV-2 the detrimental change is in COVID-19 epidemiology); increase in virulence or change in clinical disease presentation; or a decrease in effectiveness of public health and social measures or available diagnostics, vaccines, therapeutics. In an embodiment, the CoV is a VOC or VOI as described in Vasireddy et al., 2021, Winger et al., 2021 or Sanyaolu et al., 2021, Chavda et al., 2022. In an embodiment, the CoV is classified as a VOC, VOI or VHC by a health regulatory body e.g. the World Health Organisation (WHO), the United States Center of Disease Control (CDC), the European Centre for Disease Prevention and Control (ECDC) or an equivalent local government health regulatory body in a specific jurisdiction. In an embodiment, the CoV is classified as a VOC or VOI by WHO. In an embodiment, the CoV is classified as a VOC, VOI or VHC by the CDC. In an embodiment, the CoV is classified as a VOC or VOI by ECDC. In an embodiment, the CoV is a “Variant of High Consequence” also referred to as a “VHC”. In an embodiment the VHC as clear evidence that prevention measures or medical countermeasures have significantly reduced effectiveness relative to previously circulating variants. In addition to the characteristics of a VOC, a VHC can have one or more of the following impacts on medical countermeasures: demonstrated failure of diagnostic test targets; evidence to suggest a significantly reduction in vaccine effectiveness, a disproportionately high number of vaccine breakthrough cases, or very low vaccine-induced protection against severe disease; significantly reduced susceptibility to multiple emergency use authorization or approved therapeutics and more severe clinical disease and increased hospitalizations In an embodiment, where the CoV is SARS-CoV-2 VOC, the VOC comprises one or more of the following mutations: H69del, V70del, G142del / D, Y144del,V213G, S371F / L, D405N, R408S, E484K / Q / A, S494P, N501Y, A570D, D614G, P681H / R, T716I, S982A, D1118H, V1176F, K1191N, D80A, D215G, 241del, 242del, 243del, K417N, N501Y, D614G, A701V, T19R, V70F, T95I, E156-, F157-, R158G, A222V*, W258L*, K417N / T*, L452R, T478K, D614G, D950N, L18F, T20N, P26S, D138Y, R190S, K417T, N501Y, D614G, H655Y, T1027I, H655Y A67V, del69-70, T95I, del142-144, Y145D, N211del, L212I, ins214EPE, G339D, S373P, S375F, K417N, N440K, G446S, S477N, T478K, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, N764K, D796Y, N856K, Q954H, N969K and L981F. In an embodiment, where the CoV is SARS-CoV-2 VOC, the VOC comprises one or more of the following RBD mutations: G339D / H, R346T, L368I, S371F / L, S373P, S375F, T376A, D405N, R408S, K417N / T, N440K, K444T, V445P, G446S, L452R, F456L, N460K, S477N, T478K / R, E484K / Q / A, F486V / S / P, F490S, Q493R, G496S, Q498R , S494P, N501Y, Y505H. In an embodiment, the VOC comprises one or more of the following NTD mutations: L18F, T19R / I, T20N, del24-26, P26S, A27S, Q52H, A67V, del69-70, H69del, V70del, V70F, D80A, V83A, T95I, D138Y, del142-144, G142del, G142D, Y144del, Y145D, K147Q, delE156, delF157, del157-158, R158G, E180V, Q183E, R190S, N211del, L212I, V213G / E, ins214EPE, D215G, 241del, 242del, 243del, G252V, A222V*, and W258L*. In an embodiment, the VOC is B.1.1.7 or a variant thereof. In an embodiment, the VOC is B.1.351 or a variant thereof. In an embodiment, the VOC is B.1.351.2 or a variant thereof. In an embodiment, the VOC is B.1.351.2 or a variant thereof. In an embodiment, the VOC is B.1.351.3 or a variant thereof. In an embodiment, the VOC is P1 or a variant thereof. In an embodiment, the VOC is P1.1 or a variant thereof. In an embodiment, the VOC is P1.2 or a variant thereof. In an embodiment, the VOC is B.1.617.2 or a variant thereof. In an embodiment, the VOC is AY.1 or a variant thereof. In an embodiment, the VOC is AY.2 or a variant thereof. In an embodiment, the VOC is AY.3 or a variant thereof. In an embodiment, the VOC is B.1.1.529 or a variant thereof. In an embodiment, the VOC is BA.1 or a variant thereof. In an embodiment, the VOC is BA.1.1 or a variant thereof. In an embodiment, the VOC is BA.2 or a variant thereof. In an embodiment, the VOC is BA.2.74 or a variant thereof. In an embodiment, the VOC is BA.3 or a variant thereof. In an embodiment, the VOC is BA.4 or a variant thereof. In an embodiment, the VOC is BA.5 or a variant thereof. In an embodiment, the VOC is BA.4-5 (also known as BA.4 / 5) or a variant thereof. In an embodiment, the VOC is XBB 1.5 or a variant thereof. In an embodiment, the VOC is XBB 1.16 or a variant thereof. In an embodiment, the VOC is XBB 2.3 or a variant thereof. In an embodiment, the VOC is XBB 1.9.2 or a variant thereof. In an embodiment, the VOC is XBB 1.9.1 or a variant thereof. In an embodiment, the VOC is BA.2.86 or a variant thereof. In an embodiment, the VOC is JN.1 or a variant thereof. In an embodiment, the VOC is CH.1.1 or a variant thereof. In an embodiment, where the CoV is SARS-CoV-2 VOI, the VOI comprises one or more of the following mutations: L452R, D614G, S13I, W152C, A67V, 69del, 70del, 144del, E484K, Q677H, F888L, L5F, D80G, T95I, Y144, F157S, D253G, L452R, S477N, E484K, A701V, T859N, D950H and Q957R, N501Y, P681R, P681H, E484Q, P681R, S477N, L452Q and F490S. In an embodiment, the VOI is B.1.525 or a variant thereof. In an embodiment, the VOI is B.1.526 or a variant thereof. In an embodiment, the VOI is B.1.617.1 or a variant thereof. In an embodiment, the VOI is C37 or a variant thereof. In an embodiment, the VOI is B.1.427 or a variant thereof. In an embodiment, the VOI is B.1.429 or a variant thereof. In an embodiment, the VOI is P2 or a variant thereof. In an embodiment, the VOI is B.1.525 or a variant thereof. In an embodiment, the VOI is P3 or a variant thereof. In an embodiment, the VOI is B.1.620 or a variant thereof. In an embodiment, the VOI is B.1.621 or a variant thereof. In an embodiment, the VOI is C.37 or a variant thereof. In an embodiment, the VOI is BA2.75 or a variant thereof. In an embodiment, the VOI is BQ.1 or a variant thereof. CoV infections cause can cause respiratory, enteric, hepatic, and neurological diseases in different animal species, including camels, cattle, cats, and bats. CoV can be transmitted from one individual to another through contact of viral droplets with mucosa. Typically, viral droplets are airborne and inhaled via the respiratory tract including the nasal airway. Typically, the individual is a human individual. In some embodiments, the individual is a live stock or domestic animal. Typically, during an infection, CoV can be found in the upper respiratory tract, for example the nasal passages. In some examples, CoV can be found in the lower respiratory tract, for example the bronchi and / or alveoli. In an embodiment, a CoV infection causes one or more symptoms selected from one or more of: fever, cough, sore throat, shortness of breath, viral shedding respiratory insufficiency, runny nose, nasal congestion, malaise, bronchitis, headache, muscle pain, dyspnea, moderate pneumonia, severe pneumonia, acute respiratory distress syndrome (ARDS). In an embodiment, the ARDS is selected from mild ARDS (defined as 200 mmHg < PaO2 / FiO2 ≤ 300 mmHg), moderate ARDS (defined as 100 mmHg < PaO2 / FiO2 ≤ 200 mmHg) and severe ARDS (defined as PaO2 / FiO2 ≤ 100 mmHg). In an embodiment, a SARS-CoV-2 infection can cause one or more symptoms selected from one or more of: fever, cough, sore throat, shortness of breath, viral shedding, respiratory insufficiency, runny nose, nasal congestion, malaise, bronchitis, headache, muscle pain, dyspnea, moderate pneumonia, severe pneumonia, acute respiratory distress syndrome (ARDS). In an embodiment, the CoV infection is asymptomatic. SARS-CoV-2 SARS-CoV-2 has four major structural proteins: spike (S), membrane (M) and envelope (E) proteins, and nucleocapsid (N) protein. S, M and E are embedded in the viral surface envelope and N is located in in the ribonucleoprotein. The S protein recognizes the host cellular receptor to initiate virus entry. The viral S glycoprotein mediates receptor attachment and virus-cell membrane fusion and is the target of NAbs (Duan et al., 2020; Finkelstein et al., 2021; Walls et al., 2020; Hoffmann et al., 2020). The mature spike comprises 2 functional subunits, S1 and S2, that are derived from a polyprotein precursor, S, by furin cleavage of an oligobasic motif as it transits the Golgi. ACE2 receptor attachment is mediated by the RBD within the large subunit, S1, while membrane fusion is mediated by the small subunit, S2, which contains the fusion peptide. S1 and S2 form a heterodimer via non-covalent interactions; a coiled-coil-forming ^-helix of S2 (amino acids 986- 1033; referred to as CH) forms the core of the trimer (Wrapp et al., 2020). A membrane-spanning sequence at the C-terminus of S2 stabilizes the trimer and anchors it to the viral or cell membrane (Fu et al., 2021). The ACE2 RBD sits atop the S1 glycoprotein trimer and presents in “up” ACE2- binding-ready and “down” inert orientations (Ke et al., 2020). Following receptor attachment, S2 is cleaved by the TMPRSS2 protease at the cell surface to liberate the fusion peptide and full fusion activation. The S glycoprotein mediates membrane fusion via a class I mechanism whereby an activation trigger (ACE2-binding by S1, TMPRSS2 cleavage of S2) causes the S2 subunit of the metastable pre-fusion trimer to refold into a stable trimer of hairpins, bringing the N-terminal fusion peptide and C-terminal membrane spanning sequences together such that their associated membranes fuse (Cai et al., 2020). Prior to its encounter with cellular ACE2 and TMPRSS2, the prefusion spike conformation, i.e. the predominant spike conformation present on the surface of virions (Ke et al., 2020, Turunova et al., 2020), comprises a trimer of outer S1 subunits in association with a trimer of inner S2 fusion / transmembrane subunits that form the core of the S1-S2 complex. In this conformation, 3 copies of the RBD sit atop the spike and are surrounded by three copies of the NTD, while the fusion peptide at the S2 N-terminus is largely sequestered within the trimer. In the closed conformation, the 3 RBDs lie flat, occluding the RBM, whereas in the open conformation, one or more RBDs lift to expose the RBM enabling ACE2 binding. Class I viral fusion glycoproteins such as S of betacoronaviruses, Env of retroviruses, HA of orthomyxoviruses contain a central coiled-coil, which act as a scaffold for the conformational changes required for the membrane fusion process (Bullough et al., 1994; Cai et al., 2020; Chan et al., 1997; Julien et al., 2013; Walls et al., 2017; Walls et al., 2020; Weissenhorn et al., 1997; Wilson et al., 1981; Wrapp et al., 2020). In the case of SARS-CoV-2, prefusion, the coiled-coil comprises amino acids amino acids 988 to 1031 set out in SEQ ID NO: 1 (NCBI reference sequence YP_009724390.1). Post-fusion the coiled-coil sequence is extended comprising amino acids 913 to 1031 set out in SEQ ID NO: 1 (NCBI reference sequence YP_009724390.1). In some embodiments, the residues 986 and 987 are modified to prolines (K986P; V987P). The inward-facing positions of a coiled-coil are usually occupied by hydrophobic residues in a 3-4 repeat. In the cases of SARS-CoV and SARS-CoV-2 S, these positions are mostly occupied by polar residues that mediate few inter-helical contacts in the prefusion trimer see Figure 1B of PCT / AU2022 / 050429 and PCT / AU2022 / 050880. In the postfusion trimer, the N- terminal 2 / 3 of the coiled-coil is brought together by the packing of HR1 helices that extends the coiled-coil in an N-terminal direction by 110Å. In this conformation the inward facing residues are close enough for hydrogen bonds to form (see Figure 1C PCT / AU2022 / 050429 and PCT / AU2022 / 050880). Ile1013 forms a small hydrophobic core through inter-helical contacts with I1013 and with L1012. These interactions form a hydrophobic ceiling above a cavity formed by A1016 and A1020 that occupy central positions of the coiled-coil (Figure 1 A-D of PCT / AU2022 / 050429 and PCT / AU2022 / 050880). Vaccine antigen S protein monomers of the coronavirus vaccine antigen In an embodiment, S protein monomer in the S-protein trimer can be an ancestral SARS- CoV-2 sequence as described herein (e.g. NCBI Reference Sequence: YP_009724390.1) or can be a more recent variant such as a VOC, VOI or a VHC as described herein (e.g. delta, beta, omicron, alpha, gamma, epsilon, eta, iota, kappa, zeta, mu). In an embodiment, the S protein monomer is SEQ ID NO: 2 or variant or modified version thereof. In an embodiment, the S protein monomer is an ancestral SARS-CoV-2 sequence modified to comprise one or more mutations present in a VOC, VO1 or a VHC as described herein. In an embodiment, the modification is selected from one or S13I, L18F, T19R, T20N, P26S, A67V, delH69-V70, D80A, T95I, D138Y, G142D, delY144, W152C, E154K, E156del, F157del, R158G, R190S, D215G, del242-245, D253G, R246I, K417N / T, N439K, L452R / Q, Y453F, S477N, T478K, E484K / Q, N501Y, F565L, A570D, D614G, H655Y, Q677H, P681H / R, I692V, A701V, T716I, F888L, D950N, S982A, T1027I, Q1071H and D1118H; In an embodiment, the S protein monomer is of the omicron lineage. In an embodiment, the S protein monomer is of the alpha lineage. In an embodiment, the S protein monomer is of the gamma lineage, In an embodiment, the S protein monomer is of the epsilon lineage, In an embodiment, the S protein monomer is of the eta lineage, In an embodiment, the S protein monomer is of the iota lineage, In an embodiment, the S protein monomer is of the kappa lineage. In an embodiment, the S protein monomer is of the zeta lineage. In an embodiment, the S protein monomer is of the mu lineage. In an embodiment, the S protein monomer is of the pangolin lineage. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1207 of the amino acid sequence SEQ ID NO: 1 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1207 of the amino acid sequence SEQ ID NO: 2 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1207 of the amino acid sequence SEQ ID NO: 3 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1237 of the amino acid sequence of SEQ ID NO: 1 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1237 of the amino acid sequence of SEQ ID NO: 2 a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1237 of the amino acid sequence of SEQ ID NO: 3 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1256 of the amino acid sequence of SEQ ID NO: 1 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1256 of the amino acid sequence of SEQ ID NO: 2 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises residues corresponding to 16 to 1256 of the amino acid sequence of SEQ ID NO: 3 or a sequence at least 90% identical thereto. In an embodiment, the S protein monomer comprises an endogenous or exogenous signal sequence. In an embodiment, the S protein monomer lacks an endogenous or exogenous signal sequence. In an embodiment, the endogenous signal sequence comprises residues 1 to 15 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the S protein monomer comprises a sequence encoding the transmembrane domain of a coronavirus. In an embodiment, the S protein monomer comprises a sequence encoding the transmembrane domain of SARS-COV2. In an embodiment, the transmembrane domain comprises residues corresponding to 1217 to 1237 of the amino acid sequence SEQ ID NO: 1 or a sequences at least 90% identical thereto. In an embodiment, the transmembrane domain comprises residues corresponding to 1217 to 1237 of the amino acid sequence SEQ ID NO: 2 or a sequences at least 90% identical thereto. In an embodiment, the transmembrane domain comprises residues corresponding to 1217 to 1237 of the amino acid sequence SEQ ID NO: 3 or a sequences at least 90% identical thereto. In an embodiment, the transmembrane domain comprises residues corresponding to 1209 to 1256 of the amino acid sequence SEQ ID NO: 1 or a sequences at least 90% identical thereto. In an embodiment, the transmembrane domain comprises residues corresponding to 1209 to 1256 of the amino acid sequence SEQ ID NO: 2 or a sequences at least 90% identical thereto. In an embodiment, the transmembrane domain comprises residues corresponding to 1209 to 1256 of the amino acid sequence SEQ ID NO: 3 or a sequences at least 90% identical thereto. In an embodiment, the S protein monomer lacks a endogenous or exogenous transmembrane domain. In an embodiment, the S protein monomer does not comprise a sequence encoding the transmembrane domain of a coronavirus. In an embodiment, the S protein monomer comprises the 2P mutation as described herein. In an embodiment, the S protein monomer does not comprise the 2P mutation as described herein. In an embodiment, the S protein monomer comprises the 6P mutation as described in Hsieh et al., 2020 (F817P, A892P, A899P, A942P, K986P, V987P). In an embodiment, the S protein monomer does not comprise the 6P mutation. In an embodiment, the S protein monomer comprises the amino acid sequence of one or more of the VOC and or VOI mutations as described herein. In an embodiment, the S protein monomer does not comprise a trimerization sequence. In an embodiment, the S protein monomer does not comprise a transmembrane domain sequence. In an embodiment, the S-protein monomer does not comprise a foldon sequence. In an embodiment, the S-protein monomer does not comprise a ferritin foldon sequence. In an embodiment, the S-protein monomer does not comprise FHA. Coronavirus vaccine antigen In an aspect, the coronavirus (CoV) vaccine antigen of the present invention comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond. In an aspect, the coronavirus (CoV) vaccine antigen of the present invention comprises a CoV S protein trimer with a C-terminal truncation in the stem region. In an aspect, the coronavirus (CoV) vaccine antigen of the present invention comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond and a C- terminal truncation in the stem region. In an aspect, the coronavirus (CoV) vaccine antigen of the present invention comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond and a structural modification reduces the size of the alanine cavity. In an aspect, the coronavirus (CoV) vaccine antigen of the present invention comprises a CoV S protein trimer with a C-terminal truncation in the stem region and a structural modification reduces the size of the alanine cavity. In an aspect, the coronavirus (CoV) vaccine antigen of the present invention comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond, a C- terminal truncation in the stem region and a structural modification reduces the size of the alanine cavity. In an embodiment, the S protein monomer of the S protein trimer lacks a signal sequence. In an embodiment, the S protein monomer of the S protein trimer lacks at least part of the trimerization sequence. In an embodiment. The S protein monomer of the S protein trimer does not comprise a sequence that encodes a functional endogenous trimerization sequence. In an embodiment. The S protein monomer of the S protein trimer does not comprise a sequence that encodes a functional non-endogenous trimerization sequence. In an embodiment, the S protein trimer is soluble. In an embodiment, the CoV vaccine antigen additionally comprises the 2P modification. In an embodiment, the CoV vaccine antigen additionally comprises the 6P modification. In an embodiment, the CoV vaccine antigen is a pan-coronavirus vaccine antigen. In an embodiment, the CoV vaccine antigen is a SARS-CoV-2 vaccine antigen. In an embodiment, the CoV vaccine antigen is a SARS-CoV-2 omicron vaccine antigen. In an embodiment, the CoV vaccine antigen a SARS-CoV-2 non-omicron vaccine antigen. In an embodiment, the S protein trimer is stabilised in the prefusion conformation. In an embodiment, the S protein trimer has modified antigenicity compared to an S protein trimer lacking an inter-protomer disulfide bond. In an embodiment, the S protein trimer has modified immunogenicity compared to an S protein trimer lacking an inter-protomer disulfide bond. In an embodiment, when administered to a subject the S protein trimer elicits a neutralising antibody response as described herein. In an embodiment, the S protein trimer is further comprises a structural modification which reduces the size of the alanine cavity in the coiled-coil region of the S protein trimer and wherein the S protein trimer. Ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen In an aspect, the present invention provides a ribonucleic acid encoding the coronavirus vaccine antigen as described herein. In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond. In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen is a CoV S protein trimer and wherein the S protein monomer of the CoV S protein trimer has a C-terminal truncation in the stem region. In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond and a C-terminal truncation in the stem region. In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond and a structural modification reduces the size of the alanine cavity. In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen is a CoV S protein trimer and wherein the S protein monomer of the CoV S protein trimer has a C-terminal truncation in the stem region and a structural modification reduces the size of the alanine cavity. In an aspect, the present invention provides a ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond and a C-terminal truncation in the stem region and a structural modification reduces the size of the alanine cavity. In an embodiment, the ribonucleic acid comprises an RNA sequence corresponding to a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 135, SEQ ID NO: 136 or a sequence at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 98% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 5, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 14, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 15, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 16, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 17, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 18, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 19, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 20, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 21, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 33, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 34, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 35, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 36, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 37, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 38, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 39, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 40, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 41, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 42, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 43, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 50, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 51, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 52, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 53, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 54, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 55, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 56, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 57, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 58, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 59, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 60, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 61, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 62, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 63, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 64, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 65, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 66, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 67, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 68, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 69, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 74, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 75, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 76, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 77, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 86, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 87, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 88, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 90, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 91, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 103, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 105, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 111, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 112, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 113, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 114, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 115, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 119, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 120, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 121, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 125, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 126, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 127, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 135, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid comprises a sequence corresponding to SEQ ID NO: 136, or a sequence at least 70% identical thereto. In an embodiment, the ribonucleic acid encodes an amino acid sequence selected from: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 132 and SEQ ID NO: 133. In an embodiment, the ribonucleic acid encodes an amino acid sequence selected from: SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13. In an embodiment, the ribonucleic acid encodes an amino acid sequence selected from: SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49. In an embodiment, the ribonucleic acid encodes an amino acid sequence selected from: SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 102 and SEQ ID NO: 104. In an embodiment, the ribonucleic acid encodes an amino acid sequence selected from: SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 122, SEQ ID NO: 123 and SEQ ID NO: 124. Cysteine modification As used herein, “disulfide bond” refers to a covalent bond formed between the thiol or sulfhydryl (R-SH) side chain of two cysteine residues in one or more proteins. In some embodiments, the disulfide bond is formed between two cysteine residues within a protein. As used herein, an “inter-protomer disulfide bond” refers to a disulfide bond between two protomers of an oligomeric structure. In some embodiments, the inter-protomer disulfide bond is formed between two protomers (S protein monomers) of the S protein trimer (the oligomeric structure). In an embodiment, the non-endogenous inter-protomer disulfide bond is formed between cysteines selected from: i) cysteines at a position corresponding to amino acid numbers 914 and 1123 of SEQ ID NO: 1 or SEQ ID NO: 2 (L23), ii) cysteines at a position corresponding to amino acid numbers 571 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (D17), and iii) cysteines at a position corresponding to amino acid numbers 570 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (I1). In some embodiments, the non-endogenous inter-protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 914 and 1123 of SEQ ID NO: 1(L23). In some embodiments, the non-endogenous inter-protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 914 and 1123 of SEQ ID NO: 2 (L23). In some embodiments, the non-endogenous inter-protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 571 and 967 of SEQ ID NO: 1 (D17). In some embodiments, the non-endogenous inter-protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 571 and 967 of SEQ ID NO: 2 (D17). In some embodiments, the non-endogenous inter-protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 570 and 967 of SEQ ID NO: 1 (I1). In some embodiments, the non-endogenous inter-protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 570 and 967 of SEQ ID NO: 2 (I1). In some embodiments, the inter-protomer disulfide bond is formed as a result of the substitution of the residues corresponding to 914 and 1123 of SEQ ID NO: 1 with cysteine (L23). In some embodiments, the inter-protomer disulfide bond is formed as a result of the substitution of the residues corresponding to 914 and 1123 of SEQ ID NO: 2 with cysteine (L23). In some embodiments, the inter-protomer disulfide bond is formed as a result of substitution of the residues corresponding to 571 and 967 of SEQ ID NO: 1 with cysteine (D17). In some embodiments, the inter-protomer disulfide bond is formed as a result of substitution of the residues corresponding to 571 and 967 of SEQ ID NO: 2 with cysteine (D17). In some embodiments, the inter-protomer disulfide bond is formed as a result of substitution of the residues corresponding to 570 and 967 of SEQ ID NO: 1 with cysteine (I1). In some embodiments, the inter-protomer disulfide bond is formed as a result of substitution of the residues corresponding to 570 and 967 of SEQ ID NO: 2 with cysteine (I1). In some embodiments, the each protomer of the CoV S protein trimer can be modified with either one or more of the aforementioned inter-protomer disulfide bond(s). The inter- protomer disulfide bond modifies one or more of the: structure, stability or function of the molecule it is introduced into. In some embodiments, modifying the stability increases the melting temperature of the S protein trimer compared to an identical S protein trimer lacking the inter- protomer disulfide bond. In some embodiments, modifying the function increases the immunogenicity of the S protein trimer compared to an identical S protein trimer lacking the inter- protomer disulfide bond. In an embodiment, the S-protein trimer is modified to comprise one interprotein disulfide bond. In an embodiment, the S-protein trimer as described herein is modified to comprise one or more inter-protomer disulfide binds. In an embodiment, the S-protein trimer is modified to comprise two inter-protomer disulfide bonds. In an embodiment, the S- protein trimer is modified to comprise three inter-protomer disulfide bonds. In an embodiment, the S-protein trimer is modified to comprise four inter-protomer disulfide bonds. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 1.5°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 2°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 3°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 4°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 5°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 6°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about °C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 8°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 10°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 12°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by at least about 15°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, the melting temperature of the CoV vaccine antigen is about 38°C to about 71°C, or about 40°C to about 71°C, or about 42°C to about 71°C, or about 45°C to about 71°C, or about 50°C to about 71°C, or about 55°C to about 71°C, or about or about 60°C to about 71°C, or about 51°C to about 58°C, or about 51°C to about 57°C, or about 51°C to about 55°C, or about 52°C to about 58°C,. In some embodiments, the melting temperature of the CoV vaccine antigen is about 38°C to about 71°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 40°C to about 71°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 42°C to about 71°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 45°C to about 71°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 50°C to about 71°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 51°C to about 58°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 51°C to about 57°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 51°C to about 55°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 52°C to about 58°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 55°C to about 71°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 60°C to about 71°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 51°C, or about 52°C, or about 53°C, or about 54°C, or about 55°C, or about 55.8°C, or about 56°C, or about 57°C, or about 57.5°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 51°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 52°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 53°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 54°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 55°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 55.8°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 56°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 57°C. In some embodiments, the melting temperature of the CoV vaccine antigen is about 57.5°C In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 30°C, or by about 5°C to about 25°C, or by about 5°C to about 20°C, or by about 5°C to about 15°C, or by about 5°C to about 12.5°C, or by about 5°C to about 10°C, or by about 5°C to about 8°C, compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 30°C compared to an identical trimer lacking the inter- protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 25°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 20°C compared to an identical trimer lacking the inter- protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 15°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 12.5°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 10°C compared to an identical trimer lacking the inter-protomer disulfide bond. In some embodiments, having at least one inter-protomer disulfide bond in the CoV S protein trimer increases the trimer melting temperature by about 5°C to about 8°C compared to an identical trimer lacking the inter-protomer disulfide bond. In an embodiment, the S protein trimer comprises a sequence selected from: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 132 and SEQ ID NO: 133. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 4. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 5. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 78. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 79. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 80. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 81. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 82. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 83. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 84. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 108. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 109. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 110. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 117. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 118. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 123. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 124. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 129. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 130. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 132. In an embodiment, the S protein trimer comprises the sequence of SEQ ID NO: 133. Truncations In an embodiment, the C-terminal truncation is between residues corresponding to 1147 to 1207 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is between residues corresponding to 1147 to 1200 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is between residues corresponding to 1147 to 1193 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is between residues corresponding to 1147 to 1207 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C- terminal truncation is between residues corresponding to 1162 to 1200 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is between residues corresponding to 1162 to 1193 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is between residues corresponding to 1165 to 1193 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to 1147, 1157, 1165, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1201 or 1204 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to 1147, 1157, 1165, 1192, 1195, 1196, 1199, 1201 or 1204 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1147 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1157 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C- terminal truncation is after a residue selected from a residue corresponding to 1162, 1165, 1192 or 1199 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue selected from a residue corresponding to 1165, 1192 or 1199 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue selected from a residue corresponding to 1162, 1165, or 1192 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue selected from a residue corresponding to 1165 or 1192 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1165 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C- terminal truncation is after a residue corresponding to residue 1192 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1195 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1196 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1199 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1201 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to residue 1204 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after a residue corresponding to 1147, 1157, 1165, 1192, 1195, 1196, 1199, 1201 or 1204 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C- terminal truncation is after residue 1147 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1157 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1165 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1192 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1195 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1196 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1199 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1201 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1204 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1162 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1200 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1165 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1200 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the C-terminal truncation is after residue 1165 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1193 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1147, or residues 16 to 1157, or residues 16 to 1165, or residues 16 to 1192, or residues 16 to 1199, or residues 16 to 1200, or residues 16 to 1201, or residues 16 to 1204 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1147, or residues 16 to 1157, or residues 16 to 1165, or residues 16 to 1192, or residues 16 to 1204 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1147 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1157 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1165 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1162 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1165 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1192 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1199 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1204 of SEQ ID NO: 1 or SEQ ID NO: 2. In an embodiment, when expressed in a recombinant expression system the trimer is produced at a higher level compared to an identical S protein trimer lacking the truncation expressed in the same recombinant expression system. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased about 10% to about 60% compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased about 10% to about 50% compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased about 10% to about 40% compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased about 17% to about 36% compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by about 2 fold to about 10 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by about 3 fold to about 9 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by at least about 2 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by at least about 3 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by at least about 4 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by at least about 5 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by at least about 6 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by at least about 7 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased by at least about 8 fold compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, when expressed in a recombinant expression system the level of the S protein trimer is increased at least about 8.75 compared to the level of an identical S protein trimer lacking the truncation. In an embodiment, the S protein trimer is produced at a level greater than about 300 µg / 50 mL. In an embodiment, the S protein trimer is produced at a level of about 300 µg / 50 mL to about 2000 µg / 50 mL. In an embodiment, the S protein trimer is produced at a level of about 300 µg / 50 mL to about 1900 µg / 50 mL. In an embodiment, the S protein trimer is produced at a level of about 300 µg / 50 mL to about 1100 µg / 50 mL. In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1192 of SEQ ID NO: 1 or SEQ ID NO: 2, a non-endogenous inter-protomer disulfide bond is formed between residues corresponding to 571 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (D17). In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1192 of SEQ ID NO: 1 or SEQ ID NO: 2, a non-endogenous inter-protomer disulfide bond is formed between residues corresponding to SEQ ID NO: 2 (D17) or 570 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (I1). In an embodiment, the monomer of the S protein trimer comprises residues corresponding to 16 to 1192 of SEQ ID NO: 1 or SEQ ID NO: 2, a non- endogenous inter-protomer disulfide bond is formed between residues corresponding to 571 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (D17) or A570 and S967 of SEQ ID NO: 1 or SEQ ID NO: 2 (I1), and wherein the S protein trimer comprises a melting temperature of about 50°C to about 55°C. In an embodiment, the monomer of the S protein trimer comprises a sequence selected from: SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 6. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 7. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 8. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 9. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 10. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 11. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 12. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 13. In an embodiment, the monomer of the S protein trimer comprises a sequence selected from: SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 25. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 29. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 31. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 47. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 48. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 49. In an embodiment, the monomer of the S protein trimer comprises a sequence selected from: SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 102 and SEQ ID NO: 104. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 44. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 45. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 46. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 56. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 57. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 58. In an embodiment, the monomer of the S protein trimer is comprises the sequence of SEQ ID NO: 62. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 63. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 64. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 65. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 70. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 71. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 72. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 102. In an embodiment, the monomer of the S protein trimer comprises the sequence of SEQ ID NO: 104. In an embodiment, the monomer of the S protein trimer comprises a sequence selected from: SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 122, SEQ ID NO: 123 and SEQ ID NO: 124. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 106. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 107. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 108. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 109. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 110. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 116. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 117. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 118. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 122. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 123. In an embodiment, the monomer of the S protein trimer comprises the sequence SEQ ID NO: 124. Structural modification reduces the size of the alanine cavity In an embodiment, the S protein trimer as described herein further comprises a structural modification which reduces the size of the alanine cavity in the coiled-coil region of the S protein trimer and wherein the S protein trimer. In an aspect, the structural modification stabilises the S protein trimer. As used herein “stabilised” refers to increasing one or more of the: thermal stability, longevity, immunogenicity and production stability, yield or homogeneity of the S protein trimer, and denaturation stability. In an embodiment, the stability is increased in vitro and / or in vivo stability. In an embodiment, the in vivo stability is increased (when administered to a subject or upon assembly in a subject e.g. after translation from an mRNA vaccine). In an embodiment, the stability is increased in vitro (e.g. during production processes). In an embodiment, the structural modification stabilises the S protein trimer by reducing the size of the alanine cavity in the coiled-coil. In an embodiment, the alanine cavity is partially filled or completely filled. In an embodiment, the alanine cavity is conformationally altered. In an embodiment, the size of the alanine cavity is reduced by at least 5%, or at least 10 %, or at least 20%, or at least 30%, or at least, 40%, or at least 50%, or at least 60%, or at least 70% or at least 80%, or at least 90%, or 100%. In an embodiment, the size of the alanine cavity is reduced by at least 5%. In an embodiment, the size of the alanine cavity is reduced by at least 10%. In an embodiment, the size of the alanine cavity is reduced by at least 20%. In an embodiment, the size of the alanine cavity is reduced by at least 30%. In an embodiment, the size of the alanine cavity is reduced by at least 40%. In an embodiment, the size of the alanine cavity is reduced by at least 50%. In an embodiment, the size of the alanine cavity is reduced by at least 60%. In an embodiment, the size of the alanine cavity is reduced by at least 70%. In an embodiment, the size of the alanine cavity is reduced by at least 80%. In an embodiment, the size of the alanine cavity is reduced by at least 90%. In an embodiment, the size of the alanine cavity is reduced by 100%. In an embodiment, the size of the alanine cavity is reduced by about 10% to 100%, or about 10% to about 90%, or about 20% to about 90%, or about 20% to about 80%, or about 30% to about 80%, or about 40% to about 80%, or about 50% to about 80%. In an embodiment, the size of the alanine cavity is reduced by about 10% to 100%. In an embodiment, the size of the alanine cavity is reduced by about 10% to 90%. In an embodiment, the size of the alanine cavity is reduced by about 20% to 90%. In an embodiment, the size of the alanine cavity is reduced by about 20% to 80%. In an embodiment, the size of the alanine cavity is reduced by about 30% to 80%. In an embodiment, the size of the alanine cavity is reduced by about 40% to 80%. In an embodiment, the size of the alanine cavity is reduced by about 50% to 80%. In an embodiment, the structural modification increases the stability of the S protein trimer compared to the S protein trimer lacking the structural modification. In an embodiment, the S protein trimer is stable in the absence of at least part or all of an endogenous trimerization sequence (a trimerization sequence is not required to achieve stability). In an embodiment, the S protein trimer is stable in the absence of a non-endogenous trimerization sequence (a trimerization sequence is not required to achieve stability). In an embodiment, the S protein trimer is stable in the absence of at least part or all of an endogenous trimerization sequence (a trimerization sequence is not required to achieve stability) and in the absence of a non- endogenous trimerization sequence. In an embodiment, the structural modification increases the temperature at which the S protein trimer degrades compared to the S protein trimer lacking the structural modification. In an embodiment, degrades or degradation refers to exposure of the hydrophobic residues at the core of the S protein trimer. In an embodiment, the structural modification increases the melting temperature of the S protein trimer compared to the S protein trimer lacking the structural modification. In an embodiment, the structural modification increases the thermal stability of the S protein trimer. In an embodiment, the structural modification increases the melting temperature of the S protein trimer by about 5°C to about 25°C. In an embodiment, the structural modification increases the melting temperature of the S protein trimer by about 5°C to about 23°C. In an embodiment, the structural modification increases the melting temperature of the S protein trimer by about 5°C to about 23°C. In an embodiment, the structural modification increases the melting temperature of the S protein trimer by about 10°C to about 23°C. In an embodiment, the structural modification increases the melting temperature of the S protein trimer by about 10°C to about 20°C. In an embodiment, the structural modification increases the melting temperature of the S protein trimer by about 5°C to about 15°C. In an embodiment, the structural modification increases the melting temperature of the S protein trimer by about 5°C to about 10°C. In an embodiment, the structural modification increases the stability of the S protein trimer to denaturing conditions. Denaturing conditions include for example boiling in in the presence of detergent (e.g. sodium dodecyl sulfate) or treating with detergent (e.g. sodium dodecyl sulfate) with and without 2 betamercaptoethanol at room temperature. In one embodiment, the present specification enables a method of improving the stability and / or expression of coronavirus S antigen. In an embodiment, the CoV vaccine antigen is soluble. In an embodiment, the CoV vaccine antigen as described herein does not comprise a C-terminal trimer-stabilisation clamp sequence such as the FHA sequence. In an embodiment the CoV vaccine antigen is stabilised in a pre-fusion S protein trimer conformation. In an embodiment, the ACE2 receptor binding domain (RBD) of the S protein trimer is in a down (non-ACE2-binding ready) orientation. In an embodiment, when in the RBD-down orientation neutralising antibodies are generated that recognise the S-trimer in an RBD-down conformation in addition to RBD-up directed neutralising antibodies. In an embodiment, the CoV vaccine antigen lacks a trimerization sequence. In an embodiment, the CoV vaccine antigen lacks a transmembrane domain. In an embodiment, the CoV vaccine antigen lacks a foldon sequence / domain. In an embodiment, when the RBD is in the down orientation other non-RBD epitopes are in favourable positions for generating additional non-RBD neutralising antibodies. In an embodiment, the structural modification is in the coiled-coil region. In an embodiment, the structural modification stabilises the coiled-coil region. In an embodiment, the structural modification in the coiled-coil in S2 has an allosteric effect on the immunogenicity of S1 that enhances the immune response against CoV variants as described herein. In an embodiment, the CoV vaccine antigen is suitable for intra-dermal administration. In an embodiment, the CoV vaccine antigen is suitable for oral administration. In an embodiment, the CoV vaccine antigen is suitable for pulmonary administration. In an embodiment, the CoV vaccine antigen is suitable for nasal administration. “Alanine cavity” or “cavity” refers herein to the observed region and reduced interaction between monomers of the trimeric structure within the coiled-coil of SARS-CoV S protein due to an absence of amino acids with non-polar side chains bulkier than that of alanine or aromatic residues. In an embodiment, the alanine cavity comprises A1016 and A1020 as set out in any one of SEQ ID NO: 1 to SEQ ID NO: 3. Structural modification to the alanine cavity is effected using one or more of: amino acid substitutions disulphide bond, hydrogen bond, pi stacking (π-π stacking), salt bridge, van der Waals interactions, use of hydrophobic residue substitutions or additions, or proline stabilisation within the S protein. In one embodiment, structural modification to the alanine cavity is effected by amino acid substitutions of one or more amino acids forming the alanine cavity. In an embodiment, the structural modification is the substitution of one or more amino acids to a more hydrophobic amino acid. In an embodiment, the structural modification is the substitution of one or more amino acids in the coiled-coiled region to a more hydrophobic amino acid. In an embodiment, one or two or three of the S protein monomers in the S protein trimer comprise the substitution of one or more amino acids in the coiled-coiled region to a more hydrophobic amino acid. In an embodiment, one of the S protein monomers in the S protein trimer comprise the substitution of one or more amino acids in the coiled-coiled region to a more hydrophobic amino acid. In an embodiment, two of the S protein monomers in the S protein trimer comprise the substitution of one or more amino acids in the coiled-coiled region to a more hydrophobic amino acid. In an embodiment, three of the S protein monomers in the S protein trimer comprise the substitution of one or more amino acids in the coiled-coiled region to a more hydrophobic amino acid. In an embodiment, the structural modification creates an artificial hydrophobic core in the coiled-coil region. In an embodiment the structural modification creates an artificial hydrophobic core comprising the residues of the alanine cavity. In an embodiment, the structural modification creates an artificial hydrophobic core in the alanine cavity. In an embodiment, the amino acids at positions 1016 and 1020 contribute to the formation of the artificial hydrophobic core. In an embodiment, the artificial hydrophobic core is created by substituting an amino acid in the coiled-coil region with a more hydrophobic amino acid. In one embodiment, polar residues are replaced with bulkier hydrophobic residues. As used herein “a more hydrophobic amino acid” refers to an amino acid that is more hydrophobic than the amino acid present in the position of the coronavirus strain that is being substituted. For example, if the amino acid being modified / substituted is an alanine, it may be substituted with a more hydrophobic amino acid e.g. isoleucine, leucine, methionine, valine, phenylalanine, tyrosine and tryptophan. The hydrophobicity index is a measure of the relative hydrophobicity, or how soluble an amino acid is in water and is described for example in Sereda et al., 1994 and Monera et al., 1995. The hydrophobicity of different amino acids at pH 2 and pH7 normalised so that the most hydrophobic residue is given at a value of 100 relative to glycine (0 value) is provided in the table below. Table 1: Amino acid hydrophobicity. In an embodiment, the more hydrophobic amino acid is a hydrophobic amino acid. In an embodiment, the hydrophobic amino acid is an aliphatic hydrophobic amino acid. In an embodiment, the hydrophobic amino acid is an aromatic hydrophobic amino acid. In an embodiment, at least one amino acid in the coiled-coil region of a S protein monomer in the S protein trimer is substituted with a more hydrophobic amino acid. In an embodiment, at least one S protein monomer in the S protein trimer comprises the substitution. In an embodiment, at least two S protein monomers in the S protein trimer comprise the substitution. In an embodiment, three S protein monomers in the S protein trimer comprise the substitution. In an embodiment, at least two amino acids in the coiled-coil region of a S protein monomer in the S protein trimer are substituted with a more hydrophobic amino acid. In an embodiment, at least one S protein monomer in the S protein trimer comprises the substitutions. In an embodiment, at least two S protein monomers in the S protein trimer comprise the substitutions. In an embodiment, three S protein monomers in the S protein trimer comprise the substitutions. In an embodiment, the at least one amino acid or at least two amino acids are in position a and / or d of the heptad repeat motif of the coiled-coil region of the S protein monomers. The locations of position a and d in the in the heptad repeat motif are shown in Figure 1B of PCT / AU2022 / 050429 and PCT / AU2022 / 050880. For SARS-COV-2, positions a and d correspond to amino acids 988, 991, 995, 9981002, 1005, 1009, 1013, 1016, 1020, 1023, 1027, 1031 of SEQ ID NO: 1. In an embodiment, a substitution with a more hydrophobic amino acid occurs at position 1016. In an embodiment, a substitution with a more hydrophobic amino acid occurs at position 1020. In an embodiment, a substitution with a more hydrophobic amino acid occurs at position 1016 and 1020. In an embodiment, A1016 or A1020 are substituted with leucine, valine, Isoleucine or phenylalanine. In an embodiment, A1016 is substituted with leucine (A1016L), valine (A1016V) or isoleucine (A1016I). In an embodiment, A1020 is substituted with isoleucine (A1020I). In an embodiment, A1016 is substituted with leucine (A1016L) or valine (A1016V) and A1020 is substituted with isoleucine (A1020I). In an embodiment, A1016 is substituted with leucine (A1016L or 16L). In an embodiment, A1016 is substituted with valine (A1016V). In an embodiment, A1020 is substituted with isoleucine (A1020I). In an embodiment, A1020 is not substituted with tryptophan (W). In an embodiment, A1016 is substituted with valine and A1020 is substituted with isoleucine (referred to herein as “A1016V / A1020I” or “1016 / 20VI” or “VI”). In an embodiment, A1020 is not substituted with tryptophan (A1020W). In an embodiment, the more hydrophobic amino acid comprises one or more of the following properties: i) a hydrophobicity greater than alanine; ii) a hydrophobic amino acid that is larger than alanine; ii) a hydrophobicity greater than 47 at a pH of 2; iii) a hydrophobicity greater than 41 at a pH of 7; and iv) is selected from: isoleucine, leucine, methionine, valine, phenylalanine, tyrosine and tryptophan. In an embodiment, the amino acid is selected from: isoleucine, leucine, valine. In an embodiment, the amino acid is isoleucine. In an embodiment, the amino acid is leucine. In an embodiment, the amino acid is valine. In an embodiment, the amino acid is methionine. In an embodiment, the amino acid is phenylalanine. In an embodiment, the amino acid is tyrosine. In an embodiment, the amino acid is tryptophan. In an embodiment, the hydrophobic amino acid is not tryptophan. In an embodiment, the more hydrophobic amino acid comprises a hydrophobicity greater than alanine. In an embodiment, the more hydrophobic amino acid is larger than alanine. In an embodiment, the more hydrophobic amino acid comprises a hydrophobicity greater than 47 at a pH of 2. In an embodiment, the more hydrophobic amino acid comprises a hydrophobicity greater than 41 at a pH of 7. In an embodiment, the more hydrophobic amino acid is selected from: isoleucine, leucine, methionine, valine, phenylalanine, tyrosine and tryptophan. In an embodiment, the more hydrophobic amino acid is isoleucine. In an embodiment, the more hydrophobic amino acid is leucine. In an embodiment, the more hydrophobic amino acid is methionine. In an embodiment, the more hydrophobic amino acid is valine. In an embodiment, the more hydrophobic amino acid is phenylalanine. In an embodiment, the more hydrophobic amino acid is tyrosine. In an embodiment, the more hydrophobic amino acid is tryptophan. For the avoidance of doubt, where optimal hydrophobicity has been achieved by amino acid substitution of the alanine cavity (including A1016 and A1020), further conservative amino acid mutations could be made to the region without affecting the desirable performance of the spike protein as described herein. Conservative amino acid substitutions are known in the art. In an embodiment, the S protein trimer as described herein does not comprise a structural modification which reduces the size of the alanine cavity in the coiled-coil region of the S protein trimer and wherein the S protein trimer. In an embodiment, the S protein trimer does not comprise the VI modification. In an embodiment, the S protein monomer of the S protein trimer does not comprise one or more or more of the following substitutions: T887W, A1020W, T887W and A1020W, and P1069F. In an embodiment, the S protein monomer of the S protein trimer does not comprise the substitution T887W. In an embodiment, the S protein monomer of the S protein trimer does not comprise the substitution A1020W. In an embodiment, the S protein monomer of the S protein trimer does not comprise the substitution T887W and A1020W. In an embodiment, the S protein monomer of the S protein trimer does not comprise the substitution P1069F. Immunogenicity and antigenicity S protein is the main protein used as a target antigen in COVID-19 vaccines. Theoretically, antibodies can target the S protein to inhibit virus infection at multiple stages during the virus entry process. The RBD is the major target for neutralising antibodies (NAbs) that interfere with viral receptor binding. To date, most of the potent NAbs to SARS-CoV-2 target the RBD. Conserved neutralization sites in S2 include the fusion peptide and stem region. In addition, NAbs targeting the N-terminal domain have been reported in SARS-CoV-2 and MERS-CoV infection making it another potential target for inclusion in a vaccine. The S2 subunit is also a potential target for neutralising antibodies that interfere with the structural rearrangement of the S protein and the insertion of the fusion protein required for virus–host membrane fusion. As used herein, “neutralising antibodies” or “NAbs” is a type of antibody that binds an antigen, pathogen or toxin and neutralises its functional activity. NAbs are referred to as functional antibodies because they have a functional anti-virus effect. In an embodiment, the neutralising antibody response inhibits binding to the ACE-2 receptor. In an embodiment, the neutralising antibody inhibits binding of the RBD to the ACE-2 receptor. In an embodiment, the neutralising antibody binds to a non-RBD epitope. As used herein, a “neutralising antibody response” refers to the production of NAbs in a subject after exposure to an antigen. The ability of vaccines to elicit NAbs or effective immune responses against heterologous strains or emerging variants of concern is a major factor influencing the successful roll out of a vaccine program against SARS-CoV-2. The ability of vaccines to elicit NAbs or effective immune responses against homologous and heterologous strains or emerging variants of concern is a major factor influencing the successful roll out of a vaccine program against SARS-CoV-2. The present application enables the production and use of coronavirus S antigen mutants as described herein that elicit an enhanced immunogenicity and or antigenicity to a broader range of variants including ancestral and naturally occurring and emerging variants of concern. In an embodiment, the vaccine antigens as described herein are pan-coronavirus vaccine antigens. As used herein, “a pan-coronavirus vaccine antigen” is an antigen that produces a neutralising antibody response against more than one SARS-CoV2, sarbecoviruses and / or more than one betacoronavirus. In an embodiment, the pan-coronavirus vaccine antigen produces a neutralising antibody response against more the one SARS-CoV2. In an embodiment, the pan- coronavirus vaccine produces a neutralising antibody response against more the one sarbecoviruses. In an embodiment, the pan-coronavirus vaccine produces a neutralising antibody response against at least two sarbecoviruses. In an embodiment, the pan-coronavirus vaccine produces a neutralising antibody response against a clade 1b sarbecoviruses and a clade 1a sarbecoviruses. In an embodiment, the pan-coronavirus vaccine produces a neutralising antibody response against a clade 1b sarbecoviruses and a clade 3 sarbecoviruses. In an embodiment, the pan-coronavirus vaccine produces a neutralising antibody response against two or more of a clade 1b sarbecoviruses, a clade 1a sarbecoviruses and a clade 3 sarbecoviruses. Members of the sarbecovirus clades are shown, for example, in Figure 57 and are described, for example, in Khaledian et al. (2022) and Sallard et al. (2021). In an embodiment, the pan-coronavirus vaccine produces a neutralising antibody response against more the one betacoronavirus. In an embodiment, the pan-coronavirus vaccine produces a neutralising antibody response against at least two betacoronavirus. In an embodiment, the vaccine antigens as described herein have altered immunogenicity, when delivered to a subject, compared to a vaccine antigen lacking i) an inter- protomer disulfide bond as described herein, ii) C-terminal truncation in the stem region as described herein or i) and ii). In an embodiment, the vaccine antigens as described herein have altered immunogenicity, when delivered to a subject, compared to a vaccine antigen lacking an inter-protomer disulfide bond as described herein. In an embodiment, the vaccine antigens as described herein have altered immunogenicity, when delivered to a subject, compared to a vaccine antigen lacking the C-terminal truncation in the stem region as described herein. In an embodiment, the vaccine antigens as described herein have altered immunogenicity, when delivered to a subject, compared to a vaccine antigen lacking an inter-protomer disulfide bond as described herein and lacking the C-terminal truncation in the stem region as described herein. As used herein, “immunogenicity” refers to the ability of a substance to induce cellular and humoral immune response. In an embodiment, the altered immunogenicity is increased immunogenicity. In an embodiment, the humoral immune response comprises neutralising antibodies. Immunogenicity can be measured using any method known to a person skilled in the art including measuring antibody titre. In an embodiment, the neutralising antibody response is a RBD neutralising antibody response. In an embodiment, the neutralising antibody response comprises antibodies directed to an epitope or epitopes that include(s) part or all of RBM. In an embodiment, the neutralising antibody response is not directed at the RBM. In an embodiment, wherein the neutralising antibody response is a non-RBD neutralising antibody response. In an embodiment, the non-RBD neutralising antibody response comprises a neutralising antibody response directed to an epitope or epitopes that include(s) part or all of the stem region. In an embodiment, the non-RBD neutralising antibody response comprises a neutralising antibody response directed to an epitope or epitopes that include(s) part or all of the NTD. In an embodiment, the non-RBD neutralising antibody response comprises a neutralising antibody response directed to an epitope or epitope that includes all or part of the RBD flank. In an embodiment, the vaccine antigens as described herein have altered antigenicity, when delivered to a subject, compared to a vaccine antigen lacking i) an inter-protomer disulfide bond as described herein, ii) C-terminal truncation in the stem region as described herein or i) and ii). In an embodiment, the vaccine antigens as described herein have altered antigenicity, when delivered to a subject, compared to a vaccine antigen lacking an inter-protomer disulfide bond as described herein. In an embodiment, the vaccine antigens as described herein have altered antigenicity, when delivered to a subject, compared to a vaccine antigen lacking the C- terminal truncation in the stem region as described herein. In an embodiment, the vaccine antigens as described herein have altered antigenicity, when delivered to a subject, compared to a vaccine antigen lacking an inter-protomer disulfide bond as described herein and lacking the C-terminal truncation in the stem region as described herein. As used herein, “antigenicity” refers to the ability of a particular substance to be recognized by antibodies produced as a result of a specific immune response. In an embodiment, the altered antigenicity is increased immunogenicity. In an embodiment, the S protein trimer is able to be bound by an antibody that binds the N-terminal domain (NTD). In an embodiment, the antibody is selected from: C1520 and an antibody that binds an epitope bound by C1520. In an embodiment, the antibody is C1520. In an embodiment, the antibody that binds the NTD is an antibody that binds an epitope bound by C1520. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by C1520. As used herein, an “epitope bound by C1520” comprises the residues corresponding to K97-R102; Glycans at N122 and N149, K150-R158, Q173, D178-N188 and H245 of SEQ ID NO: 1 and SEQ ID NO: 2. In an embodiment, the S protein trimer is able to be bound by any antibody that binds the RBD. In an embodiment, the antibody is selected from: S2H92, SP177, Omi-18, Omi-42, S309, CR3022, an antibody that binds an epitope bound by S2H92, an antibody that binds an epitope bound by SP1-77, an antibody that binds an epitope bound by Omi-18, an antibody that binds an epitope bound by Omi-42, an antibody that binds an epitope bound by S309, and an antibody that binds an epitope bound by CR3022. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by S2H92. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by SP1-77. In an embodiment, the antibody the binds an epitope that includes one or more amino acids bound by Omi-18. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by Omi-42. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by S309. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by CR3022. As used herein, an “epitope bound by S2H92” comprises the residues corresponding to W353, R355, R357, T393, N394, Y396, P426-T430, K462-F464, R466 and S514-P521 of SEQ ID NO: 1 and SEQ ID NO: 2. As used herein, an “epitope bound by SP177” comprises the residues corresponding to N343, T345, R346, K / N440 and L441-V445 of SEQ ID NO: 1 and SEQ ID NO: 2. As used herein, an “epitope bound by Omi-18” comprises the residues corresponding to R403, R408, Q409, Q414-N417, D420, Y421, Y453-N460, Y473-N477, N487, R493, Y501, G502 and H505 of SEQ ID NO: 1 and SEQ ID NO: 2. As used herein, an “epitope bound by Omi-42” comprises the residues corresponding to R403, D405, R408, Q409, T415- Y421, Y453, L455, F456, K458 and Y473-N477 of SEQ ID NO: 1 and SEQ ID NO: 2. As used herein, an “epitope bound by S309” comprises the residues corresponding to T333, N334, L335, P337, G339, E340, V341, N343glycan, A344, T345, K346, E354, K356, R357, I358, S359, N360, C361, N440, I441, K444 of SEQ ID NO: 1 and SEQ ID NO: 2 (Pinto et al., 2020). As used herein, an “epitope bound by CR3022” comprises the residues corresponding to Y369, N370, A372, F374, T376, F377, K378, Y380, V382, P384, T385, K386, D389, L390, F392, D428, F429, T430, F515, L517, H519 of the RBD (Yuan et al., 2020). In an embodiment, the S protein trimer is able to be bound by any antibody that binds a RBD flank. In an embodiment, wherein antibody is selected from: S2H97, SP1-77, an antibody that binds an epitope bound by S2H92 and an antibody that binds an epitope bound by SP1-77. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by S2H92. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by SP1-77. In an embodiment, the S protein trimer is able to be bound by any antibody that binds the RBM. In an embodiment, the antibody is selected from: Omi-18, Omi-42, SA55, an antibody that binds an epitope bound by Omi-18, an antibody that binds an epitope bound by Omi-42 and an antibody that binds an epitope bound by SA55. In an embodiment, the antibody that binds the RBM is Omi-18. In an embodiment, the antibody that binds the RBM is Omi-42. In an embodiment, the antibody that binds the RBM is SA55. In an embodiment, the antibody that binds the RBM is an antibody that binds an epitope bound by Omi-18. In an embodiment, the antibody that binds the RBM is an antibody that binds an epitope bound by Omi-42. In an embodiment, the antibody that binds the RBM is an antibody that binds an epitope bound by SA55. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by Omi-18. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by Omi-42. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by SA55. In an embodiment, the S protein trimer is able to be bound by any antibody that binds the stem. In an embodiment, the antibody is selected from: CV3-25, S2P6, CC40.8, CC95-108 and CC99-103. In an embodiment, the antibody is CV3-25. In an embodiment, the antibody binds the epitope bound by CV3-25. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by CV3-25. As used herein, an “epitope bound by CV3-25” comprises the residues corresponding to K1149-D1165 of SEQ ID NO: 1 and SEQ ID NO: 2. In an embodiment, the antibody is S2P6. As used herein, an “epitope bound by S2P6” comprises the residues corresponding to F1148-F1156 of SEQ ID NO: 1 and SEQ ID NO: 2. In an embodiment, the antibody is CC40.8. As used herein, an “epitope bound by CC40.8” comprises the residues corresponding to Q1142-H1159 of SEQ ID NO: 1 and SEQ ID NO: 2. In an embodiment, the antibody is CC95-108. In an embodiment, the antibody binds the epitope bound by CC95-108. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by CC95-108. As used herein, an “epitope bound by CC95-108” comprises the residues corresponding to F1148-N1158 of SEQ ID NO: 1 and SEQ ID NO: 2. In an embodiment, the antibody is CC99-103. In an embodiment, the antibody binds the epitope bound by CC99-103. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by CC99-103. As used herein, an “epitope bound by CC99-103” comprises the residues corresponding to F1148-N1158 of SEQ ID NO: 1 and SEQ ID NO: 2. In an embodiment, the S protein trimer is able to be bound by any antibody that binds the fusion peptide. In an embodiment, the antibody that binds the fusion peptide is COV44-79. In an embodiment, the antibody binds the epitope bound by COV44-79. In an embodiment, the antibody binds an epitope that includes one or more amino acids bound by COV44-79. As used herein, an “epitope bound by COV44-79” comprises the residues corresponding to S810-D830 of SEQ ID NO: 1 and SEQ ID NO: 2 Further modifications / further stabilising modifications In an embodiment, the CoV vaccine antigen as described herein comprises one or more further modifications to enhance one or more of the: stability, immunogenicity, expression and purification of the S protein trimer. In an embodiment, the ribonucleic acid encoding a CoV vaccine as described herein comprises one or more further modifications to enhance one or more of the: stability, immunogenicity, expression and purification of the S protein trimer. In an embodiment, the further modification is selected from a proline stabilisation, furin cleavage site, a trimerization sequence, a repeat or a spacer, or nucleotide sequences encoding same. In an embodiment, the proline stabilisation modification is 986P and / or 987P. The presence of both 986P and 987P in the S protein trimer is referred to as the “2P” modification. In an embodiment, the proline stabilisation modification is 2P and F817P. In an embodiment, the proline stabilisation modification is 2P and A892P. In an embodiment, the proline stabilisation modification is 2P and A889P. In an embodiment, the proline stabilisation modification is 2P and A942P. In an embodiment, the proline stabilisation is the 6P modification as described herein. In an embodiment, the further modification is the insertion of a furin cleavage site. In an embodiment, the mutation PG682SAS is introduced to insert a furin cleavage site (e.g. PG682SAS replaces RR682RAR in delta and PG682SAS replaces HR682RAR in omicron). In an embodiment, the further modification is the addition of FHA. In an embodiment, the further modification is the addition of a purification tag. In an embodiment, the CoV vaccine antigen as described herein does not comprise one or more of the following pairs of modifications: I712C and T1077C; I714C and Y1110C; P715C and P1069C; G889C and L1034C; I909C and Y1047C; Q965C and S1003C; F970C and G999C; A972C and R995C; A890C and V1040C; T874C and S1055C; and N914C and S1123C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modification I712C and T1077C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modification I714C and Y1110C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modification P715C and P1069C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modification G889C and L1034C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modification I909C and Y1047C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modifications Q965C and S1003C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modifications F970C and G999C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modifications A972C and R995C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modifications A890C and V1040C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modifications T874C and S1055C. In an embodiment, the CoV vaccine antigen as described herein does not comprise the modifications N914C and S1123C. Antigen combinations In one embodiment, the subject modified S antigen elicits neutralising immune responses against the strain from which it is derived and one or more other strains circulating in the community. In another aspect, the antigen or vaccine comprising the antigen or encoding sequence, delivers one or multiple antigens of interest to a subject and induces an effective functional and polyfunctional immune response against homologous or heterologous strains including for example T-cell and antibody responses. In one embodiment, coronavirus antigens from one or more strains are selected from one or two or three or four of spike, nucleocapsid, membrane and envelope proteins. In one embodiment, amino acid and / or nucleotide sequences encoding SARS-CoV proteins two, three or four of N, M, E and S are employed. In an illustrative embodiment, N, M, E and S are employed. In an embodiment, one or two or multiple different variants of SARS-CoV are combined. In an embodiment, one or two or multiple different variants of SARS-CoV -2 are combined. In an embodiment, multiple variants and multiple antigens are employed. In one embodiment, the antigen or vaccine comprising the antigen or encoding sequence is administered with one or more B-cell and / or T-cell epitopes. Cell lines capable of expressing the herein disclosed modified S antigen together with one or more of N, M, E antigens, or their encoding sequences are contemplated herein. Methods of producing the coronavirus vaccine antigen Antigens as described herein may be produced by recombinant or synthetic routes as known in the art. In an embodiment, the antigen is produced from a deoxyribonucleic acid encoding the coronavirus vaccine antigen as described herein. In an embodiment, the antigen is produced from vector comprising a deoxyribonucleic acid encoding the coronavirus vaccine antigen as described herein. In an aspect, the present invention provides a host cell comprising the deoxyribonucleic acid as described herein or the vector as described herein. In an aspect, the present invention provides a method of producing the coronavirus (CoV) vaccine antigen as described herein comprising culturing the host cell as described herein in culture medium to produce the vaccine antigen. In an embodiment, the method further comprising isolating the vaccine antigen from the cell and / or cell culture medium. In an aspect, the present invention provides a vaccine comprising the coronavirus (CoV) vaccine antigen as described herein, or the protein nanoparticle as described herein, or the virus- like particle as described herein, or the deoxyribonucleic acid as described herein, or the vector as described herein. In an embodiment, vaccine is selected from an: inactivated vaccine; live attenuated vaccine; and a protein subunit vaccine. In an embodiment, the vaccine further comprises at least one further CoV vaccine antigen as described herein. In one embodiment, a nanoparticle is provided comprising an antigen as described herein fused to a polyhedrin targeting peptide from CPV or other suitable virus. Other nanoparticles are known in the art and include SOR particles, luminazine synthase particles, pyruvate dehydrogenase particles. The antigen may be linked to a carrier or nanoparticle for increased immunogenicity. Suitable carriers are known in the art. Viral like particles offer some of the structural complexity / advantages of viral surface proteins to antigens and may be derived from any suitable viruses. As used herein “a virus like particle” refers to vaccines comprising viral surface proteins but lack the viral genome and one or more structural proteins. Human and hepadnavirus HBV are good examples. VLPs comprising the antigen may form for example spontaneously upon recombinant expression of the protein and may be characterised using conventional technology. In an aspect, the present invention provides a method of increasing S protein trimer yield comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In an aspect, the present invention provides a method of stabilizing a CoV S protein trimer in a prefusion conformation comprising modifying the CoV S protein trimer to comprise at least one non-endogenous inter-protomer disulfide bond. In an aspect, the present invention provides a method of increasing the melting temperature of a CoV S protein trimer comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In an aspect, the present invention provides a method of increasing the melting temperature of a CoV S protein trimer stabilised in the prefusion conformation comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In an aspect, the present invention provides a method of enhancing neutralising antibody responses comprising modifying the CoV S protein trimer to comprise at least one inter-protomer disulfide bond and / or modifying the CoV S protein trimer to comprise a stem region C-terminal truncation. In some embodiments, a ribonucleic acid encoding the antigen is administered to a subject and the antigen is produced in the subject. RNAs encoding the coronavirus vaccine and methods of production thereof The RNA as described herein may be modified by stabilizing sequences, capping, and polyadenylation. RNA may be delivered in a vector as described herein. RNA may be delivered as plasmids to express antigen and induce immune responses. The RNA may be modified to enhance delivery via a lipid nanoparticle. The RNA may be modified to increase stability of the RNA molecule. RNA-based approaches can include amplifying or non-self amplifying constructs. In an embodiment, the RNA is a messenger RNA (mRNA). In some embodiments, an RNA encoding the antigen as described herein is administered. In some embodiments, the RNA encodes an antigen lacking a coronavirus transmembrane domain as described herein. In some embodiments, the RNA encodes an antigen comprising a trimerization domain as described herein. In some embodiments, the RNA encodes an antigen lacking a trimerization domain as described herein. In some embodiments the RNA to be administered by transient in vivo transfection is a chemically modified RNA in which a proportion (e.g., 10%, 30%, 50%, or 100%) of at least one type of nucleotide, e.g., cytosine, is chemically modified to increase its stability in vivo. For example, in some cases modified cytosines are 5 methylcytosines. Such RNAs are particularly useful for delivery / transfection to cells in vivo, especially when combined with a transfection / delivery agent. In some cases, a chemically modified RNA is a chemically modified RNA in which a majority of (e.g., all) cytosines are 5-methylcytosines, and where a majority (e.g., all) of uracils are pseudouracils. In some embodiments, non-native cysteines are engineered to create di-sulphide bonds (e.g. via recombinant genetic technologies). The synthesis and use of such modified RNAs are described in, e.g., WO 2011 / 130624. Methods for in vivo transfection of RNA polynucleotides are known in the art. The term "RNA" relates to a molecule which comprises ribonucleotide residues and preferably being entirely or substantially composed of ribonucleotide residues. "Ribonucleotide" relates to a nucleotide with a hydroxyl group at the 2'-position of a β-D-ribofuranosyl group. The term includes double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of a RNA or internally, for example at one or more nucleotides of the RNA. Nucleotides in RNA molecules can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA. Accordingly, in one embodiment, the G / C content of the coding region is modified, particularly increased, compared to the G / C content of the coding region of its particular wild type coding sequence, i.e. the unmodified mRNA. The encoded amino acid sequence of the mRNA is preferably not modified compared to the coded amino acid sequence of the particular wild type mRNA. An optimised mRNA based composition could comprise a 5' and 3' non translated region (5'-UTR, 3'-UTR) that optimise translation efficiency and intracellular stability as known in the art and an open reading frame encoding the S protein. In one embodiment, removal of uncapped 5'- triphosphates can be achieved by treating RNA with a phosphatase. RNA may have modified ribonucleotides in order to increase its stability and / or decrease cytotoxicity. For example, in one embodiment, in the RNA, 5-methylcytidine is substituted partially or completely, for cytidine. Alternatively, or additionally, pseudouridine is substituted partially or completely, preferably completely, for uridine. These modifications may also reduce indiscriminate immune inactivation which may hinder translation of the RNA. In one embodiment, the term "modification" relates to providing an RNA with a 5'-cap or 5'-cap analog. The term "5'-cap" refers to a cap structure found on the 5'-end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA via an unusual 5' to 5' triphosphate linkage. In one embodiment, this guanosine is methylated at the 7-position. The term "conventional 5'-cap" refers to a naturally occurring RNA 5'-cap, preferably to the 7-methylguanosine cap. The term "5'-cap" includes a 5'-cap analog that resembles the RNA cap structure and is modified to possess the ability to stabilize RNA and / or enhance translation of RNA. A further modification of RNA may be an extension or truncation of the naturally occurring UTR such as the X-region tail or an alteration of the 5'- or 3 '-untranslated regions (UTR) such as introduction of a UTR which is not related to the coding region of said RNA, for example, the exchange of the existing 3'-UTR with or the insertion of one or more, preferably two copies of a 3'-UTR derived from a globin gene, such as alpha2-globin, alphal-globin, beta-globin. RNA having an unmasked poly-A sequence is translated more efficiently than RNA having a masked poly-A sequence. The term "poly(A) tail" or "poly-A sequence" relates to a sequence of adenyl (A) residues which may be located on the 3'-end of a RNA molecule and "unmasked poly-A sequence" means that the poly-A sequence at the 3' end of an RNA molecule ends with an A of the poly-A sequence and is not followed by nucleotides other than A located at the 3' end, i.e. downstream, of the poly- A sequence. Furthermore, a long poly-A sequence of about 120 base pairs results in an optimal transcript stability and translation efficiency of RNA. Therefore, in order to increase stability and / or expression of the RNA it may be modified so as to be present in conjunction with a heterologous poly-A sequence, preferably having a length of 10 to 500, more preferably 30 to 300, even more preferably 65 to 200 and especially 100 to 150 adenosine residues. In an especially preferred embodiment, the poly-A sequence has a length of approximately 120 adenosine residues. To further increase stability and / or expression of the RNA used according to the invention, the poly-A sequence can be unmasked. In addition, incorporation of a 3'-non translated region (UTR) into the 3'-non translated region of an RNA molecule can result in an enhancement in translation efficiency. A synergistic effect may be achieved by incorporating two or more of such 3'-non translated regions. The 3'- non translated regions may be autologous or heterologous to the RNA into which they are introduced. In one particular embodiment the 3'-non translated region is derived from the human β-globin gene. A combination of the above described modifications, i.e. optionally incorporation of a poly-A sequence, unmasking of the poly-A sequence and incorporation of one or more 3 '-non translated regions, has a synergistic influence on the stability of RNA and increase in translation efficiency. In order to increase expression of the RNA it may be modified within the coding region so as to increase the GC-content to increase mRNA stability and to perform a codon optimization and, thus, enhance translation in cells. Modified mRNA may be synthesised enzymatically and packaged into nanoparticles such as lipid nanoparticles and administered, for example intramuscularly. Self-replicating RNA or protamine complexed RNA approaches have also been shown to generate immune responses against viral infections. The RNA molecule can be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, in colloidal drug delivery systems (e.g., liposomes, microspheres, microemulsions, nanoparticles and nanocapsules), or in macroemulsions. Such techniques are known in the art and disclosed in Remington, the Science and Practice of Pharmacy, 20th Edition, Remington, J., ed. (2000). Various approaches for systemic administration of RNA as nanoparticles or colloidal systems are known. In non-viral approaches, cationic liposomes are used to induce RNA condensation and to facilitate cellular uptake. The cationic liposomes usually consist of a cationic lipid, like DOTAP, and one or more helper lipids, like DOPE. So-called 'lipoplexes' can be formed from the cationic (positively charged) liposomes and the anionic (negatively charged) RNA. In the simplest case, the lipoplexes form spontaneously by mixing the RNA with the liposomes with a certain mixing protocol, however various other protocols may be applied. In one embodiment, nanoparticulate RNA formulations such as RNA lipoplexes, are produced with defined particle size wherein the net charge of the particles is close to zero or negative. For example, electro- neutral or negatively charged lipoplexes from RNA and liposomes lead to substantial RNA expression in spleen or immune cells after systemic administration as disclosed in WO2013 / 143683. In one embodiment, the nanoparticles comprise at least one lipid. In one embodiment, the nanoparticles comprise at least one cationic lipid. The cationic lipid can be monocationic or polycationic. Any cationic amphiphilic molecule, eg, a molecule which comprises at least one hydrophilic and lipophilic moiety is a cationic lipid within the meaning of the present invention. In one embodiment, the positive charges are contributed by the at least one cationic lipid and the negative charges are contributed by the RNA. In one embodiment, the nanoparticles comprises at least one helper lipid. The helper lipid may be a neutral or an anionic lipid. The helper lipid may be a natural lipid, such as a phospholipid or an analogue of a natural lipid, or a fully synthetic lipid, or lipid-like molecule, with no similarities with natural lipids. In one embodiment, the cationic lipid and / or the helper lipid is a bilayer forming lipid. In one embodiment, the at least one cationic lipid comprises l,2-di-0-octadecenyl-3- trimethylammonium propane (DOTMA) or analogs or derivatives thereof and / or 1 ,2-dioleoyl-3- trimethylammonium-propane (DOTAP) or analogs or derivatives thereof. In one embodiment, the at least one helper lipid comprises 1 ,2-di-(9Z-octadecenoyl)-sn- glycero-3-phosphoethanolamine (DOPE) or analogs or derivatives thereof, cholesterol (Choi) or analogs or derivatives thereof and / or l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) or analogs or derivatives thereof. In one embodiment, the molar ratio of the at least one cationic lipid to the at least one helper lipid is from 10:0 to 3:7, preferably 9: 1 to 3:7, 4: 1 to 1 : 2, 4: 1 to 2: 3, 7: 3 to 1 : 1, or 2: 1 to 1 : 1 , preferably about 1 : 1. In one embodiment, in this ratio, the molar amount of the cationic lipid results from the molar amount of the cationic lipid multiplied by the number of positive charges in the cationic lipid. In the nanoparticles described herein the lipid may form a complex with and / or may encapsulate the RNA. In one embodiment, the nanoparticles comprise a lipoplex or liposome. In one embodiment, the lipid is comprised in a vesicle encapsulating said RNA. The vesicle may be a multilamellar vesicle, an unilamellar vesicle, or a mixture thereof. The vesicle may be a liposome. A lipid nanoparticle (LNP) is generally known as a nanosized particle composed of a combination of different lipids (an aqueous volume is encapsulated by amphipathic lipid bilayers e.g., single; unilamellar or multiple; multilamellar). Many different types of lipids may be included in LNP. In some embodiments, the lipids may be one or more of an ionisable lipid, a phospholipid, a structural lipid, neutral lipid and a PEG lipid. For example, the mRNA is encapsulated in a LNP. In another example, the mRNA is bound to the LNP. For example, the mRNA is absorbed on the LNP. Methods of preparing LNP are known to a person skilled in that art and are described, for example, in Huang et al., 2021 and Schoenmaker et al., 2021. As used herein, the term “ionisable lipid” or “ionisable lipids” shall refer to a lipid having at least one protonatable or deprotonatable group. For example, the lipid is positively charged at a pH at or below physiological pH (e.g. pH 7.4), and neutral at a second pH (e.g. at or above physiological pH). n an embodiment, the lipid nanoparticle comprises an ionisable lipid as described in Table 1 of Schoenmaker et al., 2021. Suitable ionisable lipids can have an anionic, cationic or zwitterionic hydrophilic head group. Exemplary phospholipids (anionic or zwitterionic) for use in the present disclosure include, for example, phosphatidylethanolamines, phosphatidylcholines, phosphatidylserines, and phosphatidylglycerols. In one example, the lipid is a cationic lipid. Exemplary cationic lipids include, but are not limited to, dioleoyl trimethylammonium propane (DOTAP), l,2-distearyloxy- N,N-dimethyl-3-aminopropane (DSDMA), 1 ,2-dioleyloxy- N,Ndimethyl-3-aminopropane (DODMA), 1 ,2-dilinoleyloxy-N,N-dimethyl-3- aminopropane (DLinDMA), 2,5-bis((9z,12z)- octadeca-9,12,dien-1-yloxyl)benzyl-4-(dimethylamino)butanoate (LKY750). In one example, the phospholipid is 2,5-bis((9z,12z)-octadeca-9,12,dien-1-yloxyl)benzyl-4- (dimethylamino)butanoate (LKY750). Exemplary zwitterionic lipids include, but are not limited to, acyl zwitterionic lipids and ether zwitterionic lipids, such as dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DOPC) and dodecylphosphocholine. The lipids can be saturated or unsaturated. In an embodiment, the lipid nanoparticle does not comprise a cationic lipid. A person skilled person in the art will appreciate that reference to a PEGylated lipid is a lipid that has been modified with polyethylene glycol. Exemplary PEGylated lipids include, but are not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, and PEG- modified dialkylglycerols. For example, a PEG lipid includes PEG-c-DOMG, PEG-DMG, PEG- DLPE, PEG-DMPE, PEG-DPPC, a PEG-DSPE lipid and combinations thereof. Suitable neutral or zwitterionic lipids for use in the present disclosure will be apparent to the skilled person and include, for example, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn- glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl- sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2- diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3- phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2- distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl- sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3- phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. The lipids can be saturated or unsaturated. Exemplary structural lipids include, but are not limited to, cholesterol fecosterol, sitosterol, campesterol, stigmasterol, brassicasterol, ergosterol, tomatidine, tomatine, ursolic acid and alpha-tocopherol. In an embodiment, the structural lipid is a sterol. In an embodiment, the structural lipid is cholesterol. In an embodiment, the structural lipid is campesterol. Vaccines in the form of liposomes are encompassed. The term "liposome" herein refers to uni- or multilamellar lipid structures enclosing an aqueous interior. Lipids which are capable of forming liposomes include all substances having fatty or fat-like properties. Dynamic laser light scattering is a method used to measure the size of liposomes well known to those skilled in the art. An extensive description of adjuvants can be found in Cox and Coulter, "Advances in Adjuvant Technology and Application", in Animal Parasite Control Utilizing Biotechnology, Chapter 4, Ed. Young, W.K., CRC Press 1992, and in Cox and Coulter, Vaccine 15(3): 248- 256, 1997. In an aspect, the present invention provides a host cell comprising the ribonucleic acid as described herein or the vector as described herein. In an aspect, the present invention provides a method of producing a coronavirus vaccine comprising culturing the host cell as described herein in culture medium to produce the ribonucleic acid described herein. In an embodiment, the ribonucleic acid as described herein is isolated and formulated into a pharmaceutical composition. Cell culture A skilled person would appreciate that the CoV vaccine antigen as described herein, deoxyribonucleic acid as described herein, ribonucleic acid as described herein, or vector as described herein can be produced in cell culture. In one example, the cells are prokaryotic or eukaryotic. In one example, the cells are of mammalian, avian, bacterial or Arthropoda origin. In one example, the cells are mammalian. In one example, the cells are from a continuous cell line. In one example, the cells are from a primary cell line. In one example, the cells are from an immortalized cell line. In one example, the cells are adherent cells. In one example, the cells are non-adherent cells (suspension cells). In one example, the cells are immune cells. In one example, the mammalian cells are HEK, CHO or HeLa cells. In one example, the cells are HeLa cells. The cells can be cultured in any cell culture medium that allows the expansion of the cells in vitro. Such mediums and processes will be known to the skilled person. Exemplary cell culture mediums for culturing the population of cells of the present invention include, but are not limited to: Iscove’s medium, UltraCHO, CD Hybridoma serum free medium, episerf medium, MediV SF103 (serum free medium), Dulbecco’s modified eagle medium (DMEM), Eagles Modified Eagle Medium (EMEM), Glasgow’s modified eagle medium (GMEM), SMIP-8, modified eagle medium (MEM), VP-SFM, DMEM based SFM, DMEM / F12, DMEM / Ham’s F12, VPSFM / William’s medium E, ExCell 525(SFM), adenovirus expression medium (AEM) and Excell 65629. It will be appreciated by persons skilled in the art that such mediums may be supplemented with additional growth factors, for example, but not limited, amino acids, hormones, vitamins and minerals. Optionally, such mediums may be supplemented with serum, for example fetal calf serum. In one example, the cells are cultured using the batch cell culture process. In one example, the cells are cultured using the perfusion cell culture process. In one example, the cells are cultured in a seed medium and a production medium. In one example, the cells are cultured in a stirred-tank bioreactor. In one example, the volume of the bioreactor is from about 1L to about 2500L. Vectors Antigen may be delivered in the form of viral or non-viral DNA vectors. The term "vector" as used herein, includes any transmitting moiety into which the antigen encoding sequence at least is inserted, including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, virus–like particles, viral vectors such as such as adenoviruses, adeno-associated viruses (AAV), alphaviruses, flaviviruses, herpes simplex viruses (HSV), measles viruses, CMV, rhabdoviruses, retroviruses, lentiviruses, Newcastle disease virus (NDV), poxviruses, and picornaviruses or baculoviral vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or PI artificial chromosomes (PAC). Vectors include expression as well as cloning vectors. Expression vectors comprise plasmids as well as viral vectors and generally contain a desired coding sequence and appropriate DNA sequences necessary for the expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in in vitro expression systems. Cloning vectors are generally used to engineer and amplify a certain desired DNA fragment and may lack functional sequences needed for expression of the desired DNA fragments. In one embodiment, the vector is a viral vector or a non-viral vector. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno- associated viruses, herpes viruses and lentiviruses, and attenuated forms thereof, each of which have their own advantages and disadvantages as known in the art. Viral vectors specifically include without limitation an adenoviral vector and a poxviral vector. Typically, for viral vectors, about 5 x 107to 5 x 1012viral particles are administered, typically about 5 x 109to 5 x 1010viral particles. Vectors may be replicating or non-replicating. Compositions, routes of delivery and doses A person skilled in the art will appreciate that the coronavirus vaccine (CoV) antigen as described herein, deoxyribonucleic acid encoding a CoV antigen as described herein, ribonucleic acid as described herein, or vector as described herein may be formulated into a pharmaceutical composition. In an embodiment, the pharmaceutical composition is a vaccine composition. Such compositions may include one or more pharmaceutically acceptable carriers. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 19th Edition, 1995, describes compositions and formulations suitable for pharmaceutical delivery of the disclosed immunogens. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable carriers such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non- toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical compositions (such as immunogenic compositions) to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. In particular embodiments, suitable for administration to a subject the carrier may be sterile, and / or suspended or otherwise contained in a unit dosage form containing one or more measured doses of the composition suitable to induce the desired immune response. It may also be accompanied by medications for its use for treatment purposes. The unit dosage form may be, for example, in a sealed vial that contains sterile contents or a syringe for injection into a subject, or lyophilized for subsequent solubilization and administration or in a solid or controlled release dosage. In an embodiment, the composition comprises a vaccine antigen as described herein. In an embodiment, the composition comprises a vector as described herein. In an embodiment, the vector comprises a deoxyribonucleic acid as described herein. In an embodiment, the composition comprises a ribonucleic acid as described herein. In an embodiment the composition comprises a lipid nanoparticle as described herein. In an embodiment, the lipid nanoparticle encapsulates a ribonucleic acid as described herein. In an embodiment, the composition may comprise one or more other epitopes for eliciting an immune response e.g. B-cell and / or T-cell epitopes. In an embodiment, the composition may comprise one or more other RNAs encoding epitopes for eliciting an immune response e.g. B-cell and / or T-cell epitopes. In an embodiment, the composition is formulated to be compatible with its intended route of administration, e.g., local or systemic. Examples of routes of administration include intradermal, subcutaneously, intravenously, intra-arterially, intraperitoneal, intranasal, sublingual, tonsillar, orally, pulmonary, topical or other parenteral and mucosal routes. In an embodiment, the composition is formulated to be stable at refrigerator temperature. In an embodiment, the composition is formulated so that it is suitable for transportation and / or storage at refrigerator temperature. In an embodiment, refrigerator temperature is about 3°C to about 17°C, or about 4°C to about 10°C, or about 4°C. In an embodiment, the composition is formulation to be stable at room temperature. In an embodiment, room temperature is about 18°C to about 24°C, or about 20°C to about 23°C, or about 23°C. In an embodiment, the composition is formulated so that is suitable for non-cold chain transportation and / or storage. In an embodiment, the composition is formulated so that is suitable for room temperature storage and / or transpiration. In an embodiment, the composition is formulated so that is suitable for transportation and / or storage at temperatures higher than room temperature e.g. about 25°C to 40°C (for countries where cold chain and low temperature storage and transportation trains are not available. Oral, nasal and pulmonary administration include administration via inhalation and sprays delivered to the aforementioned sites. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, non-aqueous solutions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. Isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride can also be included in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, such as aluminum monostearate or gelatin. Sterile injectable solutions can be prepared by incorporating the required amount in an appropriate solvent or buffer with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, suitable methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration excipients suitable for use in sprays, tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. The sprays, tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, PRIMOGEL, or corn starch; a lubricant such as magnesium stearate or sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavouring agent such as peppermint, methyl salicylate, or orange flavouring. Formulations suitable for administration by nasal inhalation include where the carrier is a solid, include a coarse powder having a particle size, for example, in the range of about 1 to about 500 microns, which is administered in the manner via a spray, nebuliser, inhaler or snuffed. Suitable formulations wherein the carrier is a liquid for administration by nebulizer, include aqueous or oily solutions of the agent. For administration by inhalation, the agent(s) can also be delivered in the form of drops or an aerosol spray from a pressured container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S.6,468,798. Formulations suitable for administration by oral inhalation include where the carrier is a solid, include a coarse powder having a particle size, for example, in the range of about 20 to about 500 microns, which is administered by oral inhalation from a container holding the powder held close to the mouth or where the carrier is a liquid for administration by nebulizer, which can include aqueous or oily solutions of the agent. Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays, drops, or suppositories. Intra dermal delivery of vaccines by needle or needle free approaches offers advantages in terms of ease of administration and intradermal administration approaches that effectively target immunocompetent cells are contemplated. Liquid formulations may be provided in pre- filled or non-prefilled syringes or needs such disposable-syringe jet injectors, hollow microneedles mounted on syringes, and needles adapted for intra-dermal delivery. Prefilled syringes with a single ID needle are commercially available. Alternatively, solid or biodegradable microneedles coated or impregnated with vaccine such as patches or other mini-needle / spike devices, or composed of vaccine may be employed. These are inserted into the dermal layers of the skin where either the vaccine coating is dissolved, or the microneedle itself dissolves in place. The formulation may be provided as a liquid or semi liquid formulation, or as a solid or powdered formulation. Jet-injectors operate by generating a high pressured stream, which flushes a liquid vaccine formulation into the deeper skin layers. However, approaches that deliver vaccines in a solid form may also prove to be promising. One such method is the ballistic approach, in which solid vaccine particles or vaccine-coated gold particles are accelerated towards the skin by needle-free devices, so that the particles are deposited in the epidermal and dermal layers of the skin. Intramuscular administration, can be via any intramuscular method known by a person skilled in the art, including for example, intramuscular injection. The compositions can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery. Compositions may include adjuvants. Immune responses to antigens can be enhanced if administered as a mixture with one or more adjuvants. Immune adjuvants typically function in one or more of the following ways: (1) immunomodulation (2) enhanced presentation (3) CTL production (4) targeting; and / or (5) depot generation. Illustrative adjuvants that may or may not be included include: particulate or non- particulate adjuvants, complete Freund's adjuvant (CFA), aluminum salt-based adjuvant, emulsion based adjuvant, TLR agonists, ISCOMS, LPS derivatives such as MPL and derivatives thereof such as 3D-MPL also GLA, and AGP, mycobacterial derived proteins such as muramyl di- or tri-peptides, particular saponins from Quillaja saponaria, such as QS21, QS7, and ISCOPREP™ saponin, ISCOMATRIX™ adjuvant, and peptides, such as thymosin alpha 1. In addition to the saponin component, the adjuvant may comprises a sterol such as beta-sitosterol, stigmasterol, ergosterol, ergocalciferol and cholesterol. In some embodiments, the adjuvant is presented in the form of an oil-in-water emulsion, e.g. comprising squalene, alpha-tocopherol and a surfactant or in the form of a liposome. AddaVax is a squalene based oil in water nano emulsion based on the formulation of MF-59 that has been found useful in flu vaccines. The adjuvants AS03, MF59, and CpG 1018 have already been used in licensed vaccines. Other suitable adjuvants include lecithin and caromer homopolymers, Matrix M, ASO1, ALFQ. CpG mofits and co-stimulatory molecules including TLR agonists, B7, OX-40L, G-CSF are contemplated. Adjuvants are discussed in Liang et al., 2020. In an embodiment, the composition comprises an adjuvant selected from one or more of an aluminium salt-based adjuvant, emulsion adjuvant, or a TLR agonist. Examples of such adjuvants are described for example in Liang et al., 2020. A subject may receive one dose of the composition or two or three doses of the composition at scheduled intervals. Antibodies generated against the subject antigen may be used in therapy or for screening. Antibody include an immunoglobulin, antigen-binding fragment, or derivative thereof, that specifically binds and recognises the antigen or an antigenic fragment thereof, or a dimer or multimer of the antigen. The term "antibody" is used herein in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multi (and bi) specific antibodies, and antibody fragments. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab').sub.2; diabodies; linear antibodies; single-chain antibody molecules (e.g. scFv); and multispecific antibodies formed from antibody fragments. Antibody fragments include antigen binding fragments either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA methodologies (Reference may be made to Kontermann and Dubel (Ed), Antibody Engineering,Vol 1-2, Ed., Springer Press, 2010). The term epitope refers to particular peptide sequences on a molecule that are antigenic, such that they elicit a specific immune response. An epitope is the region of an antigen to which B and / or T cells respond. An antibody can bind to a particular antigenic epitope which may be formed both from contiguous amino acids or noncontiguous amino acids. Methods of prevention and / or treatment In an aspect, the present invention provides a method of preventing and / or treating a coronavirus infection in a subject. As used herein, the term "prevention" or “prophylaxis” refers to reducing the likelihood of contracting or developing infection or a symptom thereof. Prevention need not be complete and does not imply that a subject will not eventually contract or develop the infection or a symptom thereof. As used herein, the terms "treating" or "treatment" refers to at least partially obtaining a desired therapeutic outcome. In an embodiment, treatment comprises preventing or delaying the appearance of one or more symptoms of a CoV infection. In an embodiment, treatment comprises arresting or reducing the development of one or more symptoms of a CoV infection. Reference to "subject" or "subjects" includes a subject susceptible to a coronavirus infection, or at risk of exposure to a coronavirus. The subject may be infected or uninfected, and may be symptomless or in need of treatment. In an embodiment, the subject is susceptible, or at risk of exposure to a SARS-CoV-2 infection. For example, the subject can be a mammal, avian, arthropod, chordate, amphibian or reptile. Exemplary subject’s include but are not limited to human, primate, livestock (e.g. sheep, cow, chicken, horse, donkey, pig), companion animals (e.g. dogs, cats), laboratory test animals (e.g. mice, rabbits, rats, guinea pigs, hamsters), captive wild animal (e.g. fox, deer), zoo animals (e.g. lion, tiger, bear), reservoir animals (e.g. bat, camel, pangolin). In an embodiment, the subject is a mammal. In one embodiment, the subject is human. In an embodiment, the subject is a camel. In an embodiment, the human is a fetus, infant, child, early adult and adult. In one embodiment, the adult is an elderly adult. In an embodiment, the adult is one or more of greater than 60 years in age, greater than 65 years in age, greater than 70 years in age, greater than 75 years in age, greater than 80 years in age, greater than 85 years in age, greater than 90 years in age. In an embodiment, the subject has had a prior coronavirus infection. In an embodiment, the subject has had a prior SARS-CoV-2 infection. In an embodiment, the subject has received a primary coronavirus treatment regimen as described herein. In an embodiment, the subject has received a primary and a secondary coronavirus treatment regimen. In an embodiment, the subject has received a primary coronavirus treatment regimen, a secondary coronavirus treatment regimen and a tertiary coronavirus treatment regimen. In an embodiment, the subject is immunocompromised. In an embodiment, the subject has a respiratory condition. In an aspect, the present invention provides a method of inducing an immune response to a coronavirus (CoV) in a subject, the method comprising delivering the vaccine as described herein to a subject. In an aspect, the present invention provides a method of enhancing the immune response to coronavirus (CoV) in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing the likelihood of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing, or reducing the likelihood or severity of a symptom of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of reducing the severity and / or duration of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing viral shedding in a human individual infected with a coronavirus (CoV), the method comprising delivering the vaccine antigen as described herein, or vaccine as described herein to a subject. In an embodiment, the vaccine is delivered intramuscularly, intradermal, subcutaneously, intravenously, intra-arterially, intraperitoneal, intranasal, sublingual, tonsillar, orally, pulmonary, topical or other parenteral and mucosal routes. In an aspect, the present invention provides vaccine antigen as described herein or the vaccine as described herein for use in one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. In an aspect, the present invention provides kit, device, surface or strip comprising the coronavirus (CoV) vaccine antigen as described herein. In an aspect, the present invention provides use of the coronavirus (CoV) vaccine antigen as described herein in the manufacture of a medicament for one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. In an aspect, the present invention provides a method of inducing an immune response to a coronavirus (CoV) in a subject, the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of enhancing the immune response to coronavirus (CoV) in a subject, the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing the likelihood of a coronavirus (CoV) infection in a subject, the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing, or reducing the likelihood or severity of a symptom of a coronavirus (CoV) infection in a subject, the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of reducing the severity and / or duration of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an aspect, the present invention provides a method of preventing or reducing viral shedding in a human individual infected with a coronavirus (CoV), the method comprising delivering the ribonucleic acid as described herein or RNA vaccine as described herein to a subject. In an embodiment, the ribonucleic acid or RNA vaccine is delivered intramuscularly, intradermal, subcutaneously, intravenously, intra-arterially, intraperitoneal, intranasal, sublingual, tonsillar, orally, pulmonary, topical or other parenteral and mucosal routes. In an aspect, the present invention provides a ribonucleic acid as described herein or the vaccine as described herein for use in one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. In an aspect, the present invention provides a kit, device, surface or strip comprising the coronavirus (CoV) ribonucleic acid as described herein. In an aspect, the present invention provides use of the coronavirus (CoV) ribonucleic acid as described herein in the manufacture of a medicament for one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject. As used herein, the phrase “reducing the severity of an infection”, or similar phrases, includes reducing one or more of the following in an individual: titre of a virus, duration of the virus infection, the harshness or duration of one or more symptoms of a coronavirus infection in a subject. As used herein, the phrase “duration of a coronavirus infection” refers to the time in which an individual has a CoV infection or a symptom caused by a CoV infection. In an embodiment, the present invention provides a vaccine that is a primary vaccine regimen. As used herein a “primary vaccine regimen” is the first vaccine regimen administered to a subject to produce a response to a specific pathogen. In the context of SARS-CoV-2, a primary vaccine is the first vaccine regimen administered to a subject to produce an immune response to the ancestral strain and / or a variant thereof. In an embodiment, the present invention provides a booster vaccine for a primary coronavirus vaccine regimen. In an embodiment, the present invention provides a booster vaccine for instances where a subject has received more than one prior coronavirus vaccine regimen. In an embodiment, the booster acts by enhancing the immune response elicited by the primary vaccine regimen. In an embodiment, the booster acts by enhancing the immune response to VOC or VOI or VHCs to which a lesser, little or no protective immune response is generated by the primary vaccine regimen. In an embodiment, the booster is administered at least 6 months, or at least 12 months, or at least 18 months, or at least 2 years, or at least 3 years or at least 5 years, or at least 6 years, or at least 7 years after the primary vaccine regimen. In an embodiment, the booster is administer sequentially or in combination with one or more other booster vaccines. Combination treatments A coronavirus vaccine antigen or vaccine or ribonucleic acid as described herein may be administered to a subject in combination with one or more further ribonucleic acids, vaccine antigens or vaccines. The further ribonucleic acids, vaccine antigens or vaccines may produce an immune response against an infectious pathogenic agent that may be the same or different to SARS-COV-2. In an embodiment, the pathogen is selected from influenza, Respiratory syncytial virusSARS-COV-2 or a specific VOC, VOI or VHC thereof. Administration may be in combination (at the same time) or sequential in either order. Kit, device, surface or strip The subject coronavirus antigen, deoxyribonucleic acid or ribonucleic acid as described herein is captured on solid or semi-solid surfaces for assay purposes, including epidemiological, diagnostic, purification, drug-screening, vaccine screening applications etc. Many such applications and methods of immobilising antigen to surfaces are known in the art and encompassed.
[0002] EXAMPLES Example 1 – Materials and methods Recombinant spike proteins. S2P.BA45.VI-1208.H8 and C-terminal truncation mutants thereof. A synthetic gene encoding the SARS CoV-2 omicron BA4 / omicron BA5 S ectodomain (omicron BA4 and omicron BA5 S amino acid sequences are identical and are collectively referred to as BA45 here), corresponding to the S2P protein described by Wrapp et al., 2020, was obtained from GeneART-ThermoFisher Scientific. The gene encodes S amino acids 16 to 1208, the furin cleavage site mutation, H681RRAR-> P681GSAS, the ‘2P’ mutation (K986P / V987P) and the VI mutation (A1016V / A1020I). The C-terminus of S2P was appended with a Gly-Ser-Gly-Ser linker and an octa-His affinity tag. The synthetic S2P.BA45.VI-1208.H8 gene was ligated downstream of a DNA sequence encoding the tissue plasminogen activator leader via NheI, within pcDNA3 (Invitrogen). DNA fragments encoding C-terminal truncation mutations were prepared by polymerase chain reaction using Phusion DNA polymerase (ThermoFisher), S2P.BA45.VI-1208.H8 DNA as template, the forward primer, 5’- AGCTCTGTGCTGAATGATATC (SEQ ID NO: 92), and reverse primers designed to encode a Gly-Ser-His6 sequence and stop codon after the desired C-terminal spike residue: (SEQ ID NO: 93) K1157: 5’-CGGCTCTAGATTAATGGTGATGATGGTGGTGGGATCCCTTAAAGTACTTGTCCAGTTCCTC (SEQ ID NO: 94) D1165: 5’-CGGCTCTAGATTAATGGTGATGATGGTGGTGGGATCCGTCCACGTCGGGGCTTGTGTGGTTC (SEQ ID NO: 95) N1192: 5’-CGGCTCTAGATTAATGGTGATGATGGTGGTGGGATCCATTCTTGGCCACCTCGTTCAGCCG (SEQ ID NO: 96) D1199: 5’-CGGCTCTAGATTAATGGTGATGATGGTGGTGGGATCCGTCGATCAGGCTCTCGTTCAGATTC (SEQ ID NO: 97) L1200: 5’-CGGCTCTAGATTAATGGTGATGATGGTGGTGGGATCCCAGGTCGATCAGGCTCTCGTTCAG (SEQ ID NO: 98) Q1201: 5’-CGGCTCTAGATTAATGGTGATGATGGTGGTGGGATCCTTGCAGGTCGATCAGGCTCTCG (SEQ ID NO: 99) G1204: 5’-CGGCTCTAGATTAATGGTGATGATGGTGGTGGGATCCCCCCAGTTCTTGCAGGTCGATCAGGCTCTC The PCR products encoding the C-terminal truncations were used to replace the DNA sequence encompassed by EcoRV and XbaI restriction sites in Figure 4 within the pcDNA3- S2P.BA45.VI-1208.H8 expression vector. All sequences were verified by fluorescent Sanger sequencing (BigDye Terminator v3.1, ABI). The S1147 truncation was initially introduced into the pcDNA3-S2P-FHA vector containing ancestral Hu-1 spike sequence described in (Poumbourios et al., 2023) by using a synthetic gene encoding amino acids 979-1147-GlySer-His6-followed by a stop codon. The synthetic fragment is encompassed by EcoRV and XbaI restriction sites. The VI mutation was then introduced by overlap-extension PCR mutagenesis. The ancestral Hu-1 spike DNA was then replaced with the corresponding omicron BA4 / 5 spike DNA fragment from S2P.BA45.VI- 1208.H8. Cysteine substitution mutants. Cysteine substitution mutations were introduced into the S2P.BA45.VI-1147, S2P.BA45.VI-1192, and S2P.BA45.VI-1204 expression vectors using synthetic genes (GeneART-ThermoFisher Scientific) encoding the paired Cys substitution mutations listed in Table 2. The V1016A / I1020A (AA) and P986V / P987K (noP) back-mutations were introduced to the various vectors using synthetic genes (GeneART-ThermoFisher Scientific) encoding the appropriate mutations. Table 2. Shows the near neighbour contacts between SARS Cov-2 subunits determined using the Ligand-Protein Contacts & Contacts of Structural Units server. Contacting pair Distance (Å) Buried Å2.C ^-C ^ distance (Å) subunits code T547 N978 3.2 30.9 6.7, 6.8, 6.4 S1-S2 A2 A713 Q895 3.2 43.5 5.6, 5.7, 5.6 S2-S2 B8 A668 T866 3.5 43.1 5.4, 5.4, 5.5 S1-S2 C12 D571 S967 4.4 22.4 6.9, 5.8, 5.5 S1-S2 D17 G757 S968 5.3 17.7 5.5, 5.1, 4.7 S2-S2 E22 S758 T961 3.4 19.2 7.5, 7.6, 7.7 S2-S2 F24 N317 D737 3.4 41.2 7.5, 7.2, 8.0 S1-S2 G1 A570 S967 4.5 11.9 7.0, 5.5, 5.0 S1-S2 I1 A890 G1046 3.7 29.4 4.7, 3.8, 4.7 S2-S2 K19 N914 S1123 3.1 25.3 7.0, 7.3, 7.4 S2-S2 L23 S1030 D1041 3.7 20 5.8, 5.7, 5.8 S2-S2 M25 The coordinates of the ancestral SARS CoV-2 prefusion stabilized spike trimer in the 1RBD-up, 2RBD-down conformation, PDB ID: 6VSB, were analysed to identify inter-subunit near-neighbour contacts as potential targets for paired Cys substitution mutagenesis. The closest distance between interacting amino acid pairs, buried surface, C ^-C ^ distance, subunit in which interacting pairs are located and mutant code are shown. S2P.BA45-1273 expression vectors. Synthetic genes encoding S residues 1-1273 of Omicron BA.4 / BA.5 variants (the sequences are identical) were produced by GeneART-Thermo Fisher. The genes contained a KpnI restriction site followed by the TATCGCCACC (SEQ ID NO: 100) sequence at the 5’ end (prior to the ATG start codon) and an XbaI site (after the TAA stop codon) at the 3’ end. The synthetic genes encoded furin cleavage site mutations, H681RRAR-> P681GSAS and the di-Pro ‘2P’ substitution at positions 986 and 987. The synthetic genes were cloned into the KpnI-XbaI sites of pCDNA3. The D17, I1, L23, DL and IL mutations were introduced to the vectors by subcloning of the appropriate fragments containing the mutations from various vectors or synthetic gene products (GeneART). Fluorescent sequencing was used to confirm that the mutations had been transferred to the appropriate vectors. Expression and purification of recombinant spike proteins. Spike expression vectors were transfected into Expi293F cells using Expifectamine, as recommended by the manufacturer (ThermoFisher Scientific). The cells were cultured for 7 days at 34°C after which the transfection supernatants were clarified by centrifugation and filtration through 0.45 μm nitrocellulose filters. The SARS CoV-2 glycoproteins were then purified by divalent cation affinity chromatography using TALON resin (Merck) followed by size exclusion chromatography using a Superose 6 Increase 10 / 300 column linked to an AKTApure instrument (Cytiva). All proteins were concentrated using Amicon centrifugal filter units. The protein solutions were filter-sterilized using 0.45 μm nitrocellulose filters and protein aliquots stored at -80°C. The buffer was phosphate buffered saline pH 7.4. Protein purity was assessed by SDS-PAGE and SEC. SDS-PAGE was performed using NuPAGE Bis-Tris and Tris-Acetate precast gels and an XCell SureLock Mini- Cell Electrophoresis System (Thermo Fisher) as recommended by the manufacturer. Precision plus prestained protein standards (Bio-Rad) were the molecular weight markers. Recombinant spike ligands. hACE2-Fc is a recombinant fusion protein comprising amino acids 19-615 of the human ACE2 ectodomain linked to the Fc domain of human IgG1 via a GS linker and is described previously (Poumbourios et al., 2023). Recombinant mNAbs. pCDNA3-based human IgG1 heavy and kappa and lambda light chain expression vectors (Center et al., 2020) containing the variable regions of SARS CoV-2 directed mNAbs S2H97 (Starr et al., 2021), Omi-18 and Omi-42 (Nutalai et al., 2022), SP1-77 (Luo et al., 2022), C1520 (Wang et al., 2022), COV44-79 (Dacon et al., 2022), CV3-25 (Jennewein et al., 2021) were produced in-house as described in Poumbourios et al., 2023. Differential scanning fluorimetry (DSF). Differential scanning fluorimetry was used to assess protein thermostability (Niesen et al., 2007). Protein (10 µg) was diluted into 25µL with 5x concentration SYPRO Orange Protein Gel Stain (Sigma Aldrich) in duplicate. The samples were then heated in an QuantStudio 7 Real-time qPCR System in 0.5°C increments from 25°C to 95°C for 1 minute per increment. Measurements of fluorescence were taken at the end of each increment. Excitation was at 492nm, and emission at 610nm. The Tm was determined to be the minimum of the negative first derivative of the melting curve. Biolayer interferometry. BLI-based measurements were determined using an OctetRED96 System (ForteBio, Fremont CA). Antibodies were diluted in kinetic buffer to 10 μg / ml and immobilized onto anti-human IgG Fc capture biosensors (AHC, ForteBio). Kinetics assays were carried out at 30 °C using standard kinetics acquisition rate settings (5.0 Hz, averaging by 20) at a sample plate shake speed of 1,000 rpm. The kinetic experiments included five steps: (a) baseline (180 s); (b) antibody loading (300 s); (c) second baseline (180 s); (d) association of antigen (300 s), and (e) dissociation of antigen (300 s). Fitting curves were constructed using ForteBio Data Analysis 10.0 software using a 1: 1 binding model, and double reference subtraction was used for correction. Western blotting of S2P-1273 glycoproteins expressed in 293T cells.293T cells were transfected with the expression vectors using FUGENE HD (Promega) according to the manufacturer’s instructions. At 48 h post-transfection, the cells were washed with ice-cold PBS, centrifuged for 90 sec at 10,000 rpm and the pellets lysed in lysis buffer (1% Triton X100 in PBS containing 1 mM ethylenediamine tetraacetic acid) for 30 min on ice. The lysates were clarified by centrifugation at 10,000 rpm for 10 min at 4°C and subjected to SDS-PAGE in the presence or absence of 3% betamercaptoethanol. The proteins were transferred to nitrocellulose using the iBLOT2 system (Thermo Fisher), and the membranes blocked with 5% skim milk powder in PBS. The filters were probed with Rabbit anti-S1 polyclonal antibody (Sino Biological) and anti-rabbit IRDye800CW (Odyssey). The filters were then scanned in a LI-CORE imager. Flow Cytometry.293T cells were transfected with S2P.BA45.VI-1273, D17.VI-1273 and I1.VI-1273 expression vectors together with an EGFP-expression vector (EGFP-N1) using FUGENE 6 (Promega) according to the manufacturer’s instructions. At 48 h post transfection, the cells were washed with PBS and then detached using versene solution. The cells were resuspended in 1000 μl PBS and stained with LIVE / DEAD Red Dead Cell (Invitrogen) stain at 1: 1000 dilution for 30 minutes at room temperature. The cells were washed twice in ice-cold FACS buffer (5% v / v fetal calf serum in PBS containing 2 mM ethylenediamine tetra acetic acid) by centrifugation at 400 xg for 5 min. The cells were resuspended in 800 µl of FACS buffer, added to U-bottom 96-well culture plates and incubated with 5 µg / ml of ACE2-Fc and human mNAbs in FACS buffer for 1 h at room temperature. The cells were washed twice in ice-cold FACS buffer by centrifugation at 400 xg for 5 min. The cells were then incubated with AlexaFluor 647 goat anti-human (H+L) (Invitrogen) for 30 min at room temperature in the dark. The cells were washed twice in ice-cold FACS buffer by centrifugation at 400 xg for 5 min, resuspended in 100 μl FACS buffer and immediately applied to a Canto II flow cytometer. Ten thousand events were captured for each antibody-S2P.BA45.VI-1273 variant combination. FlowJo software was used for data analysis. The viable 293T cell population was first gated by forward scatter and side scatter and single cells chosen for analysis after doublet discrimination. EGFP / S2P-1273 glycoprotein double-positive cells were analysed for fluorescence intensity. S6P-1192 glycoprotein expression vectors. The hexa-Pro (or 6P) mutation: F817P, A892P, A899P, A942P, V986P, K987P (Hsieh et al., (2020), was introduced to S2P.BA45-1192 expression vectors using synthetic ‘hexa-Pro converter’ gene fragments produced by GenSCRIPT. Two converters were used: ‘Hexa-Pro converter BsrGI-EcoRV’ (SEQ ID NO: 143) for S6P.BA45-1192 proteins lacking the D17 and I1 mutations (5’- TGTACAATGTATATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGC AGCTTCTGCACCCAGCTGAAGAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAA CACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTT CGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCC CTATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGT ATGGCGATTGTCTGGGCGATATTGCCGCCAGGGATCTGATCTGCGCCCAGAAGTTTAACG GACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACAAGCGCTC TGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCTGGCCCTGCCCTGCAGATC CCCTTTCCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAACGTGCTG TACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACTCCGCCATCGGCAAGATCCAGGAC AGCCTGAGCAGCACACCTAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGC CCAGGCACTGAACACCCTGGTCAAGCAGCTGTCTAGCAAGTTCGGCGCCATCAGCTCTGT GCTGAATGATATC) and ‘Hexa-Pro S967C converter BsrGI-EcoRV’ (SEQ ID NO: 144) for S6P.BA45-1192 proteins containing the D17 and I1 mutations (5’- TGTACAATGTATATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGC AGCTTCTGCACCCAGCTGAAGAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAA CACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGTACTT CGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCC CTATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGT ATGGCGATTGTCTGGGCGATATTGCCGCCAGGGATCTGATCTGCGCCCAGAAGTTTAACG GACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACAAGCGCTC TGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCTGGCCCTGCCCTGCAGATC CCCTTTCCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAACGTGCTG TACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACTCCGCCATCGGCAAGATCCAGGAC AGCCTGAGCAGCACACCTAGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCACAATGC CCAGGCACTGAACACCCTGGTCAAGCAGCTGTGCAGCAAGTTCGGCGCCATCAGCTCTG TGCTGAATGATATC). The converters were ligated into the BsrGI and EcoRV restriction sites of the appropriate S2P.BA45-1192 vectors. For the omicron BA.2.86 and clade 3 bat sarbecovirus PRD-0038 spikes, synthetic genes corresponding to ancestral Hu-1 reference isolate amino acids 16-1192 were obtained from Genscript. The synthetic genes encode the hexaPro mutation, the furin cleavage site mutation: R681RRAR-> P681GSAS for omicron BA.2.86 (PRD-0038 S lacks a furin cleavage site), and in some cases the VI mutation: A1016V / A1020I (Poumbourios et al., 2023). The C-terminus of the S6P-1192 spikes was appended with a Gly-Ser linker and a hexa-His affinity tag. The synthetic genes were ligated downstream of a DNA sequence encoding the tissue plasminogen activator leader via NheI, within pcDNA3 (Invitrogen). Cysteine substitution mutations were introduced into the S6P-1192 expression vectors using synthetic gene fragments (Genscript) encoding paired Cys substitution mutations corresponding to D17 (D571C / S967C) and I1 (A570C / S967C). S6P.BA45-1273 glycoprotein expression vectors. S6P.BA45-1273 expression vectors were created by replacing the NotI-EcoRV restriction fragment of S2P.BA45-1273 expression vectors with the corresponding gene fragment encoding diCys, furin site and hexaPro mutations from the appropriate S6P.BA45-1192 expression vectors. Additional recombinant monoclonal antibodies. pCDNA3-based human IgG1 heavy and kappa and lambda light chain expression vectors (Center et al., 2020) containing the variable regions of SARS CoV-2 directed mNAbs SA55 (Cao et al., 2020), S309 (Shang et al. (2020)), CC95-108, CC99-103 (Zhou et al., 2023), CR3022 (ter Meulen et al., 2006), S2P6 (Pinto et al., 2020). and CC40.8 (Zhou et al., 2022) were produced in-house as described in Poumbourios et al., 2023. RBD expression vectors. Synthetic genes encoding the receptor binding domain (RBD; amino acids 332-532) of ancestral Hu-1, Omicron BA.5, XBB.1.5 and JN.1 isolates were obtained from GeneART-ThermoFisher Scientific or GenSCRIPT and ligated to the tissue plasminogen activator leader via NheI in pcDNA3. The genes encode a C-terminal hexa-His tag and Avitag sequence. NTD expression vectors. Gene fragments encoding amino acids 16-305, corresponding to the S N-terminal domain were amplified by polymerase chain reaction. The templates were S2P.16L-FHA, encoding the ancestral Hu-1 sequence (Poumbourios et al., 2023), S6P.BA45.AA-1192 and S6P.BA286.AA-1192. Note that the BA.2.86 and JN.1 NTDs are identical. The forward primer was CMVf (SEQ ID NO: 145) (5’cgcaaatgggcggtaggcgtg) and the reverse primers were: CoV2 NTD 3’_A (SEQ ID NO: 146) (5’ctcgaagatgtcgttcaggccgccggacttcagggtgcactttgtc), CoV2 NTD 3’_B (SEQ ID NO: 147) (5’cctccttcgtgccactcgattttctgggcctcgaagatgtcgttcag), and CoV2 NTD 3’_C (SEQ ID NO: 148) (5’cgccgctctagattaatggtgatgatggtggtgggatcctccttcgtgccactcg). The NTD fragments were appended at the 3’ ends with hexa-His and Avitag sequences. Maltose-binding protein-stem chimeric protein, MBP-stem(1138-1208). A gene fragment encoding the stem region of S (amino acids 1138-1208) was amplified by polymerase chain reaction. The template was S2P-FHA, which encodes an ancestral Hu-1 spike-derived sequence (Poumbourios et al., 2023) and the primers WuStemY1138NotIforw (SEQ ID NO: 149) (5’gcggcggcggccgcctacgaccctctgcagcccgagc) and WuSTEMQ1208SalIRev (SEQ ID NO: 150) (5’-cgccgcgtcagcttattgctcgtacttccccagttcttgc). The DNA fragment was ligated into the NotI-SalI site of MBP / gp41(522–654) (Lay et al., 2004). MBP-stem(1138-1208) expression was induced for 18 h at 24°C in E. coli BL21 cells using 100 mM isopropyl β-d-1-thiogalactopyranoside after which the cells were pelleted, subjected to freeze (-80°C)-thaw cycle and the cells disrupted by sonication in 300 mM NaCl / 100 mM Tris.HCl pH8 / 1 mM Ethylenediaminetetraacetic acid / 1 mM phenylmethylsulfonyl fluoride (S buffer). The clarified supernatant was then affinity purified over amylose agarose by elution with 10 mM maltose in S buffer followed by Superose 12 SEC. SFur BA45 expression vector. The wild type omicron BA.4 / 5 spike expression vector, SFur BA45, was derived from S2P.BA45-1273 following reinstatement of the wild type spike sequence via standard molecular biological techniques. Biolayer interferometry. BLI-based measurements were determined using an OctetRED96 System (ForteBio, Fremont CA). Antibodies were diluted in kinetic buffer to 10 μg / ml and immobilized onto anti-human IgG Fc capture biosensors (AHC, Sartorius). Kinetics assays were carried out at 30 °C using standard kinetics acquisition rate settings (5.0 Hz, averaging by 20) at a sample plate shake speed of 1,000 rpm. The kinetic experiments included five steps: (a) baseline (180 s); (b) antibody loading (300 s); (c) second baseline (180 s); (d) association of antigen (300 s), and (e) dissociation of antigen (300 s). Fitting curves were constructed using Octet Analysis Studio 13.0.3.52 software using a 1: 1 binding model, and double reference subtraction was used for correction. Immunization and viral challenge of K18hACE2 mice. Groups of 16 B6.Cg-Tg(K18- ACE2)2Priman (K18hACE2) 8-10 week-old female mice were immunized via interscapular subcutaneous injection with 10 ^g of S6P.BA45-1192 proteins (100 ^L) in a 1:1 (v / v) mix with AddaVax adjuvant (InvivoGen, San Diego, CA) at weeks 0, 3 and 6. A negative control group was immunized as above with a 1:1 (v / v) mix of PBS and adjuvant. A 10% total blood volume mandibular bleed was taken one day before the final booster and seven days before viral challenge for sera analysis. An additional terminal bleed of four mice from each treatment group was performed alongside the final bleed to ensure enough sample was collected. Sera were stored at -20°C, with heat inactivation at 56 °C for 30 min prior to use in immunological assays. Two weeks following the second booster all mice were lightly anesthetized using 4% v / v isoflurane and infected intranasally with 104TCID50 of SARS-CoV-2 Omicron BA.5 (hCoV- 19 / Australia / VIC61194 / 2022; GISAID: EPI_ISL_13276063) in 50 µL of PBS. One group of four mice was treated with 50 µL PBS as a mock challenge. At four days post infection eight mice per group were culled by CO2 asphyxiation before lung and nasal turbinate tissues were collected into PBS containing penicillin / streptomycin and amphotericin b. Lungs and nasal turbinates were homogenized in 2 mL and 1 mL of PBS, respectively. Vero-TMPRSS2 cells were infected to determine the tissue culture infective dose (TCID50 / ml). Vero-TMPRSS2 cells in 24 well and 96- well plates were utilized for titration assays. Cells were infected with sample in quadruplicate. Cells were incubated at 37°C and 5% CO2 for 5 days. Following incubation, wells with cytopathic effects were recorded and the virus titre (TCID50 / mL) for each sample determined by limited dilution using the Reed and Muench method. Authentic virus neutralization assay. The neutralizing activity of sera against authentic ancestral hCoV-19 / Australia / NSW2715 / 2020, Omicron BA.5, XBB.1.5 and JN.1 SARS-CoV-2 was determined with the rapid high-content SARS-CoV-2 microneutralization assay described by Aggarwal et al.2022. Briefly, Hoechst-33342-stained HAT-24 cells were seeded in 384-well plates (Corning, CLS3985). Serially diluted heat-inactivated vaccinal sera were co-incubated with an equal volume of SARS-CoV-2 virus solution at twice the median lethal dose for 1 h at 37 °C. 40 μl of serum-virus mixtures were added to an equal volume of pre-plated cells, incubated for 20 h and then directly imaged on an ImageXpress Pico Automated Cell Imaging System (Molecular Devices). Cellular nuclei counts were obtained with CellReporterXpress Image Acquisition and Analysis software (Molecular Devices), and the percentage of virus neutralization was calculated as described in Aggarwal et al. 2022. The neutralization ID50 was the last consecutive dilution reaching ≥50% neutralization. Chemiluminescence Immunoassay (ELISA). Nunc Maxisorp 384-well white plates were coated with 1ug / ml of S glycoproteins, NTD proteins, RBD proteins, stem proteins or synthetic peptides overnight at 4°C, washed with PBS and blocked with BSA (10mg / ml, PBS) at room temperature for 1 h. The plates were again washed and incubated with serially diluted serum samples or mNAbs for 2 h at room temperature. Antibody binding detected using horseradish peroxidase-labelled rabbit anti-guinea pig antibody (Dako, Glostrup, Denmark). Light signals were detected using SuperSignal ELISA Pico Chemiluminescent Substrate (ThermoFisher Scientific) and measured immediately for 0.5 seconds using CLARIOstar (BMG Lab Technologies). Relative light units (RLUs) were plotted against the reciprocal dilution in GraphPad Prism 10.1.0 and curves fitted using Specific binding with Hill slope. The binding titre was defined as the reciprocal dilution of serum giving RLUs fifty-times that of background, as defined by binding to BSA. Flow Cytometry.293T cells were transfected with S6P.BA451273 expression vectors together with an EGFP-expression vector (EGFP-N1) using FUGENE 6 (Promega) according to the manufacturer’s instructions. At 48 h post transfection, the cells were washed with PBS and then detached using versene solution. The cells were resuspended in 1000 μl PBS and stained with LIVE / DEAD Red Dead Cell (Invitrogen) stain at 1: 1000 dilution for 30 minutes at room temperature. The cells were washed twice in ice-cold FACS buffer (5% v / v fetal calf serum in PBS containing 2 mM ethylenediamine tetra acetic acid) by centrifugation at 400 xg for 5 min. The cells were resuspended in 800 µl of FACS buffer, added to V-bottom 96-well culture plates and incubated with 5 µg / ml of ACE2-Fc and human mNAbs in FACS buffer for 1 h at room temperature. The cells were washed twice in ice-cold FACS buffer by centrifugation at 400 xg for 5 min. The cells were then incubated with AlexaFluor 647 goat anti-human (H+L) (Invitrogen) for 30 min at room temperature in the dark. The cells were washed twice in ice-cold FACS buffer by centrifugation at 400 xg for 5 min, resuspended in 100 μl FACS buffer and immediately applied to a Canto II flow cytometer. Ten thousand events were captured for each antibody-S2P.BA45.VI- 1273 variant combination. FlowJo software was used for data analysis. The viable 293T cell population was first gated by forward scatter and side scatter and single cells chosen for analysis after doublet discrimination. EGFP / S2P-1273 glycoprotein double-positive cells were analysed for fluorescence intensity. Pseudotyped virus production and analysis. S-pseudotyped HIV luciferase reporter viruses were prepared according to the method of Jackson et al., 2020. Plasmids used for the production of S-HIV pseudoparticles were a kind gift of Professor Doria-Rose, NIH Vaccine Research Center, and include the packaging plasmid pCMVΔR8.2 and luciferase reporter plasmid pHR' CMV Luc (Naldini et al., 1996), and a TMPRSS2 plasmid (Böttcher et al., 2006). Together with S-expression plasmids, the 3 plasmids were co-transfected into HEK293T cells and after 18 h of incubation, the medium was replaced with fresh Dulbecco’s modification of minimal essential medium containing 10% fetal bovine serum (DMF10) and cultured for a further 2 days. Supernatants containing pseudoviruses were filtered through 0.45 ^m membrane filters prior to use. The infectivity of filtered pseudoparticle-containing supernatants was determined 3 days after inoculation of 293-ACE2 cells plated on poly-L-lysine coated 96-well culture plates (10,000 cells per well). Luciferase activity was measured using Promega’s luciferase assay system in a Clariostar plate reader (BMG Labtech). Transfection of mRNA. mRNAs encoding the various spike constructs were transfected into Expi293F (soluble spike glycoprotein) or 293T cells (membrane anchored spike glycoproteins) using lipofectamine MessengerMAX (Thermo Fisher Scientific) as recommended by the manufacturer. Example 2 – Identification of amino acid sequence determinants within the S2 stem that control the thermostability and yield of S2P.BA45 trimers The base S glycoprotein construct used here to identify amino acid sequence determinants within the S2 stem that control the biophysical properties of S trimers is S2P.omiBA45.VI-1208.H8 (referred to herein as S2P.BA45.VI-1208) as described in (Poumbourios et al., 2023). This protein was produced by a CMV promoter driven vector that expresses residues 16-1208 of the omicron BA.4 S glycoprotein (omicron BA.4 and omicron BA.5 sequences are identical (Tegally et al., 2022), the ‘2P’mutation - a di-Pro substitution at positions 986 and 987 that maintains the S trimer in a prefusion conformation, and a furin cleavage site mutation, H681RRAR-> P681GSAS (Wrapp et al., 2020). The A1016V / A1020I ‘VI’ mutation was added to the CH coiled coil forming sequence of S2 (Poumbourios et al., 2023). A Gly-Ser-Gly- Ser linker and octa-His or hexa-His tag was added to Q1208, the C-terminal residue of the ectodomain. An N-terminal tissue plasminogen activator leader sequence (tPAL) was joined to residue 16 by an Ala-Ser linker to enable secretion (Figure 2B). See Figures 3 and 4 for amino acid and DNA sequences, respectively. The construct is referred to as S2P.BA45.VI-1208 throughout. A model of the expected 3D architecture of S2P.BA45.VI-1208 is depicted in Figure 5. Shown are: 1) the head (residues 16-1139), comprising the RBD, fusion peptide and CH coiled coil to which the VI mutation was introduced: 2) the stem, (residues 1140-1208) which connects the ectodomain to the transmembrane domain (TMD). The short coiled coil that is observed at the top of the stem in cryo-electron microscopic (cryo-EM) structures e.g. Wrapp et al., 2020 is shown.3) The location and partial structure of the membrane anchor (Fu et al., 2021) is shown at the bottom. 4) Recombinant soluble spike proteins often have the TMD replaced with a trimerization clamp such as T4 foldon (also shown in Guthe et al., 2004) to stabilize the trimer. To identify amino acid sequences that determine the biochemical properties of S2P.BA45.VI, a set of C-terminal stem truncation mutants were created. Figure 6 shows the sequence of the stem with key features and truncation points annotated. The new C-termini are: • S1147, that includes a short coiled coil that is observed at the top of the stem in most cryo-electron microscopic (cryo-EM) structures of the soluble S2P trimer e.g. Wrapp et al,.2020; (referred to as S2P.BA45.VI-1147). • K1157, which completes the hydrophobic repeat of the short coiled coil at the top of the stem; (referred to as S2P.BA45.VI-1157). • D1165, which includes N-linked glycosylation site at N1158; (referred to as S2P.BA45.VI-1165). • N1192, which includes a hydrophobic repeat to the N-linked glycosylation site at N1194; (referred to as S2P.BA45.VI-1192). • D1199, which includes the N-linked glycosylation site at N1194; (referred to as S2P.BA45.VI-1199). • L1200, Q1201 and G1204 that continues the hydrophobic repeat to the C- terminal residue of the ectodomain at Q1208. (referred to as S2P.BA45.VI-1200, S2P.BA45.VI-1201 and S2P.BA45.VI-1204, respectively). Amino acid and DNA sequences shown in Figures 7 and 8, respectively. The S2P.BA45.VI proteins were expressed in Expi293F cells and partially purified from culture supernatants by divalent cation (TALON) affinity chromatography. Superose 6 size exclusion chromatography (SEC) was used to reveal the size properties of the secreted proteins. The thyroglobulin (669 kDa) molecular weight standard was used to mark the position of the S2P trimer (Wrapp et al., 2020). SEC of S2P.BA45.VI-1208 revealed a heterogeneous protein preparation with putative trimer accounting for <20% of total affinity purified protein (Figure 9A). C-terminal truncation to G1204, Q1201, and L1200 led to the appearance of a prominent putative trimer peak coeluting with the 669 kDa marker amongst a number of lower-molecular weight species. Fractions consistent with the expected size of S2P.BA45.VI trimer were collected, concentrated and re- chromatographed on Superose 6 following a freeze (-80°C)-thaw cycle. Figure 9B indicates that ≥90% purity was achieved and that the putative trimers are stable. The melting temperatures (Tms) of the purified trimers were determined by differential scanning fluorimetry (DSF) as being between 60°C-61°C (Figure 9C). Further truncation to D1199, N1192, D1165, K1157 and S1147 gave rise to major peaks that coeluted with the 440 kDa marker (Figure 9A) that were purified to homogeneity (Figure 9B). The elution position of these truncated S2P.BA45.VI species indicated a lower molecular weight than that of S2P.BA45.VI-1208. The elution of proteins is determined by their hydrodynamic or Stokes radius (La Verde et al., 2017). Thus S2P.BA45.VI-1147, -1157, -1165, and -1192 are likely to have smaller Stokes radii than S2P.BA45.VI-1208, -1204, -1201 and - 1200 due to truncation of most of the stem (See Figure 5). DSF indicated that these shorter S2P.BA45.VI proteins had Tms in the range 38.4°C-40°C (Figure 9C) indicating lower thermostabilities than their counterparts with longer stems with Tms of 60-61°C. Despite this decrease in thermal stability, the putative trimers were stable after a freeze (-80°C)-thaw cycle. The yield and elution positions of the purified putative trimers and their Tms are listed in Figure 9D. SDS-PAGE under nonreducing and reducing conditions indicated a prominent band at ~160- 170 kDa at >95% purity for all constructs (Figure 10). Plots of Tm and trimer yield as functions of C-terminal length show that L1200 is the key determinant of thermostability. However, the thermostable trimers are low yielding. Conversely, truncation to N1192, D1165 and K1157 leads to high yielding trimers but with lower thermostability (Figure 11). Example 3 – Neutralizing antibody (NAb) epitope profiles of S2P.BA45.VI trimers with truncated stems The antigenic structures of the S2P.BA45.VI stem-truncated proteins were next probed with ACE2-Fc and human monoclonal NAbs (mNAbs) in biolayer interferometry (Figure 12). The human mNAbs examined were C1520 directed to the NTD (Wang et al., 2022), Omi-18 and Omi- 42 to the RBM (Nutalai et al.2022), S2H97 (Starr et al., 2021) and SP1-77 (Luo et al., 2022) to conserved epitopes within the RBD excluding the RBM, COV44-79 to the fusion peptide (Dacon et al., 2022), and CV3-25 to the stem of S2 (Jennewein et al, 2021 and Li et al., 2022). ACE2-Fc and the human mNAbs were attached to anti-human IgG Fc capture biosensors while the S2P glycoproteins were in the analyte phase. The sensograms shown in Figure 12 correlate with the 1: 1 bimolecular interaction model with R2values being >0.93 for all but one case and ^2values being <2 (Table 1). Plots of response at binding equilibrium (Req) provides a summary of the interaction between S ligands and purified S2P.BA45.VI stem truncation mutant oligomers (Figure 13). Roughly equivalent binding was achieved by all mutants to the NTD-directed NAb C1520, whereas proteins terminating at 1157, 1165 and 1192 achieve slightly higher Req values with RBM-directed ligands than those terminating at 1199, 1201 and 1204. A similar trend was observed with the RBD / non-RBM-specific NAbs, S2H97 and SP1-77. Poor overall binding was observed with the fusion peptide NAb COV44-79, indicating that this epitope is poorly accessed. Maximal binding to NAb CV3-25, whose epitope encompasses amino acids K1147-D1165 of the stem, was observed with S2P.BA45.VI-1192. An inspection of the binding kinetics (Table 3) indicates relatively high affinity interactions between all spike proteins and ligands (except COV44-79) with KD affinity constants being ≤6.7x10-9M. S2P.BA45.VI-1192 exhibited strong binding to all ligands and of all spike constructs achieved the highest Req against the stem NAb CV3-25, which has pan-SARS CoV-2 variant neutralizing properties.
[0003] mnam uhdnacF-2E C AotsremirtekipsSfoscitenikgnidniB.3elbaT Example 4 – Structure-directed cysteine substitution mutagenesis to covalently stabilize the S2P.BA45.VI trimer A complementary approach was used to stabilize the S2P.BA45.VI ectodomain trimer by introducing cysteine pairs into the subunit interface to create intermolecular disulfides. To this end, S1-S1, S1-S2 and S2-S2 interfacial residues were identified in the SARS CoV-2 S trimer (PDB ID: 6VSB) using the LPC-CSU server (http: / / oca.weizmann.ac.il / oca-bin / lpccsu) for Cys substitution mutagenesis. Small polar residues such as Ser, Thr, Asn and Asp, that are not components of glycosylation sequons or salt bridges, as well as glycine and alanine, were targeted with Cys substitutions as it was reasoned that substitution of such side chains is less likely to affect the overall fold of the Spike glycoprotein trimer. Eleven contact residue pairs, whose C ^ atoms were approximately in the range of 4.2-6.6Å of each other, the optimal distance between C ^ atoms of Cys residues participating in disulfide bonds (Reiter et al., 1995), were identified for Cys substitution mutagenesis of S2P.BA45.VI-1147 (Table 3; Figure 14). The amino acid and DNA sequences of S2P.BA45.VI-1147 Cys mutants are shown in Figures 15 and 16, respectively. Example 4 – Biochemical characteristics of S2P.BA45.VI-1147 Cys substitution mutants The S2P.BA45.VI-1147 Cys mutants were expressed in Expi293F cells (50 ml cultures) and affinity purified from the culture supernatants by divalent cation affinity chromatography as described above. Superose 6 SEC indicated that only 3 of the 11 di-Cys mutants were efficiently affinity purified suggesting that most of the mutations introduce a folding defect that inhibits expression and / or secretion (Figure 17A). Thus D17 (D571C / S967C), I1 (A570C / S967C) and L23 (N914C / S1123C) were largely produced as trimeric proteins, the latter presenting almost exclusively as trimer (Figure 17A and B). D17 and I1 increased the melting temperature of S2P.BA45.VI-1147 from 38.5°C to 55.5°C and 51.5°C, respectively. L23 caused a modest increase in melting temperature from 38.5°C to 44°C (Figure 17C). Importantly, the D17, I1 and L23 mutations were associated with 11-, 8.75- and 17.5-fold increases in trimer yield, respectively, over the parental S2P.BA45.VI-1147 construct (Figure 17D). Non-reducing and reducing SDS-PAGE were used to determine whether intermonomer disulfides had formed in the 3 mutants. Under non-reducing conditions, S2P.BA45.VI-1147 migrated to its expected monomer molecular weight (~150 kDa) whereas D17 and I1 migrated to a position consistent with a high molecular weight; L23 migrated to an intermediate position (Figure 18). Under reducing conditions all proteins were resolved to their monomeric molecular weights. Because the D17, I1 and L23 disulfides will only theoretically form in the context of a trimeric Spike due to the C ^ distance and geometric constraints imposed in their design (Table 3 and Figure 14), it is inferred infer that D17 and I1 crosslink each monomer within the trimer whereas L23 crosslinks 2 monomers and one monomer remains unbonded. Example 5 – The I1 (A570C / S967C) and D17 (D571C / S967C) mutations covalently crosslink S2P.BA45.VI-1192 and S2P.BA45.VI-1204 trimers The D17, I1, and L23 mutations were introduced to S2P.BA45.VI-1192 (to give D17.VI- 1192, I1.VI-1192 and L23.VI-1192, respectively) and to S2P.BA45.VI-1204 (to give D17.VI-1204, I1.VI-1204 and L23.VI-1204, respectively). S2P.BA45.VI-1192 is a high yielding putative trimer with a lower Tm (39.5°C), whereas S2P.BA45.VI-1204 is a lower yielding putative trimer with a high Tm (60.5°C) (see Figure 11). Importantly, unlike S2P.BA45.VI-1147, these longer constructs contain the highly conserved neutralizing epitope recognized by mNAb CV3-25 within the stem. This experiment was performed to determine if these constructs with longer stems had an appropriate trimeric geometry that enables the I1, D17 and L23 disulfides to form. The protein and DNA sequences of these constructs are shown in Figures 19 and 20, respectively. The spike variants were expressed in Expi-293F cells and purified from the supernatant by divalent cation affinity chromatography using TALON resin followed by Superose 6 SEC. Figure 21A shows that the affinity purified D17.VI-1192 and I1.VI-1192 proteins were comprised largely of a single species that coeluted with parental S2P.BA45.VI-1192 and the 440 kDa marker. DSF showed that the purified D17.VI-1192 and I1.VI-1192 proteins had elevated Tms (55°C and 51°C, respectively) relative to parental S2P.BA45.VI-1192 (40°C) (Figure 21B). The D17 and I1 disulfides increased the yield of S2P.BA45.VI-1192 trimer by 2.3- and 1.7-fold, respectively. SDS-PAGE under non-reducing conditions indicated a >250 kDa band for both mutants whereas under reducing conditions, this was resolved to the expected monomer molecular weight of ~ 170 kDa with some residual oligomer persisting for I1.VI-1192 (Figure 21C). In contrast to I1 and D17, the L23 (N914C / S1123C) mutation was not tolerated in the context of S2P.BA45.VI-1192, with very little L23.VI-1192 protein being secreted. The I1, D17 and L23 mutations performed relatively poorly in the thermostable S2P.BA45.VI-1204 backbone with lower yields of putative trimer being secreted (Figure 21D). The purified D17.VI-1204 and I1.VI-1204 trimers showed near-identical Tms to their 1192 counterparts (5.15°C and 55°C, respectively) (Figure 21E) and non-reducing SDS-PAGE indicated that intermolecular disulfides had formed (Figure 21F). As for S2P.BA45-1192, the L23 mutation was not tolerated in the context of S2P.BA45.VI-1204, with very little L23-1204 protein being secreted. These data indicate that: 1) S2P.BA45.VI-1192 and S2P.BA45.VI-1204 attain trimeric quaternary structures that enable the I1 and D17 disulfides to form; 2) I1 and D17 mutations confer thermostability to S2P.BA45.VI-1192 trimers and increase their yield; 3) I1 and D17 do not improve the biophysical properties of the longer S2P.BA45.VI-1204 protein; 4) the I1 and D17 disulfides appear to dictate the Tm of both low- and high- thermostability S2P.BA45.VI trimers; 5) The L23 mutation is not accommodated in S2P.BA45.VI constructs with C-terminal stem extensions beyond S1147 to N1192 and G1204. Example 6 – NAb epitope profiles of covalently-linked D17-1192 and I1-1192 trimers The presentation of broad NAb epitopes in D17-1192 and I1-1192 trimers was examined in BLI using the following ligands: ACE2-Fc, Omi-42 and Omi-18 to the RBM, S2H92 and SP1- 77 to the RBD (excluding the RBM), and CV3-25 to the stem. The 3D structures of complexes between the RBD and the ACE2 extracellular domain (PDB ID: 6VW1) (Shang et al., 2020) domain or Fabs derived from Omi-18 (PDB ID: 7ZFB); Omi-42 (PDB ID: 7ZR7), (Nutalai et al., 2022), S2H97 (PDB ID: 7M7W) (Starr et al., 2021) and SP1-77 (PDB ID: 7UPX) (Altman et al,. 2021), or CV3-25 and the stem region of the trimer (Li et al., 2022), are shown to the left of Figure 21. It is notable that the ACE2 ECD, Omi-18 and Omi-42 exhibit a similar binding mode to the RBM (ACE2 contact residues shown as black spheres) at the top of the RBD. S2P.BA45.VI- 1192 showed robust binding to ACE2-Fc, Omi-18 and Omi-42 whereas, D17-1192 bound poorly to the 3 RBM-directed ligands. The data suggest that D17 occludes the RBM, which is the major site of immune escape in VOCs most likely by inducing the 3-RBD down conformation in the spike trimer. I1 partially occludes the RBM, blocking its interaction with ACE2, but not RBM- dependent epitopes located on the ‘shoulder’ and ‘back of neck’ of the RBD (Nutalai et al., 2022) as seen by Omi-42 and Omi-18, respectively. Two NAbs, S2H97 and SP1-77 with pan-VOC neutralizing activity were next examined. Both epitopes are conserved and are located ‘below’ the RBM on opposite flanks of the RBD. S2H97 and SP1-77 bound to WT and the 2 mutants with similar potency indicating that the exposure of both epitopes is not affected by the I1 and D17 mutations. The pan-variant-neutralizing stem NAb, CV3-25, exhibited markedly diminished off- rates when bound to the 2 mutants in comparison to parental S2P.BA45.VI-1192. Table 4 shows the binding kinetics between D17-1192 and I1-1192 and the various S ligands. In all cases excepting interactions between D17-1192 and ACE2-Fc, Omi-18 and Omi- 42, the sensograms shown in Figure 22 correlate with the 1: 1 bimolecular interaction model with R2values being >0.96 for all but one case and ^2values being <1.65. Strong interactions between all spike proteins and ligands were defined by affinity constants (KD) of ≤6x10-9M. A notable effect of the D17 and I1 mutations was the imperceptible dissociation rate of CV3-25, which is directed to the stem and has pan-SARS CoV-2 variant neutralizing properties. Table 4. Binding kinetics of S2P.BA45.VI-1192 Spike trimers to ACE2-Fc and human monoclonal NAbs. D17 and I1 thus represent methods for regulating the exposure of the highly immunogenic but also highly mutable RBM and potential refocussing of antibody responses to other conserved epitopes within the RBD. Furthermore, the I1 and D17 disulfides at the top of the head domain stabilize the CV3-25 NAb-stem interaction at the base of the trimer, likely via an allosteric mechanism. In an immunization setting, this latter property of D17 and I1 could theoretically lead to sustained interactions between the stem and CV3-25-like B cell receptors to induce high affinity NAbs to this highly conserved site. Example 7 – The VI mutation is not essential for the thermostability of S2P.BA45-1192 trimers ± the D17 and I1 mutations Previous studies with S2P.BA45-1208 indicated that the VI mutation was associated with improved thermostability and essential for the maintenance of trimeric structure (Poumbourios et al., 2023). To determine whether the VI mutation is also needed for maintenance of the S2P.BA45-1192 trimer, V1016 and I1020 were reverted to the natural Ala residues to give S2P.BA45.AA-1192. The protein and DNA sequences of these constructs are shown in Figures 23 and 24, respectively. Divalent cation affinity chromatography (TALON) followed by SEC of S2P.BA45.AA-1192 gave rise to a major putative trimer peak coeluting with the 440 kDa marker (Figure 25A) that was purified to homogeneity. The S2P.BA45.AA-1192 trimer was stable after a freeze (-80°C)-thaw cycle (Figure 25B) and DSF indicated a Tm of 43°C (Figure 25C), close to that of S2P.BA45.VI-1192 (41°C). The D17 and I1 mutations were introduced into S2P.BA45.AA-1192 to give D17.AA-1192 and I1.AA-1192, respectively. The protein and DNA sequences of these constructs are shown in Figures 23 and 24, respectively. Divalent cation affinity chromatography (TALON) followed by SEC of D17.AA-1192 and I1.AA-1192 gave rise to a major putative trimer peak coeluting with the 440 kDa marker for both proteins (Figure 25A). Both proteins were purified to homogeneity (Figure 25B). The purified D17.AA-1192 and I1.AA-1192 trimers had Tms of 55°C and 52°C, respectively (Figure 25C), which are virtually identical to their VI counterparts. Both proteins were stable after a freeze (-80°C)-thaw cycle. SDS-PAGE under non-reducing conditions indicated a >250 kDa band for both mutants whereas this was resolved to the expected monomer molecular weight of ~ 170 kDa with some residual oligomer persisting for I1.AA-1192 (Figure 25D). To further examine the relative contributions of disulfide bond and VI mutations to spike trimer thermostability, DSF was performed on D17-1192 and I1-1192 ± VI in the presence of increasing concentrations of betamercaptoethanol. Figure 26 shows that the decrease in Tm with increasing betamercaptoethanol concentration was largely identical for VI and AA versions of S2P.D17-1192 and S2P.D17-1192, respectively. The data are again consistent with VI not contributing to the stability of S2P.D17-1192 and S2P.D17-1192 trimers. Thus, the VI mutation is thus not required for the retention of S2P.BA45-1192 trimeric structure stability and the D17 and I1 disulfides can form and improve the thermal stability of S2P.BA45-1192 in both the presence and absence of VI. The L23 mutation is compatible with the S2P.BA45-1192 lacking VI, however, the intermolecular disulfide does not form. Example 8 – NAb epitope profiles of covalently linked I1-1192 and D17-1192 trimers with and without VI BLI was used to compare the NAb epitope profiles of covalently linked S2P.I1-1192 and S2P.D17-1192 trimers with and without VI. ACE2-Fc and the human mNAbs were attached to anti-human IgG Fc capture biosensors while the S2P glycoproteins (30 nM) were in the analyte phase. The data show that S2P.BA45.VI-1192 and S2P.BA45.VI-1192 trimers have near- identical binding abilities for the neutralizing ligands examined (Figure 27). D17.VI-1192 and D17.AA-1192 trimers bound poorly to the RBM ligands, ACE2-Fc, Omi-18 and Omi-42, but potently to the NTD mNAb C1520, to the broadly neutralizing RBD mNAbs, S2H97 and SP1-77, and stem mNAb CV3-25. Whereas S2P.I1.VI-1192 showed diminished binding to the RBM ligands, the reversion of VI to AA in S2P.I1.AA-1192 restored potent binding to Omi-18 and Omi- 42. As for their D17 counterparts, both S2P.I1.VI-1192 and S2P.I1.AA-1192 bound potently to C1520, S2H97, SP1-77, and CV3-25. These data suggest that the VI-to-AA reversion does not affect the NAb epitope profile of D17-1192, suggesting a 3RBD-down conformation. However, VI-to-AA reversion in I1-1192 improves binding of RBM-directed NAbs suggesting RBDs adopt a more open conformation. The other conserved NAb epitopes examined were equally well presented in the 4 spike contexts. Thus, 5 constructs have been generated with varying degrees of RBM exposure: (S2P.BA45.VI-1192=S2P.BA45.VI-1192) > I1.AA-1192 > (I1.VI- 1192=D17.AA-1192) >D17.VI-1192. The biochemical and antigenic characteristics of S2P.BA45- 1192 variants are summarized in Table 5.
[0004] opxnsE icifctoessir er0et utc l 0au 3trc aan ehocissanhciepnp ne sgie suoitlif stlain or capmodn 0ssnoa ilt5 afaulmocie r osCf dnnyEie ethStpoeora)ivi pm btfarcir n(oayp e esr earmiprt neF opmmrSseelmourufp DSfn r bi:cac. d5eod de esilppeni lni0 albmerieylmr03 toaTte atet n:a Do e@abTcDdR / n Example 9 – D17, I1 and L23 combination mutants D17 and I1 were separately combined with L23 in S2P.BA45.AA-1192 and S2P.BA45.VI- 1192 to determine if the combination mutations can improve spike yield and thermostability. The protein and DNA sequences of these constructs are shown in Figures 28 and 29, respectively. Divalent cation affinity chromatography (TALON) followed by SEC indicated poor expression of DL.VI-1192 and IL.VI-1192, consistent with the incompatibility of L23 with S2P.BA45.VI-1192 (Figure 30A). By contrast, DL.AA-1192 and LI.AA-1192 both gave rise to a major putative trimer peak (Figure 30A) that could be purified to homogeneity (Figure 30B). The DL.AA-1192 and IL.AA-92 trimers were stable after a freeze (-80°C)-thaw cycle (Figure 30B) and DSF indicated Tms of 56°C and 52.4°C, respectively (Figure 30C). Non-reducing SDS-PAGE indicated that the intermonomer disulfide had formed in the combination mutants with the same efficiency as in D17 and I1 (Figure 30D). However, the yields of trimer for DL.AA-1192 and IL.AA-1192 were inferior their D17 and I1 counterparts, respectively (Table 2). Example 10 – The 2P mutation is not required for BA45-1192 trimer stability but is important for trimer yield The function of the ‘2P’ mutation is to stabilize the spike trimer in the prefusion conformation by blocking the spontaneous transition of S2 to the fusion-activated trimer of hairpins (Wrapp et al., 2020). To examine the role of 2P in BA45.VI-1192 trimer expression and stability as well as in formation of the D17 and I1 disulfides, Pro986Pro987 were reverted to the native amino acids, Lys and Val, respectively, in D17.VI-1192, D17.AA-1192, I1.VI-1192 and I1.AA-1192 to give: SnoP.VI-1192, SnoP.D17.AA-1192, SnoP.I1.VI-1192, and SnoP.I1.AA-1192, respectively. The protein and DNA sequences of these constructs are shown in Figures 31 and 32, respectively. Divalent cation affinity chromatography (TALON) followed by SEC revealed the presence of spike trimers however, these represented ~30% of total secreted spike protein for VI containing constructs and 53-58% of total secreted spike protein for AA containing constructs (Figure 33A). The purified trimers (Figure 33B) had identical Tms to their S2P-containing counterparts but were obtained in significantly lower yields (Figure 33C and D; Table 2). SDS- PAGE under non-reducing conditions revealed the presence of a single band migrating above the 250 kDa marker for purified SnoP.VI-1192, SnoP.D17.AA-1192, SnoP.I1.VI-1192, and SnoP.I1.AA-1192 trimers, whereas SDS-PAGE under reducing conditions resolved these bands to the monomer molecular weight of ~180 kDa (Figure 34). These data indicate that the D17 and I1 disulfides can form in the presence and absence of 2P and VI mutations. Overall, the data indicate that the VI and 2P mutations are not essential for trimer stability nor D17 and I1 disulfide formation but 2P is required for high trimer yields. Example 11 - The D17 and I1 mutations direct intermolecular disulfide bond formation in full-length, membrane anchored S2P glycoproteins The abilities of the D17, I1, L23, DL and IL disulfide mutants to covalently stabilize full- length S2P.BA45.VI-1273 trimers containing the native transmembrane domain and cytoplasmic tail were examined. CMV driven expression vectors containing codon-optimised genes encoding residues 1-1273 of S glycoproteins derived from Omicron BA.4 / BA.5 were prepared. The H681RRAR-> P681GSAS mutation at the furin site and the di-Pro “2P” substitution at positions 986 and 987 were also included. The protein and DNA sequences of these constructs are shown in Figures 35 and 36, respectively. To demonstrate expression of the S2P.BA45.VI-1273 glycoproteins and cysteine mutants thereof, the DNA vectors were transfected into 293T cells. The cells were lysed and the lysate subjected to SDS-PAGE and western blotting with rabbit anti-S1 polyclonal antibody. Under non-reducing conditions, Figure 37, left panel indicates a major ~ 180 kDa protein band corresponding to the monomer was observed for S2P.BA45-1273 and S2P.BA45.VI-1273, the latter of which contains the VI mutation. The addition of D17 and I1 to S2P.BA45.VI-1273 resulted in 2 major high molecular weight species, likely corresponding to disulfide linked trimers and dimers (dsl-spike). These data indicate that the D17 and I1 disulfide can covalently stabilize the full-length Omicron BA.4 / 5.VI oligomer. By contrast, L23-containing mutants were poorly expressed, like due to the incompatibility of L23, VI and C-terminal stem sequences, as observed with soluble S2P.BA45-1192 glycoproteins. Two faint high molecular weight bands were, however observed and are likely to be residual trimers and dimers that resist sodium dodecyl sulfate plus heat disruption. SDS-PAGE under reducing conditions (Figure 37, right panel) resulted in a doublet migrating at close to the position of monomeric spike for all constructs. The double could be due to clipping by a contaminating protease following Spike denaturation or due to the presence of alternate glycoforms. The data indicate that the D17 (D571C / S967C) and I1 (A570 / S967C) disulfide mutations covalently stabilise the full length S2P.BA45.VI-1273 oligomer. Example 12 – Effect of D17 and I1 mutations on the NAb epitope profile of full-length, membrane anchored S2P glycoproteins Flow cytometry, ACE2-Fc and human monoclonal antibodies were used to examine the effects of the D17 and I1 mutations on the presentation of key neutralization epitopes in the context of full-length S2P.BA45.VI expressed on the cell surface.293T cells were cotransfected with the various S2P.BA45.VI-1273 expression vectors and an EGFP expression vector and intact cells were stained with the ACE2-Fc and human monoclonal NAbs and AlexaFluor- conjugated anti-human immunoglobulin. The cells were counterstained with LIVE / DEAD stain to enable the exclusion of dead cells from analyses. The histograms in Figure 38A show that S2P.BA45.VI-1273, D17.VI-1273 and I1.VI-1273 glycoproteins bind to ACE2-Fc and to all monoclonal NAbs tested. The isotype control HCV-specific antibody (HCV1) exhibited no binding. These data indicate that the S2P.BA45.VI-1273 variant glycoproteins are expressed on the cell surface and that they present diverse NAb epitopes. The geometric means of fluorescence intensity of the histograms presented in Figure 38A were determined. The data in Figure 38B indicate diminished binding by D17.VI-1273 and I1.VI-1273 to ACE2-Fc, Omi-18, and Omi-42 (directed to the RBM), C1520 (directed to the NTD), SP1-77 (directed to the RBD flank), whereas binding to S2H97 (to the RBD flank, opposite side of SP1-77 epitope) and CV3-25 (stem) was similar for the 3 constructs. Thus, in a full-length membrane anchored context, the D17 and I1 mutations diminish exposure of bNAb epitopes involving the RBM, NTD and RBD flank whereas the epitopes recognised by S2H97 and CV3- 25 are not affected. Example 13 – BA45-1192 spike proteins containing hexaPro (S6P) Hsieh et al., 2020 identified 6 simultaneous proline substitutions within S2 (F817P, A892P, A899P, A942P, V986P, K987P) that conferred higher expression and stability to an ancestral spike trimer containing a foldon trimerization clamp. This mutant was referred to as hexaPro (or the S6P or 6P mutation). The effects of hexaPro on the expression, stability and epitope profile of the clampless omicron BA45-1192 spike and its disulfide bonded D17 and I1 derivatives was therefore examined. Four hexaPro derivatives were prepared: S6P.BA45.AA- 1192, S6P.BA45.D17.AA-1192, S6P.BA45.I1.AA-1192, S6P.BA45.I1.VI-1192 each being a counterpart of S2P proteins described in Examples 5 and 7. The protein and DNA sequences of these constructs are shown in Figures 39 and 40, respectively. Divalent cation affinity chromatography (TALON) followed by SEC of S6P.BA45.AA-1192 gave rise to a major putative trimer peak coeluting with the 440 kDa marker and its S2P counterpart (Figure 41A). The purified S6P.BA45.AA-1192 trimer was stable after a freeze (-80°C) thaw cycle (Figure 41B) and DSF indicated a Tm of 43°C (Figure 41C). The biophysical characteristics of S6P.BA45.AA-1192 and its S2P counterpart were almost identical except that the former was expressed at higher yield: 86 mg / L versus 36 mg / L. The D17 and I1 disulfide mutants were converted to hexaPro to give: S6P.BA45.D17.AA- 1192, S6P.BA45.I1.AA-1192 and S6P.BA45.I1.VI-1192; the latter also includes the VI core cavity-filling mutation. Divalent cation affinity chromatography (TALON) followed by SEC of S6P.BA45.D17.AA-1192, S6P.BA45.I1.AA-1192 and S6P.BA45.I1.VI-1192, which gave rise to a major putative trimer peak b for each, eluting between the 669 kDa and 440 kDa marker (Figure 41A). The S6P.BA45.I1.AA-1192 SEC profile indicated the presence of an additional slower- eluting (lower molecular weight) species. The fractions between the vertical dashed lines in Figure 41A were pooled, concentrated and samples subjected to SEC after a freeze-thaw cycle. The single symmetrical peaks in the chromatograms indicate that the S6P proteins had been purified to homogeneity (Figure 41B). The purified S6P.BA45.D17.AA-1192 trimers had a Tm of 55°C, whereas the Tm of S6P.BA45.I1.AA-1192 and S6P.BA45.I1.VI-1192 was 52°C (Figure 41C), which are virtually identical to their S2P counterparts. Note that an additional less thermostable species (Tm ~43°C) is present in the S2P.BA45.I1.AA-1192 sample. SDS-PAGE under non-reducing conditions indicated a >250 kDa band for the 3 disulfide mutants whereas this was resolved to the expected monomer molecular weight of ~ 170 kDa under reducing conditions, consistent with quantitative disulfide formation (Figure 41D). The yields of S6P.BA45.D17.AA-1192 and S2P.BA45.D17.AA-1192 trimers were virtually identical (27 and 30 mg / L, respectively) (Table 6). By contrast, the yield of S6P.BA45.I1.VI-1192 was greater than double that of its S2P counterpart: 45 versus 19.2 mg / L, respectively. Thus, the hexaPro mutation improves the yields of parental and I1.VI, but not D17, forms of omicron BA.4 / 5-1192 trimers in comparison to the 2P versions. The hexaPro mutation, however, does not increase thermostability in this context. The biochemical and antigenic characteristics of S2P.BA45-1192 and S6P.BA45-1192 variants are summarized in Table 6.
[0005] Table 6. Characteristics of spike trimers. Example 14 – Epitope profiles of S6P.BA45-1192 trimers BLI was used to examine the NAb epitope profiles of disulfide-linked S6P.BA45-1192 trimers. ACE2-Fc and human mNAbs were attached to anti-human IgG Fc capture biosensors while S6P glycoproteins were in the analyte phase. The sensograms show that when compared to the parental S6P trimer, the D17.AA and I1.VI mutants generated diminished binding responses with ligands directed to the RBM, namely ACE2-Fc, Omi-18, Omi-42 and SA55 (Figure 42). The binding kinetics indicated slower on- and off- rates for the RBM-directed ligands (Table 7). The covalently-stabilized trimers exhibited markedly (~100-fold) lower dissociation constants (KD) for ACE2-Fc and the D17 variant exhibited an ~10-fold lower KD for Omi-18. By contrast, the parental, D17.AA and I1.VI S6P trimers exhibited near-identical binding characteristics to NAbs S2H97, SP1-77 and S309 directed to conserved epitopes within the RBD that do not involve the RBM, as well as to C1520, directed to the NTD with dissociation constants in the range 10-9to <10-12M. Projection of the ACE2, Omi-18, Omi-42 and SA55 epitopes onto ‘open’ and ‘closed’ RBD conformations within spike trimers indicates that they are occluded in the closed conformation. By contrast, the RBD epitopes of S2H97, SP1-77 and S309 are exposed in both conformations (Figure 43). This analysis suggests a mechanism whereby disulfide stabilization of spike trimers via D17 and I1 promotes closed RBD conformations that limit access to RBM-dependent epitopes but not to conserved epitopes on the RBD that do not involve the RBM. CV3-25, CC99-103 and CC95-108 are directed to the stem of S2, which encompasses key neutralization epitopes that are conserved among betacoronaviruses (Zhou et al., 2023). These NAbs exhibited greatly reduced dissociation rates and dissociation constants (at least 2 to 3 orders of magnitude for KD) with D17 and I1.VI suggesting that disulfide stabilization of spike trimers enables more stable NAb-stem interactions (Figure 42).
[0006] Table 7. Binding kinetics of S6P.BA45-1192 variant trimers to neutralizing ligands Example 15 – Trimeric S6P.BA45-1192 vaccines protect K18hACE mice against viral challenge The protective efficacy and immunogenicity of purified S6P.BA45.AA-1192, S6P.BA45.D17.AA-1192 and S6P.I1.VI-1192 trimers were assessed in K18hACE2 transgenic mice. Four groups of 166-8-week female mice were immunized subcutaneously with vehicle or 10 ^g trimer in 50% (vol / vol) AddaVAX adjuvant, a squalene oil in water emulsion. The mice received 3 doses of vehicle or vaccine 3 weeks apart and were bled immediately before the 3rddose or 2 weeks after the 3rddose. Three weeks after the 3rddose, 12 mice from each group were challenged with 104TCID50 of Omicron BA.5 virus. Four days after challenge, nasal turbinates (NTs) and lungs and were collected from 8 mice per group while lungs from 4 mice per group were fixed with 10% neutral buffered formalin for pathological examination (Figure 44). The vehicle control group had mean virus titers of 102.7TCID50 / ml in NTs and 104.4TCID50 / organ in lungs after Omicron BA.5 challenge (Figure 45). By contrast virus was not recovered from the NTs and lungs of mice receiving the 3 vaccines (limit of detection 100.5TCID50) except for 2 mice in the parental trimer group from which ~10 TCID50 was recovered from NTs, suggesting break-through infection. The data indicate that the three S6P.BA45-1192 trimer vaccines are protective against BA.5 challenge, with complete protection conferred by the D17 and I1.VI versions. Example 16 – Antibody responses to covalently stabilized S6P.BA45-1192 trimers following 2 and 3 immunizations The R-20 microneutralization assay developed by Aggarwal et al.2022 employing HAT- 24 cells and authentic omicron BA.5 SARS-CoV-2 was used to determine whether the 3rddose of immunogen provided a boost to neutralizing antibody titres. A comparison of post-dose-2 and dose-3 sera (week-6 and week-8 sera, respectively) indicated ~3.3-4.6-fold statistically significant increases in mean neutralization ID50s following the 3rddose (Figure 46A). The omicron BA.5 RBD and S6P.BA45.AA-1192 trimer binding titres of vaccinal sera were determined by chemiluminescent immunosorbent assay (CLIA). Figure 46B shows a significant ~2.6-fold reduction in RBD binding activity after the 3rddose of S2P.BA45.D17.AA-1192 but not the other 2 immunogens. With respect to trimer-specific antibody, only the I1.VI variant caused a small ~ 2-fold increase in mean titre after the 3rddose (Figure 46C). The data indicate that the 3rdimmunogen dose boosts neutralizing antibody titre but this is not reflected in RBD and trimer binding antibody. Example 17 – Covalently stabilized S6P.BA45-1192 trimers are superior immunogens with respect to induction of neutralizing antibodies The R-20 microneutralization assay was used to determine week-8 neutralizing antibody titres against homologous omicron BA.5 virus as well as ancestral, XBB.1.5 and JN.1 variants. Figure 47 lists the mutations present in omicron BA.5, XBB.1.5 and JN.1 spike proteins relative to the reference ancestral isolate Hu-1. The data presented in Figure 48 show significantly higher BA.5 neutralizing titres elicited by the D17 and I1.VI immunogens (reciprocal geometric mean ID50 = 6,503 and 5,128, respectively) relative to parental (432). This trend in neutralization potency was also observed with ancestral, omicron XBB.1.5 and JN.1 variants although the overall titres were ~1.5log10 lower in comparison to homologous virus neutralizing titres, likely due to the presence of mutations in the NTD and RBD of these variants (Figure 47). D17 and I1.VI-immune sera retained neutralizing activity with geometric mean ID50s above 1 / 70 against the XBB.1.5 and JN.1 variants that emerged after BA.5, whereas the neutralizing activity of sera elicited by the parental trimer was not significantly different to that of the vehicle control group. Example 18 – The 3 S6P.BA45-1192 immunogens elicit cross-variant reactive antibodies directed to the RBD and NTD CLIA was used to examine the ability of vaccinal antibodies to recognise the RBD and NTD immunodominant antigenic domains from different SARS CoV-2 variants. Figure 49 shows that the 3 immunogens elicited reciprocal RBD-binding antibody titres in the range 6141-8453 for BA.5, 2559-4246 for ancestral, 1727-7808 for XBB.1.5 and 1250-2645 for JN.1. The data suggest that the 14 amino acid changes in the JN.1 RBD in comparison to BA.5 (see Figure 47) affects the binding ability of vaccinal sera. Figure 50 shows the NTD-binding ability of vaccinal sera. In this experiment, NTDs from 3 variants were examined: BA.5, ancestral and JN.1. The parental S6P.BA45.AA-1192 immunogen elicited significantly higher binding titres to the 3 variant NTDs than did the covalently stabilised D17 and I1.VI immunogens (at least 3-fold higher to BA.5 and JN.1 NTDs; ~6-fold higher to ancestral). It should be noted here that the parental vaccine (S6P.BA45.AA-1192) elicited significantly lower neutralizing antibody titres against the NTD variant-matched viruses than the covalently stabilised D17 and I1.VI vaccines (see Figure 48). These data suggest that high NTD-titres are negatively associated with neutralizing activity. Sera from the 3 immunogen groups exhibited very similar binding titres to the BA.5 and JN.1 NTDs despite having ~1.5log10 lower neutralizing activity against JN.1 virus relative to BA.5 virus. These data suggest that the NTD-directed antibodies detected here are unlikely to account for the potent neutralization seen with BA.5 virus and the weak neutralization seen with JN.1 in Figure 48. Example 19 – Detection of antibodies to the highly conserved stem region of S2 The stem region of S2 (amino acids 1138-1208) has been postulated to form a flexible link between the well-ordered S1-S2 trimer head and the membrane-spanning sequence (Turonova et al., 2020). The S2 stem is highly conserved in sarbecoviruses and contains cross- clade neutralizing antibody epitopes (Zhou et al., 2023). A synthetic stem peptide (amino acids 1138-1165) and a chimeric protein comprising maltose binding protein linked via 3 alanines to stem amino acids 1138-1208 (MBP-stem[1138-1208]) was used to assess whether the 3 immunogens elicited antibodies to this antigenic region. The data presented in Figure 51 show that the 3 immunogens elicited approximately equivalent stem-directed antibody titres with ~ 5- fold higher titres seen with MBP-stem(1138-1208) relative to synthetic stem (1138-1165) peptide. This observation suggests that immunogens elicited antibody specificities that extend beyond the core stem 1138-1165 epitope. Example 20 – Antibodies to the conserved fusion peptide were not detected in vaccinal sera The fusion peptide, amino acids 808-832 of S2 has also been postulated as a conserved neutralizing antibody epitope (Dacon et al., 2022). An ELISA employing a synthetic fusion peptide comprising spike amino acids 808-832 (FP808-832) did not detect specific antibodies to this epitope in vaccinal sera (Figure 51). The viral challenge and immunogenicity data are summarised in Figure 52. Example 21 – Ability of D17 and I1.VI mutations to covalently stabilize soluble S trimers of an emergent SARS CoV-2 variant: omicron BA.2.86. The omicron BA.2.86 variant was first reported in August 2023 and phylogenetic analysis suggests that its closest ancestor is BA.2. BA.2.86 S has 38 amino acid changes in comparison to BA.2 and is thought to have arisen in a chronically infected immunocompromised individual due to the lack of any intermediate sequences in the database. BA.2.86 is the progenitor of the current dominant global circulating isolates, JN.1, KP.1, KP.2 and KP.3. When compared to BA.4 / 5, BA.2.86 S has 28 point mutations, 3 deletions and a 4-amino acid insertion (see Figure 47), the two variant S glycoproteins sharing 97.3% amino acid identity. The above method for producing covalently stabilised soluble SARS CoV-2 S trimers was applied to an emergent SARS CoV-2 variant, using BA.2.86 S as an example. pcDNA3 expression vectors for S6P.BA286.AA- 1192, S6P.BA286.D17.AA-1192, and S6P.BA286.I1.VI-1192 spike sequences containing an N- terminal tPA leader and C-terminal His6 tag were prepared. The amino acid and DNA sequences of the expected mature S proteins (i.e. excluding the tPA leader and His6 tag) are shown in Figures 53 and 54, respectively. The omicron BA.2.86 S glycoproteins were expressed in Expi293F cells and purified by TALON divalent cation affinity chromatography and Superose 6 SEC as described for their BA.4 / 5 counterparts in Figure 41. Figure 55A shows the SEC profiles of the BA.2.86 spikes after the TALON step. S6P.BA286.AA-1192 gave rise to a major putative trimer peak eluting just prior to the 440 kDa. The S6P.BA45.AA-1192 trimer was stable after a freeze (-80°C)-thaw cycle (Figure 55B) and DSF indicated a Tm of 42°C (Figure 41C). The biophysical characteristics of S6P.BA286.AA-1192 and its BA.4 / 5 counterpart were almost identical except that the former was expressed at higher yield: 86 mg / L versus 42 mg / L. The SEC profiles of S6P.BA286.D17.AA-1192 and S6P.BA286.I1.VI-1192 show a major putative trimer peak eluting approximately midway between the 669 and 440 kDa markers (Figure 55A). Putative trimer-containing fractions were pooled, concentrated and subjected to SEC after a freeze-thaw cycle, the single symmetrical peaks indicate that the S6P proteins had been purified to homogeneity (Figure 55B). The purified S6P.BA286.D17.AA-1192 trimers had a Tm of 57°C, whereas the Tm of S6P.BA286.I1.VI-1192 was 53°C (Figure 55C), which are virtually identical to their BA.4 / 5 counterparts (see Figure 41). SDS-PAGE under non-reducing conditions indicated a >250 kDa band for the 2 disulfide mutants whereas this was resolved to the expected monomer molecular weight of ~ 170 kDa under reducing conditions, consistent with quantitative disulfide formation (Figure 55D). The yields of S6P.BA286.D17.AA-1192 and S2P.BA286.I1.VI-1192 trimers were 26 and 40 mg / L, respectively (Table 6). Example 22 – Epitope profiles of S6P.BA286-1192 trimers Figure 56 shows the binding of spike ligands to S6P.BA286-1192 trimers in BLI. As before, ACE2-Fc and human NAbs were attached to anti-human IgG Fc capture biosensors while S6P glycoproteins (30 nM) were in the analyte phase. A variety of effects on ligand binding were observed with the D17 and I1.VI mutations: ACE2-Fc, Omi-42 and SA55 (RBM): greatly diminished binding responses observed for D17; slightly diminished binding responses observed for I1.VI but decreased dissociation rates. Omi-18 (RBM): fast on- and off-rates observed for the parental trimer; greatly diminished binding response for D17; strong binding response with greatly diminished off-rate for I1.VI. C1520 (NTD), S2H97, SP1-77 (RBD flank): similar levels of binding responses observed for the 3 spikes with diminished off-rates for D17 and I1.VI. CV3-25, CC95-108 and CC99-103 (stem): diminished binding responses observed for D17 and I1.VI, however with diminished off-rates. Overall, the data suggest that D17 tends to diminish binding by ligands directed to the RBM perhaps by inducing a conformation that limits access to this region. By contrast, RBM- dependent epitopes appear to be accessible in the I1.VI spike and ligand binding to these epitopes appears to be stabilized by the mutation. In the case of stem epitopes, both D17 and I1.VI mutations limit binding to these epitopes but ligand binding to these epitopes appears to be stabilized by the mutations. Example 23 – Ability of D17 and I1.VI mutations to covalently stabilize soluble S trimers of a divergent ACE2-using bat sarbecovirus: PRD-0038 The Sarbecovirus subgenus of the Betacoronavirus genus is comprised of 4 clades: clade 1b, including SARS CoV-2 and related Asian bat and pangolin viruses; clade 1a, which includes SARS CoV and related Asian bat and civet viruses; clade 2, largely comprised of Asian bat viruses, and clade 3 which includes viruses from European and African bats. Clade 1a, 1b and 3 sarbecoviruses use ACE2 for cellular entry whereas clade 2 viruses use an alternative receptor due to a deletion in their RBDs that precludes ACE2 binding. Figure 57 shows the phylogenetic relationships between S glycoproteins of members of the 4 sarbecovirus clades and the percentage amino acid identities between omicron BA.4 / 5 and highlighted examples from the ACE2-using clades. We chose the PRD-0038 spike, which shares 72.6% amino acid identity with the BA.4 / 5 spike, to ask whether the D17 and I1.VI mutations could covalently stabilize soluble S trimers of a highly divergent ACE2-using bat sarbecovirus with potential for spill-over into the human population. The PRD-0038 spike uses Rhinolophus sp. ACE2 for entry, however only 2 mutations (K482Y / T487W) in the RBD are required to confer human ACE2-binding ability (Lee et al., 2023). The D17- and I1-equivalent mutational targets were identified by structural alignment of the PRD- 0038 spike trimer (PDB ID 8U29) with that of BA.4 / 5 (PDB ID 7XNQ). Figure 58 shows that the D17 (D571 / S967) and I1 (A570 / S967) mutational targets in the SARS CoV-2 spike (Figure 58A) correspond to D560 / S950 and S559 / S950, respectively, in PRD-0038 (Figure 58B). The C ^-C ^ distances for D560 / S950 and S559 / S950 are 5.3Å and 5.0Å, respectively. For comparison, clade 1b BANAL-20-235 (Lan et al., 2020) and clade 1a WIV1 (Ge et al., 2013) bat sarbecoviruses that are able to use human ACE2 and are more closely related to the BA.4 / 5 spike sequence were subjected to the same analysis. An examination of the BANAL-20-235 and WIV1 spike trimer structures (PDB ID 8I3W and 8TC0, respectively) identified D17- and I1-equivalent targets with similar inter-C ^ distances to their counterparts in the PRD-0038 spike (Figure 58C and D). pcDNA3 expression vectors for the PRD-0038 soluble spikes, S6P.PRD.AA-1192, S6P.PRD.D17.AA-1192, and S6P.PRD.I1.VI-1192, containing an N-terminal tPA leader and C- terminal His6 tag were prepared. The amino acid and DNA sequences of the expected mature S proteins (i.e. excluding the tPA leader and His6 tag) are shown in Figures 59 and 60, respectively. The PRD-0038 spikes were expressed in Expi293F cells and purified by TALON divalent cation affinity chromatography and Superose 6 SEC as described for their omicron BA.4 / 5 and BA.2.86 counterparts. Figure 61A shows the SEC profiles of the PRD-0038 spikes after the TALON step. The PRD-0038 spike variants presented as a major putative trimer peak eluting close to the 440 kDa standard. DSF indicated a Tm of 50.5°C for parental S6P.PRD.AA- 1192 which increased to 55.8°C and 52°C, respectively with D17 and I1.VI, respectively (Figure 61B). SDS-PAGE under non-reducing conditions indicated a >250 kDa band for the 2 disulfide mutants whereas this was resolved to the expected monomer molecular weight of ~ 170 kDa under reducing conditions, consistent with quantitative disulfide formation (Figure 61C). These data indicate that the 1192 stem truncation in concert with the D17 or I1.VI mutations can be used to produce covalently stabilized soluble spike trimers with concomitant increases in thermal stability from divergent sarbecoviruses. Example 24 – Epitope profiles of S6P.PRD-1192 trimers Figure 62 shows the epitope profiles of disulfide-linked S6P.PRD-1192 trimers as determined in BLI. As before, human monoclonal NAbs were attached to anti-human IgG Fc capture biosensors while S6P glycoproteins were in the analyte phase. CR3022, which was isolated from a SARS CoV-infected patient (Ter Meulen et al., 2006) and recognises a cryptic epitope of the RBD (Huo et al., 2020 and Zhou et al., 2020) bound to the 3 S6P.PRD-1192 variant glycoproteins with approximately equal affinities (KDs) for parental and I1.VI PRD-0038 trimers and an ~3-fold reduction in affinity for D17 (KDs shown at the top right of each sensogram). The conserved stem region of the PRD-0038 glycoprotein variants was probed with NAbs obtained with SARS CoV-2-infected patients. In all cases, 9-312-fold increases in affinities were observed with S6P.PRD.I1.VI-1192 when compared to parental and D17 trimers (KDs highlighted). These data indicate that the I1.VI mutation has a stabilizing effect on stem-NAb interactions in the context of the PRD-0038 spike. Example 25 – Expression of S6P.BA286-1192 trimeric proteins from mRNA To determine whether S6P.BA286-1192 trimeric proteins expressed from mRNA had similar characteristics to those expressed from DNA (see Figs 55 and 56), mRNA encoding S6P.BA286.AA-1192, S6P.BA286.D17.AA-1192, and S6P.BA286.I1.VI-1192 were synthesised and transfected into Expi293F cells; control cells were transfected with S6P.BA286.AA-1192 DNA expression vector. At 48 h post-transfection, the spike proteins present in culture supernatants were purified by divalent cation affinity chromatography followed by Superose 6 SEC. The chromatograms in Figure 63A show prominent putative trimer peaks for the 3 S6P.BA286-1192 glycoproteins expressed from mRNA as well as for the parental S6P.BA286.AA-1192 glycoprotein expressed from DNA. Differential scanning fluorimetry shown in Figure 63B indicated melting temperatures of 43°C for the parental S6P.BA286.AA-1192 glycoprotein expressed from mRNA and DNA, and Tms of 57.5°C and 55°C for the D17 and I1.VI versions, respectively, expressed from mRNA. These Tms for mRNA-expressed D17 and I1.VI correspond well to those observed in Figure 55C for their DNA-expressed counterparts which were 57°C and 53°C, respectively. SDS-PAGE under non-reducing conditions confirmed quantitative disulfide stabilization of spike oligomers trimer with D17 and I1 mutations (Figure 63C). Thus mRNA can be used to express the covalently stabilized soluble spike trimers lacking a trimerization clamp. Example 26 – Epitope profiles of S6P.BA286-1192 trimers expressed from mRNA Figure 64 compares the binding of sensor-bound neutralizing ligands to purified S6P.BA286-1192 trimers expressed from mRNA and DNA. The binding characteristics of mRNA versus DNA-derived spike proteins was generally consistent: Omi-18, Omi-42, SP1-77, and CV3- 25 exhibited faster off-rates with parental S6P.BA286.AA-1192 when compared to the D17 and I1.VI versions with D17 showing decreased responses with RBM-dependent ligands. However, subtle differences were seen with ACE2-Fc and S2H97 where mRNA-derived parental spike exhibited slower off-rates than its DNA-derived counterpart pointing to subtle differences in RBD conformation that affect the stability of interaction with these ligands. These data indicate that the antigenic architectures of mRNA- and DNA-derived S6P.BA286-1192 spikes are similar. Example 27 – The D17 and I1 mutations in full-length, membrane anchored S6P glycoproteins expressed from DNA and mRNA The abilities of the D17 and I1 disulfide mutants to covalently stabilize full-length S6P- 1273 spikes containing the native transmembrane domain and cytoplasmic tail expressed from DNA and mRNA were examined. The omicron BA.4 / 5 spike sequence was used for DNA expression while the omicron BA.2.86 spike sequence was used for mRNA expression. The protein and DNA sequences of these constructs are shown in Figures 65 and 66, respectively. The DNA vectors and mRNA were transfected into 293T cells, the cells lysed 24 h later, and the lysates subjected to SDS-PAGE and western blotting with guinea pig S-immune sera. Under non-reducing conditions (Figure 67, left panel), a major ~ 180 kDa protein band corresponding to the monomer was observed for S6P.BA286.AA-1273 and S6P.BA45.AA-1273, expressed from mRNA and DNA, respectively. The addition of D17 and I1.VI to either spike sequence resulted in 2 major high molecular weight species, likely corresponding to disulfide linked trimers and dimers (dslS). These data indicate that the D17 and I1 disulfide can covalently stabilize full-length Omicron BA.2.86 and BA.4 / 5 oligomers derived from mRNA and DNA, respectively. SDS-PAGE under reducing conditions (Figure 67, right panel) resulted in a band migrating at a mol.wt position consistent with monomeric spike (monS) for all constructs. Two faint lower molecular weight species were also observed and are likely break-down products of S. The data indicate that the D17 (D571C / S967C) and I1 (A570 / S967C) disulfide mutations covalently stabilise the full length S6P-1273 oligomers. Example 28 – Effect of D17 and I1 mutations on the NAb epitope profile of full-length, membrane anchored S6P glycoproteins expressed from mRNA and DNA Flow cytometry, ACE2-Fc and human monoclonal antibodies were used to examine the effects of the D17 and I1 mutations on the presentation of key neutralization epitopes in the context of full-length S6P-1273 spikes derived from mRNA and DNA and expressed on the cell surface.293T cells were co-transfected with an EGFP expression vector and the various S6P- 1273 expression vectors and mRNAs described in Figure 67. Intact cells were stained with the ACE2-Fc and human monoclonal NAbs and AlexaFluor-conjugated anti-human immunoglobulin. The cells were counterstained with LIVE / DEAD stain to enable the exclusion of dead cells from analyses. The histograms in Figure 68A show that S6P.BA45.AA-1273, S6P.BA45.D17.AA- 1273 and S6P.BA45.I1.VI-1273 glycoproteins expressed from DNA bind to ACE2-Fc and to all monoclonal NAbs tested. The isotype control HCV-specific antibody (HC33.1) exhibited no binding. The geo...
Claims
CLAIMS 1. A coronavirus (CoV) vaccine antigen comprising a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond.
2. The CoV vaccine antigen of claim 1, wherein the non-endogenous inter-protomer disulfide bond is formed between cysteines selected from: i) cysteines at a position corresponding to amino acid numbers 571 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (D17); ii) cysteines at a position corresponding to amino acid numbers 570 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (I1); and iii) cysteines at a position corresponding to amino acid numbers 914 and 1123 of SEQ ID NO: 1 or SEQ ID NO: 2 (L23).
3. The CoV vaccine antigen of claim 1 or claim 2, wherein the non-endogenous inter- protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 914 and 1123 of SEQ ID NO: 1 or SEQ ID NO: 2 (L23).
4. The CoV vaccine antigen of claim 1 or claim 2, wherein the non-endogenous inter- protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 571 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (D17).
5. The CoV vaccine antigen of claim 1 or claim 2, wherein the non-endogenous inter- protomer disulfide bond is formed between cysteines at a position corresponding to amino acid numbers 570 and 967 of SEQ ID NO: 1 or SEQ ID NO: 2 (I1).
6. The CoV vaccine antigen of any one of claims 1 to 5, wherein the S protein trimer melting temperature is increased by at least about 5°C compared to a S protein trimer lacking the non- endogenous inter-protomer disulfide bond.
7. The CoV vaccine antigen of any one of claims 1 to 6, wherein the S protein trimer melting temperature is increased by about 5°C to about 20°C, or by about 5°C to about 15°C, or by about 5°C to about 12.5°C, or by about 5°C to about 10°C, or by about 5°C to about 8°C, compared to a S protein trimer lacking the non-endogenous inter-protomer disulfide bond.
8. The CoV vaccine antigen of any one of claims 1 to 7, wherein two protomers of the S protein trimer are bonded by a non-endogenous inter-protomer disulfide bond.
9. The CoV vaccine antigen of any one of claims 1 to 8, wherein each protomer of the S protein trimer are bonded to another protomer of the S protein trimer by a non-endogenous inter- protein disulfide bond.
10. The CoV vaccine antigen of any one of claims 1 to 9, wherein the S protein trimer comprises an endogenous or non-endogenous membrane spanning sequence.
11. The CoV vaccine antigen of any one of claims 1 to 10, wherein the protomer of the S protein trimer comprises a sequence selected from: SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO:
84. SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 132 and SEQ ID NO:
133.
12. The CoV vaccine antigen of any one of claims 1 to 11, wherein the S protein trimer is stabilised in the prefusion conformation.
13. A coronavirus (CoV) vaccine antigen comprising a CoV S protein trimer with a C-terminal truncation in the stem region.
14. The CoV vaccine antigen of any one of claims 1 to 12, wherein the S protein trimer has a C-terminal truncation in the stem region.
15. The CoV vaccine antigen of claim 13 or claim 14, wherein the C-terminal truncation is between residues corresponding to 1147 to 1207 of SEQ ID NO: 1 or SEQ ID NO:
2.
16. The CoV vaccine antigen of any one of claims 13 to 15, wherein the C-terminal truncation is between residues corresponding to 1147 to 1193 of SEQ ID NO: 1 or SEQ ID NO:
2.
17. The CoV vaccine antigen of any one of claims 13 to 15, wherein the C-terminal truncation is after a residue corresponding to 1147, 1157, 1165, 1192, 1195, 1196, 1199, 1201 or 1204 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO: 2.
18. The CoV vaccine antigen of any one of claims 13 to 15 or 17, wherein the C-terminal truncation is after a residue corresponding to 1147, 1157, 1165, 1192, 1195, 1196, 1199, 1201 or 1204 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO:
2.
19. The CoV vaccine antigen of any one of claims 13 to 18, wherein the C-terminal truncation is after a residue corresponding to 1192 of SEQ ID NO: 1 or SEQ ID NO: 2 and before the residue corresponding to 1208 of SEQ ID NO: 1 or SEQ ID NO:
2.
20. The CoV vaccine antigen of any one of claims 13 to 19, wherein the protomer of the S protein trimer comprises or consists of residues corresponding to 16 to 1147, or residues 16 to 1157, or residues 16 to 1165, or residues 16 to 1192, or residues 16 to 1204 of SEQ ID NO: 1 or SEQ ID NO:
2.
21. The CoV vaccine antigen of claim 20, wherein the protomer of the S protein trimer comprises or consists of residues corresponding to 16 to 1192 of SEQ ID NO: 1 or SEQ ID NO:
2.
22. The CoV vaccine antigen of any one of claims 1 to 21, wherein when administered to a subject the S protein trimer elicits a neutralising antibody response.
23. The CoV vaccine antigen claim 22, wherein the neutralising antibody response is a neutralising antibody response directed to an epitope or epitopes that include(s) part or all of the receptor binding domain (RBD).
24. The CoV vaccine antigen claim 22, wherein the neutralising antibody response is a non- RBD neutralising antibody response.
25. The CoV vaccine antigen of claim 24, wherein the non-RBD neutralising antibody response comprises a neutralising antibody response directed to an epitope or epitopes that include(s) part or all of the stem region.
26. The CoV vaccine antigen of claim 24 or claim 25, wherein the non-RBD neutralising antibody response comprises a neutralising antibody response directed to an epitope or epitopes that include(s) part or all of the N-terminal domain region (NTD).
27. The CoV vaccine antigen of any one of claims 24 to 26, wherein the neutralising antibody response comprises a neutralising antibody response directed to an epitope or epitopes that include(s) part or all of RBD flank.
28. The CoV vaccine antigen of claim 23, wherein the neutralising antibody response comprise eliciting neutralising antibodies to an epitope or epitopes that include(s) part or all of the receptor binding motif (RBM).
29. The CoV vaccine antigen of any one of claims 1 to 23, wherein the S protein trimer does not elicit neutralising antibody responses to the receptor binding motif (RBM).
30. The CoV vaccine antigen of any one of claims 1 to 29, wherein the S protein trimer is able to be bound by an antibody that binds an epitope or epitopes that include(s) part or all the N-terminal domain (NTD).
31. The CoV vaccine antigen of claim 30, wherein the antibody is selected from: C1520 and an antibody that binds an epitope bound by C1520.
32. The CoV vaccine antigen of any one of claims 1 to 31, wherein the S protein trimer is able to be bound by any antibody that binds an epitope or epitopes that include(s) part or all the receptor binding domain (RBD).
33. The CoV vaccine antigen of claim 32, wherein the antibody is selected from: S2H92, SP177, Omi-18, Omi-42, an antibody that binds an epitope bound by S2H92, an antibody that binds an epitope bound by SP1-77, an antibody that binds an epitope bound by Omi-18, and an antibody that binds an epitope bound by Omi-42.
34. The CoV vaccine antigen of any one of claims 1 to 31, wherein the S protein trimer is able to be bound by any antibody that binds an epitope or epitopes that include(s) part or all a RBD flank.
35. The CoV vaccine antigen of claim 34, wherein the antibody is selected from: S2H97, SP1-77, an antibody that binds an epitope bound by S2H92 and an antibody that binds an epitope bound by SP1-77.
36. The CoV vaccine antigen of any one of claims 1 to 35, wherein the S protein trimer is able to be bound by any antibody that binds an epitope or epitopes that include(s) part or all the RBM.
37. The CoV vaccine antigen of claim 36, wherein the antibody is selected from: Omi-18, Omi-42, an antibody that binds an epitope bound by Omi-18, and an antibody that binds an epitope bound by Omi-42.
38. The CoV vaccine antigen of any one of claims 1 to 37, wherein the S protein trimer is able to be bound by any antibody that binds an epitope or epitopes that include(s) part or all the stem region.
39. The CoV vaccine antigen of claim 38, wherein the antibody is CV3-25 or an antibody that binds an epitope bound by CV3-25.
40. The CoV vaccine antigen of any one of claims 1 to 39, wherein the melting temperature of the S protein trimer is about 38°C to about 71°C, or about 40°C to about 71°C, or about 42°C to about 71°C, or about 45°C to about 71°C, or about 50°C to about 71°C, or about 55°C to about 71°C, or about or about 60°C to about 71°C.
41. The CoV vaccine antigen of claim 40, wherein the melting temperature is about 40°C to about 71°C.
42. The CoV vaccine antigen of any one of claims 13 to 41, wherein when expressed in a recombinant expression system the trimer is produced at a higher level compared to a S protein trimer lacking the truncation expressed in the same recombinant expression system.
43. The CoV vaccine antigen of any one of claims 13 to 42, wherein when expressed in a recombinant expression system the level of the S protein trimer is increased about 17% to about 36% compared to the level of a S protein trimer lacking the truncation.
44. The CoV vaccine antigen of anyone of claims 13 to 43, wherein when expressed in a recombinant expression system the level of the S protein trimer is increased by about 2 fold to about 10 fold compared to the level of a S protein trimer lacking the truncation.
45. The CoV vaccine antigen of anyone of claims 13 to 44, wherein the S protein trimer is produced at a level greater than about 300 µg / 50 mL.
46. The CoV vaccine antigen of anyone of claims 13 to 45 wherein the S protein trimer is produced at a level of about 300 µg / 50 mL to about 2000 µg / 50 mL.
47. The CoV vaccine antigen of anyone of claims 1 to 46, wherein the S protein trimer is soluble.
48. The CoV vaccine antigen of any one of claims 13 to 42, wherein the vaccine antigen additionally comprises the 2P modification.
49. The CoV vaccine antigen of any one of claims 1 to 47, wherein the vaccine antigen additionally comprises the 6P modification.
50. The CoV vaccine antigen of any one of claims 1 to 49, wherein the vaccine antigen is a pan-coronavirus vaccine antigen.
51. The CoV vaccine antigen of any one of claims 1 to 50, wherein the vaccine antigen is a SARS-CoV-2 vaccine antigen.
52. The CoV vaccine antigen of claim 51, wherein the vaccine antigen is a SARS-CoV-2 omicron vaccine antigen.
53. The CoV vaccine antigen of claim 51, wherein the vaccine antigen is a SARS-CoV-2 non- omicron vaccine antigen.
54. The CoV vaccine antigen any one of claims 1 to 53, wherein the S protein trimer further comprises a structural modification which reduces the size of the alanine cavity in the coiled-coil region of the S protein trimer.
55. The CoV vaccine antigen of claim 54, wherein the structural modification is within the coiled-coil region.
56. The CoV vaccine antigen of claim 54 or claim 55, wherein the structural modification creates an artificial hydrophobic core in the alanine cavity.
57. The CoV vaccine antigen of any one of claims 54 to 56, wherein at least one amino acid in the coiled-coil region of a S protein monomer of the S protein trimer is substituted with a more hydrophobic amino acid or wherein at least two amino acids in the coiled-coil region of a S protein monomer of the S protein trimer are substituted with a more hydrophobic amino acid.
58. The CoV vaccine antigen of claim 57, wherein the at least one amino acid or at least two amino acids are in position a and / or d of the heptad repeat motif of the coiled-coil region of the S protein monomers.
59. The CoV vaccine antigen of any one of claims 54 to 58, wherein the more hydrophobic amino acid comprises one or more of the following properties: i) a hydrophobicity greater than alanine; ii) is a hydrophobic amino acid that is larger than alanine; iii) a hydrophobicity greater than 47 at a pH of 2; iv) a hydrophobicity greater than 41 at a pH of 7; and v) is selected from: isoleucine, leucine, methionine, valine, phenylalanine, tyrosine and tryptophan.
60. The CoV vaccine antigen of any one of claims 54 to 59, wherein the at least one amino acid in the coiled-coil region of S protein monomer is A1016.
61. The CoV vaccine antigen of claim 60, wherein A1016 is substituted with valine (A1016V or 16V).
62. The CoV vaccine antigen of any one of claims 54 to 61, wherein the at least one amino acid in the coiled-coil region of S protein monomer is A1020.
63. The CoV vaccine antigen of claim 62, wherein A1020 is substituted with isoleucine (A1020I or 20I).
64. The CoV vaccine antigen of any one of claims 54 to 63, wherein the at least one amino acid in the coiled-coil region of S protein monomer are A1016 substituted with valine and A1020 is substituted isoleucine (A1016V / A1020I or VI).
65. The CoV vaccine antigen of any one of claims 54 to 64, wherein the at least one amino acid in the coiled-coil region of S protein monomer are A1016 substituted leucine (A1016L or 16L).
66. The CoV vaccine antigen of any one of claims 13 to 65, wherein the S protein trimer comprises or consists of residues corresponding to 16 to 1192 of SEQ ID NO: 1 or SEQ ID NO: 2, a non-endogenous inter-protomer disulfide bond is formed between residues corresponding to D571 and S967 of SEQ ID NO: 1 or SEQ ID NO: 2 (D17) or A570 and S967 of SEQ ID NO: 1 or SEQ ID NO: 2 (I1), and wherein the S protein trimer comprises a melting temperature of about 50°C to about 55°C.
67. The CoV vaccine antigen of any one claims 13 to 66, wherein the S protein trimer comprises or consists of a sequence selected from: SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO:
13.
68. The CoV vaccine antigen of any one of claims 13 to 67, wherein the S protein trimer comprises or consists of a sequence selected from: SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO:
49.
69. The CoV vaccine antigen of any one of claims 13 to 68, wherein the S protein trimer comprises or consists of a sequence selected from: SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 102, SEQ ID NO: 103 SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 122, SEQ ID NO: 123 and SEQ ID NO:
124.
70. The CoV vaccine antigen of any one of claims 13 to 69, wherein the S protein trimer lacks a signal sequence.
71. The CoV vaccine antigen of any one of claims 13 to 70, wherein the C-terminal truncation is between residues corresponding to 1162 to 1200 of SEQ ID NO: 1 or SEQ ID NO:
2.
72. The CoV vaccine antigen of any one of claims 13 to 71, wherein the C-terminal truncation is after a residue selected from a residue corresponding to 1162, 1165, 1192 or 1199 of SEQ ID NO: 1 or SEQ ID NO:
2.
73. The CoV vaccine antigen of any one claims 13 to 71, wherein the C-terminal truncation is after residue 1192 of SEQ ID NO: 1 or SEQ ID NO:
2.
74. A protein nanoparticle comprising the coronavirus (CoV) vaccine antigen of any one of claims 1 to 73.
75. A virus-like particle comprising the coronavirus (CoV) vaccine antigen of any one of claims 1 to 73.
76. A deoxyribonucleic acid or a ribonucleic acid encoding the coronavirus vaccine antigen of any one of claims 1 to 73.
77. A ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen comprises a CoV S protein trimer with at least one non-endogenous inter-protomer disulfide bond.
78. A ribonucleic acid encoding a S protein monomer of a coronavirus (CoV) vaccine antigen wherein the vaccine antigen is a CoV S protein trimer and wherein the S protein monomer of the CoV S protein trimer has a C-terminal truncation in the stem region.
79. A vector comprising the deoxyribonucleic acid or ribonucleic acid of any one of claims 76 to 78.
80. A host cell comprising the deoxyribonucleic acid or ribonucleic acid of any one of claims 76 to 78 or the vector of claim 79.
81. A method of producing the coronavirus (CoV) vaccine antigen of any one of claims 1 to 70 comprising culturing the host cell of claim 80 in culture medium to produce the vaccine antigen.
82. A method of producing a coronavirus (CoV) vaccine comprising culturing the host cell of claim 80 in culture medium to produce the ribonucleic acid or deoxyribonucleic acid of any one of claims 76 to 78.
83. A vaccine comprising the coronavirus (CoV) vaccine antigen of any one of claims 1 to 73 or 81, or the protein nanoparticle of claim 74, or the virus-like particle of claim 75, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, or the vector of claim 73.
84. The vaccine of claim 83, wherein the vaccine is selected from an: inactivated vaccine; live attenuated vaccine; a protein subunit vaccine and an RNA vaccine.
85. The vaccine of claim 83 or claim 84, wherein the vaccine further comprises at least one further CoV vaccine antigen or at least one further ribonucleic acid encoding an S protein monomer of a coronavirus (CoV) vaccine antigen.
86. A method of inducing an immune response to a coronavirus (CoV) in a subject, the method comprising delivering the vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, or vaccine of any one of claims 83 to 85 to a subject.
87. A method of enhancing the immune response to coronavirus (CoV) in a subject, the method comprising delivering the vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, or vaccine of any one of claims 83 to 85 to a subject.
88. A method of preventing or reducing the likelihood of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, or vaccine of any one of claims 83 to 85 to a subject.
89. A method of preventing or reducing the likelihood or severity of a symptom of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or theribonucleic acid of any one of claims 76 to 78, or vaccine of any one of claims 83 to 85 to a subject.
90. A method of reducing the severity and / or duration of a coronavirus (CoV) infection in a subject, the method comprising delivering the vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, or vaccine of any one of claims 83 to 85 to a subject.
91. A method of preventing or reducing viral shedding in a human individual infected with a coronavirus (CoV), the method comprising delivering the vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, or vaccine of any one of claims 83 to 85 to a subject.
92. The method of any one of claims 86 to 91, wherein delivery is intramuscular, intradermal, subcutaneous, intravenous, intra-arterial, intraperitoneal, intranasal, sublingual, tonsillar, oral, pulmonary, topical or another parenteral mucosal route.
93. The CoV vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, or the vaccine of any one of claims 83 to 85 for use in one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject; iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject.
94. A kit, device, surface or strip comprising the coronavirus (CoV) vaccine antigen of any one of claims 1 to 73 or claim 81, or the ribonucleic acid of any one of claims 76 to 78.
95. Use of the coronavirus (CoV) vaccine antigen of any one of claims 1 to 73 or claim 81, or the deoxyribonucleic acid of claim 76, or the ribonucleic acid of any one of claims 76 to 78, in the manufacture of a medicament for one or more of: i) inducing an immune response to a CoV in a subject; ii) enhancing the immune response to a CoV in a subject;iii) preventing or reducing the likelihood of a CoV infection in a subject; iv) preventing or reducing the likelihood of severity of a CoV symptom in a subject; v) reducing the severity and / or duration of a CoV infection in a subject; vi) preventing or reducing viral shedding in a subject; and vii) treating a CoV infection in a subject.
96. A method of increasing S protein trimer yield comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation.
97. A method of stabilizing a CoV S protein trimer in a prefusion conformation comprising modifying the CoV S protein trimer to comprise at least one non-endogenous inter-protomer disulfide bond.
98. A method of increasing the melting temperature of a CoV S protein trimer comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation.
99. A method of increasing the melting temperature of a CoV S protein trimer stabilised in the prefusion conformation comprising modifying the CoV S protein trimer to comprise a stem region C-terminal truncation.
100. A method of enhancing neutralising antibody responses comprising modifying the CoV S protein trimer to comprise at least one inter-protomer disulfide bond and / or modifying the CoV S protein trimer to comprise a stem region C-terminal truncation.