Coronavirus vaccine and how to use it

Abstract

To provide nucleic acid molecules encoding a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-CoV-2 spike antigens, immunogenic compositions and vaccines, and their use in inducing immune responses and protecting against or treating a SARS-CoV-2 infection in a subject.SOLUTION: A nucleic acid molecule encoding a SARS-CoV-2 spike antigen is provided which comprises: a nucleic acid sequence having at least 99% identity over the entire length of the nucleic acid sequence set forth in nucleotides 55 to 3837 of SEQ ID NO: 2; a nucleic acid sequence having at least 99% identity over the entire length of SEQ ID NO: 2; the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2; and the nucleic acid sequence of SEQ ID NO: 2.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] Cross-reference of related applications This application is a compilation of U.S. provisional applications No. 62 / 981,451 filed on February 25, 2020, No. 63 / 004,380 filed on April 2, 2020, No. 63 / 028,404 filed on May 21, 2020, No. 63 / 033,349 filed on June 2, 2020, No. 63 / 040,865 filed on June 18, 2020, No. 63 / 046,415 filed on June 30, 2020, and No. 63 / 062,762 filed on August 7, 2020. We claim the interests of U.S. Provisional Application No. 63 / 114,858 filed on 17 November, U.S. Provisional Application No. 63 / 130,593 filed on 24 December 2020, U.S. Provisional Application No. 63 / 136,973 filed on 13 January 2021, U.S. Provisional Application No. 62 / 981,168 filed on 25 February 2020, U.S. Provisional Application No. 63 / 022,032 filed on 8 May 2020, U.S. Provisional Application No. 63 / 056,996 filed on 27 July 2020, and U.S. Provisional Application No. 63 / 063,157 filed on 7 August 2020. The contents of each of these applications are incorporated herein by reference in their entirety.

[0002] Sequence List This application includes a sequence listing submitted electronically as a text file named "104409_000596_SL.txt", created on February 24, 2021, with a size of 58,410 bytes. The sequence listing is incorporated herein by reference.

[0003] This invention relates to a vaccine against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and a method for administering the vaccine. [Background technology]

[0004] COVID-19, previously known as 2019-nCoV pneumonia or disease, has rapidly emerged as a global threat to public health, joining the growing number of animal-to-human transmitted coronavirus-related illnesses, Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS). There is an urgent need for medical measures, such as vaccines, to combat the spread of this novel coronavirus. There are at least seven identified human-infecting coronaviruses, including MERS-CoV and SARS-CoV.

[0005] In December 2019, Wuhan, China, became the epicenter of the global outbreak of the novel coronavirus. This coronavirus, SARS-CoV-2, was isolated and sequenced from human respiratory epithelial cells from infected patients (Zhu, et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J Med. 2020; Wu, et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020). The symptoms of the disease can range from mild, flu-like symptoms to severe cases with life-threatening pneumonia (Huang, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020). The global situation is evolving dynamically, and on January 30, 2020, the World Health Organization declared COVID-19 a Public Health Emergency of International Concern (PHEIC). [Overview of the project]

[0006] Nucleic acid molecules encoding the SARS-CoV-2 spike antigen are provided herein. According to some embodiments, the encoded SARS-CoV-2 spike antigen is a consensus antigen. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 90% identity over the entire length of the nucleic acid sequence described in SEQ ID NO: 2, nucleotides 55-3837 of SEQ ID NO: 2, nucleic acid sequence of nucleotides 55-3837 of SEQ ID NO: 2, nucleic acid sequence of SEQ ID NO: 2, nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO: 3, nucleic acid sequence of SEQ ID NO: 3, nucleic acid sequence having at least about 90% identity over the entire length of nucleotides 55-3837 of SEQ ID NO: 5, nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO: 5, nucleic acid sequence of nucleotides 55-3837 of SEQ ID NO: 5, nucleic acid sequence of SEQ ID NO: 6, or nucleic acid sequence of SEQ ID NO: 6. This specification also provides a nucleic acid molecule encoding a SARS-CoV-2 spike antigen, wherein the SARS-CoV-2 spike antigen comprises an amino acid sequence having at least about 90% identity over the entire length of residues 19 to 1279 of SEQ ID NO: 1, the amino acid sequence described in residues 19 to 1279 of SEQ ID NO: 1, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 1, an amino acid sequence having at least about 90% identity over the entire length of residues 19 to 1279 of SEQ ID NO: 4, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO: 4, the amino acid sequence described in residues 19 to 1279 of SEQ ID NO: 4, or the amino acid sequence of SEQ ID NO: 4.

[0007] In some embodiments, the nucleic acid molecule encoding the SARS-CoV-2 antigen is incorporated into the virus particle.

[0008] Furthermore, vectors containing nucleic acid molecules encoding the SARS-CoV-2 antigen are provided. In some embodiments, the vector is an expression vector. The nucleic acid molecule can be operably ligated to a regulatory element selected from a promoter and a polyadenylation signal. The expression vector may be a plasmid or a viral vector.

[0009] An immunogenic composition comprising an effective amount of vector or viral particles is disclosed. The immunogenic composition may, but is not limited to, include pharmaceutically acceptable excipients such as buffers. The buffer may optionally be physiological saline-sodium citrate buffer. In some embodiments, the immunogenic composition includes an adjuvant.

[0010] This specification also provides SARS-CoV-2 spike antigens. According to some embodiments, the SARS-CoV-2 spike antigen is a consensus antigen. In some embodiments, the SARS-CoV-2 spike antigen comprises an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO: 1, the amino acid sequence described in residues 19-1279 of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 1, the amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO: 4, the amino acid sequence described in residues 19-1279 of SEQ ID NO: 4, or the amino acid sequence of SEQ ID NO: 4.

[0011] This specification further provides vaccines for the prevention or treatment of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection. The vaccine comprises an effective amount of one or a combination of the aforementioned nucleic acid molecules, vectors, or antigens. According to some embodiments, the vaccine further comprises a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient may be a buffer, optionally a saline-sodium citrate buffer. According to some embodiments, the vaccine further comprises an adjuvant.

[0012] Methods for inducing an immune response to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in subjects requiring such induction are further provided. In the embodiments that appear, the method for inducing an immune response comprises administering an effective amount of one or a combination of the aforementioned nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines to a subject. Also provided herein is a method for protecting a subject requiring protection from infection by SARS-CoV-2, wherein the method comprises administering an effective amount of one or a combination of the aforementioned nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines to a subject. Furthermore, methods are provided for in treating a SARS-CoV-2 infection in subjects requiring such treatment, wherein the method comprises administering an effective amount of one or a combination of the aforementioned nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines to a subject. In any of these methods, administration may comprise at least one of electroporation and injection. According to some embodiments, administration comprises, for example, parenteral administration by intradermal, intramuscular, or subcutaneous injection, optionally followed by electroporation. In some embodiments of the disclosed method, an initial dose of approximately 0.5 mg to approximately 2.0 mg of nucleic acid molecules is administered to a subject, optionally being 0.5 mg, 1.0 mg, or 2.0 mg of nucleic acid molecules. The method may further include administering a subsequent dose of approximately 0.5 mg to approximately 2.0 mg of nucleic acid molecules to the subject about four weeks after the initial dose, optionally being 0.5 mg, 1.0 mg, or 2.0 mg of nucleic acid molecules. In further embodiments, the method includes administering one or more further subsequent doses of approximately 0.5 mg to approximately 2.0 mg of nucleic acid molecules to the subject at least 12 weeks after the initial dose, optionally being 0.5 mg, 1.0 mg, or 2.0 mg of nucleic acid molecules. In any of these embodiments, INO-4800 or a biosimilar thereof is administered.

[0013] This specification also provides the use of one or a combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in methods for inducing an immune response to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in subjects that require such induction. Furthermore, this specification provides the use of one or a combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in methods for protecting subjects from infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). This specification also provides the use of one or a combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in methods for treating subjects that require treatment for SARS-CoV-2 infection. According to any of these uses, the nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines may be administered to a subject by at least one of electroporation and injection. In some embodiments, the nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines are administered parenterally to the subject, followed by electroporation. In some embodiments of the disclosed use, an initial dose of approximately 0.5 mg to approximately 2.0 mg of nucleic acid molecules is administered to the subject, optionally the initial dose being 0.5 mg, 1.0 mg, or 2.0 mg of nucleic acid molecules. This use may further include administering a subsequent dose of approximately 0.5 mg to approximately 2.0 mg of nucleic acid molecules to the subject about four weeks after the initial dose, optionally the subsequent dose being 0.5 mg, 1.0 mg, or 2.0 mg of nucleic acid molecules. In further embodiments, this use includes administering one or more further subsequent doses of approximately 0.5 mg to approximately 2.0 mg of nucleic acid molecules to the subject at least 12 weeks after the initial dose, optionally the further subsequent dose being 0.5 mg, 1.0 mg, or 2.0 mg of nucleic acid molecules. In any of these embodiments, INO-4800 or its biosimilar is administered.

[0014] This specification further provides the use of one or a combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in the preparation of pharmaceuticals. In some embodiments, the pharmaceuticals are for treating or protecting against infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In some embodiments, the pharmaceuticals are for treating or protecting against diseases or disorders associated with SARS-CoV-2 infection. In some embodiments, the pharmaceuticals are for treating or protecting against coronavirus disease 2019 (COVID-19), adult multisystem inflammatory syndrome (MIS-A), or pediatric multisystem inflammatory syndrome (MIS-C).

[0015] The present invention further relates to a method for detecting a persistent cellular immune response in a subject, the method comprising the steps of: administering an immunogenic composition for inducing an immune response to the SARS-CoV-2 antigen to a subject in need; isolating peripheral mononuclear cells (PBMCs) from the subject; stimulating the isolated PBMCs with a spike antigen comprising the amino acid sequence described in SEQ ID NO: 1, the amino acid sequence described in SEQ ID NO: 4, or the amino acid sequence of SEQ ID NO: 4, or an amino acid sequence selected from the group consisting of fragments thereof containing at least 20 amino acids; and detecting at least one of the number of cytokine-expressing cells and the level of cytokine expression. In one embodiment, the step of detecting at least one of the number of cytokine-expressing cells and the level of cytokine expression is performed using intracellular cytokine staining (ICS) analysis using enzyme-linked immunospot (ELISpot) or flow cytometry.

[0016] In one embodiment, the subject is administered an immunogenic composition comprising a nucleic acid molecule, and the nucleic acid molecule comprises a nucleotide sequence encoding a peptide comprising an amino acid sequence having at least about 90% identity over the full length of residues 19 to 1279 of SEQ ID NO: 1, the amino acid sequence set forth in residues 19 to 1279 of SEQ ID NO: 1, an amino acid sequence having at least about 90% identity over the full length of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 1, an amino acid sequence having at least about 90% identity over the full length of residues 19 to 1279 of SEQ ID NO: 4, an amino acid sequence having at least about 90% identity over the full length of SEQ ID NO: 4, the amino acid sequence set forth in residues 19 to 1279 of SEQ ID NO: 4, or the amino acid sequence of SEQ ID NO: 4. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] [Figure 1]Figures 1A, 1B, 1C, and 1D show the design and expression of SARS-CoV-2 synthetic DNA vaccine constructs. Figure 1A shows schematic diagrams of the SARS-CoV-2 synthetic DNA vaccine constructs pGX9501 (matched) and pGX9503 (outlier (OL)) containing an IgE reader sequence and a SARS-CoV-2 spike protein insert ("Covid-19 spike antigen" or "Covid-19 spike-OL antigen"). Figure 1B shows the results of RT-PCR assays of RNA extracts from COS-7 cells double-transfected with pGX9501 or pGX9503. Extracted RNA was analyzed by RT-PCR using PCR assays designed for each target and for COS-7 β-actin mRNA used as the internally expressed normalization gene. Delta CT (ΔCT) was calculated by subtracting the β-actin CT for each transfection concentration from the target CT, and plotted against the logarithm of the transfected pDNA mass (plotted as mean ± SD). Figure 1C shows the analysis of in vitro spike protein expression in 293T cells after transfection with pGX9501, pGX9503, or MOCK plasmid by Western blotting. 293T cell lysates were degraded on a gel and probed with polyclonal anti-SARS spike protein. The blot was detached and then probed with anti-β-actin loading control. Figure 1D shows in vitro immunofluorescence staining of 293T cells transfected with 3 μg / well of pGX9501, pGX9503, or pVax (empty control vector). Spike protein expression was measured with polyclonal anti-SARS spike protein IgG and anti-IgG secondary. Cell nuclei were counterstained with DAPI. Images were captured using the ImageXpress® Pico automated cell imaging system. [Figure 2]IgG binding screening of a panel of SARS-CoV-2 and SARS-CoV antigens using sera from INO-4800-treated mice is shown. As described in the methods, BALB / c mice were immunized on day 0 with 25 μg of INO-4800 or pVAX-empty vector (control). Protein antigen binding of IgG in 1:50 and 1:250 serum dilutions from mice on day 14. The data shown represent the mean OD450nm values (mean + SD) for each group of 4 mice. [Figure 3] Figures 3A, 3B, 3C, and 3D show the humoral responses against SARS-CoV-2 S1+2 and S receptor-binding domain (RBD) protein antigens in BALB / c mice after a single dose of INO-4800. BALB / c mice were immunized on day 0 with the indicated doses of INO-4800 or pVAX-empty vector as described in Example 1. SARS-CoV-2 S1+2 (Figure 3A) or SARS-CoV-2 RBD (Figure 3B) protein antigen binding of IgG in serial serum dilutions from mice on day 14 is shown. The data shown represent the mean OD450nm values (mean + SD) for each group of 8 mice (Figures 3A and 3B) and 5 mice (Figures 3C and 3D). Serum IgG binding endpoint titers against SARS-CoV-2 S1+2 (Figure 3B) and SARS-CoV-2 RBD (Figure 3D) proteins. Data representing two independent experiments. [Figure 4A] Figures 4A and 4B show the neutralizing antibody responses after immunization with INO-4800. BALB / c mice (n = 5 per group) were immunized twice on days 0 and 14 with 10 μg of INO-4800. Serum was collected 7 days after the second immunization and serial dilutions were incubated with a pseudovirus expressing SARS-CoV-2 spike and then with ACE2-293T cells. Figure 4A shows the neutralizing ID50 (mean ± SD) in naive and INO-4800-immunized mice. Figure 4B shows the relative light units (RLU) for sera from naive mice and mice vaccinated with INO-4800 as described in the methods. [Figure 4B] Same as above. [Figure 5] Figures 5A and 5B show the humoral response to SARS-CoV-2 in Hartley guinea pigs after a single dose of INO-4800. Hartley guinea pig mice were immunized on day 0 with 100 μg of INO-4800 or a pVAX-empty vector, as described in Example 1. Figure 5A shows the binding of IgG to the SARS-CoV-2 S protein antigen in serial serum dilutions on day 0 and day 14. The data shown represent the mean OD450 nm value (mean + SD) for five guinea pigs. Figure 5B shows the serum IgG binding titer (mean ± SD) to the SARS-CoV-2 S protein on day 14. The P value was determined by the Mann-Whitney test. [Figure 6]Figures 6A–6F show that INO-4800 immunized mouse and guinea pig serum compete with the ACE2 receptor for binding to the SARS-CoV-2 spike protein. Figure 6A shows that the soluble ACE2 receptor binds to the CoV-2 full-length spike at an EC50 of 0.025 μg / ml. Figure 6B shows that purified serum IgG from BALB / c mice (n=5 per group) after a second immunization with INO-4800 shows significant competition for the ACE2 receptor. Animal-derived serum IgG samples were used in three separate assays. Figure 6C shows that purified IgG from n=5 mice 7 days after a second immunization with INO-4800 shows significant competition for the ACE2 receptor for binding to the SARS-CoV-2 S 1+2 protein. The soluble ACE2 concentration for the competition assay was approximately 0.1 μg / ml. Bars represent the mean and standard deviation of AUC. Figure 6D shows Hartley guinea pigs immunized with 100 μg of INO-4800 or pVAX-empty vector on day 0 and day 14, as described in the Methods. Serum (1:20 dilution) collected on day 28 was added to the SARS-CoV-2 coated well before the addition of serial dilutions of ACE2 protein. Detection of ACE2 binding to the SARS-CoV-2 S protein was measured. This experiment used serum collected from 5 INO-4800-treated animals and 3 pVAX-treated animals. Figure 6E shows serial dilutions of guinea pig serum collected on day 21 added to the SARS-CoV-2 coated well before the addition of ACE2 protein. Detection of ACE2 binding to the SARS-CoV-2 S protein was measured. This experiment used serum collected from 4 INO-4800-treated guinea pigs and 5 pVAX-treated guinea pigs. Figure 6F shows purified IgG from n=5 mice 14 days after second immunization with INO-4800, demonstrating competition for the ACE2 receptor binding to the SARS-CoV-2 spike protein compared to pooled naive mouse IgG. Naive mice were run in a single column. Vaccinated mice were run in two columns. If no error bars are displayed, the error is smaller than the data point. [Figure 7]Figures 7A–7D show the detection of SARS-CoV-2 S protein-reactive antibodies in BALs of INO-4800-immunized animals. BALB / c mice (5 mice per group) were immunized with INO-4800 or pVAX on days 0 and 14, and BALs were collected on day 21 (Figures 7A and 7B). Hartley guinea pigs (5 mice per group) were immunized with INO-4800 or pVAX on days 0, 14, and 21, and BALs were collected on day 42 (Figures 7C and 7D). Bronchoalveolar lavage fluid was dual-assayed for SARS-CoV-2 spike protein-specific IgG antibodies by ELISA. Data are presented as endpoint titers (Figures 7A and 7C) and BAL dilution curves with raw OD450nm values ​​(Figures 7B and 7D). In Figures 7A and 7C, bars represent the mean for each group, and error bars represent the standard deviation. **The Mann-Whitney U test shows p<0.01.** [Figure 8] Figures 8A–8C show the induction of T cell responses in BALB / c mice after administration of INO-4800. BALB / c mice (n=5 / group) were immunized with 2.5 or 10 μg of INO-4800. T cell responses were analyzed in animals on days 4, 7, 10 (Figures 8A and 8B), and 14 (Figure 8C). T cell responses were measured by IFN-γ ELISpot in splenocytes stimulated for 20 hours with an overlapping peptide pool spanning SARS-CoV-2 (Figure 8A), SARS-CoV (Figure 8B), or MERS-CoV (Figure 8C) spike proteins. Bars represent mean + SD. [Figure 9] Figures 9 and 10 show cellular and humoral immune responses measured in New Zealand White (NZW) rabbits treated with INO-4800. Intradermal delivery of pDNA at day 0 and day 28. PBMC IFN-γ ELISA (Figure 9), serum IgG-conjugated ELISA (Figure 10). [Figure 10] Same as above. [Figure 11A]Figures 11A–11E show the humoral immune response to the SARS-CoV-2 spike protein measured in rhesus monkeys treated with INO-4800. Intradermal delivery of pDNA at day 0 and day 28. Serum IgG-conjugated ELISA. [Figure 11B] Same as above. [Figure 11C] Same as above. [Figure 11D] Same as above. [Figure 11E] Same as above. [Figure 12A] Figures 12A–12G show humoral immune responses to SARS and MERS spike proteins measured in rhesus monkeys treated with INO-4800. Intradermal delivery of pDNA at day 0 and day 28. Serum IgG-conjugated ELISA. (Figures 12A–12G; left panel, 1 mg INO-4800; right panel, 2 mg INO-4800). [Figure 12B] Same as above. [Figure 12C] Same as above. [Figure 12D] Same as above. [Figure 12E] Same as above. [Figure 12F] Same as above. [Figure 12G] Same as above. [Figure 13A] Figures 13A–13C show the cellular immune response measured by PBMC IFN-γ ELISpot in rhesus monkeys treated with INO-4800 after intradermal delivery of pDNA on day 0 and day 28. The results are shown in Figures 13A (SARS CoV-2 spike peptide), 13B (SARS CoV spike peptide), and 13C (MERS CoV spike peptide). [Figure 13B] Same as above. [Figure 13C] Same as above. [Figure 14]Figures 14A and 14B show T cell epitope mapping after INO-4800 administration to BALB / c mice. Splenocytes were stimulated for 20 hours with a SARS-CoV-2 peptide matrix mapping pool. Figure 14A shows the T cell response after stimulation with the matrix mapping SARS-CoV-2 peptide pool. Bars represent the mean + SD of 5 mice. Figure 14B shows the mapping of SARS-CoV-2 spike protein and identification of immunodominant peptides in BALB / c mice. Known immunodominant SARS-CoV HLA-A2 epitopes are included for comparison. Figure 14B discloses Sequence IDs 26–35, respectively, in order of appearance. [Figure 15] Figures 15A–15H show the fluid correlation of protection in the throat and nasal compartments. (Figures 15A–15D) Correlation of throat viral load Log10 cDNA copy mL-1 on day 1 (Figures 15A, 15B) and day 3 (Figures 15C, 15D) after SARS-CoV-2 challenge with microneutralizing titer (Figures 15A, 15C) and RBD IgG binding endpoint titer (Figures 15B, 15D). (Figures 15E–15H) The same analysis for nasal viral load. P and R values ​​provided for two-sided nonparametric Spearman rank correlation analysis. Control animals - red filled circle, INO-4800 X1 - green filled circle, and INO-4800 X2 - blue filled circle. [Figure 16] The Phase I trial flowchart is shown. [Figure 17A]Figures 17A, 17B, 17C, and 17D show the humoral antibody response in the Phase I clinical trial. Humoral responses in the 1.0 mg and 2.0 mg dose groups were evaluated for their ability to neutralize live virus (n=18, 1.0 mg; n=19, 2.0 mg) (Figure 17A), their ability to bind to the RBD region (Figure 17B), and their ability to bind to all spike proteins (S1 and S2) (Figure 17C). Endpoint titers were calculated as the titer showing an OD3.0 SD above baseline, with baseline titer set to 1. In Figure 17D, humoral responses in the 1.0 mg and 2.0 mg dose groups were evaluated for their ability to bind to all spike proteins (S1 and S2) (n=19, 1.0 mg; n=19, 2.0 mg). Endpoint titers were calculated as the titer showing an OD3.0 SD above baseline, with baseline titer set to 1. The response to live virus neutralization was PRNT IC50 ≥ 10. In all graphs, the horizontal line represents the median and the bars represent the interquartile range. [Figure 17B] Same as above. [Figure 17C] Same as above. [Figure 17D] Same as above. [Figure 18A]Figures 18A–18G show the results of cellular immune response analysis from a Phase I clinical trial. PBMCs isolated from vaccinated individuals were stimulated in vitro with the SARS-CoV-2 spike antigen. The number of cells capable of secreting IFN-gamma was measured in a standard ELISpot assay for the 1.0 mg and 2.0 mg dose groups (Figure 18A). The horizontal line represents the median, and the bars represent the interquartile range. As shown in Figure 18B, the entire peptide of the spike antigen was divided into pools, and the pools were mapped to specific regions of the antigen and tested individually in ELISpot. Three subjects are shown to illustrate the pooled response and associated magnitude diversity across the subjects. The pie chart represents the overall diversity in the 2.0 mg dose group. As shown in Figure 18C, SARS-CoV-2 spike-specific cytokine production was measured from CD4+ and CD8+ T cells by flow cytometry. The bars represent the mean response. Cytokine production is further segmented using CCR7 and CD45RA to central memory (CM), effector memory (EM), or effector (E) differentiation states, using data in Figure 18D indicating what percentage of the overall cytokine response originates from which differentiation group. Pie charts representing the polyfunctionality of CD4+ and CD8+ T cells for each dose cohort are provided in Figure 18E. IL-4 production by CD4+ T cells for each dose cohort is shown in Figure 18F. Horizontal lines represent the mean response. Graphs represent all evaluable subjects. Statistical analysis was performed on all paired datasets. Significant results are indicated in the figure; unindicated results indicate a lack of statistical significance. Figure 18G provides heatmaps of each subject in the 2.0 mg dose group and their percentage of ELISpot response specific to each pool containing SARS-CoV-2 spike antigen. [Figure 18B] Same as above. [Figure 18C] Same as above. [Figure 18D] Same as above. [Figure 18E] Same as above. [Figure 18F] Same as above. [Figure 18G] Same as above. [Figure 19] This includes mild (grade 1), moderate (grade 2), severe (grade 3), and life-threatening (grade 4) phase I systemic and local adverse events. [Figure 20] Supplemental data regarding humoral immune responses are provided. Three convalescent samples (all three symptomatic but not hospitalized) tested by the ELISpot assay showed a lower T-cell response than the 2.0 mg dose group at week 8, with a median T-cell count of 33. [Figure 21] This provides supplemental enzyme-linked immunospot (ELISpot) data. [Figure 22] Figures 22A–22F show humoral and cellular responses in rhesus monkeys vaccinated with INO-4800. Overview of the study (Figure 22A). Spike-specific IgG (Figure 22B), RBD (Figure 22C), and live virus-neutralizing antibodies (Figure 22D) were measured in serum from rhesus monkeys that received one or two doses of INO-4800 or unvaccinated (control) monkeys. Lines represent geometric means. Cellular immune response in rhesus monkeys vaccinated with INO-4800. SARS-CoV-2 spike-specific interferon-gamma from PBMCs.

number

[0018] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. In case of any conflict, this specification, including its definitions, shall prevail. Similar or equivalent methods and materials may be used in the practice or testing of the present invention, but preferred methods and materials are described below. All publications, patent applications, patents, and other references referenced herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and are not intended to be limiting.

[0019] The term “including” is intended to include examples that are encompassed by the terms “essentially consisting of” and “consisting of,” and similarly, the term “essentially consisting of” is intended to include examples that are encompassed by the term “consisting of.” This disclosure also intends other embodiments “including,” “consisting of,” and “essentially consisting of” embodiments or elements presented herein, whether expressly described or not.

[0020] For clarity, it should be understood that certain features of the materials and methods disclosed herein, as described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, for brevity, various features of the materials and methods disclosed, as described in the context of a single embodiment, may also be provided separately or in any subcombination.

[0021] The singular forms "a," "and," and "the" refer to multiple things unless the context otherwise indicates otherwise.

[0022] When used in relation to a numerical range, cutoff, or specific value, the term "approximately" is used to indicate that the enumerated values ​​may vary by up to 10% from the enumerated value. Therefore, the term "approximately" is used to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or ±0.1% from a given value. When a value is represented as an approximation by the preceding use of "approximately," it will be understood that a particular value may form a different embodiment. A reference to a specific number includes at least that specific value unless the context otherwise explicitly states otherwise.

[0023] As used herein, “adjuvant” means any molecule added to the vaccine described herein to enhance the immunogenicity of the antigen.

[0024] As used herein, “antibody” means an antibody of class IgG, IgM, IgA, IgD, or IgE, or a fragment thereof, including Fab, F(ab')2, Fd, or a fragment or derivative thereof, and single-chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies, and derivatives thereof. The antibody may be an antibody isolated from a mammalian serum sample, a polyclonal antibody, an affinity-purified antibody, or a mixture thereof, which exhibits sufficient binding specificity to a desired epitope or sequence derived therefrom.

[0025] The term "biosimilar" (of an approved reference product / biological drug, i.e., a drug listed in the reference) refers to a biological product that is very similar to a reference product in terms of safety, purity, and potency, with only minor differences in clinically inactive components, based on data from (a) analytical studies showing that the biological product is very similar to the reference product, with only minor differences in clinically inactive components; (b) animal studies (including toxicity assessments); and / or (c) clinical studies or multiple studies (including immunogenicity and pharmacokinetic or pharmacodynamic assessments) sufficient to demonstrate safety, purity, and potency in one or more appropriate conditions of use, where the reference product is licensed and intended for use, and a license is sought for the biosimilar. A biosimilar may be an interchangeable product that can be substituted in place of the reference product at a pharmacy without intervention from a prescribing healthcare professional. To meet the additional criterion of “interchangeability,” the biosimilar is expected to produce the same clinical outcomes as the reference product in any given patient, and if the biosimilar is administered multiple times to an individual, the risks in terms of safety or reduced efficacy of alternating or switching between the use of the biosimilar and the use of the reference product are not greater than the risks of using the reference product without such alternation or switching. The biosimilar utilizes the same mechanism of action for the proposed conditions of use to the extent that the mechanism is known for the reference product. One or more conditions of use specified, recommended or suggested on the label for the biosimilar have been previously approved for the reference product. The route of administration, dosage form, and / or potency of the biosimilar are the same as those of the reference product, and the biosimilar is manufactured, processed, packaged or stored in a facility that meets standards designed to ensure that the biosimilar remains safe, pure, and effective. The biosimilar may contain minor modifications to the amino acid sequence, such as N-terminal or C-terminal cleavage, which are not expected to alter the biosimilar performance compared to the reference product.

[0026] As used herein, “coding sequence” or “coding nucleic acid” means a nucleic acid (RNA or DNA molecule) containing a nucleotide sequence that codes for a protein. The coding sequence may further include start and end signals operably ligated to a regulatory element including a promoter, as well as polyadenylation signals that can induce expression in cells of an individual or mammal to which the nucleic acid is administered.

[0027] As used herein, “complement” or “complementary” means Watson-Crick (e.g., AT / U and CG) or Hoogsteen base pairings between nucleotides or nucleotide analogs of nucleic acid molecules.

[0028] As used herein, “consensus” or “consensus sequence” may mean a synthetic nucleic acid sequence or a corresponding polypeptide sequence constructed based on an analysis of the alignment of multiple subtypes of a particular antigen. This sequence may be used to induce broad immunity against multiple subtypes, serotypes, or strains of a particular antigen. A consensus sequence (or consensus antigen) can be generated by manipulating a synthetic antigen, such as a fusion protein.

[0029] As used interchangeably herein, “electroporation,” “electrical permeability,” or “electrical motion enhancement” (“EP”) refers to the use of transmembrane electric field pulses to induce microscopic pathways (pores) in biological membranes, which enable biomolecules such as plasmids, oligonucleotides, siRNAs, drugs, ions, and water to pass from one side of the cell membrane to the other.

[0030] As used herein, “fragment” means a nucleic acid sequence or a portion thereof that encodes a polypeptide capable of inducing an immune response in mammals. A fragment may also be a DNA fragment selected from at least one of the various nucleotide sequences that encode the protein fragments described below.

[0031] With respect to polypeptide sequences, “fragment” or “immunogenic fragment” means a polypeptide capable of inducing an immune response in mammals that cross-react with the full-length wild-type SARS-CoV-2 antigen. A consensus protein fragment may contain at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the consensus protein. In some embodiments, the consensus protein fragment may contain at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, at least 60 amino acids, at least 70 amino acids, at least 80 amino acids, at least 90 amino acids, at least 100 amino acids, at least 110 amino acids, at least 120 amino acids, at least 130 amino acids, at least 140 amino acids, at least 150 amino acids, at least 160 amino acids, at least 170 amino acids, at least 180 amino acids, at least 190 amino acids, at least 200 amino acids, at least 210 amino acids, at least 220 amino acids, at least 230 amino acids, or at least 240 amino acids from the consensus protein.

[0032] As used herein, the term “gene construct” refers to a DNA or RNA molecule containing a nucleotide sequence that codes for a protein. The coding sequence includes start and terminate signals operably ligated to a regulatory element containing a promoter and a polyadenylation signal that can direct the expression of the nucleic acid molecule in the cells of an individual to which it is administered. As used herein, the term “expressible form” refers to a gene construct containing the necessary regulatory elements operably ligated to a protein-coding sequence so that the coding sequence is expressed if present in the cells of an individual.

[0033] As used herein in the context of two or more nucleic acid or polypeptide sequences, “identical” or “same” means that the sequences have a specified percentage of residues that are the same across a specified region. The percentage can be calculated by optimally aligning the two sequences, comparing them across a specified region, determining the number of positions where identical residues occur in both sequences, calculating the number of matching positions, dividing the number of matching positions by the total number of positions within the specified region, and multiplying the result by 100 to obtain the percentage of sequence identity. If the two sequences are of different lengths, or if the alignment produces one or more staggered ends and the specified comparison region contains only a single sequence, the residues of the single sequence are included in the denominator but not in the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent. Identity can be performed manually or using computer sequencing algorithms such as BLAST or BLAST 2.0.

[0034] As used herein, “immune response” means the activation of the host’s immune system, such as the mammalian immune system, in response to the introduction of an antigen. The immune response may take the form of a cellular response, a humoral response, or both.

[0035] As used herein, “nucleic acid,” “oligonucleotide,” “polynucleotide,” or “nucleic acid molecule” means at least two nucleotides covalently bonded to one another. A single-stranded description also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of the described single-stranded molecule. Many variants of a nucleic acid can be used for the same purposes as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses probes that hybridize under stringent hybridization conditions.

[0036] Nucleic acids can be single-stranded or double-stranded, or may contain portions of both double-stranded and single-stranded sequences. Nucleic acids can be DNA, both genomic and cDNA, RNA, or hybrids, and may contain combinations of deoxyribonucleotides and ribonucleotides, as well as combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids can be obtained by chemical synthesis or by recombinant methods.

[0037] As used herein, “operably linked” means that gene expression is under the control of a promoter, thereby spatially linked. The promoter may be positioned 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene may be approximately the same as the distance between the promoter it controls and the gene from which the promoter originates. As is known in the art, variations in this distance can be accommodated without loss of promoter function.

[0038] As used herein, “peptide,” “protein,” or “polypeptide” may mean a linked sequence of amino acids, which may be natural, synthetic, or a modified or combined form of natural and synthetic amino acids.

[0039] As used herein, “promoter” means a synthetic or naturally occurring molecule that can give, activate, or enhance the expression of nucleic acids in cells. A promoter may include one or more specific transcriptional regulatory sequences to further enhance its expression and / or to alter spatial and / or temporal expression. A promoter may also include distal enhancer or repressor elements that can be located several thousand base pairs from the transcription start site. Promoters may be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. Promoters can constitutively or differentially regulate the expression of gene components with respect to the cell, tissue, or organ in which expression occurs, or with respect to the developmental stage in which expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, and CMV IE promoter.

[0040] "Signal peptide" and "leader sequence" are used interchangeably herein and refer to amino acid sequences that can be ligated at the amino terminus of the SARS-CoV-2 protein described herein. Signal peptides / leader sequences typically induce protein localization. As used herein, signal peptides / leader sequences preferably facilitate the secretion of the protein from the cell from which it is produced. Signal peptides / leader sequences are often cleaved from the remainder of the protein and, often after secretion from the cell, are referred to as mature proteins. Signal peptides / leader sequences are ligated at the N terminus of the protein.

[0041] As used herein, “subject” may mean a mammal that desires or requires to be immunized with the immunogenic composition or vaccine described herein. The mammal may be a human, chimpanzee, guinea pig, dog, cat, horse, cattle, mouse, rabbit, or rat.

[0042] As used herein, “substantially identical” means that the first and second amino acid sequences are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 50 This could mean that across the range of 0, 600, 700, 800, 900, 1000, 1100, or more amino acids, the percentage is at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. "Substantially identical" also means that the first nucleic acid sequence and the second nucleic acid sequence are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 60 This could mean that over regions of 0, 700, 800, 900, 1000, 1100, or more nucleotides, at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0043] As used herein, “treatment” or “treating” may mean the protection of an animal from disease through means of preventing, suppressing, repressing, or completely eliminating the disease. Preventing disease includes administering the immunogenic composition or vaccine of the present invention to an animal before the onset of the disease. Suppressing disease includes administering the immunogenic composition or vaccine of the present invention to an animal after the induction of the disease but before its clinical manifestation. Repressing disease includes administering the immunogenic composition or vaccine of the present invention to an animal after the clinical manifestation of the disease.

[0044] Where used herein, unless otherwise stated, the term “clinically proven” (used independently or to modify the terms “safe” and / or “effective”) means that the clinical trial has been proven by a clinical trial that meets the approval criteria of the U.S. Food and Drug Administration, the EMA, or the corresponding national regulatory authority. For example, proof may be provided by a clinical trial described in the examples provided herein.

[0045] When relating to doses, drug regimens, treatments, or methods of use with SARS-CoV-2 antigens (e.g., pGX9501 or INO-4800 or SARS-CoV-2 spike antigens administered as their biosimilars), the term “clinically proven safe” refers to a favorable risk-benefit ratio with an acceptable frequency and / or acceptable severity of adverse events (referred to as AEs or TEAEs) occurring during treatment, compared to standard treatment or another comparator. Adverse events are inappropriate medical occurrences in patients who have been administered a drug. One indicator of safety is the incidence of adverse events (AEs) graded according to the Common Toxicity Criteria for Adverse Events CTCAE v4.03 by the National Cancer Institute (NCI).

[0046] As used herein in the context of dosage, drug regimens, treatments, or methods, the terms “clinically proven efficacy” and “clinically proven effect” refer to the effectiveness of a particular dose, drug regimen, or treatment regimen. Efficacy can be measured based on changes in the course of the disease in response to the agents of the present invention. For example, a SARS-CoV-2 antigen (e.g., pGX9501 or INO-4800 or a SARS-CoV-2 spike antigen administered as a biosimilar thereof) is administered to a patient in an amount and time sufficient to induce improvement, preferably sustained improvement, in at least one indicator reflecting the severity of the disorder being treated. To determine whether the amount and time of treatment are sufficient, various indicators reflecting the extent of the disease, disorder, or condition in question can be evaluated. Such indicators include, for example, clinically recognized indicators of disease severity, symptoms, or appearance of the disorder in question. The degree of improvement is generally determined by a physician who can make this determination based on signs, symptoms, biopsy, or other test results, and questionnaires given to the subject, such as quality of life questionnaires developed for a given disease, can be utilized. For example, administering SARS-CoV-2 antigen (e.g., SARS-CoV-2 spike antigen administered as pGX9501 or INO-4800 or their biosimilars) can achieve improvement in the patient's condition associated with SARS-CoV-2 infection. Improvement may be indicated by improvement in indicators of disease activity, recovery of clinical symptoms, or any other measure of disease activity.

[0047] With respect to nucleic acids, the term “variant” as used herein means (i) a portion or fragment of a referenced nucleotide sequence, (ii) a complement of a referenced nucleotide sequence or a portion thereof, (iii) a nucleic acid substantially identical to a referenced nucleic acid or its complement, or (iv) a nucleic acid that hybridizes under stringent conditions to a referenced nucleic acid, its complement, or a sequence substantially identical thereto.

[0048] A variant can further be defined as a peptide or polypeptide with a different amino acid sequence due to an amino acid insertion, deletion, or conservative substitution, but which retains at least one biological activity. Typical examples of “biological activity” include the ability to bind to a particular antibody or the ability to promote an immune response. A variant can also mean a protein having an amino acid sequence that is substantially identical to a referenced protein that has an amino acid sequence that retains at least one biological activity. Conservative substitutions of amino acids, i.e., replacing an amino acid with a different amino acid with similar properties (e.g., hydrophilicity, degree and distribution of charged regions), are typically recognized in the art as involving minor changes. These minor changes can be identified, in part, by considering the hydroxyl index of amino acids, as understood in the art. Kyte et al., J.Mol.Biol.157:105-132 (1982). The hydroxyl index of amino acids is based on consideration of their hydrophobicity and charge. It is known in the art that amino acids with similar hydroxyl indices can be substituted and still retain protein function. In one embodiment, amino acids having a hydropathic index of ±2 are substituted. The hydrophilicity of amino acids can also be used to identify substitutions that would result in proteins that retain biological function. Consideration of amino acid hydrophilicity in the context of peptides allows for the calculation of useful measures that have been reported to correlate well with the peptide's greatest local mean hydrophilicity, antigenicity, and immunogenicity. Substitutions of amino acids with similar hydrophilicity values ​​can result in peptides that retain biological activity, e.g., immunogenicity, as understood in the art. Substitutions may be made with amino acids having hydrophilicity values ​​within ±2 of each other. Both the hydrophobic index and hydrophilicity value of amino acids are influenced by the specific side chain of that amino acid. Consistent with its observations, it is understood that amino acid substitutions that are biological function and compatibility depend on the relative similarity of amino acids, and in particular, of their side chains, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties.

[0049] A variant can be a nucleic acid sequence that is substantially identical over the full length of the complete gene sequence or a fragment thereof. A nucleic acid sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the gene sequence or a fragment thereof. A variant can be an amino acid sequence that is substantially identical over the full length of the amino acid sequence or a fragment thereof. An amino acid sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the amino acid sequence or a fragment thereof.

[0050] As used herein, “vector” may mean a nucleic acid sequence containing an origin of replication. A vector may be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. A vector may be a DNA or RNA vector. A vector may be a self-replicating extrachromosomal vector, preferably a DNA plasmid.

[0051] In the enumeration of numerical ranges as described herein, each number intervening between them is explicitly intended with the same precision. For example, in the range 6–9, the numbers 7 and 8 are intended in addition to 6 and 9, and in the range 6.0–7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly intended.

[0052] Nucleic acid molecules, antigens, and immunogenic compositions Immunogenic compositions, such as vaccines, comprising nucleic acid molecules encoding SARS-CoV-2 antigen, fragments thereof, variants thereof, or combinations thereof, are provided herein. Immunogenic compositions, such as vaccines, comprising SARS-CoV-2 antigen, fragments thereof, variants thereof, or combinations thereof, are also provided herein. Immunogenic compositions may be used to treat, prevent, and / or protect against SARS-CoV-2-based pathologies by protecting against and treating any number of strains of SARS-CoV-2. Immunogenic compositions can significantly induce an immune response in a subject to which the immunogenic composition is administered, thereby protecting against and treating SARS-CoV-2 infection.

[0053] Immunogenic compositions may be DNA vaccines, peptide vaccines, or combinations of DNA and peptide vaccines. DNA vaccines may contain nucleic acid molecules encoding the SARS-CoV-2 antigen. Nucleic acid molecules may be DNA, RNA, cDNA, their variants, their fragments, or combinations thereof. Nucleic acid molecules may also contain additional sequences encoding linker, reader, or tag sequences linked to the nucleic acid molecule encoding the SARS-CoV-2 antigen by peptide bonds. Peptide vaccines may contain SARS-CoV-2 antigen peptides, SARS-CoV-2 antigen proteins, their variants, their fragments, or combinations thereof. Combined DNA and peptide vaccines may contain the above-mentioned nucleic acid molecules encoding the SARS-CoV-2 antigen and SARS-CoV-2 antigen peptides or proteins, where the SARS-CoV-2 antigen peptide or protein and the encoded SARS-CoV-2 antigen have the same amino acid sequence.

[0054] The disclosed immunogenic compositions can induce both humoral and cellular immune responses targeting the SARS-CoV-2 antigen in subjects administered with the immunogenic compositions. The disclosed immunogenic compositions can induce neutralizing antibodies and immunoglobulin G (IgG) antibodies that are reactive with the SARS-CoV-2 spike antigen. The immunogenic compositions can also induce CD8+ and CD4+ T cell responses that are reactive with the SARS-CoV-2 antigen and produce interferon-gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), and interleukin-2 (IL-2).

[0055] An immunogenic composition can induce a humoral immune response in subjects to whom it is administered. The induced humoral immune response may be specific to the SARS-CoV-2 antigen. The induced humoral immune response may be reactive with the SARS-CoV-2 antigen. The humoral immune response can be induced by approximately 1.5 to 16 times, approximately 2 to 12 times, or approximately 3 to 10 times in subjects to whom the vaccine is administered. Humoral immune responses can be induced in vaccinated subjects by at least approximately 1.5 times, at least approximately 2.0 times, at least approximately 2.5 times, at least approximately 3.0 times, at least approximately 3.5 times, at least approximately 4.0 times, at least approximately 4.5 times, at least approximately 5.0 times, at least approximately 5.5 times, at least approximately 6.0 times, at least approximately 6.5 times, at least approximately 7.0 times, at least approximately 7.5 times, at least approximately 8.0 times, at least approximately 8.5 times, at least approximately 9.0 times, at least approximately 9.5 times, at least approximately 10.0 times, at least approximately 10.5 times, at least approximately 11.0 times, at least approximately 11.5 times, at least approximately 12.0 times, at least approximately 12.5 times, at least approximately 13.0 times, at least approximately 13.5 times, at least approximately 14.0 times, at least approximately 14.5 times, at least approximately 15.0 times, at least approximately 15.5 times, or at least approximately 16.0 times.

[0056] The humoral immune response induced by the immunogenic composition may include increased levels of neutralizing antibodies associated with the administered subject compared to the unadministered subject. These neutralizing antibodies may be specific to the SARS-CoV-2 antigen. They may also be reactive with the SARS-CoV-2 antigen. Neutralizing antibodies can provide protection and / or treatment against SARS-CoV-2 infection and its associated pathologies in subjects administered with the immunogenic composition.

[0057] The humoral immune response induced by an immunogenic composition may include increased levels of IgG antibodies associated with the administered subject compared to a subject not administered with the immunogenic composition. These IgG antibodies may be specific to the SARS-CoV-2 antigen. These IgG antibodies may be reactive with the SARS-CoV-2 antigen. The levels of IgG antibodies associated with the administered subject can be increased by approximately 1.5 to 16 times, approximately 2 to 12 times, or approximately 3 to 10 times compared to a subject not administered with the immunogenic composition. The levels of IgG antibodies associated with subjects administered the immunogenic composition were at least approximately 1.5 times, at least approximately 2.0 times, at least approximately 2.5 times, at least approximately 3.0 times, at least approximately 3.5 times, at least approximately 4.0 times, at least approximately 4.5 times, at least approximately 5.0 times, at least approximately 5.5 times, at least approximately 6.0 times, at least approximately 6.5 times, at least approximately 7.0 times, at least approximately 7.5 times, and at least approximately 8. It can be increased by 0x, at least about 8.5x, at least about 9.0x, at least about 9.5x, at least about 10.0x, at least about 10.5x, at least about 11.0x, at least about 11.5x, at least about 12.0x, at least about 12.5x, at least about 13.0x, at least about 13.5x, at least about 14.0x, at least about 14.5x, at least about 15.0x, at least about 15.5x, or at least about 16.0x.

[0058] An immunogenic composition can induce a cellular immune response in a subject to which the immunogenic composition is administered. The induced cellular immune response may be specific to the SARS-CoV-2 antigen. The induced cellular immune response may be reactive to the SARS-CoV-2 antigen. The induced cellular immune response may include inducing a CD8+ T cell response. The induced CD8+ T cell response may be reactive to the SARS-CoV-2 antigen. The induced CD8+ T cell response may be multifunctional. The induced cellular immune response may include inducing a CD8+ T cell response, in which CD8+ T cells produce interferon-gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), interleukin-2 (IL-2), or a combination of IFN-γ and TNF-α.

[0059] The induced cellular immune response may include an increased CD8+ T cell response associated with the immunogenic composition compared to the untreated subject. The CD8+ T cell response associated with the immunogenic composition can be increased by approximately 2 to 30 times, 3 to 25 times, or 4 to 20 times compared to the untreated subject. The CD8+ T cell response associated with subjects administered the immunogenic composition was at least approximately 1.5 times, at least approximately 2.0 times, at least approximately 3.0 times, at least approximately 4.0 times, at least approximately 5.0 times, at least approximately 6.0 times, at least approximately 6.5 times, at least approximately 7.0 times, at least approximately 7.5 times, at least approximately 8.0 times, at least approximately 8.5 times, at least approximately 9.0 times, at least approximately 9.5 times, at least approximately 10.0 times, at least approximately 10.5 times, at least approximately 11.0 times, at least approximately 11.5 times, at least approximately 12.0 times, and at least approximately 12 times compared to subjects not administered the immunogenic composition. It can be increased by approximately 12.5 times, at least approximately 13.0 times, at least approximately 13.5 times, at least approximately 14.0 times, at least approximately 14.5 times, at least approximately 15.0 times, at least approximately 16.0 times, at least approximately 17.0 times, at least approximately 18.0 times, at least approximately 19.0 times, at least approximately 20.0 times, at least approximately 21.0 times, at least approximately 22.0 times, at least approximately 23.0 times, at least approximately 24.0 times, at least approximately 25.0 times, at least approximately 26.0 times, at least approximately 27.0 times, at least approximately 28.0 times, at least approximately 29.0 times, or at least approximately 30.0 times.

[0060] The induced cellular immune response may include an increased frequency of CD3+CD8+ T cells that produce IFN-γ. The frequency of CD3+CD8+IFN-γ+ T cells associated with subjects treated with the immunogenic composition can be increased by at least approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold compared to subjects not treated with the immunogenic composition.

[0061] The induced cellular immune response may include an increased frequency of CD3+CD8+ T cells that produce TNF-α. The frequency of CD3+CD8+TNF-α+ T cells associated with subjects treated with the immunogenic composition can be increased by at least approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, or 14-fold compared to subjects not treated with the immunogenic composition.

[0062] The induced cellular immune response may include an increased frequency of IL-2-producing CD3+CD8+ T cells. The frequency of CD3+CD8+IL-2+ T cells associated with subjects treated with the immunogenic composition can be increased by at least approximately 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 times compared to subjects not treated with the immunogenic composition.

[0063] The induced cellular immune response may include an increased frequency of CD3+CD8+ T cells that produce both IFN-γ and TNF-α. The frequency of CD3+CD8+IFN-γ+TNF-α+ T cells associated with subjects treated with the immunogenic composition may be increased by at least approximately 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, 60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 85-fold, 90-fold, 95-fold, 100-fold, 110-fold, 120-fold, 130-fold, 140-fold, 150-fold, 160-fold, 170-fold, or 180-fold compared to subjects not treated with the immunogenic composition.

[0064] A cellular immune response induced by an immunogenic composition may include inducing a CD4+ T cell response. The induced CD4+ T cell response may be reactive with the SARS-CoV-2 antigen. The induced CD4+ T cell response may be multifunctional. The induced cellular immune response may include inducing a CD4+ T cell response, in which CD4+ T cells produce IFN-γ, TNF-α, IL-2, or a combination of IFN-γ and TNF-α.

[0065] The induced cellular immune response may include an increased frequency of CD3+CD4+ T cells that produce IFN-γ. The frequency of CD3+CD4+IFN-γ+ T cells associated with subjects treated with the immunogenic composition can be increased by at least approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold compared to subjects not treated with the immunogenic composition.

[0066] The induced cellular immune response may include an increased frequency of CD3+CD4+ T cells that produce TNF-α. The frequency of CD3+CD4+TNF-α+ T cells associated with subjects treated with the immunogenic composition can be increased by at least approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, or 22-fold compared to subjects not treated with the immunogenic composition.

[0067] The induced cellular immune response may include an increased frequency of IL-2-producing CD3+CD4+ T cells. The frequency of CD3+CD4+IL-2+ T cells associated with subjects treated with the immunogenic composition may be increased by at least approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 45-fold, 50-fold, 55-fold, or 60-fold compared to subjects not treated with the immunogenic composition.

[0068] The induced cellular immune response may include an increased frequency of CD3+CD4+ T cells that produce both IFN-γ and TNF-α. The frequency of CD3+CD4+IFN-γ+TNF-α+ associated with subjects treated with the immunogenic composition is at least approximately 2 times, 2.5 times, 3.0 times, 3.5 times, 4.0 times, 4.5 times, 5.0 times, 5.5 times, 6.0 times, 6.5 times, 7.0 times, 7.5 times, 8.0 times, 8.5 times, 9.0 times, 9.5 times, 10.0 times, 10.5 times, 11.0 times, and 11.5 times compared to subjects not treated with the immunogenic composition. It can be increased by 12.0 times, 12.5 times, 13.0 times, 13.5 times, 14.0 times, 14.5 times, 15.0 times, 15.5 times, 16.0 times, 16.5 times, 17.0 times, 17.5 times, 18.0 times, 18.5 times, 19.0 times, 19.5 times, 20.0 times, 21 times, 22 times, 23 times, 24 times, 25 times, 26 times, 27 times, 28 times, 29 times, 30 times, 31 times, 32 times, 33 times, 34 times, or 35 times.

[0069] The immunogenic composition of the present invention may possess the characteristics necessary for an effective immunogenic composition, such as being safe so as not to cause disease or death itself, being protective against diseases resulting from exposure to biological pathogens such as viruses or bacteria, inducing neutralizing antibodies to prevent cell creation, inducing protective T cells against intracellular pathogens, and providing ease of administration, few side effects, biological stability, and low cost per dose.

[0070] Immunogenic compositions can further induce an immune response when administered to different tissues, such as muscle or skin. Immunogenic compositions can further induce an immune response when administered parenterally, for example, by subcutaneous, intradermal, or intramuscular injection, as described herein, and optionally followed by electroporation.

[0071] a. SARS-CoV-2 antigen and the nucleic acid molecule encoding it As described above, immunogenic compositions comprising nucleic acid molecules encoding the SARS-CoV-2 antigen, fragments thereof, variants thereof, or combinations thereof are provided herein.

[0072] Upon binding to cell surface proteins and membrane fusions, the coronavirus enters the cell, and its single-stranded RNA genome is released into the cytoplasm of the infected cell. This single-stranded RNA genome is positive-sense and can therefore be translated into RNA polymerase, which produces further viral RNA that is negative-sense. Thus, the SARS-CoV-2 antigen can also be SARS-CoV-2 RNA polymerase.

[0073] The viral negative RNA strand is transcribed into a smaller subgenome positive RNA strand, which is used to translate other viral proteins, such as the nucleocapsid (N) protein, the envelope (E) protein, and the matrix (M) protein. Therefore, the SARS-CoV-2 antigen may include the SARS-CoV-2 nucleocapsid protein, the SARS-CoV-2 envelope protein, or the SARS-CoV-2 matrix protein.

[0074] The viral negative RNA strand can also be used to replicate the viral genome, which is bound by the nucleocapsid protein. The matrix protein, along with the spike protein, is incorporated into the endoplasmic reticulum of the infected cell. Together, the nucleocapsid protein bound to the viral genome, as well as the membrane-embedded matrix and spike proteins, sprout in the lumen of the endoplasmic reticulum, thereby enclosing the viral genome within the membrane. The viral progeny are then transported to the cell membrane of the infected cell by Golgi vesicles and released into the extracellular space by endocytosis.

[0075] Coronaviruses, including SARS-CoV-2, are encapsulated by a membrane and possess a type I membrane glycoprotein known as the spike (S) protein, which forms a spike protruding from the surface of the coronavirus. The SARS-CoV-2 S protein is a class I membrane fusion protein, the major envelope protein on the surface of the coronavirus. The spike protein facilitates the binding of the coronavirus to proteins located on the cell surface, such as metalloproteinase aminopeptidase N, mediating cell-viral membrane fusion. In particular, the spike protein contains an S1 subunit that facilitates the binding of the coronavirus to cell surface proteins. Thus, the S1 subunit of the spike protein controls which cells are infected by the coronavirus. The spike protein also contains an S2 subunit, a transmembrane subunit that facilitates viral-cell membrane fusion. Therefore, the SARS-CoV-2 antigen may include the SARS-CoV-2 spike protein, the S1 subunit of the SARS-CoV-2 spike protein, the S2 subunit of the SARS-CoV-2 spike protein, or a fragment of the S1 subunit containing the SARS-CoV-2 spike receptor binding domain.

[0076] In some embodiments, the SARS-CoV-2 antigen may be the SARS-CoV-2 spike protein, SARS-CoV-2 RNA polymerase, SARS-CoV-2 nucleocapsid protein, SARS-CoV-2 envelope protein, SARS-CoV-2 matrix protein, fragments thereof, variants thereof, or combinations thereof.

[0077] SARS-CoV-2 antigens may be SARS-CoV-2 spike antigens, fragments thereof, variants thereof, or combinations thereof. SARS-CoV-2 spike antigens can induce an immune response in mammals against one or more SARS-CoV-2 strains. SARS-CoV-2 spike antigens may contain epitopes that are particularly effective as immunogens and can induce an anti-SARS-CoV-2 immune response against them.

[0078] The SARS-CoV-2 antigen may be a consensus antigen derived from two or more strains of SARS-CoV-2. In some embodiments, the SARS-CoV-2 antigen is a SARS-CoV-2 consensus spike antigen. Since the SARS-CoV-2 consensus spike antigen may be derived from the sequence of a spike antigen from a strain of SARS-CoV-2, the SARS-CoV-2 consensus spike antigen is unique. In some embodiments, the SARS-CoV-2 consensus spike antigen may be an outlier spike antigen having a greater amino acid sequence dispersion than other SARS-CoV-2 spike proteins. Therefore, the immunogenic compositions of the present invention are broadly applicable to multiple strains of SARS-CoV-2 due to the unique sequences of the SARS-CoV-2 consensus spike antigen. These unique sequences allow the vaccine to provide universal protection against multiple strains of SARS-CoV-2, including genetically diverse variants of SARS-CoV-2. Nucleic acid molecules encoding the SARS-CoV-2 antigen can be modified for improved expression. Modifications may include codon optimization, RNA optimization, addition of a Kozak sequence for increased translation initiation, and / or addition of an immunoglobulin reader sequence to increase the immunogenicity of the SARS-CoV-2 antigen. The SARS-CoV-2 spike antigen may include an immunoglobulin signal peptide, such as, but not limited to, immunoglobulin E (IgE) or immunoglobulin (IgG) signal peptides. In some embodiments, the SARS-CoV-2 spike antigen may include a hemagglutinin (HA) tag. The SARS-CoV-2 spike antigen may be designed to induce a stronger and broader cellular and / or humoral immune response than the corresponding codon-optimized spike antigen.

[0079] In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity across the entire length of residues 19-1279 of SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity across the entire length of SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid molecule encoding the SARS-CoV-2 antigen includes a nucleotide sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the sequence described in SEQ ID NO: 2, SEQ ID NO: 2, or SEQ ID NO: 3.

[0080] In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over the entire length of residues 19-1279 of SEQ ID NO: 4. In some embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence described in residues 19-1279 of SEQ ID NO: 4. In some embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the nucleic acid molecule encoding the SARS-CoV-2 antigen has at least approximately 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity across the entire length of nucleotides 55-3837 of SEQ ID NO: 5, or across the entire length of SEQ ID NO: 5. The nucleic acid sequence having at least approximately 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity across the entire length of the nucleic acid sequence of Sequence ID No. 6, or the nucleic acid sequence of Sequence ID No. 6.

[0081] In some embodiments, the SARS-CoV-2 antigen is operably linked to an IgE reader sequence. In some such embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence described in SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen is encoded by a nucleotide sequence described in SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments where the SARS-CoV-2 antigen includes an IgE reader, the SARS-CoV-2 antigen comprises the amino acid sequence described in SEQ ID NO: 4. In some such embodiments, the SARS-CoV-2 antigen is encoded by a nucleotide sequence described in SEQ ID NO: 5 or SEQ ID NO: 6.

[0082] An immunogenic fragment of SEQ ID NO: 1 may be provided. The immunogenic fragment may contain at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 1. In some embodiments, the immunogenic fragment includes a leader sequence, such as an immunoglobulin reader, such as an IgE reader. In some embodiments, the immunogenic fragment does not include a leader sequence.

[0083] Immunogenic fragments of proteins having an amino acid sequence homologous to the immunogenic fragment of SEQ ID NO: 1 may be provided. Such immunogenic fragments may contain at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of a protein that is 95% homologous to SEQ ID NO: 1. Some embodiments relate to immunogenic fragments having 96% homology to the consensus protein sequence immunogenic fragment described herein. Some embodiments relate to immunogenic fragments having 97% homology to the consensus protein sequence immunogenic fragment described herein. Some embodiments relate to immunogenic fragments having 98% homology to the consensus protein sequence immunogenic fragment described herein. Some embodiments relate to immunogenic fragments having 99% homology to the consensus protein sequence immunogenic fragment described herein. In some embodiments, the immunogenic fragment includes a leader sequence, such as an immunoglobulin leader, such as an IgE leader. In some embodiments, the immunogenic fragment does not include a leader sequence.

[0084] Some embodiments relate to immunogenic fragments of SEQ ID NO: 1. The immunogenic fragment may be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to the fragment of SEQ ID NO: 1. The immunogenic fragment may be at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to the fragment of SEQ ID NO: 1. In some embodiments, the immunogenic fragment includes a sequence that codes for a leader sequence, such as an immunoglobulin reader, such as an IgE reader. In some embodiments, the fragment does not include a coding sequence that codes for a leader sequence.

[0085] An immunogenic fragment of SEQ ID NO: 4 may be provided. The immunogenic fragment may contain at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 4. In some embodiments, the immunogenic fragment includes a leader sequence, such as an immunoglobulin reader, such as an IgE reader. In some embodiments, the immunogenic fragment does not include a leader sequence.

[0086] Immunogenic fragments of proteins having an amino acid sequence homologous to the immunogenic fragment of SEQ ID NO: 4 may be provided. Such immunogenic fragments may contain at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of a protein that is 95% homologous to SEQ ID NO: 4. Some embodiments relate to immunogenic fragments having 96% homology to the consensus protein sequence immunogenic fragment described herein. Some embodiments relate to immunogenic fragments having 97% homology to the consensus protein sequence immunogenic fragment described herein. Some embodiments relate to immunogenic fragments having 98% homology to the consensus protein sequence immunogenic fragment described herein. Some embodiments relate to immunogenic fragments having 99% homology to the consensus protein sequence immunogenic fragment described herein. In some embodiments, the immunogenic fragment includes a leader sequence, such as an immunoglobulin leader, such as an IgE leader. In some embodiments, the immunogenic fragment does not include a leader sequence.

[0087] Some embodiments relate to immunogenic fragments of SEQ ID NO: 4. The immunogenic fragment may be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 4. The immunogenic fragment may be at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to the fragment of SEQ ID NO: 4. In some embodiments, the immunogenic fragment includes a sequence that codes for a leader sequence, such as an immunoglobulin reader, such as an IgE reader. In some embodiments, the fragment does not include a coding sequence that codes for a leader sequence.

[0088] b. Vectors An immunogenic composition may contain one or more vectors containing nucleic acid molecules encoding the SARS-CoV-2 antigen. One or more vectors may be capable of expressing the antigen. The vectors may have nucleic acid sequences containing origins of replication. The vectors may be plasmids, bacteriophages, bacterial artificial chromosomes, or yeast artificial chromosomes. The vectors may be either self-replicating extrachromosomal vectors or vectors integrated into the host genome.

[0089] One or more vectors can be expression constructs, which are typically plasmids used to introduce a specific gene into target cells. Once the expression vector enters the cell, the protein encoded by the gene is produced by the cellular transcription and translation mechanism ribosome complex. Plasmids are frequently engineered to contain regulatory sequences that act as enhancer and promoter regions, resulting in efficient transcription of the gene carried on the expression vector. The vectors of this invention express large amounts of stable messenger RNA and, therefore, proteins.

[0090] Vectors may have expression signals such as strong promoters, strong termination codons, regulation of the distance between the promoter and the cloned gene, and insertion of transcription termination sequences and PTIS (portable translation initiation sequences).

[0091] (1) Expression vector A vector can be a circular plasmid or a linear nucleic acid. Circular plasmids and linear nucleic acids can induce the expression of a specific nucleotide sequence in appropriate target cells. A vector may have a promoter operably ligated to the antigen-coding nucleotide sequence, which can be operably ligated to a termination signal. A vector may also contain sequences necessary for the proper translation of the nucleotide sequence. A vector containing the target nucleotide sequence can be a chimeric, meaning that at least one of its components is non-homologous to at least one of the other components. The expression of a nucleotide sequence in an expression cassette may be under the control of a constitutive promoter or an inductive promoter that initiates transcription only when the host cell is exposed to some specific external stimulus. In multicellular organisms, promoters may also be specific to a particular tissue or organ or developmental stage.

[0092] (2) Circular and linear vectors The vector may be a circular plasmid (e.g., an autonomous replicating plasmid with an origin of replication) that can transform target cells by integration into the cell genome or may exist outside the chromosome.

[0093] The vector may be pVAX, pcDNA3.0, pGX-0001, or Provax, or any other expression vector that expresses antigen-coding DNA and allows cells to translate the sequence into an antigen recognized by the immune system.

[0094] This specification also provides linear nucleic acid immunogenic compositions, or linear expression cassettes ("LECs"), that can be efficiently delivered to a target via electroporation and express one or more desired antigens. An LEC may be any linear DNA that lacks a phosphate backbone. The DNA may encode one or more antigens. An LEC may contain a promoter, introns, stop codons, and / or polyadenylation signals. Antigen expression may be controlled by the promoter. An LEC may not contain any antibiotic resistance genes and / or a phosphate backbone. An LEC may not contain other nucleic acid sequences not related to the expression of the desired antigen gene.

[0095] LEC can originate from any plasmid that can be linearized. Plasmids may be capable of expressing antigens. Plasmids may be pNP (Puerto Rico / 34) or pM2 (New Caledonia / 99). Plasmids may be WLV009, pVAX, pcDNA3.0, or Provax, or any other expression vector that expresses antigen-coding DNA and allows cells to translate the sequence into an antigen recognized by the immune system.

[0096] LEC can be perM2. LEC can be perNP. perNP and perMR can originate from pNP (Puerto Rico / 34) and pM2 (New Caledonia / 99), respectively.

[0097] (3) Promoter, intron, stop codon, and polyadenylation signals A vector may have a promoter. The promoter can be any promoter capable of driving gene expression and regulating the expression of an isolated nucleic acid. Such a promoter is a cis-acting sequence element required for transcription via DNA-dependent RNA polymerase, which transcribes the antigen sequences described herein. The choice of promoter used to induce the expression of heterologous nucleic acids depends on the specific application. The promoter may be located at approximately the same distance from the transcription start site in the vector as it is at its native setting. However, variations in this distance can be accommodated without loss of promoter function.

[0098] The promoter can be operably linked to nucleic acid sequences that encode signals necessary for efficient polyadenylation of antigens and transcripts, ribosome binding sites, and translation termination. The promoter may be the CMV promoter, SV40 early promoter, SV40 late promoter, metallothionein promoter, mouse mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or another promoter that has been shown to be effective for expression in eukaryotic cells.

[0099] The vector may contain enhancers, as well as introns having functional splice donor and acceptor sites. The vector may also contain a transcription termination region downstream of the structural gene to provide efficient termination. The termination region may be derived from the same gene as the promoter sequence, or from a different gene.

[0100] c. Excipients and other components of immunogenic compositions The immunogenic composition may further contain pharmaceutically acceptable excipients. These pharmaceutically acceptable excipients may be functional molecules such as vehicles, carriers, buffers, or diluents. As used herein, “buffer” refers to a buffer solution that resists changes in pH due to the action of its acid-base conjugate component. Buffers generally have a pH of about 4.0 to about 8.0, for example, about 5.0 to about 7.0. In some embodiments, the buffer is physiological saline-sodium citrate (SSC) buffer. In some embodiments where the immunogenic composition contains a nucleic acid molecule encoding the SARS-CoV-2 spike antigen as described above, the immunogenic composition contains, for example, 10 mg / ml of the vector in the buffer, but not limited to SSC buffer. In some embodiments, the immunogenic composition contains 10 mg / mL of the DNA plasmid pGX9501 or pGX9503 in the buffer. In some embodiments, the immunogenic composition is stored at about 2°C to about 8°C. In some embodiments, the immunogenic composition is stored at room temperature. The immunogenic composition can be stored at room temperature for at least one year. In some embodiments, the immunogenic composition is stable at room temperature for at least one year, and stability is defined as a percentage of at least about 80% supercoiled plasmid. In some embodiments, the percentage of supercoiled plasmid is at least about 85% after storage at room temperature for at least one year.

[0101] Pharmaceutically acceptable excipients may be transfection promoters, which may include surfactants such as immunostimulatory complexes (ISCOMS), Freund's incomplete adjuvants, LPS analogs including monophosphoryl lipid A, muramil peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection promoters.

[0102] The transfection promoter may be a polyanion, polycation, or lipid, including poly-L-glutamic acid (LGS). The transfection promoter is poly-L-glutamic acid, which may be present in the immunogenic composition at a concentration of less than 6 mg / ml. The transfection promoter may also include surfactants, e.g., immunostimulatory complexes (ISCOMS), Freund's incomplete adjuvants, LPS analogs including monophosphoryl lipid A, muramyl peptides, quinone analogs, and vesicles, e.g., squalene and squalene, and hyaluronic acid may also be used in combination with gene constructs. DNA plasmid immunogenic compositions may also contain liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection accelerators, including other liposomes known in the art, such as transfection accelerators such as lipids, lecithin liposomes, or DNA-liposome mixtures (see, for example, WO9324640). The transfection accelerators are polyanions, polycations, or lipids, including poly-L-glutamic acid (LGS). The concentration of the transfection agent in the immunogenic composition is less than 4 mg / ml, less than 2 mg / ml, less than 1 mg / ml, less than 0.750 mg / ml, less than 0.500 mg / ml, less than 0.250 mg / ml, less than 0.100 mg / ml, less than 0.050 mg / ml, or less than 0.010 mg / ml.

[0103] Pharmacokinetically acceptable excipients may be adjuvants. Adjuvants may be other genes expressed in alternative plasmids or delivered as proteins in combination with the plasmids in immunogenic compositions. Adjuvants may be selected from the group consisting of α-interferon (IFN-α), β-interferon (IFN-β), γ-interferon, platelet-derived growth factor (PDGF), TNFα, TNFβ, GM-CSF, epidermal growth factor (EGF), cutaneous T cell-inducing chemokines (CTACK), epithelial thymic expression chemokines (TECK), mucosa-associated epithelial chemokines (MEC), IL-12, IL-15, MHC, CD80, and CD86, which contains IL-15 with a deleted signal sequence and optionally a signal peptide from IgE. The adjuvant may be IL-12, IL-15, IL-28, CTACK, TECK, platelet-derived growth factor (PDGF), TNFα, TNFβ, GM-CSF, epidermal growth factor (EGF), IL-1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, or a combination thereof.

[0104] Other genes that may be useful as adjuvants include those encoding: MCP-1, MIP-1a, MIP-1p, IL-8, RANTES, L-selectin, P-selectin, E-selectin, CD34, GlyCAM-1, MadCAM-1, LFA-1, VLA-1, Mac-1, p150.95, PECAM, ICAM-1, ICAM-2, ICAM-3, CD2, LFA-3, M-CSF, G-CSF, IL-4, variant forms of IL-18, CD40, CD40L , vascular growth factor, fibroblast growth factor, IL-7, IL-22, nerve growth factor, vascular endothelial growth factor, Fas, TNF receptor, Flt, Apo-1, p55, WSL-1, DR3, TRAMP, Apo-3, AIR, LARD, NGRF, DR4, DR5, KILLER, TRAIL-R2, TRICK2, DR6, caspase ICE, Fos, c-jun, Sp-1, Ap-1, Ap-2, p38, p65Rel, MyD88, IRAK, TRAF6, IkB, inactive NIK, SAP K, SAP-1, JNK, interferon-responsive genes, NFκB, Bax, TRAIL, TRAILrec, TRAILrecDRC5, TRAIL-R3, TRAIL-R4, RANK, RANK ligand, Ox40, Ox40 ligand, NKG2D, MICA, MICB, NKG2A, NKG2B, NKG2C, NKG2E, NKG2F, TAP1, TAP2, and their functional fragments.

[0105] The immunogenic composition may further comprise a gene vaccine enhancer described in U.S. Patent Application No. 021,579, filed April 1, 1994, which is fully incorporated by reference.

[0106] Immunogenic compositions can be formulated according to the method of administration used. According to some embodiments, immunogenic compositions are formulated in a buffer, optionally in saline-sodium citrate buffer. For example, an immunogenic composition may be formulated at a concentration of 10 mg of nucleic acid molecules per 1 ml of sodium citrate buffer. Injectable immunogenic pharmaceutical compositions may be sterile, pyrogen-free, and particle-free. Isotonic formulations or solutions may be used. Additives for isotonicity may include chloride, dextrose, mannitol, sorbitol, and lactose. Immunogenic compositions may contain vasoconstrictors. Isotonic solutions may include phosphate-buffered saline. Immunogenic compositions may further contain stabilizers, including gelatin and albumin. Stabilizers may allow formulations containing LGS or polycations or polyanions to be stable for extended periods at room temperature or ambient temperature.

[0107] A manufactured article containing an immunogenic composition is also provided herein. In some embodiments, the manufactured article is a container for holding the immunogenic composition. The container may be, for example, a syringe or a vial, but is not limited to these. The vial may have a stopper that can be penetrated by the syringe.

[0108] The immunogenic composition may be packaged in either multiple doses or single dosage forms in preferably sterile containers such as ampoules, bottles, or vials. The containers are preferably sealed after being filled with the vaccine preparation. Preferably, the vaccine is packaged in a container with a label that identifies the vaccine and has a notice in the format prescribed by a government agency such as the U.S. Food and Drug Administration, reflecting the approval of the vaccine under applicable law, dosage information, etc. The label preferably contains information about the vaccine that is useful to healthcare workers administering the vaccine to patients. The package also preferably includes printed informational material regarding the administration of the vaccine, instructions, indications, and any necessary and required warnings.

[0109] Vaccination methods Furthermore, the Specified Provisions Provide a method for treating, protecting against, and / or preventing a disease in subjects that need to be treated, protected against, and / or prevented by administering an immunogenic composition to them. Administration of an immunogenic composition to a subject can induce or elicit an immune response in the subject. The induced immune response can be used to treat, prevent, and / or protect against a disease, for example, a pathogen associated with SARS-CoV-2 infection. The induced immune response in a subject administered an immunogenic composition can provide resistance to one or more SARS-CoV-2 strains.

[0110] The induced immune response may include an induced humoral immune response and / or an induced cellular immune response. The humoral immune response can be induced by approximately 1.5 to 16 times, approximately 2 to 12 times, or approximately 3 to 10 times. The induced humoral immune response may include IgG antibodies and / or neutralizing antibodies that are reactive to the antigen. The induced cellular immune response may include a CD8+ T cell response, which can be induced by approximately 2 to 30 times, approximately 3 to 25 times, or approximately 4 to 20 times.

[0111] The vaccine dose may be 1 μg to 10 mg of active ingredient per kg of body weight per dose, or 20 μg to 10 mg of active ingredient per kg of body weight per dose. The vaccine can be administered every 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 days or more, or every 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 weeks or more. The number of vaccine doses for effective treatment may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 doses or more.

[0112] In one embodiment, the total vaccine dose is 1.0 mg of nucleic acid. In another embodiment, the total vaccine dose is 2.0 mg of nucleic acid, administered as 2 × 1.0 mg of nucleic acid.

[0113] a. Administration Immunogenic compositions can be formulated according to standard techniques well known to those skilled in the art in the pharmaceutical field. Such compositions can be administered by dosages and techniques well known to those skilled in the art in the medical field, taking into account factors such as the age, sex, weight, and condition of a particular subject, as well as the route of administration. Vaccines may be administered, for example, in one, two, three, four, or more injections. In some embodiments, an initial dose of nucleic acid molecules of about 0.5 mg to about 2.0 mg is administered to the subject. The initial dose may be administered in one, two, three, or more injections. Following the initial dose, subsequent doses of nucleic acid molecules of about 0.5 mg to about 2.0 mg may be administered in one, two, three, or more injections, about one, two, three, four, or more times, about one, two, three, four, or more weeks after the previous dose. Each subsequent dose may be administered in one, two, three, or more injections. In some embodiments, the immunogenic composition is administered to the subject before, with, or after additional drugs. In some embodiments, the immunogenic composition is administered as a booster after administration of an agent for the treatment of SARS-CoV-2 infection, or an agent for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection. In one embodiment, the disease or disorder associated with SARS-CoV-2 infection includes, but is not limited to, coronavirus disease 2019 (COVID-19). In some embodiments, the disease or disorder associated with SARS-CoV-2 infection is adult multisystem inflammatory syndrome (MIS-A) or pediatric multisystem inflammatory syndrome (MIS-C).

[0114] The subjects may be mammals, such as humans, horses, non-human primates, cattle, pigs, sheep, cats, dogs, guinea pigs, rabbits, rats, or mice.

[0115] Vaccines can be administered prophylactically or therapeutically. In prophylactic administration, the vaccine can be administered in a sufficient amount to induce an immune response. In therapeutic use, the vaccine is administered to the target in need in a sufficient amount to induce a therapeutic effect. The amount sufficient to achieve this is defined as the "therapeutic effective dose." The effective dose for this use will depend, for example, on the specific composition of the vaccine regimen being administered, the method of administration, the stage and severity of the disease, the patient's general health condition, and the judgment of the prescribing physician.

[0116] Vaccines can be administered by methods well known in the art, such as those described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)), Felgner et al. (U.S. Patent No. 5,580,859, issued December 3, 1996), Felgner (U.S. Patent No. 5,703,055, issued December 30, 1997), and Carson et al. (U.S. Patent No. 5,679,647, issued October 21, 1997), all of which are incorporated herein by reference in their entirety. The vaccine DNA can be compounded into particles or beads that can be administered to an individual, for example, using a vaccine gun. Those skilled in the art will know that the selection of a pharmaceutically acceptable carrier containing physiologically acceptable compounds depends, for example, on the route of administration of the expression vector.

[0117] Vaccines can be delivered via a variety of routes. Typical delivery routes include parenteral administration, such as intradermal, intramuscular, or subcutaneous delivery. Other routes include oral, intranasal, and intravaginal routes. In particular, for vaccine DNA, the vaccine can be delivered into the interstitial space of the tissues of an individual (Felgner et al., U.S. Patent Nos. 5,580,859 and 5,703,055 (all of which are incorporated herein by reference in their entirety)). Vaccines may also be administered intramuscularly, or via intracutaneous or subcutaneous injection, or percutaneously, for example, by iontophoresis. Epidermal delivery of vaccines can also be used. Epidermal delivery may include mechanically or chemically stimulating the outermost layer of the epidermis to promote an immune response to the irritant (Carson et al., U.S. Patent No. 5,679,647 (all of which are incorporated herein by reference in their entirety)). Optionally following parenteral delivery, electroporation may be performed as described herein.

[0118] Vaccines can also be formulated for administration via the nasal cavity. Formulations suitable for nasal administration, where the carrier is solid, may include, for example, a coarse powder having a particle size in the range of about 10 to about 500 microns, which is administered by olfactory means, i.e., by rapid inhalation through the nasal cavity from a container of powder held near the nose. Formulations may be nasal sprays, nasal drops, or by aerosol administration via nebulizer. Formulations may include aqueous or oily solutions of the vaccine.

[0119] Vaccines may be liquid preparations such as suspensions, syrups, or elixirs. Vaccines may also be preparations for parenteral, subcutaneous, intradermal, intramuscular, or intravenous administration (e.g., injectable administration), such as sterile suspensions or emulsions.

[0120] Vaccines can be incorporated into liposomes, microspheres, or other polymer matrices (Felgner et al., U.S. Patent No. 5,703,055; Gregoriadis, Liposome Technology, Vols. I to III (2nd edition 1993), the contents of which are incorporated herein by reference in their entirety). Liposomes may consist of phospholipids or other materials and may be non-toxic, physiologically acceptable, and metabolizable carriers that are relatively easy to produce and administer.

[0121] The vaccine may be administered via electroporation, for example, by the method described in U.S. Patent No. 7,664,545, the details of which are incorporated herein by reference. Electroporation may be carried out by the methods and / or apparatus described in U.S. Patents No. 6,302,874, No. 5,676,646, No. 6,241,701, No. 6,233,482, No. 6,216,034, No. 6,208,893, No. 6,192,270, No. 6,181,964, No. 6,150,148, No. 6,120,493, No. 6,096,020, No. 6,068,650, and No. 5,702,359, the details of which are incorporated herein by reference in their entirety. Electroporation can be performed using minimally invasive devices.

[0122] Minimally invasive electroporation devices ("MIDs") may be devices for injecting the aforementioned vaccines and associated fluids into body tissues. The device may comprise a hollow needle, a DNA cassette, and a fluid delivery means, and the device is adapted to activate the fluid delivery means in use to simultaneously (e.g., automatically) inject the DNA into the body tissue while the needle is inserted. This has the advantage that the ability to gradually inject the DNA and associated fluids while the needle is inserted leads to a more even distribution of the fluids through the body tissue. Pain experienced during injection may be mitigated due to the distribution of DNA injected over a larger area.

[0123] MIDs may inject vaccines into tissue without the use of needles. MIDs can inject vaccines as a small flow or jet with a force that penetrates the surface of the tissue and enters the underlying tissue and / or muscle. The force behind the small flow or jet may be provided by expanding a compressed gas, such as carbon dioxide, through a microorifice in fractions of a second. Examples of minimally invasive electroporation devices and methods of using them are described in published U.S. Patent Application No. 2008 / 0234655, U.S. Patents No. 6,520,950, No. 7,171,264, No. 6,208,893, No. 6,009,347, No. 6,120,493, No. 7,245,963, No. 7,328,064, and No. 6,763,264, the contents of each of these are incorporated herein by reference.

[0124] The MID may include an injector that produces a high-speed jet of fluid that penetrates tissue painlessly. Such needle-free injectors are commercially available. Examples of needle-free injectors available herein include those described in U.S. Patents 3,805,783, 4,447,223, 5,505,697, and 4,342,310, the contents of which are incorporated herein by reference.

[0125] A desired vaccine in a form suitable for direct or indirect electrotransport can typically be introduced (e.g., injected) into the tissue to be treated using a needle-free injector, by bringing the tissue surface into contact with the injector with sufficient force to cause the vaccine to penetrate the tissue. For example, if the tissue to be treated is mucous membrane, skin, or muscle, the drug is fired toward the mucous membrane or skin surface with sufficient force to penetrate through the stratum corneum into the dermis, or into the underlying tissue and muscle, respectively.

[0126] Needle-free injectors are suitable for delivering vaccines to all types of tissues, particularly skin and mucous membranes. In some embodiments, needle-free injectors can be used to propel a vaccine-containing liquid onto a surface and the target skin or mucous membrane. Representative examples of various types of tissues that can be treated using the methods of the present invention include the pancreas, larynx, nasopharynx, sublingual, oropharyngeal, lips, throat, lungs, heart, kidneys, muscles, breasts, colon, prostate, thymus, testes, skin, mucous membrane tissue, ovaries, blood vessels, or any combination thereof.

[0127] MIDs may have needle electrodes for electroporating tissue. By generating pulses between multiple electrode pairs in a multi-electrode array, for example, set in a rectangular or square pattern, improved results are provided compared to generating pulses between a single electrode. For example, disclosed in U.S. Patent No. 5,702,359, entitled "Needle Electrodes for Mediated Delivery of Drugs and Genes," is a needle array in which multiple pairs of needles can be pulsed during therapeutic treatment. In that application, which is fully described by reference and incorporated herein, the needles are arranged in a circular array, but have connectors and switching devices that enable pulse generation between opposing pairs of needle electrodes. A pair of needle electrodes may be used for delivering recombinant expression vectors to cells. Such devices and systems are described in U.S. Patent No. 6,763,264, which is incorporated herein by reference. Alternatively, a single-needle device similar to a conventional hypodermic needle could be used to enable DNA injection and electroporation, applying pulses at a lower voltage than those delivered by currently used devices, thus reducing the electrical sensation experienced by the patient.

[0128] A MID may include one or more electrode arrays. The array may include two or more needles of the same or different diameters. The needles may be spaced evenly or unevenly. The needles may be spaced 0.005 inches to 0.03 inches, 0.01 inches to 0.025 inches, or 0.015 inches to 0.020 inches. The needles may be 0.0175 inches in diameter. The needles may be spaced 0.5 mm, 1.0 mm, 1.5 mm, 2.0 mm, 2.5 mm, 3.0 mm, 3.5 mm, 4.0 mm, or more.

[0129] A MID may consist of a pulse generator and two or more needle vaccine injectors that deliver vaccine and electroporation pulses in a single step. The pulse generator may allow for flexible programming of pulses and injection parameters, as well as comprehensive recording and storage of electroporation and patient data, via a personal computer operated by a flashcard. The pulse generator can deliver various volt pulses in a short period of time. For example, the pulse generator can deliver three 15-volt pulses with a duration of 100 milliseconds. An example of such a MID is the Ergen 1000 system by Inovio Biomedical Corporation, which is described in U.S. Patent No. 7,328,064, which is incorporated herein by reference.

[0130] The MID may be the CELLECTRA® (Inovio Pharmaceuticals, Blue Bell PA) device and system, a modular electrode system that facilitates the introduction of macromolecules such as DNA into cells of selected tissues in the body or plants. The modular electrode system may include multiple needle electrodes, subcutaneous needles, electrical connectors providing conductive links from a programmable constant-current pulse controller to the multiple needle electrodes, and a power supply. An operator can grasp the multiple needle electrodes mounted on a support structure and firmly insert them into selected tissue in a living organism or plant. The macromolecule is then delivered to the selected tissue via the subcutaneous needles. The programmable constant-current pulse controller is activated, and a constant-current electrical pulse is applied to the multiple needle electrodes. The applied constant-current electrical pulse facilitates the introduction of the macromolecule into cells between the multiple electrodes. Cell death due to overheating of cells is minimized by limiting the power consumption within the tissue with the constant-current pulse. The Cellectra® device and system is described in U.S. Patent No. 7,245,963, the details of which are incorporated herein by reference. A CELLECTRA® device may be a CELLECTRA 2000® device or a CELLECTRA® 3PSP device.

[0131] The MID may be the Ergen 1000 system (Inovio Pharmaceuticals). The Ergen 1000 system may include a device providing a hollow needle and a fluid delivery means, wherein the device is adapted to activate the fluid delivery means in use to simultaneously (e.g., automatically) inject the fluid, which is the vaccine described herein, into the body tissue while the needle is inserted into the body tissue. The advantage is that the fluid can be injected gradually while the needle is inserted, leading to a more even distribution of the fluid through the body tissue. Also, the pain experienced during injection is thought to be reduced by the distribution of the volume of fluid injected over a larger area.

[0132] In addition, automatic fluid injection facilitates the automatic monitoring and registration of the actual amount of fluid injected. This data can be stored by the control unit for documentation purposes, if necessary.

[0133] The injection rate can be either linear or nonlinear, and it is understood that the injection may occur after the needle has been inserted through the skin of the target to be treated, and while it is further inserted into the body tissue.

[0134] Suitable tissues into which the fluid can be injected by the apparatus of the present invention include tumor tissue, skin, or liver tissue, but may also be muscle tissue.

[0135] This device further includes needle insertion means for guiding the insertion of a needle into body tissue. The fluid injection rate is controlled by the needle insertion rate. This has the advantage of controlling both the needle insertion and injection of the injectable fluid, allowing the insertion rate to be matched to the injection rate as needed. It also makes it easier for the user to operate the device. Means for automatically inserting the needle into body tissue can be provided as needed.

[0136] The user can choose when to begin injecting the fluid. However, ideally, the injection should begin when the tip of the needle reaches the muscle tissue, and the device may include means for sensing when the needle has been inserted deep enough for the injection to begin. This means that the device can prompt the user to automatically begin injecting the fluid when the needle reaches the desired depth (usually the depth to which muscle tissue begins). The depth to which muscle tissue begins can be a preset needle insertion depth, such as 4 mm, which is considered sufficient for the needle to pass through the skin layer.

[0137] The sensing means may include an ultrasonic probe. The sensing means may include means for detecting changes in impedance or resistance. In this case, the means may be adapted to sense changes in impedance or resistance as the needle moves from different types of body tissue to muscle, rather than recording the depth of the needle in body tissue. Both of these alternatives provide a relatively accurate and simple means of operation for the sensing means from which injection can be initiated. The depth of needle insertion can be further recorded as needed and used to control fluid injection so that the volume of fluid to be injected is determined while the depth of needle insertion is being recorded.

[0138] The device may further comprise a base for supporting a needle and a housing for receiving the base, wherein the base is movable relative to the housing, so that the needle is retracted into the housing when the base is in a first rearward position relative to the housing, and extends out of the housing when the base is in a second forward position within the housing. This is advantageous to the user because the housing can be positioned on the patient's skin, and then the needle can be inserted into the patient's skin by moving the housing relative to the base.

[0139] As described above, it is desirable to achieve controlled-rate fluid injection so that the fluid is uniformly distributed over the entire length of the needle as it is inserted into the skin. The fluid delivery means may include a piston drive means adapted to inject fluid at a controlled rate. The piston drive means can be actuated, for example, by a servo motor. However, the piston drive means can be actuated by a base that moves axially relative to the housing. It will be understood that alternative means of fluid delivery may be provided. For example, a closed container that can be squeezed for fluid delivery at a controlled or uncontrolled rate can be provided instead of a syringe and piston system.

[0140] The apparatus described above can be used for any type of injection. However, it is considered particularly useful in the field of electroporation, and therefore it may further include means for applying a voltage to the needle. This allows the needle to be used not only for injection but also as an electrode in electroporation. This is particularly advantageous because it means that the electric field is applied to the same area as the injected fluid. Conventionally, electroporation has had the problem that it is very difficult to precisely align the electrode with the previously injected fluid, so users tend to inject more fluid than necessary in a larger area and try to apply the electric field to a higher area to ensure overlap between the injected material and the electric field. Using the present invention, it is possible to achieve a good fit between the electric field and the fluid while reducing both the volume of the injected fluid and the magnitude of the applied electric field.

[0141] Combined use In some embodiments, the present invention provides methods for treating SARS-CoV-2 infection or treating, protecting against, and / or preventing a disease or disorder associated with SARS-CoV-2 infection in subjects requiring such treatment, or in combination with one or more additional agents for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection. In some embodiments, the disease or disorder associated with SARS-CoV-2 infection is coronavirus disease 2019 (COVID-19), adult multisystem inflammatory syndrome (MIS-A), or pediatric multisystem inflammatory syndrome (MIS-C).

[0142] Nucleic acid molecules encoding the SARS-CoV-2 antigen and additional drugs may be administered by any preferred method such that both the combination of the SARS-CoV-2 antigen and the additional drug-encoding nucleic acid molecules are present in the target. In one embodiment, the method may include administering a first composition comprising an agent for the treatment of SARS-CoV-2 infection, or for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, and administering a second composition comprising a nucleic acid molecule encoding the SARS-CoV-2 antigen less than 1 day, less than 2 days, less than 3 days, less than 4 days, less than 5 days, less than 6 days, less than 7 days, less than 8 days, less than 9 days, or less than 10 days after the administration of the first composition comprising an agent for the treatment of SARS-CoV-2 infection, or for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection. In one embodiment, the method may include administering a first composition containing a nucleic acid molecule encoding the SARS-CoV-2 antigen, and administering a second composition containing an agent for the treatment or prevention of SARS-CoV-2 infection, or a disease or disorder associated with SARS-CoV-2 infection, less than 1 day, less than 2 days, less than 3 days, less than 4 days, less than 5 days, less than 6 days, less than 7 days, less than 8 days, less than 9 days, or less than 10 days after administration of the nucleic acid molecule encoding the SARS-CoV-2 antigen. In one embodiment, the method may include the simultaneous administration of a first composition containing an agent for the treatment or prevention of SARS-CoV-2 infection, or a disease or disorder associated with SARS-CoV-2 infection, and a second composition containing a nucleic acid molecule encoding the SARS-CoV-2 antigen. In one embodiment, the method may include the administration of a single composition containing an agent for the treatment or prevention of SARS-CoV-2 infection, or a disease or disorder associated with SARS-CoV-2 infection, and a nucleic acid molecule encoding the SARS-CoV-2 antigen.

[0143] In some embodiments, the agent for treating SARS-CoV-2 infection, or for treating or preventing a disease or disorder associated with SARS-CoV-2 infection, is a therapeutic agent. In one embodiment, the therapeutic agent is an antiviral agent. In one embodiment, the therapeutic agent is an antibiotic agent.

[0144] Non-limiting examples of antibiotics that can be used in combination with the nucleic acid molecule encoding the SARS-CoV-2 antigen of the present invention include aminoglycosides (e.g., gentamicin, amikacin, tobramycin), quinolones (e.g., ciprofloxacin, levofloxacin), cephalosporins (e.g., ceftazidime, cefepime, cefoperazone, cefpirome, ceftoviprole), anti-Pseudomonas penicillins: carboxypenicillins (e.g., carbenicillin and ticarcillin) and ureidopenicillins (e.g., mezlocillin, azlocillin, and piperacillin), carbapenems (e.g., meropenem, imipenem, doripenem), polymyxins (e.g., polymyxin B and colistin), and monobactams (e.g., aztreonam).

[0145] Administration as a booster In one embodiment, the immunogenic composition is administered as a booster vaccine after administration of an initial agent or vaccine for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including but not limited to COVID-19, adult multisystem inflammatory syndrome (MIS-A), or pediatric multisystem inflammatory syndrome (MIS-C). In one embodiment, the booster vaccine is administered at least once, at least twice, at least three times, at least four times, or at least five times after administration of an initial agent or vaccine for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including but not limited to SARS-CoV-2 infection, including COVID-19, adult multisystem inflammatory syndrome (MIS-A), or pediatric multisystem inflammatory syndrome (MIS-C). In one embodiment, the booster vaccine is administered at least 8 hours, at least 12 hours, at least 16 hours, at least 20 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 months, at least 6 months, at least 10 months, at least 11 months, at least 1 year, or more than 1 year after administration of an initial drug or vaccine for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including, but not limited to, COVID-19, adult multisystem inflammatory syndrome (MIS-A), or pediatric multisystem inflammatory syndrome (MIS-C).

[0146] Use in assays In some embodiments, the nucleic acid molecules or encoded antigens of the present invention can be used in assays in vivo or in vitro. In some embodiments, the nucleic acid molecules or encoded antigens can be used in assays to detect the presence of anti-SARS-CoV-2 spike antibodies. Exemplary assays in which nucleic acid molecules or encoded antigens may be incorporated include, but are not limited to, immunohistochemical assays, immunocytochemical assays, ELISAs, capture ELISAs, enzyme-linked immunospot (ELISpot) assays, sandwich assays, enzyme immunoassays, radioimmunoassays, and fluorescence immunoassays. All of these are known to those skilled in the art. See, for example, Harlow et al., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York, and Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY.

[0147] In one embodiment, the SARS-CoV-2 spike antigen or fragment thereof of the present invention can be used in an assay for intracellular cytokine staining combined with flow cytometry to evaluate the T cell immune response. This assay allows for the simultaneous evaluation of multiple phenotypic, differentiation, and functional parameters associated with responding T cells, particularly the expression of multiple effector cytokines. These attributes make it a particularly suitable technique for evaluating the T cell immune response induced by the vaccine of the present invention.

[0148] In one embodiment, the SARS-CoV-2 spike antigen or fragment thereof of the present invention can be used in the ELIspot assay. The ELIspot assay is a highly sensitive immunoassay that measures the frequency of cytokine-secreting cells at the single-cell level. In this assay, cells are cultured on a surface coated with a specific capture antibody, either in the presence or absence of a stimulus. In one embodiment, the SARS-CoV-2 spike antigen or fragment thereof of the present invention can be used as a stimulus in the ELIspot assay.

[0149] Diagnostic methods In some embodiments, the present invention relates to a method for diagnosing a subject as having a SARS-CoV-2 infection or having SARS-CoV-2 antibodies. In some embodiments, the method includes contacting a sample derived from the subject with cells containing the SARS-CoV-2 antigen of the present invention or a nucleic acid molecule for the expression of the SARS-CoV-2 antigen, and detecting the binding of an anti-SARS-CoV-2 spike antibody to the SARS-CoV-2 antigen of the present invention. In such embodiments, the binding of an anti-SARS-CoV-2 spike antibody present in the subject's sample to the antigen of the present invention or a fragment thereof would indicate that the subject is currently or previously infected with SARS-CoV-2.

[0150] Kits and manufactured articles This specification provides a kit that can be used to treat a subject using the vaccination method described above. This kit may contain an immunogenic composition as described herein.

[0151] The kit may also include instructions for carrying out the vaccination method described above and / or instructions for using the kit. Instructions included in the kit may be affixed to the packaging material or included as accompanying documentation. Instructions are typically, but are not limited to, materials or printed matter. Any medium capable of storing instructions and communicating them to end users is contemplated in this disclosure. Such mediums include, but are not limited to, electronic storage media (e.g., magnetic disks, tapes, cartridges), optical media (e.g., CD-ROMs), etc. As used herein, the term “instructions” may include the address of an internet site providing the instructions.

[0152] Further inventions relating to manufactured articles containing the immunogenic compositions described herein are provided herein. In some embodiments, the manufactured article is a container, for example, a vial, optionally a disposable vial. In one embodiment, the manufactured article is a disposable glass vial with a stopper containing the immunogenic composition described herein to be administered. In some embodiments, the vial includes a stopper that can be penetrated by a syringe, and a seal. In some embodiments, the manufactured article is a syringe.

[0153] The present invention has multiple embodiments, which are illustrated by the following non-limiting examples. [Examples]

[0154] Example 1 material and method: Cell lines. Human embryonic kidney (HEK)-293T (ATCC® CRL-3216®) and African green monkey kidney COS-7 (ATCC® CRL-1651®) cell lines were obtained from ATCC (Old Town Manassas, VA). All cell lines were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin.

[0155] In vitro protein expression (Western blot). Human embryonic kidney cells, 293T, were cultured and transfected as previously described (Yan, et al. Enhanced cellular immune responses elicited by an engineered HIV-1 subtype B consensus-based envelope DNA vaccine. Mol Ther. 2007;15(2):411-421). 293T cells were transfected with pDNA using TurboFectin 8.0 (OriGene) transfection reagent according to the manufacturer's protocol. After 48 hours, cell lysates were collected using modified RIPA cell lysis buffer. Proteins were isolated on 4–12% bis-tris gel (ThermoFisher Scientific). Post-transfer, blots were incubated with anti-SARS-CoV spike protein polyclonal antibody (Novus Biologicals) and then visualized with horseradish peroxidase (HRP) conjugated anti-mouse IgG (GE Amersham).

[0156] Immunofluorescence of transfected 293T cells. For in vitro staining of spike protein expression, 293T cells were cultured on 4-well glass slides (Lab-Tek) and transfected with 3 μg / well pDNA using TurboFectin 8.0 (OriGene) transfection reagent according to the manufacturer's protocol. Cells were fixed at room temperature (RT) for 10 minutes 48 hours after transfection with 10% neutral buffered formalin (BBC Biochemical, Washington State), and then washed with PBS. Before staining, chamber slides were blocked at room temperature for 1 hour in PBS with 0.3% (v / v) Triton-X (Sigma) and 2% (v / v) donkey serum. Cells were stained at room temperature for 2 hours with 1% (w / v) BSA (Sigma), 2% (v / v) donkey serum, 0.3% (v / v) Triton-X (Sigma), and rabbit anti-SARS-CoV spike protein polyclonal antibody (Novus Biologicals) diluted in 0.025% (v / v) 1 g / ml sodium azide (Sigma) in PBS. Slides were washed three times in PBS for 5 minutes each, and then stained with donkey anti-rabbit IgG AF488 (Life Technologies, A21206) at room temperature for 1 hour. Slides were washed again, mounted, and covered with DAPI-Fluoromount (SouthernBiotech).

[0157] In vitro RNA expression (qRT-PCR). In vitro mRNA expression of plasmids was demonstrated by reverse transcription and analysis of total RNA extracted from cells using PCR after transfection with COS-7 using serially diluted plasmids. Transfection with four concentrations of plasmids was performed using FuGENE® 6 transfection reagent (Promega), with final masses ranging from 80 to 10 ng / well. Transfection was performed in duplicate. After 18-26 hours of incubation, cells were lysed with RLT buffer (Qiagen). Total RNA was isolated from each well using the Qiagen RNeasy kit according to the kit instructions. The obtained RNA concentrations were measured using OD. 260 / 280The RNA sample was determined and diluted to 10 ng / μL. Then, 100 nanograms of RNA were converted to cDNA using a high-volume cDNA reverse transcription (RT) kit (Applied Biosystems) according to the kit instructions. An RT reaction containing RNA but without reverse transcriptase (minus RT) was included as a control for plasmid DNA or cellular genomic DNA contamination. Next, 8 μL of sample cDNA was subjected to PCR using primers and probes specific to the target sequences (pGX9501 forward-CAGGACAAGAACACACAGGAA (SEQ ID NO: 7); pGX9501 reverse-CAGGCAGGATTTGGGAGAAA (SEQ ID NO: 8); pGX9501 probe-ACCCATCAAGGACTTTGGAGG (SEQ ID NO: 9); and pGX9503 forward-AGGACAAGAACACACAGGAAG (SEQ ID NO: 10); pGX9503 reverse-CAGGATCTGGGAGAAGTTGAAG (SEQ ID NO: 11); pGX9503 probe-ACACCACCCATCAAGGACTTTGGA (SEQ ID NO: 12)). In another reaction, the same amount of sample cDNA was subjected to PCR using primers and probes designed for the β-actin sequences of the COS-7 cell line (β-actin forward - GTGACGTGGACATCCGTAAA (SEQ ID NO: 13); β-actin reverse - CAGGGCAGTAATCTCCTTCTG (SEQ ID NO: 14); β-actin probe - TACCCTGGCATTGCTGACAGGATG (SEQ ID NO: 15)). The primers and probes were synthesized by Integrated DNA Technologies, Inc., and the probes were labeled with 56-FAM and Black Hole Quencher 1. The reaction was performed using ABI Fast Advance 2X (catalog no. 4444557) at a final forward and reverse primer concentration of 1 μM, and a probe concentration of 0.3 μM.Using the QuantStudio® 7 Flex Real Time PCR Studio System (Applied Biosystems), samples were first subjected to a 1-minute retention period at 95°C, followed by 40 PCR cycles, each consisting of 1 second at 95°C and 20 seconds at 60°C. After PCR, amplification results were analyzed as follows: Negative transfection controls (NTCs), negative RT controls, and NTCs were examined for each respective adaptation. Threshold cycles (C) of each transfection concentration for INO-4800 SARS-CoV-2 target mRNA and β-actin mRNA were analyzed. T The results were generated from QuantStudio® software using automated threshold setting. Expression in any of the plasmid transfected wells compared to the negative transfection control was 5C. TIf the plasmid was larger, it was considered active for mRNA expression. Animals: Female, 6-week-old C57 / BL6 and BALB / c mice were purchased from Charles River Laboratories (Malvern, PA) and The Jackson Laboratory (Bar Harbor, ME). Female, 8-week-old Hartley guinea pigs were purchased from Elm Hill Labs (Chelmsford, MA). All animals were housed in the animal facilities of The Wistar Institute Animal Facility or Acculab Life Sciences (San Diego, CA). All animal studies and investigations complied with all applicable ethical regulations, and the studies were ethically approved by the Wistar Institute or Acculab Institutional Animal Care and Use Committees (IACUC). For mouse studies, on day 0, doses of 2.5, 10, or 25 μg of pDNA were administered via needle injection into the tibialis anterior (TA) muscle, followed by administration by CELLECTRA® in vivo electroporation (EP). CELLECTRA® EP delivery consists of two sets of pulses with a constant current of 0.2 amps. The second pulse set is delayed by 3 seconds. Within each set, there are two 52 ms pulses with a 198 ms delay between them. Blood was collected on days 0 and 14. For analysis of cellular immune responses, parallel groups of mice were successively sacrificed on days 4, 7, and 10 post-immunization. In the guinea pig study, on day 0, 100 μg of pDNA was administered cutaneously via Mantoux injection, followed by CELLECTRA® in vivo EP.

[0158] Antigen-binding ELISA. ELISA was performed to determine serum antibody binding titers. Nunc ELISA plates were coated overnight at 4°C with 1 μg / ml recombinant protein antigen in Dulbecco's phosphate-buffered saline (DPBS). The plates were washed three times and then blocked at 37°C for 2 hours with 3% bovine serum albumin (BSA) in DPBS containing 0.05% Tween® 20. The plates were then washed and incubated with serial dilutions of mouse or guinea pig serum at 37°C for 2 hours. The plates were washed again and then incubated with a 1:10,000 dilution of horseradish peroxidase (HRP) conjugate anti-guinea pig IgG secondary antibody (Sigma-Aldrich, catalog no. A7289) or HRP conjugate anti-mouse IgG secondary antibody (Sigma-Aldrich) at room temperature for 1 hour. After the final wash, plates were developed using SureBlue® TMB 1-component peroxidase substrate (KPL, catalog no. 52-00-03), and the reaction was stopped with TMB stop solution (KPL, catalog no. 50-85-06). Plates were read at a wavelength of 450 nm within 30 minutes using a Synergy® HTX plate reader (BioTek Instruments, Highland Park, VT). Binding antibody endpoint titers (EPTs) were calculated as previously described (Bagarazzi ML, Yan J, Morrow MP, et al. Immunotherapy against HPV16 / 18 generates potent TH1 and cytotoxic cellular immune responses. Sci Transl Med. 2012;4(155):155ra138).The tested binding antigens included SARS-CoV-2 antigen: S1 spike protein (Sino Biological 40591-V08H), S1+S2 ECD spike protein (Sino Biological 40589-V08B1), RBD (University of Texas, at Austin (McLellan Lab.)), SARS-CoV antigen: spike S1 protein (Sino Biological 40150-V08B1), S(1-1190) (Immune Tech IT-002-001P), and spike C-terminus (Meridian Life Science R18572).

[0159] ACE2 competition ELISA. For mouse studies, ELISA was performed to determine serum IgG antibody competition against human ACE2 with a human Fc tag. Nunc ELISA plates were coated with 1 μg / mL rabbit anti-His6X in 1×PBS for 4–6 hours at room temperature (RT), and washed four times with washing buffer (1×PBS and 0.05% Tween® 20). The plates were blocked overnight at 4°C with blocking buffer (1×PBS, 0.05% Tween® 20, 5% unsweetened condensed milk and 1% FBS). The plates were washed four times with washing buffer and then incubated with full-length (S1+S2) spike protein containing a C-terminal His tag (Sino Biologics, catalog no. 40589-V08B1) at 10 μg mL-1 at room temperature for 1 hour. The plates were washed, and then serial dilutions of purified mouse IgG mixed with 0.1 μg mL-1 recombinant human ACE2 containing a human Fc tag (ACE2-IgHu) were incubated at room temperature for 1–2 hours. The plates were washed again, and then incubated with a 1:10,000 dilution of horseradish peroxidase (HRP) conjugated anti-human IgG secondary antibody (Bethyl, catalog no. A80-304P) at room temperature for 1 hour. The final washed plates were developed using 1-Step Ultra TMB-ELISA substrate (Thermo, catalog no. 34029), and the reaction was stopped with 1 M sulfuric acid. The plates were read at a wavelength of 450 nm within 30 minutes using a SpectraMax Plus 384 microplate reader (Molecular Devices, Sunnyvale, CA). Competitive curves were plotted, and statistical significance was determined by calculating the area under the curve (AUC) using Prism 8 analysis software along with multiple t-tests.

[0160] For the guinea pig study, 96-well half-area assay plates (Costar) were coated overnight at 4°C with 25 μl per well of 5 μg / mL SARS-CoV-2 spike S1+S2 protein (Sino Biological) diluted in 1× DPBS (Thermofisher). The plates were washed with 1× PBS buffer containing 0.05% TWEEN® 20 (Sigma). 100 μl per well of 3% (w / v) BSA (Sigma) in 1× PBS containing 0.05% TWEEN® 20 was added and incubated at 37°C for 1 hour. Serum samples were diluted 1:20 in 1% (w / v) BSA in 1× PBS containing 0.05% TWEEN®. After washing the assay plates, 25 μl / well of diluted serum was added and incubated at 37°C for 1 hour. Human recombinant ACE2-Fc tags (Sinobiological) were directly added to diluted serum, followed by incubation at 37°C for 1 hour. The plates were washed, and 25 μl per well of 1:10,000 diluted goat anti-hu Fc fragment antibody HRP (Bethyl, A80-304P) was added to the assay plates. The plates were incubated at room temperature for 1 hour. For development, OD was recorded at 450 nm using SureBlue / TMB stop solution (KPL, MD).

[0161] SARS-CoV-2 pseudovirus neutralization assay. SARS-CoV-2 pseudotyped viruses were prepared using HEK293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.RE- plasmid (NIH AIDS reagent) in a 1:1 ratio. 48 hours after transfection, the transfection supernatant was collected, concentrated to 12% final volume with FBS, filtered sterile (Millipore Sigma), and set aside for storage at -80°C. SARS-CoV-2 pseudotyped viruses were titrated to obtain relative luminescence units (RLU) greater than 50 times that of individual cells after 72 hours of infection. Mouse serum from INO-4800 vaccinated and naive groups was inactivated by heating at 56°C for 15 minutes and serially diluted 3-fold, starting with a 1:10 dilution, for the assay. Serum was incubated with a fixed amount of SARS-CoV-2 pseudotyped virus for 90 minutes. HEK293T cells stably expressing ACE2 were added after 90 minutes and incubated in a standard incubator (37% humidity, 5% CO2) for 72 hours. Post-infection, cells were lysed using the britelite® plus luminescence reporter gene assay system (Perkin Elmer catalog no. 6066769), and relative luminescence units (RLU) were measured using a Biotek plate reader. Neutralizing titer (ID) 50 ) was calculated as a serum dilution in which the RLU was reduced by 50% compared to the RLU in the virus control well, after subtracting the background RLU in the cell control well.

[0162] SARS-CoV-2 wild-type virus neutralization assay. A neutralization assay of the SARS-CoV-2 / Australia / VIC01 / 2020 isolate was performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples heat-inactivated at 56°C for 30 minutes. SARS-CoV-2 (Australia / VIC01 / 2020 isolate) (Caly et al., Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia. Med. J. Aust. (2020) doi:10.5694 / mja2.50569; published online: April 13, 2020) was diluted to a concentration of 933 pfu / ml and mixed 50:50 in 1% FCS / MEM containing 25 mM HEPES buffer. Serum dilutions were then performed in 96-well V-bottom plates at a ratio of 1:10 to 1:320. After incubating the plates in a humidified box at 37°C for 1 hour, 1.5 × 10⁶ cells per well were added to 10% FCS / MEM. 5 The virus was transferred to the wells of a 24-well plate that had been seeded the previous day with Vero E6 cells and washed twice with DPBS. The virus was adsorbed at 37°C for a further 1 hour and then overlaid on plaque assay overlay medium (1×MEM / 1.5%CMC / 4%FCS final). After incubation at 37°C for 5 days in a humidified box, the plate was fixed, stained, and plaques were counted. The median neutralizing titer (ND50) was determined using the Spearman-Karber formula for control wells containing only the virus.

[0163] The SARS-CoV-2 / WH-09 / human / 2020 isolate neutralization assay was performed at the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (CAMS), authorized by the National Health Commission of the People's Republic of China. Seed SARS-CoV-2 (SARS-CoV-2 / WH-09 / human / 2020) stock and virus isolation studies were performed in Vero E6 cells, which were maintained in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen, Carlsbad, USA) supplemented with 10% fetal bovine serum (FBS), 100 IU / ml penicillin, and 100 μg / ml streptomycin, and incubated at 36.5°C and 5% CO2. Viral titers were determined using a standard 50% tissue culture infectious dose (TCID50) assay. Serum samples collected from immunized animals were inactivated at 56°C for 30 minutes and then serially diluted in cell culture medium in two separate dilutions. The diluted samples were mixed in a 1:1 ratio with a 100 TCID50 virus suspension in a 96-well plate and subsequently incubated in a 5% CO2 incubator at 36.5°C for 2 hours. Subsequently, 1–2 × 10⁶ of the serum-virus mixture was added. 4 Individual Vero cells were added to the plate, and the plate was incubated in a 36.5°C, 5% CO2 incubator for 3–5 days. Cytopathic effects (CPE) in each well were recorded under a microscope, and the neutralization titer was calculated by the number of dilutions under 50% protective conditions.

[0164] Bronchoalveolar lavage fluid was collected. Bronchoalveolar lavage (BAL) fluid was collected by washing the lungs of euthanized and bled mice with 700-1000 μl of ice-cold PBS containing 100 μm EDTA, 0.05% sodium azide, 0.05% Tween® 20, and 1× protease inhibitor (Pierce) (mucosal preparation solution (MPS)) using a blunt-end needle. Guinea pig lungs were washed with 20 ml of MPS via a 16G catheter inserted into the trachea. The collected BAL fluid was stored at -20°C until assay time.

[0165] IFN-γ ELISpot. Mouse: Mouse spleens were individually harvested in RPMI1640 medium supplemented with 10% FBS (R10) and penicillin / streptomycin, and treated into single-cell suspensions. The cell pellet was resuspended in 5 mL of ACK lysis buffer (Life Technologies, Carlsbad, CA) at room temperature for 5 minutes, and then PBS was added to stop the reaction. The sample was again centrifuged at 1,500 g for 10 minutes, the cell pellet was resuspended in R10, and then passed through a 45 μm nylon filter before being used in the ELISpot assay. The ELISpot assay was performed on mouse IFN-γ ELISpot PLUS The procedure was performed using MABTECH plates. 96-well ELISpot plates pre-coated with capture antibodies were blocked overnight at 4°C in R10 medium. 200,000 mouse splenocytes were plated into each well and stimulated for 20 hours with a pool of 15-mer peptides (5 peptides per protein) consisting of 9 overlapping amino acids from SARS-CoV-2, SARS-CoV, or MERS-CoV spike proteins. Matrix mapping was performed using peptide pools in the matrix designed to identify immunodominant responses. Cells were stimulated with a final concentration of 5 μL of each peptide / well in RPMI + 10% FBS (R10). Spots were developed according to the manufacturer's instructions. R10 and a cell stimulation cocktail (Invitrogen) were used as negative and positive controls, respectively. Spots were scanned and quantified using an ImmunoSpot® CTL reader. Spot-forming units (SFUs) per million cells were calculated by subtracting the negative control wells.

[0166] Flow cytometry. Splenocytes isolated from BALB / c and C57BL / 6 mice were stained with intracellular cytokines and stimulated with duplicate peptides across the SARS-CoV-2 S protein at 37°C and 5% CO2 for 6 hours. Unless otherwise noted, cells were stained with the following antibodies from BD Biosciences, using the dilutions indicated in parentheses: FITC anti-mouse CD107a (1:100), PerCP-Cy5.5 anti-mouse CD4 (1:100), APC anti-mouse CD8a (1:100), ViViD dye (1-40) (LIVE / DEAD® Fixable Violet Dead Cell Stain Kit; Invitrogen, L34955), APC-Cy7 anti-mouse CD3e (1:100), and BV605 anti-mouse IFN-γ (1:75) (eBiosciences). Phorbol myristate acetate (PMA) was used as a positive control, and complete medium only was used as a negative control. Cells were washed, fixed, and cellular events were obtained using FACS CANTO (BD Biosciences), followed by FlowJo software (FlowJo LLC, Ashland, OR) analysis.

[0167] Statistics. All statistical analyses were performed using GraphPad Prism 7 or 8 software (La Jolla, CA). Data were considered significant if p < 0.05. Lines in all graphs represent the mean, and error bars represent the standard deviation. No samples or animals were excluded from the analysis. Randomization was not performed in animal studies. Samples and animals were not blinded before each experiment.

[0168] result Design and synthesis of SARS-CoV-2 DNA vaccine constructs Four spike protein sequences were extracted from the first four available SARS-CoV-2 complete genome sequences published in GISAID (Global Initiative on Sharing All Influenza Data). Three of the spike sequences were 100% identical, and one was considered an outlier (98.6% sequence identity with the other sequences). After sequence alignment, the SARS-CoV-2 spike glycoprotein sequence ("Covid-19 spike antigen"; SEQ ID NO: 1) was generated and an N-terminal IgE reader sequence was added. A highly optimized DNA sequence encoding the SARS-CoV-2 IgE-spike was constructed to enhance expression and immunogenicity, as described elsewhere in this specification. The SARS-CoV-2 spike outlyer glycoprotein sequence ("Covid-19 spike-OL antigen"; SEQ ID NO: 4) was generated and an N-terminal IgE reader sequence was added. Optimized DNA sequences were synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate early promoter and bovine growth hormone polyadenylation signaling. The resulting plasmids were designated as pGX9501 and pGX9503, respectively, and designed to encode the SARS-CoV-2 S protein from three matched sequences and outlier sequences (Figure 1A).

[0169] In vitro characterization of synthetic DNA vaccine constructs The expression of the encoded SARS-CoV-2 spike transgene was measured at the RNA level in COS-7 cells transfected with pGX9501 and pGX9503. Spike transgene expression was confirmed by RT-PCR using total RNA extracted from transfected COS-7 cells (Figure 1B). In vitro spike protein expression in 293T cells was measured by Western blotting using cross-reactive antibodies against SARS-CoV S protein on cell lysates. Western blotting of lysates of HEK-293T cells transfected with pGX9501 or pGX9503 constructs revealed a band close to the predicted S protein molecular weight of 140–142 kDa, with a slight shift likely attributable to 22 potential N-linked glycans in the S protein (Figure 1C). Immunofluorescence studies detected the S protein in 293T cells transfected with pGX9501 or pGX9503 (Figure 1D). In summary, in vitro studies revealed spike protein expression at both the RNA and protein levels after transfecting cell lines with candidate vaccine constructs.

[0170] Humoral immune response in mice. pGX9501 was selected as a vaccine construct to proceed with immunogenicity studies due to the broad range likely to be offered compared to the outlier pGX9503. pGX9501 was subsequently referred to as INO-4800. The immunogenicity of INO-4800 was evaluated in BALB / c mice after administration to the tibialis anterior muscle using a CELLECTRA® delivery device. (Sardesai & Weiner, Curr. Opin. Immunol., 23, 421-429 (2011)). Serum reactivity from mice immunized with INO-4800 was measured against a panel of SARS-CoV-2 and SARS-CoV antigens (Figure 2). Analysis revealed limited cross-reactivity to SARS-CoV-2 S protein antigen in the serum of INO-4800-immunized mice, and IgG binding to SARS-CoV-2 S protein antigen. Serum IgG binding endpoint titers were measured in mice immunized with pDNA against recombinant SARS-CoV-2 spike protein S1+S2 region (Figures 3A and 3B) and recombinant SARS-CoV-2 spike protein receptor-binding domain (RBD) (Figures 3C and 3D). Endpoint titers were observed in the serum of mice 14 days after immunization with a single dose of INO-4800 (Figures 3B, 3C, 3D).

[0171] Neutralization assay. A neutralization assay was developed using a pNL4-3.Luc.RE-based pseudovirus exhibiting the SARS-CoV-2 spike protein. Neutralization titer was detected by the decrease in relative luciferase units (RLU) compared to a control that did not show a decrease in RLU signaling. BALB / c mice were immunized twice with INO-4800 on day 0 and day 14, and serum was collected 7 days after the second immunization. The pseudovirus was incubated with serial dilutions of mouse serum, and the serum-virus mixture was added to 293T cells stably expressing the human ACE2 receptor (ACE2-293T) for 72 hours. In INO-4800 immunized mice, a mean neutralization ID50 titer of 92.2 was observed (Figures 4A and 4B). No decrease in RLU was observed in the control animals. Neutralization titers against two wild-type SARS-CoV-2 virus strains were further measured by a plaque reduction neutralization assay (PRNT). Serum from INO-4800 immunized BALB / c mice was neutralized with both SARS-CoV-2 / WH-09 / human / 2020 and SARS-CoV-2 / Australia / VIC01 / 2020 virus strains at mean ND50 titers of 97.5 and 128.1, respectively (Table 1). Live virus neutralization titers were also evaluated in C57BL / 6 mice according to the same INO-4800 immunization regimen. Serum from INO-4800 immunized C57BL / 6 mice was neutralized with wild-type SARS-CoV-2 virus with a mean ND50 titer of 340 (Table 1). [Table 1]

[0172] The immunogenicity of INO-4800 in the Hartley guinea pig model, an established model for intradermal vaccine delivery (Carter, et al. The adjuvant GLA-AF enhances human intradermal vaccine responses. Sci Adv. 2018;4(9):eaas9930, Schultheis, et al. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin. Vaccine. 2017;35(1):61-70) was evaluated. 100 μg of pDNA was administered skin-level by Mantoux injection, followed by administration via the CELLECTRA® device on the days described in the Methods section above. On day 14, anti-spike protein binding of serum antibodies was measured by ELISA. INO-4800 immunization revealed an immune response in terms of serum SARS-CoV-2 S1+2 protein-bound IgG levels (Figures 5A and 5B). The SARS-CoV-2 S protein binding titer at the 14-day endpoint was 10,530 and 21 in guinea pigs treated with 100 μg of INO-4800 or pVAX (control), respectively (Figure 5B). Antibody neutralizing activity after intradermal INO-4800 immunization in a guinea pig model was evaluated. Guinea pigs were treated with pVAX or INO-4800 on days 0, 14, and 28, and serum samples were collected on days 35 or 42 to measure serum neutralizing activity against pseudovirus or wild-type virus, respectively. SARS-CoV-2 pseudovirus neutralizing activity with a mean ND50 titer of 573.5 was observed in INO-4800-immunized guinea pigs (Table 1). Wild-type SARS-CoV-2 virus activity was also observed in INO-4800 immunized guinea pigs with an ND50 titer >320 by PRNT assay, which was observed in all animals (Table 1). The functionality of serum antibodies was further measured by evaluating their ability to inhibit ACE2 binding to the SARS-CoV-2 spike protein.Serum (1:20 dilution) collected from INO-4800-immunized guinea pigs after a second immunization inhibited the binding of SARS-CoV-2 spike protein across the ACE-2 concentration range (0.25 μg / ml to 4 μg / ml) (Figure 6E). Furthermore, serum dilution curves revealed that serum collected from INO-4800-immunized guinea pigs blocked the binding of ACE-2 to SARS-CoV-2 in a dilution-dependent manner (Figure 6F). Serum collected from pVAX-treated animals showed negligible activity in inhibiting ACE-2 binding to the viral protein, and the decrease in OD signal at the peak serum concentration is considered a matrix effect in the assay.

[0173] Inhibition of the SARS-CoV-2 S protein binding to the ACE2 receptor. The receptor inhibitory function of the INO-4800-induced antibody response was investigated. An ELISA-based ACE2 inhibition assay was developed as a neutralization substitute. As a control in the assay, ACE2 is shown to bind to the SARS-CoV-2 spike protein at EC50 of 0.025 μg / ml (Figure 6A). BALB / c mice were immunized with 10 μg of INO-4800 on days 0 and 14, and serum IgG was purified on postimmunization day 21 to ensure that the inhibition was antibody-mediated. Inhibition of the spike-ACE2 interaction was compared using serum IgG from naive mice and INO-4800-vaccinated mice (Figure 6B). The receptor inhibition assay was repeated in groups of 5 immunized mice, demonstrating that the INO-4800-induced antibody competes with ACE2 for binding to the SARS-CoV-2 spike protein (Figures 6C and 6F). ACE2 binding inhibition was further evaluated in a guinea pig model. Serum collected from INO-4800 immunized guinea pigs inhibited the binding of SARS-CoV-2 spike protein across a range of ACE2 concentrations (0.25 μg / ml to 4 μg / ml) (Figure 6D). Furthermore, serum dilution curves revealed that serum collected from INO-4800 immunized guinea pigs blocked ACE2 binding to SARS-CoV-2 in a dilution-dependent manner (Figure 6E). Serum collected from pVAX-treated animals showed negligible activity in inhibiting ACE2 binding to the viral protein, and the decrease in OD signaling at the highest serum concentration is considered a matrix effect in the assay. Figure 6F shows purified IgG from n=5 mice 14 days after the second immunization with INO-4800, showing competition for the ACE2 receptor binding to the SARS-CoV-2 spike protein compared to pooled naive mouse IgG.

[0174] In summary, immunogenicity studies in both mice and guinea pigs revealed that the SARS-CoV-2 vaccine candidate, INO-4800, can induce an antibody response against the SARS-CoV-2 spike protein. ACE2 is considered a key receptor for SARS-CoV-2 cell entry, and blocking this interaction suggests that INO-4800-inducing antibodies can prevent host infection.

[0175] Biodistribution of SARS-CoV-2 reactive IgG in the lungs. Lower respiratory tract disease (LRD) is associated with severe cases of COVID-19. The presence of SARS-CoV-2-targeting antibodies in the lung mucosa may potentially mediate protection against LRD. The presence of SARS-CoV-2-specific antibodies in the lungs of immunized mice and guinea pigs was evaluated. BALB / c mice and Hartley guinea pigs were immunized with INO-4800 or pVAX-controlled pDNA at days 0 and 14, or 0, 14, and 28, respectively. Bronchoalveolar lavage (BAL) fluid was collected after sacrifice and performed SARS-CoV-2 S protein ELISA. In both BALB / c and Hartley guinea pigs treated with INO-4800, a statistically significant increase in SARS-CoV-2 S protein-binding IgG in BAL fluid was measured compared to animals treated with pVAX control (Figures 7A-7D). In summary, these data demonstrate the presence of anti-SARS-CoV-2 specific antibodies in the lungs after immunization with INO-4800.

[0176] Cross-reactive cellular immune responses against coronaviruses in mice. T cell responses against SARS-CoV-2, SARS-CoV, and MERS-CoV S antigens were assayed by IFN-γ ELISpot. BALB / c mouse groups were sacrificed on days 4, 7, or 10 after INO-4800 administration (2.5 or 10 μg of pDNA), splenocytes were harvested, and single cell suspensions were stimulated for 20 hours with pools of 15-mer overlapping peptides spanning the SARS-CoV-2, SARS-CoV, and MERS-CoV spike proteins. On day 7 after INO-4800 administration, T cell responses of 205 and 552 SFU per 10 6 splenocytes were measured for the 2.5 and 10 μg doses, respectively (Figure 8A). On day 10 after INO-4800 administration, higher responses of 852 and 2,193 SFU per 10 6 splenocytes were observed. Furthermore, the cross-reactivity of the cellular responses induced by INO-4800 against SARS-CoV was assayed, and on day 7 (74 [2.5 μg dose] and 140 [10 μg dose] SFU per 10 6 splenocytes) and day 10 (242 [2.5 μg dose] and 588 [10 μg dose] SFU per 10 6 splenocytes), both showed lower but detectable T cell responses (Figure 8B). Interestingly, no cross-reactive T cell responses against MERS-CoV peptides were observed (Figure 8C). A representative image of the IFN-γ ELISpot plate is provided in Figure 31. T cell populations producing IFN-γ were identified. Flow cytometry analysis of splenocytes collected from BALB / c mice 14 days after single INO-4800 immunization revealed that the T cell compartment contained 0.04% CD4+ and 0.32% CD8+ IFN-γ+ T cells after stimulation with SARS-CoV-2 antigen (Figure 32).

[0177] BALB / c SARS-CoV-2 Epitope Mapping. Epitope mapping was performed on splenocytes from BALB / c mice administered a 10 μg dose of INO-4800. Using 30 matrix mapping pools, splenocytes were stimulated over 20 hours, and immunodominant responses were detected in multiple peptide pools (Figure 14A). The responses were deconvoluted to identify several epitope (H2-Kd) clusterings within the receptor-binding domain and the S2 domain (Figure 14B). Interestingly, one SARS-CoV-2 H2-Kd epitope, PHGVVFLHV (SEQ ID NO: 16), was observed to overlap with and be adjacent to the SARS-CoV human HLA-A2 restriction epitope VVFLHVTVYV (SEQ ID NO: 17).

[0178] In summary, we detected the T cell response to the SARS-CoV-2 S protein epitope in mice immunized with INO-4800.

[0179] Example 2 - Cellular and humoral immune responses measured in New Zealand White (NZW) rabbits treated with INO-4800. Intradermal delivery of pDNA on day 0 and day 28. PBMC IFN-γ ELISA (Figure 9), serum IgG-binding ELISA (Figure 10).

[0180] Example 3 Humoral immune response to SARS-CoV-2 spike protein measured in rhesus monkeys treated with INO-4800. Intradermal delivery of pDNA at day 0 and day 28. Serum IgG-conjugated ELISA. (Figures 11A-11E.)

[0181] Humoral immune responses to SARS and MERS spike proteins measured in rhesus monkeys treated with INO-4800. Intradermal delivery of pDNA on day 0 and day 28. Serum IgG-conjugated ELISA. (Figures 12A-12G, left panel, 1 mg INO-4800; right panel, 2 mg INO-4800). Cellular immune responses measured by PBMC IFN-γ ELISpot in rhesus monkeys treated with INO-4800 after intradermal delivery of pDNA on day 0 and day 28. Results are shown in Figures 13A (SARS CoV-2 spike peptide), 13B (SARS CoV spike peptide), and 13C (MERS CoV spike peptide).

[0182] Example 4: INO-4800 SARS-CoV-2 Spike ELISA Assay The SARS-CoV-2 spike protein is coated onto the wells of a 96-well microplate by incubation overnight or for up to 3 days. Blocking buffer is then added to block any remaining free binding sites. A human serum sample containing antibodies against the SARS-CoV-2 spike protein and an assay control is added to the block plate and incubated for 1 hour. During incubation, the anti-spike protein antibody and positive control present in the sample bind to the immobilized spike protein on the plate. The plate is then washed to remove any unbound serum components. Next, horseradish peroxidase (HRP)-labeled anti-human IgG antibody is added to enable detection of antibodies bound to the spike protein. After 1 hour of incubation, the plate is washed to remove any unbound HRP detection antibody, and TMB substrate is added to the plate. In the presence of horseradish peroxidase, the TMB substrate turns blue in proportion to the amount of HRP present in the wells. After allowing the reaction to proceed for approximately 10 minutes, the TMB turns yellow when an acid-based stop solution is added to stop the enzymatic reaction. The yellow color is proportional to the amount of bound anti-spike protein antibody in each well and is read at 450 nm. The magnitude of the assay response is expressed as titer. Titer is defined as the largest serial dilution in which the assay signal is greater than the cutoff value, based on the assay background level for a serum panel from a normal human donor.

[0183] Eligibility of ELISA assay method The INO-4800 SARS-CoV-2 spike ELISA assay is qualified and found suitable for its intended use in measuring humoral responses in subjects participating in clinical trials involving INO-4800. Formal qualification consisted of 18 plates and was performed by two operators over four days. Qualification determined assay sensitivity, specificity, selectivity, and precision. Convalescent serum was unavailable at the time the assay was developed; therefore, monoclonal antibodies were used for development. All parameters in this assay were tested using monoclonal antibodies diluted in normal human serum. Overall assay sensitivity was found to be 16.1 ng / mL in 1 / 20 dilution serum and 322 ng / mL in undiluted serum. Specificity was assessed by pre-incubating the anti-spike protein antibody with recombinant spike protein prior to the assay. Pre-incubation with recombinant spike protein resulted in a signal reduction of over 60%, indicating that the antibody specifically bound to the spike protein coated on the plates and not to different assay components. Selectivity was investigated by spiking individual human serum samples with a positive control anti-spike antibody at concentrations near the detection limit. Seven out of ten individuals had a signal above the cutoff, and eight out of ten individuals had an assay signal within 20% of the average signal for all ten individuals, demonstrating that matrix effects are expected to be minimal in most human serum samples at a 1 / 20 dilution. Assay precision was evaluated by assaying high, low, and medium anti-spike protein antibody positive controls six times on each of the six plates. The results showed low intra-assay raw signal variability but high inter-assay raw signal variability. Since each individual plate cutoff is based on the negative control signal on each plate, inter-assay variability in raw signals is not expected to affect the accuracy of the final titer calculation. To test this, the precision of the plate cutoff was evaluated in this qualification by titrating each of the six plates with HPC (high positive control) six times for a total of 36 titer assessments.Of the 36 values, 35 were identical (titer of 180), but one of the titer determinations was one step lower than the others (60 instead of 180). This resulted in an inter-assay CV of 4.6%.

[0184] Example 5: INO-4800 SARS-CoV-2 Spike ELISPOT Assay The enzyme-coupled immunosorbent spot (ELISPOT) assay is a highly sensitive immunoassay that measures the frequency of cytokine-secreting cells at the single-cell level. In this assay, cells are cultured on a surface coated with a specific capture antibody, either in the presence or absence of a stimulus. After a suitable incubation period, the cells are removed, and the secreted molecules are detected using a detection antibody in a procedure similar to that used in ELISA. The detection antibody is biotinylated and subsequently subjected to streptavidin-enzyme conjugation. By using a substrate with precipitates rather than soluble products, the final result is a spot visible on the surface. Each spot corresponds to an individual cytokine-secreting cell. The qualification of the IFN-y ELISPOT assay was successfully completed by evaluating the assay's specificity, reproducibility, and precision (intra-assay and inter-assay precision), dynamic range, linearity, relative precision, detection and quantification limits, and assay robustness. This assay has been tested and certified under GLP / GCLP laboratory guidelines.

[0185] Eligibility of the ELISPOT assay. Specificity readings yielded a mean of fewer than 10 spot-forming units (SFUs) for the assay-negative control (medium containing DMSO), a mean of 565 SFUs for the positive control peptide pool CEF, and a mean of 593 SFUs in response to stimulation with mitogen (phorbol myristate acetate + ronomycin). The highest reported CV% for intra-assay variability was 7.37%. The highest reported CV% for inter-assay variability was 17.23%. The highest observed CV% for inter-operator variability was 8.11%. These values ​​are below the FDA-recommended standard acceptance threshold of 20%.

[0186] The linearity of the dilution curve was demonstrated by a slope of 0.15 and an R² value of 0.99. Assay accuracy was over 90% across the enumerated dynamic range (156–5000 cells / well) and fell within the acceptance criteria of 80–120%. The detection limit was 11 SFU / 1×10⁻¹⁶. 6 It was determined to be PBMC, and the limit of quantification was set to 20 SFU / 1 × 10⁻⁶. 6 The assay was observed using PBMCs. The robustness of the assay was evaluated by varying (i) peptide concentration, (ii) secondary antibody concentration, (iii) incubation time, and (iv) plate membrane drying.

[0187] Based on the results of this eligibility assessment, IFN-y ELISPOT is considered eligible and ready for use in clinical trials.

[0188] Example 6: Phase 1 open-label trial to evaluate the safety, tolerability, and immunogenicity of INO-4800, a prophylactic vaccine against SARS-CoV-2, administered intradermally to healthy volunteers, followed by administration by electroporation. This is a Phase 1, open-label, multicenter trial (clinical trial_gov identifier NCT04336410) to evaluate the safety, tolerability, and immunological profile of INO-4800 (pGX9501) administered by intradermal (ID) injection followed by electroporation (EP) using the CELLECTRA® 2000 device in healthy adult volunteers. Approximately 40 healthy volunteers will be evaluated across two dose levels: Study Group 1 and Study Group 2, shown in Table 2. A total of 20 subjects will be enrolled in each study group. [Table 2]

[0189] All participants will be followed for 24 weeks after the last dose. Week 28 will be the end-of-study (EOS) visit.

[0190] Main purpose: • Evaluate the tolerability and safety of INO-4800 administered via ID injection followed by EP in healthy adult volunteers. • Evaluate cellular and humoral immune responses to INO-4800 administered via ID injection, followed by EP.

[0191] Primary safety endpoints: • Organ-specific classification (SOC), preferred terminology (PT), incidence of adverse events by severity, and relationship with the investigational drug. • Reactions at the administration (i.e., injection) site (described by frequency and severity) • Incidence of adverse events of particular interest

[0192] Primary immunogenicity endpoint: • SARS-CoV-2 spike glycoprotein antigen-specific antibody detected by binding assay

number

[0193] Exploratory purpose: • Assess the extended immunological profile by evaluating the immune response of both T cells and B cells.

[0194] Exploratory endpoints: An extended immunological profile may (but is not limited to) include additional assessments of T and B cell numbers, neutralization response, and T and B cell molecular changes by measuring mRNA levels of immunological proteins and target genes at all weeks, as determined by sample availability.

[0195] Safety evaluation: Participants will be tracked for safety throughout the duration of the study until the end of the study (EOS) or their last visit. Adverse events will be collected at all visits (and the day 1 phone call). Clinical blood and urine samples will be collected at screening, day 0 (pregnancy test only), week 1, week 4 (pregnancy test only), week 6, week 8, week 12, and week 28 according to the event schedule (Table 3). All adverse events, regardless of relationship, will be collected from consent until EOS. All serious adverse events, adverse events of special interest, and treatment-related adverse events will be tracked until resolved or stabilized. [Table 3-1] [Table 3-2]

[0196] Immunogenicity assessment: Immunological blood samples will be collected at screening, day 0 (pre-administration), week 4 (pre-administration), week 6, week 8, week 12, and week 28. The decision to analyze the samples collected for the immunological endpoint will be continuously determined throughout the trial.

[0197] Clinical trial population: Healthy adult volunteers aged 18-50, inclusive.

[0198] Inclusion criteria: a. Adults aged 18-50, comprehensive. b. Based on the medical history, physical examination, and vital signs performed at the time of screening, the principal investigator determined that the patient was healthy. c. I am able to and willing to comply with all test procedures. d. Screening the test results within the normal range, or the principal investigator determining that they are not clinically important. Negative serological testing for hepatitis B surface antigen (HBsAg), hepatitis C antibody, and human immunodeficiency virus (HIV) antibody screening. f. Screening electrocardiograms (ECGs) that the principal investigator determines do not present any clinically significant findings (e.g., Wolff-Parkinson-White syndrome). g. Use of medically effective contraception with a failure rate of less than 1% per year when used consistently and correctly from screening to 3 months after the last dose, being postmenopausal, being surgically infertile, or having a partner who is unable to fert.

[0199] Exclusion criteria: a. You must be pregnant or breastfeeding, or intend to become pregnant or father a child within the planned duration of the trial, starting with a screening visit within 3 months of your last dose. b. You are currently participating in or have previously participated in a clinical trial using the investigational drug within 30 days prior to day 0. c. Prior exposure to SARS-CoV-2 (clinical testing at the discretion of the principal investigator) or acceptance of an investigational vaccine product for the prevention of COVID-19, MERS, or SARS. d. Current status or medical history of the following conditions: • Respiratory diseases (e.g., asthma, chronic obstructive pulmonary disease). • Hypertension, sitting systolic blood pressure > 150 mm Hg or diastolic blood pressure > 95 mm Hg. • Malignant tumors within 5 years of screening. • Cardiovascular disease (e.g., myocardial infarction, congestive heart failure, cardiomyopathy, or clinically significant arrhythmias). e. Immunosuppression resulting from an underlying medical condition or treatment, including the following: Primary immunodeficiency. • Long-term use of oral or parenteral glucocorticoids (7 days or more). • Current or anticipated use of disease-modifying doses of antirheumatic drugs and biological disease-modifying agents. • A history of solid organ or bone marrow transplantation. • A history of other clinically significant immunosuppressive or clinically diagnosed autoimmune diseases. f. Considering the anterolateral aspect of the deltoid and quadriceps femoris muscles, there are fewer than two acceptable sites available for ID injection and EP injection. g. Any physical examination findings and / or any medical history that, in the opinion of the principal investigator, could interfere with the results of the study or could pose an additional risk to the patient by participation in the study.

[0200] Clinical Trial Therapy: The INO-4800 drug product contains 10 mg / mL of DNA plasmid pGX9501 in 1×SSC buffer (150 mM sodium chloride and 15 mM sodium citrate). Fill a 0.4 mL volume into a 2 mL glass vial fitted with a rubber stopper and a sealed aluminum cap. Store INO-4800 at 2–8°C.

[0201] In study group 1, patients received one 1.0 mg intradermal (ID) injection of INO-4800 at each medication visit on day 0 and week 4, followed by electroporation (EP) using the CELLECTRA® 2000 device. In study group 2, patients received two 1.0 mg INO-4800 ID injections (a total of 2.0 mg per medication visit) at two different acceptable sites on the limbs on day 0 and week 4, followed by EP using the CELLECTRA® 2000 device.

[0202] Peripheral blood immunogenicity assessment Obtain whole blood and serum samples. Immunological blood and serum samples are collected at the time of hospital visit designated in the screening and event schedule (Table 2). To enable all immunological tests, immunological samples on both screening and day 0 are required. The immune responses of T cells and B cells against INO-4800 are measured using assays that may include, but are not limited to, ELISA, neutralization, evaluation of immunological gene expression, evaluation of immunological protein expression, flow cytometry, and ELISPOT. The ELISA binding assay is a standard plate-based ELISA using a 96-well ELISA plate. The plate is coated with the SARS-CoV-2 spike protein and blocked. After blocking, sera from vaccinated subjects are serially diluted and incubated on the plate. A secondary antibody capable of binding to human IgG is used to evaluate the level of vaccine-specific antibodies in the sera. The T cell response is evaluated by an IFN-gamma ELISPOT assay. PBMC isolated from study volunteers are incubated with peptide fragments of the SARS-CoV-2 spike protein. The cells and peptides are placed on MabTech plates coated with an antibody that captures IFN-gamma. After 24 hours of stimulation, the cells are washed away and a secondary antibody that binds to IFN-gamma is added. Each vaccine-specific cell gives rise to spots that can be counted to determine the level of the induced cellular response. Additionally, the humoral response against the SARS-CoV-2 nucleocapsid protein (NP) can also be evaluated to rule out potential infection by wild-type SARS-CoV-2 after INO-4800 treatment under investigation. The determination of the analysis of samples collected for immunological endpoints is continuously judged throughout the study.

[0203] Primary outcome measures: 1. Percentage of participants with adverse events (AE) [Time frame: from baseline to week 28] 2. Percentage of patients with administration (injection) site reactions [Time frame: from day 0 to week 28] 3. Incidence of Adverse Events of Special Interest (AESI) [Timeframe: Up to Week 28 from Baseline] 4. Change in Antigen-Specific Binding Antibody Titer from Baseline [Timeframe: Up to Week 28 from Baseline] If the optical density after vaccination is 2.0 SD higher than the optical density on Day 0 and exceeds the ELISA-specific cut-off, the subject is considered to have a positive antibody response. 5. Antigen-Specific Interferon-Gamma

Number

[0204] The safety of INO-4800 was measured and graded according to the "Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials" issued in September 2007 (Appendix A). Adverse events of special interest (AESI) (severe or non-severe) are one of the scientific and medical concerns specific to the product or program. AESI includes those listed in Table 4.

Table 4

[0205] Dose-Limiting Toxicity (DLT) For the purposes of this clinical trial, the following are dose-limiting toxicities. [[ID=…]]· Erythema, swelling, and / or induration at the local injection site of Grade 3 or higher were observed more than 1 day after INO-4800 administration (See Table 5). · Pain or tenderness at the injection site requiring hospitalization despite appropriate use of non-narcotic analgesics. • Grade 4 or higher non-injection site adverse events as assessed by a PI associated with INO-4800 administration. • Clinically significant laboratory abnormalities of grade 4 or higher, as assessed by a PI associated with INO-4800 administration. [Table 5]

[0206] Analysis group The analysis group is as follows: The modified intention-to-treatment (mITT) population includes all subjects who received at least one dose of INO-4800. Subjects in this sample will be analyzed by assigned dose group of INO-4800. Multiple primary and exploratory immunological endpoints will be analyzed using the mITT population. • The protocol-compliant (PP) population consists of mITT subjects who received all scheduled doses and had no significant protocol violations as assessed by medical monitors. Analysis of the PP population is considered to support the corresponding mITT analysis.

[0207] The safety analysis population includes all subjects who received at least one dose of INO-4800 administered by ID injection. Subjects within this population are classified according to the dose of INO-4800 administered. This population will be used for all safety analyses of this study.

[0208] Key safety analysis The primary analyses for this trial are safety analyses of clinically significant changes in safety laboratory parameters from baseline, including adverse events (TEAEs) that occurred during treatment, administration site reactions, and safety laboratory parameters.

[0209] For this study, a TEAE is defined as any adverse event, adverse event of special interest, or serious adverse event occurring on or after day 0 following IP administration. All TEAEs are summarized by frequency, percentage, and associated 95% Clopper-Pearson confidence interval. Frequency is also presented separately by number of doses and indicated by system order class and preferred terminology. Further frequency is presented in relation to maximum severity and relationship to IP. Multiple occurrences of the same AE in a single subject are counted only once, following the worst-case approach in relation to severity and relationship to IP. All serious TEAEs are summarized as described above. The duration of an AE is calculated as AE cessation day - AE onset day + 1 day. AEs and SAEs that are not TEAEs or serious TEAEs are presented in the list.

[0210] All of these major safety analyses are conducted on subjects within the safety population.

[0211] Main immunogenicity analysis SARS-CoV-2 spike glycoprotein antigen-specific binding antibody titers and specific cellular immune responses are analyzed by test groups within age groups. Binding antibody titers are analyzed for each test group using geometric mean and associated 95% confidence intervals. Increases in antigen-specific cellular immune responses are analyzed for each test group using median, interquartile range, and 95% confidence intervals. Changes from baseline for both binding antibody titers and increases in antigen-specific cellular responses are analyzed using geometric mean multiplier increases and 95% confidence intervals. Binding antibody titers are analyzed between each test group pair within age groups using geometric mean ratios and associated 95% confidence intervals. Antigen-specific cellular immune responses are analyzed between each test group within age groups using median differences and associated 95% confidence intervals. All of these major immunogenicity analyses are performed on subjects in mITT and PP populations.

[0212] Exploratory analysis T and B cell counts after baseline are descriptively analyzed by study group, along with mean / median and associated 95% confidence intervals. The percentage of neutralizing antibodies is analyzed for each study group using the median, interquartile range, and 95% confidence intervals.

[0213] The safety and immunogenicity of optional booster doses of INO-4800 after the previous two-dose regimen are analyzed as described below. Serum neutralizing antibody titers and pseudoneutralizing antibody titers are analyzed for each study group within age strata using geometric mean and associated 95% confidence intervals. Fold increases from baseline are tabulated for each immunogenic biomarker. If sufficient data for analysis are available, a group immunogenicity comparison between subjects who selected only two doses and those who selected a booster dose in addition to two doses is performed exploratorily.

[0214] Further exploration of the effects of age and other potential confounding factors on the relationship between immune biomarkers and INO-4800 dose may involve the use of ANCOVA and / or logistic regression models.

[0215] Preliminary preclinical results All 8 reported adverse events were grade 1, and 5 were due to local injection site reactions. No serious adverse events, adverse events of special interest, or dose-limiting toxicities were reported.

[0216] Preliminary binding ELISA analysis showed that 7 / 9 (78%) of subjects had a positive antibody response. Responders had a 4-fold increase in titer.

[0217] At week 6, multiple immunological assays, including those for humoral and cellular immune responses, were performed on both the 1.0 mg and 2.0 mg dose cohorts after two doses. Analysis at that point showed that 94% (34 out of a total of 36 study participants) demonstrated a total immune response rate, based on preliminary data evaluating humoral (binding and neutralizing) and T-cell immune responses. One participant in the 1 mg dose cohort and two participants in the 2 mg dose cohort were excluded from immunoanalysis because they tested positive for COVID-19 immune response at study enrollment, indicating a prior infection. One participant in the 2 mg dose cohort discontinued the study for reasons unrelated to safety or tolerability.

[0218] Up to week 8, INO-4800 was generally safe and well-tolerated in all participants in both cohorts. All 10 reported adverse events (AEs) were of grade 1 severity, and most were injection site redness. No serious adverse events (SAEs) were reported.

[0219] Results of the initial Phase I Population statistics of the test population A total of 55 participants were screened, and 40 participants were enrolled in the first two groups (Figure 16). The median age was 34.5 years (ranging from 18 to 50 years). 55% of the participants were male (Table 6). The majority of participants were Caucasian (82.5%). [Table 6]

[0220] The vaccine was administered via intradermal injection of 0.1 ml, followed by administration of an epidermal pulse (EP) at the injection site. EP was performed seasonally using a CELLECTRA® 2000 with four 52-millisecond pulses at 0.2 A (40–200 V depending on tissue resistance). The first two pulses were 0.2 seconds apart, followed by a 3-second pulse interval, and then the last two pulses were also 0.2 seconds apart. Dose groups were sequentially enrolled using a safety run-in for each group. Participants were and will be evaluated clinically and for safety on day 1, and at weeks 1, 4 (dose 2), 6, 8, 12, 28, 40, and 52. Safety clinical tests (complete blood count, comprehensive metabolic panel, and urinalysis) were and will be performed at all follow-up visits except on days 0, 1, and 4. Immunological specimens were obtained at all time points after dose 1, except on day 1 and week 1. The principal investigators recorded and graded local and systemic adverse events (AEs), regardless of their relationship to the vaccine. AEs were graded according to the Toxicity Grading Scale for Healthy Adults and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials guidelines, issued by the Food and Drug Administration in September 2007.

[0221] Vaccine safety and tolerability Thirty-nine participants (97.5%) completed both doses, and one participant in the 2.0 mg group discontinued participation before receiving the second dose due to unrelated reasons unrelated to the study or administration, specifically lack of transportation to the clinical setting. All remaining 39 participants completed follow-up visits 8 weeks after dose 1. A total of 11 local and systemic adverse events (AEs) were reported by 8 weeks after dose 1, six of which were considered vaccine-related. All AEs were mild or grade 1 in severity. The most frequent AEs were injection site reactions, including injection site pain (3) and erythema (2). One vaccine-related systemic AE was nausea. There were no febrile reactions. No participants discontinued the study due to AEs. No serious adverse events (SAEs) or aesthesia-induced adverse events (AESIs) were reported. There were no clinically concerning abnormal laboratory values ​​throughout the initial 8-week follow-up period. In the 2.0 mg group (10% of the subjects), there was no increase in the number of participants experiencing vaccine-related adverse events (AEs) compared to the 1.0 mg group (15% of the subjects). In addition, in both dose levels, the frequency of AEs at the second dose did not increase compared to the first dose. Therefore, the Phase 1 safety data for INO-4800 suggest that the vaccine is likely a safe booster, as there was no increase in the frequency of adverse events after the second dose compared to the first dose.

[0222] Immunogenicity: 38 subjects were included in the immunogenicity analysis. In addition to one subject in the 2.0 mg group who discontinued treatment before completion, one subject in the 1.0 mg group was excluded because they were considered seropositive at baseline.

[0223] Humoral immune response: Serum samples were used to measure neutralizing antibody titers against SARS-CoV-2 / Australia / VIC01 / 2020 isolates, as well as binding antibodies against RBD and total spike S1+S2 proteins.

[0224] S1+S2 Enzyme-Linked Immunoadsorption Assay (ELISA): Serum-bound anti-SARS-CoV-2 spike antibodies were detected using a standard binding ELISA. ELISA plates were coated with recombinant S1+S2 SARS-CoV-2 spike protein (Sino Biological), incubated overnight, and blocked. Samples were serially diluted and incubated on blocked assay plates for 1 hour. The magnitude of the assay response was expressed as titer, defined as the largest serial dilution where the optical density 3SD exceeded the background on day 0. 68% of participants in the 1.0 mg group and 70% of participants in the 2.0 mg group showed at least an increased serum IgG binding titer to the S1+S2 spike protein compared to the pre-vaccination point (day 0), with responder GMTs of 320.0 (95% CI: 160.5, 638.1) and 508.0 (95% CI: 243.6, 1059.4) in the 1.0 mg and 2.0 mg groups, respectively (Figure 17C). In Figure 17D, humoral responses in the 1.0 mg and 2.0 mg dose groups were evaluated based on their ability to bind to all spike proteins (S1 and S2) (n=19, 1.0 mg; n=19, 2.0 mg). Endpoint titers were calculated as the titer showing an OD3.0 SD above baseline, with baseline titer set to 1. The response to live virus neutralization was PRNT IC50 ≥ 10. In all graphs, the horizontal line represents the median and the bars represent the interquartile range.

[0225] Furthermore, serum was tested for its ability to neutralize live virus in a SARS-CoV-2 wild-type virus neutralization assay. The SARS-CoV-2 / Australia / VIC01 / 2020 isolate neutralization assay was performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples heat-inactivated at 56°C for 30 minutes. SARS-CoV-2 (Australia / VIC01 / 2020 isolate 44) was diluted to a concentration of 933 pfu ml-1 and doubled the serum dilution by mixing 50:50 in 1% FCS / MEM containing 25 mM HEPES buffer. After incubation at 37°C for 5 days in a humidified box, plates were fixed, stained, and plaques were counted. Viral titers were determined using a standard 50% tissue culture infectious dose (TCID50) assay. Following the second vaccination at week 6, the responder geometric mean titers (GMT) by live virus PRNT IC50 neutralization assay were 82.4 and 63.5 in the 1.0 mg and 2.0 mg groups, respectively. The proportion of responders (PRNT IC50 ≥ 10 after vaccination) was 83% and 84% in the 1.0 mg and 2.0 mg groups, respectively (Figure 17A and Table 7). [Table 7]

[0226] RBD enzyme-linked immunosorbent assay (ELISA): MaxiSorp 96-well plates (ThermoFisher, 439454) were coated with 50 ul / well of 1 ug / ml SARS-CoV-2 RBD (SinoBiological, 40592-V08H), diluted in PBS, and incubated overnight at 4°C. The plates were washed four times with PBST (PBS containing 0.05% Tween®-20) and blocked at room temperature for 2 hours with 200 ul / well of blocking buffer (PBS containing 5% skim milk powder and 0.1% Tween®-20). After washing with PBST, serially diluted serum samples at 50 ul / well were added to the plates in double doses and incubated at room temperature for 2 hours. After washing with PBST, 50 μl / well of anti-human IgG-HRP detection antibody (BD Pharmingen, 555788), diluted 500-fold in blocking buffer, was added and incubated at room temperature for 1 hour. After washing with PBST, 50 μl / well of 1-Step Ultra TMB (Thermo, 34028) was added and incubated at room temperature for 5 minutes. The color change reaction was stopped by adding 50 μl / well of 2 M sulfuric acid, and optical absorbance was measured at 450 and 570 nm on a Synergy 2 microplate reader (Biotek). Endpoint titer was defined as the largest serial dilution in which the OD450-570 value exceeded 3 standard deviations of the matched day 0 signal. At week 6, the responder GMT was 385.6 (95% CI: 69.0, 2154.9) and 222.1 (95% CI: 87.0, 566.8) in the 1.0 mg and 2.0 mg groups, respectively (Figure 17B).

[0227] Overall serological conversion (defined as participants responding with neutralizing or binding antibodies against S protein or RBD) after two vaccine administrations in the 1.0 mg and 2.0 mg dose groups was 89% and 95%, respectively.

[0228] Cellular response: Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples, frozen, and stored in liquid nitrogen for later analysis.

[0229] INO-4800 SARS-CoV-2 spike ELISPOT. Peripheral mononuclear cells (PBMCs) were isolated before and after vaccination. Cells were stimulated in vitro with a pool of 15-mer peptides (9 residues duplicated) spanning the full-length consensus spike protein sequence. Cells were incubated overnight (18-22 hours, 37°C, 5% CO2) with the peptide pool (225 μg / ml), DMSO alone (0.5%, negative control), or PMA and ionomycin (positive control). The following day, cells were washed and plates were developed: detection antibodies were biotinylated, followed by streptavidin-enzyme conjugation. By using a substrate with precipitate rather than a soluble product, visible spots were produced. Each spot corresponds to an individual cytokine-secreting cell. After developing the plates, spots were scanned and quantified using a CTL S6 Microanalyzer (CTL) with ImmunoCapture® and ImmunoSpot® software. Values ​​are shown as the background subtracted average of the three measured values.

[0230] The response rate at week 8 was 74% in the 1.0 mg dose group and 100% in the 2.0 mg dose group (Table 8). 10 6The median SFUs per PBMC were 46 and 71 for responders in the 1.0 mg and 2.0 mg dose groups, respectively. In each group, the number of interferon-γ secreting cells (SFUs) obtained per million PBMCs increased statistically significantly from baseline (P=0.001 and P<0.0001, respectively, Wilcoxon rank-sum test, post-hoc analysis), Figure 18A. Interestingly, five non-responders in the 1.0 mg group who performed the T-cell ELISpot assay showed a strong response by the live virus neutralization assay. Also interesting was the lower T-cell response in three convalescent samples tested by the ELISpot assay compared to the 2.0 mg dose group at week 8, with a median of 33. INO-4800 produced a stronger T-cell response in the 2.0 mg dose group, with a higher frequency and higher responder median response (45.6 vs. 71.1). As shown in Figure 18B, the T cell response in the 2.0 mg group was mapped to five epitope pools. Interestingly, T cell responses were observed in all regions of the spike protein. [Table 8]

[0231] INO-4800 SARS-CoV-2 Spike Flow Cytometry Assay: The contribution of CD4+ and CD8+ T cells to the cellular immune response to INO-4800 was evaluated by intracellular cytokine staining (ICS). PBMCs were also used for intracellular cytokine staining (ICS) analysis using flow cytometry. One million PMBCs in 200 μL of complete RPMI medium were stimulated for 6 hours (37°C, 5% CO2) with DMSO (negative control), PMA and ionomycin (positive control, 100 ng / mL and 2 μg / mL, respectively), or the indicated peptide pool (225 μg / mL). After 1 hour of stimulation, brefelzin A and monensin (BD GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block the secretion of expressed cytokines. After stimulation, cells were moved overnight at 4°C. Next, the cells were washed in PBS for live / dead staining (Life Technologies Live / Dead aqua fixable viability dye, as previously described), and then resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, 20 mM HEPES). The cells were then stained for extracellular markers, fixed and permeabilized, and then stained for the cytokines indicated for antibodies used in flow cytometry (Table 9). [Table 9]

[0232]

number

[0233] CD4+ and CD8+ T cells were examined after vaccination. Nearly half (47%) of the CD8+ T cells in the 2.0 mg dose group were double-celled.

number

number

number

[0234] Any cytokine (any response after vaccination,

number

[0235] Furthermore, Th2 response was measured by evaluating IL-4 production, and no statistically significant increase (Wilcoxon rank-sum test, post-hoc analysis) was observed in any of the groups after vaccination (Figure 18F).

[0236] In this Phase 1 trial, INO-4800 vaccination was effective in reducing Th1 cytokines.

number

number

[0237] Phase 1 update This study, designed as a Phase 1 open-label, multicenter trial (NCT04336410), evaluated the safety, tolerability, and immunogenicity of INO-4800 administered intradermally (ID) followed by electroporation using a CELLECTRA 2000 device. Healthy participants aged 18–50 years with no known history of COVID-19 received either 1.0 mg or 2.0 mg of INO-4800 in two dose regimens (weeks 0 and 4).

[0238] DNA vaccine INO-4800. This vaccine was manufactured in accordance with current Good Manufacturing Practices. INO-4800 contains plasmid pGX9501 expressing the synthesis-optimized sequence of the SARS-CoV-2 full-length spike glycoprotein, optimized as previously described, at a concentration of 10 mg / ml in saline sodium citrate buffer.

[0239] Endpoints. Safety endpoints included systemic and local administration site responses up to 8 weeks after dose 1. Immunological endpoints included antigen-specific binding antibody titers, neutralizing titers, and antigen-specific interferon-gamma (IFN-γ) cellular immune responses after two doses of vaccine. For live virus neutralization, responders were defined as PRNT IC50 > 10 at week 6, or > 4 if the subject was a responder in ELISA. For S1+S2 ELISA, responders were defined as a value > 1 at week 6. For ELISpot assay, responders were defined as a value > 10 above week 0. 6 It is defined as the value at week 6 or week 8 where the number of spot formation units exceeds 12 per PBMC.

[0240] Research procedure. Forty participants were enrolled into two groups: 20 participants each in a 1.0 mg dose group and a 2.0 mg dose group, receiving the vaccine at week 0 and week 4. The vaccine was administered via intradermal injection of 0.1 ml into the arm, followed by administration at the injection site using an EP (electroconvulsive therapy) device. Participants in the 1.0 mg dose group received one injection at each medication visit. The second dose of the vaccine could be administered in the same arm or a different arm relative to the first dose. Participants in the 2.0 mg dose group received one injection in each arm at each medication visit. EP was performed using CELLECTRA® 2000, as previously described. This device delivers a total of four electrical pulses, each with a current of 0.2 A and a voltage intensity of 40–200 V for a duration of 52 milliseconds. The dose groups were enrolled sequentially using safety run-ins for each. The 1.0 mg dose group enrolled one participant per day for three days. The Independent Data Safety Monitoring Committee (DSMB) reviewed the safety data for week 1 and, based on a favorable safety assessment, recommended full enrollment of an additional 17 participants in that dose group. The 2.0 mg dose group was subsequently enrolled in a similar manner. Participants were evaluated for safety and concomitant medications at all time points, including screening, week 0 (dose 1), post-dose telephone the day after administration, after dose 1, week 1, week 4 (dose 2), week 6, week 8, week 12, week 28, week 40, and week 52. The principal investigator recorded and graded local and systemic adverse events, regardless of their relationship to the vaccine. Safety clinical laboratory tests (complete blood count, comprehensive metabolic panel, and urinalysis) were and will continue to be performed at screening, after dose 1, week 1, week 6, week 8, week 12, week 28, and week 52. Immunological specimens were obtained at all time points after dose 1, except on day 1 and week 1. AEs were graded according to the Toxicity Grading Scale for Healthy Adults and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials guidelines issued by the Food and Drug Administration in September 2007. DSMB reviewed laboratory data and AE data for participants up to 8 weeks included in this report.The protocol specified safety suspension rules and adverse events of special interest (AESIs) were observed. For the purposes of this report, clinical and laboratory safety assessments from the first dose to 8 weeks later are presented.

[0241] Protocol eligibility. Eligible participants must meet the following criteria: healthy adults aged 18-50 years, able to adhere to all study procedures, motivated, and with a body mass index of 18-30 kg / m² at screening. 2 The main exclusion criteria included: being a woman, having negative serological tests for hepatitis B surface antigen, hepatitis C antibody, and human immunodeficiency virus antibody, having a screening electrocardiogram (ECG) that the principal investigator determined to be clinically insignificant, using a medically effective method of contraception with a failure rate of less than 1% per year when used consistently, being postmenopausal, or surgically infertile, or having a partner who is infertile.

[0242] Clinical trial population: Healthy adult volunteers aged 18-50, inclusive.

[0243] Inclusion criteria: a. Adults aged 18-50, comprehensive. b. Based on the medical history, physical examination, and vital signs performed at the time of screening, the principal investigator determined that the patient was healthy. c. I am able to and willing to comply with all test procedures. d. Screening the test results within the normal range, or the principal investigator determining that they are not clinically important. Negative serological testing for hepatitis B surface antigen (HBsAg), hepatitis C antibody, and human immunodeficiency virus (HIV) antibody screening. f. Screening electrocardiograms (ECGs) that the principal investigator determines do not present any clinically significant findings (e.g., Wolff-Parkinson-White syndrome). g. Use of medically effective contraception with a failure rate of less than 1% per year when used consistently and correctly from screening to 3 months after the last dose, being postmenopausal, being surgically infertile, or having a partner who is unable to fert.

[0244] Exclusion criteria: a. You must be pregnant or breastfeeding, or intend to become pregnant or father a child within the planned duration of the trial, starting with a screening visit within 3 months of your last dose. b. You are currently participating in or have previously participated in a clinical trial using the investigational drug within 30 days prior to day 0. c. Prior exposure to SARS-CoV-2 (clinical testing at the discretion of the principal investigator) or acceptance of an investigational vaccine product for the prevention of COVID-19, MERS, or SARS. d. Current status or medical history of the following conditions: • Respiratory diseases (e.g., asthma, chronic obstructive pulmonary disease). • Hypertension, sitting systolic blood pressure > 150 mm Hg or diastolic blood pressure > 95 mm Hg. • Malignant tumors within 5 years of screening. • Cardiovascular disease (e.g., myocardial infarction, congestive heart failure, cardiomyopathy, or clinically significant arrhythmias). e. Immunosuppression resulting from an underlying medical condition or treatment, including the following: Primary immunodeficiency. • Long-term use of oral or parenteral glucocorticoids (7 days or more). • Current or anticipated use of disease-modifying doses of antirheumatic drugs and biological disease-modifying agents. • A history of solid organ or bone marrow transplantation. • A history of other clinically significant immunosuppressive or clinically diagnosed autoimmune diseases. f. Considering the anterolateral aspect of the deltoid and quadriceps femoris muscles, there are fewer than two acceptable sites available for ID injection and EP injection. g. Any physical examination findings and / or any medical history that, in the opinion of the principal investigator, could interfere with the results of the study or could pose an additional risk to the patient by participation in the study.

[0245] Methods for evaluating immunogenicity. Screening, pre-administration (week 0), and week 6 and week 8 samples were analyzed. Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples by standard overlay on a Ficol hyperque and subsequently centrifuged. The isolated cells were frozen in 10% DMSO and 90% fetal bovine serum. The frozen PBMCs were stored in liquid nitrogen for subsequent analysis. Serum samples were stored at -80°C until use for measuring binding and neutralizing antibody titers.

[0246] SARS-CoV-2 wild-type virus neutralization assay. A neutralization assay of SARS-CoV-2 / Australia / VIC01 / 2020 isolate was performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples heat-inactivated at 56°C for 30 minutes. SARS-CoV-2 (Australia / VIC01 / 2020 isolate 44) was diluted to a concentration of 933 pfu / ml and doubled the serum dilution by mixing 50:50 in 1% FCS / MEM containing 25 mM HEPES buffer. After incubation at 37°C for 1 hour, the virus-antibody mixture was transferred to a confluent monolayer of Vero E6 cells (ECACC 85020206; PHE, UK). The virus was adsorbed to the cells for a further 1 hour at 37°C in the incubator, and the cell monolayer was layered in MEM / 4% FBS / 1.5% CMC. After incubation at 37°C for 5 days, the plates were fixed and stained with 0.2% crystal violet solution (Sigma) in 25% methanol (v / v). Plaques were counted.

[0247] S1+S2 enzyme-coupled immunosorbent assay (ELISA). ELISA plates were coated with 2.0 mg / mL recombinant SARS-CoV-2 S1+S2 spike protein (Acro Biosystems; SPN-C52H8) and incubated overnight at 2–8°C. S1+S2 contains the full-length spike protein, amino acid residue Val 16-Pro 1213, GenBank number QHD43416.1. It contains two mutations to stabilize the protein in its pre-trimeric state (R683A, R685A) and also contains a C-terminal 10×His tag (SEQ ID NO: 24). The plates were then washed with PBS containing 0.05% Tween®-20 (Sigma; P3563) and blocked at room temperature for 1–3 hours (Starting Block, Thermo Scientific; 37, 538). Samples were sequentially diluted with blocking buffer, washed, and double-added to the blocked assay plates along with the prepared controls. Samples were incubated on blocked assay plates at room temperature for 1 hour. After incubation of samples and controls, the plates were washed, and then a 1 / 1000 preparation of anti-human IgG HRP conjugate (BD Pharmingen; 555,788) in blocking buffer was added to each well and incubated at room temperature for 1 hour. The plates were washed, and then TMB substrate (KPL; 5120-0077) was added and incubated at room temperature for approximately 10 minutes. Next, TMB stop solution (KPL; 5150-0021) was added, and the plates were read at 450 nm and 650 nm on a Synergy HTX microplate reader (BioTek). The magnitude of the assay response was expressed as titer, defined as the maximum cross-dilution coefficient of the maximum serial dilution where the plate-corrected optical density exceeded 3 SD of the background of the corresponding week 0 for the subject.

[0248] SARS-CoV-2 spike ELISpot assay. Peripheral mononuclear cells (PBMCs) were stimulated in vitro with a 15-mer peptide (9 residues duplicated) spanning the full-length consensus spike protein sequence before and after vaccination. Cells were incubated overnight in a pre-coated ELISpot plate (Mab-Tech, Human IFN-g ELISpot Plus) with a peptide pool at a concentration of 5 mg per ml. The following day, cells were washed, and the plates were developed with a biotinylated anti-IFN-g detection antibody, followed by a streptavidin-enzyme conjugate, resulting in visible spots. Each spot corresponds to an individual cytokine-secreting cell. After plate development, the spots were scanned and quantified using a CTL S6 Micro Analyzer (CTL) with Immuno-Capture and ImmunoSpot software. Values ​​are presented as the measured triple background subtracted mean. The ELISpot assay was deemed valid with 12 spot-forming units as the lower limit of detection. Therefore, anything exceeding this cutoff is considered a signal of an antigen-specific cellular response.

[0249] INO-4800 SARS-CoV-2 spike flow cytometry assay. PBMCs were also used for intracellular cytokine staining (ICS) analysis using flow cytometry. One million PMBCs in 200 mL of complete RPMI medium were stimulated for 6 hours (37°C, 5% CO2) with DMSO (negative control), PMA and ionomycin (positive controls, 100 ng / mL and 2 mg / mL, respectively), or the indicated peptide pool (225 μg / mL). After 1 hour of stimulation, brefelzin A and monensin (BD GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block the secretion of expressed cytokines. After stimulation, the cells were moved overnight at 4°C. The cells were then washed in PBS for live / dead staining (Life Technologies Live / Dead Water-Fixed Viability Dye) and subsequently resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, 20 mM HEPES). Next, extracellular markers were stained, cells were fixed and permeabilized (eBioscience® Foxp3Kit), and then stained for cytokines (Table 9) using fluorescent conjugate antibodies. Figures 22A and B show representative gating strategies for CD4+ and CD8+ T cells, as well as

number

[0250] Statistical analysis. Formal power analysis was not applied to this study. Safety endpoints: Descriptive statistics were used to summarize the proportion of patients with AEs, administration site reactions, and AESI up to week 8. Immunogenic endpoints: Descriptive statistics were also used to summarize the median response (in 95% confidence interval) and proportion of responders for cellular outcomes, and the geometric mean titer (in 95% confidence interval) and proportion of responders for humoral outcomes. Post-hoc analyses were performed to subtract paired differences from pre-vaccination to post-vaccination for SARS-CoV-2 neutralization response (using paired t-tests on a natural logarithmic scale), ELISpot response (using Wilcoxon signed-rank test), and intracellular flow assay response (using Wilcoxon signed-rank test).

[0251] result Demographics of the test population. A total of 55 participants were screened, and 40 participants were enrolled in the first two groups (Figure 16). The median age was 34.5 years (ranging from 18 to 50 years). 55% (22 / 40) of the participants were male (Table 6). The majority of participants were Caucasian (82.5%, 33 / 40).

[0252] Vaccine safety and tolerability. Of the 40 participants, a total of 39 (97.5%) completed both doses. One participant in the 2.0 mg group discontinued participation before receiving the second dose due to lack of transportation to the clinical setting; the discontinuation was unrelated to the study or administration (Figure 16). All of the remaining 39 subjects completed follow-up visits 8 weeks after dose 1. A total of 11 local and systemic adverse events (AEs) were reported by 8 weeks after dose 1, six of which were considered vaccine-related (Table 10). All AEs were grade 1 (mild) in severity. Five of the six related AEs were injection site reactions, including injection site pain (3) and erythema (2). One of the vaccine-related grade 1 systemic AEs was nausea. All related AEs occurred on the day the subject received the first or second dose of vaccine. There were no fever reactions, and no antipyretics were used after vaccination. No subjects discontinued the study due to AEs. No serious adverse events (SAEs) or adverse events of special interest (AESIs) were reported. Throughout the initial 8-week follow-up period, no abnormal laboratory values ​​were observed by the investigator as clinically significant. There was no increase in the number of participants experiencing vaccine-related AEs in the 2.0 mg group (10%, 2 / 20) compared to the 1.0 mg group (15%, 3 / 20) (Figure 19). In addition, the frequency of AEs at the second dose did not increase compared to the first dose in either dose group. [Table 10]

[0253] Immunogenicity. Thirty-eight subjects were included in the immunogenicity analysis. In addition to one subject in the 2.0 mg group who discontinued treatment before completion, one subject in the 1.0 mg group was excluded because they were considered seropositive at baseline. Data for this subject can be found in Table 11. [Table 11]

[0254] Humoral immune response. Serum was tested for its ability to bind to the S1+S2 spike protein. 89% (17 / 19) of participants in the 1.0 mg group and 95% (18 / 19) of participants in the 2.0 mg group showed increased serum IgG binding titers to the S1+S2 spike protein compared to pre-vaccination time (week 0). Responder GMTs were 655.5 (95% CI: 255.6, 1681.0) and 994.2 (95% CI: 395.3, 2500.3) in the 1.0 mg and 2.0 mg groups, respectively (Figure 17B, Figure 20, and Table 13). Serum was also tested for its ability to neutralize live virus using the live virus PRNTIC50 neutralization assay. The geometric mean multiplier increase from baseline at week 6 was 10.8 at the 95% CI of (4.4, 27.0) and 11.5 at the 95% CI of (5.3, 24.9) in the 1.0 mg and 2.0 mg groups, respectively. A statistically significant increase above baseline was observed at week 6 in each group (paired t-test, P<0.0001, post-hoc analysis), Figure 17A. At week 6, the proportion of respondents was 78% (14 / 18) and 84% (16 / 19) in the 1.0 mg and 2.0 mg groups, respectively (Figure 17A and Table 13), and the geometric mean titer (GMT) of respondents was 102.3 (95% CI: 37.4, 280.3) and 63.5 (95% CI: 39.6, 101.8) in the 1.0 mg and 2.0 mg groups, respectively. Overall serological conversion at week 6 (defined as participants responding with neutralizing and / or binding antibodies against the S protein) was 95% (18 / 19) in each of the 1.0 mg and 2.0 mg dose groups (Table 13).

[0255] Enzyme-linked immunotherapy spot (ELISpot). The response rate at week 8 was 74% (14 / 19) in the 1.0 mg dose group and 100% (19 / 19) in the 2.0 mg dose group. These data, obtained along with seroconversion data, resulted in a 100% (19 / 19) overall immune response in each group (Table 13, Figures 18A and 21). 10 6The median SFU per PBMC was 46 (95% CI: 21.1, 142.2) and 71 (95% CI: 32.2–194.4) for respondents in the 1.0 mg and 2.0 mg dose groups, respectively. The median change from baseline at week 8 was 22.3 (95% CI: 2.2, 63.4) and 62.8 (95% CI: 22.2, 191.1) in each group, showing a statistically significant increase from baseline in each group (P=0.001 and P<0.0001, respectively, Wilcoxon rank-sum test, post-hoc analysis), Figure 18A. It should also be noted that three convalescent samples (all symptomatic but not hospitalized) tested by the ELISpot assay showed a lower T-cell response at week 8 than the 2.0 mg dose group, with a median of 33 (Figure 20). As shown in Figures 18B and 18G, the T cell response in the 2.0 mg group was mapped to five epitope pools. Encouraged, the T cell response was observed in all regions of the spike protein, with the dominant pool encompassing the receptor-binding domain region, followed by the N-terminal domain, as well as the fusion peptide, heptad repeat 1, and central helix.

[0256] Intracellular flow assay. The contribution of CD4+ and CD8+ T cells to the cellular immune response to INO-4800 was evaluated by intracellular cytokine staining (ICS). In the 2.0 mg dose group,

number

number

number

number

number

number

[0257] INO-4800 was well-tolerated, with formulation-related grade 1 adverse events (AEs) occurring in 15% (3 / 20 subjects) and 10% (2 / 20 subjects) of participants in the 1.0 mg and 2.0 mg dose groups, respectively. Only grade 1 AEs were observed in this trial, which was favorable compared to existing licensed vaccines. The safety profile of this successful COVID-19 vaccine is significant and supports the broader development of INO-4800 in at-risk populations, including the elderly and those with comorbidities, who are at greater risk of complications from SARS-CoV-2 infection. INO-4800 also produced balanced humoral and cellular immune responses, with all 38 evaluable participants showing either an antibody or T-cell response, or both, after two doses of INO-4800. Humoral responses, measured by binding or neutralizing antibodies, were observed in 95% (18 / 19) of participants in each dose group. Neutralizing antibodies, as measured by live virus neutralization assay, were observed in 78% (14 / 18) and 84% (16 / 19) of participants in the 1.0 mg and 2.0 mg dose groups, respectively, with corresponding GMTs of 102.3 [95% CI (37.4, 280.3)] and 63.5 [95% CI (39.6, 101.8)]. The range overlaps with the PRNT IC50 titers reported from convalescent patients and those in NHP protected by SARS-CoV-2 challenge. Furthermore, titers were statistically significantly increased. It is important to note that all but one vaccine recipient who did not develop neutralizing antibody titers showed a positive response in the T-cell ELISpot assay, suggesting that the immune response generated by the vaccine is differentially registered in these assays. Cellular immune responses were observed in 74% (14 / 19) and 100% (19 / 19) of the 1.0 mg and 2.0 mg dose groups, respectively. Importantly, INO-4800 showed a higher frequency and higher median response rate (46 [95% CI (21.1, 142.2)] vs. 71 [95% CI (32.2, 194.4)] SFU10 in the 1.0 mg and 2.0 mg dose groups, respectively. 6T cell responses with PBMCs were induced. These T cell responses in the 2.0 mg dose group were larger than those in the convalescent samples tested (Figure 18A). Furthermore, SFUs were statistically significantly increased. Flow cytometry assays showed increased cytokine production from both CD4+ and CD8+ T cell compartments in both the 1.0 mg and 2.0 mg dose groups, and especially in the 2.0 mg group.

number

number

[0258] In this Phase 1 trial, INO-4800 vaccination was effective in reducing Th1 cytokines.

number

number

[0259] Expanded Phase I trial Approximately 120 healthy volunteers will be evaluated across three dose levels (test groups). Each test group will enroll a total of 40 participants. Enrollment in each test group will be stratified by age, with n=20 for those aged 18-50, n=10 for those aged 51-64, and n=10 for those aged 65 and over (Table 14).

[0260] Participants must be adults at least 18 years of age who, based on their medical history, physical examination, and vital signs performed at screening, are deemed healthy by the principal investigator, able to comply with all study procedures, motivated, have normal or clinically insignificant laboratory test results at screening, and have an OCD of 18-30 kg / m² at screening. 2The criteria must be comprehensive and include negative serological tests for hepatitis B surface antigen (HBsAg), hepatitis C antibody, and human immunodeficiency virus (HIV) antibody at screening, an ECG that the principal investigator deems free of clinically significant findings (e.g., Wolff-Parkinson-White syndrome) at screening, and meeting one of the following criteria regarding fertility: postmenopausal woman as defined by spontaneous amenorrhea for 12 months or longer, surgically infertile, or partner infertile, or use of medically effective contraception. Exclusion criteria are as follows:Being pregnant or breastfeeding, or intending to become pregnant or father a child within the planned duration of the trial, starting with a screening visit within 3 months of the last dose; a positive serum pregnancy test during screening, or a positive urine pregnancy test prior to administration; currently participating in or having participated in a trial using the investigational product within 30 days prior to day 0; prior exposure to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), or acceptance of the investigational product for the prevention or treatment of COVID-19, Middle East respiratory syndrome (MERS), or severe acute respiratory syndrome (SARS); current occupation at high risk of SARS-CoV-2 exposure (e.g., healthcare worker or emergency responder with direct interaction with patients or providing direct care to patients); current or past respiratory illness, hypersensitivity, or severe allergic reaction to vaccines or drugs. History of diabetes, hypertension, malignancy, or cardiovascular disease within 5 years of screening; immunosuppression as a result of an underlying disease or treatment, including primary immunodeficiency, long-term use (≥7 days) of oral or parenteral glucocorticoids, current or anticipated use of disease-modifying doses of antirheumatic drugs and biological disease modifiers, history of solid organ or bone marrow transplantation, and history of other clinically significant immunosuppressive or clinically diagnosed autoimmune diseases; fewer than two permissible sites available for ID injection and EP, considering the anterolateral deltoid and quadriceps femoris muscles; or reported smoking, inhalation, or abuse or dependence of active drugs, alcohol, or other substances; or any physical examination findings and / or any medical history that, in the opinion of the principal investigator, could interfere with the outcome of the study or pose an additional risk to the patient by participation in the study.

[0261] All subjects will receive medication on day 0 and week 4 (Table 15). Subjects who consent to receiving a booster dose (Table 16) will receive the booster dose at the same dose previously received for the two-dose regimen (day 0 and week 4), starting from week 12 of the administration schedule. Safety and immunogenicity will be evaluated two weeks after the booster dose. [Table 14]

[0262] Participants who did not receive the optional booster dose were followed until the End of Study (EOS) visit at week 52, which was considered the EOS visit (Table 15). For participants who received the optional booster dose, the visit at week 48 after the booster dose was considered the EOS visit (Table 16).

[0263] Main purpose: • Evaluate the tolerability and safety of INO-4800 administered via ID injection followed by EP in healthy adult volunteers. • Evaluate cellular and humoral immune responses to INO-4800 administered via ID injection, followed by EP.

[0264] Primary safety endpoints: • Organ-specific classification (SOC), preferred terminology (PT), incidence of adverse events by severity, and relationship with the investigational drug. Proportion of participants experiencing adverse events (AEs) [Time frame: from baseline to week 52 (if no optional booster dose was administered) or visit at week 48 after booster dose (if an optional booster dose was administered)]. • Reactions at the administration (i.e., injection) site (described by frequency and severity). Percentage of participants experiencing injection site reactions [Time frame: from day 0 to week 52 (if no optional booster dose was administered) or visit at week 48 after booster dose (if an optional booster dose was administered)]. • Incidence of adverse events of special interest. Percentage of participants experiencing adverse events of special interest (AESI) [Time frame: from baseline to week 52 (if no optional booster dose was administered) or visit at week 48 after booster dose (if an optional booster dose was administered)].

[0265] Primary immunogenicity endpoint: • SARS-CoV-2 spike glycoprotein antigen-specific antibody binding assay. Change from baseline in SARS-CoV-2 spike glycoprotein antigen-specific binding antibody titer [Time frame: from baseline to week 52 (if no optional booster dose was administered) or visit at week 48 after booster dose (if an optional booster dose was administered)]. • Antigen-specific cellular immune response as measured by IFN-gamma ELISpot and / or flow cytometry assays. Change in antigen-specific cellular immune response from baseline [timeframe: baseline to 52 weeks (if no optional booster dose was administered) or visit at 48 weeks after booster dose (if an optional booster dose was administered)].

[0266] Exploratory purpose: • Assess the extended immunological profile by evaluating the immune response of both T cells and B cells. • Evaluation of the safety and immunogenicity of INO-4800 administered by ID injection followed by an optional booster dose via EP, and subsequent exploratory endpoints for the two-dose regimen: An extended immunological profile may (but is not limited to) include additional assessments of T and B cell numbers, neutralization response, and T and B cell molecular changes by measuring mRNA levels of immunological proteins and target genes at all weeks, as determined by sample availability. • Incidence of all adverse events after ID injection, followed by an optional booster dose of INO-4800 administered by EP. • SARS-CoV-2 spike glycoprotein antigen-specific neutralizing and binding antibodies after ID injection, followed by an optional booster dose of INO-4800 administered by EP. • ID injection followed by an optional booster dose of INO-4800 administered by EP.

number

[0267] Safety assessment. Participants will be tracked for safety throughout the trial period until the end of study (EOS) or the participant's last visit. Adverse events will be collected at all visits (including phone calls on day 1 and week 36 after booster dose). Clinical laboratory blood and urine samples will be collected according to the event schedule (Tables 15 and 16). [Table 15-1] [Table 15-2] [Table 16]

[0268] Immunogenicity assessment. Immunological blood samples are collected according to the event schedule (Tables 15 and 16). The decision to analyze the samples collected for the immunological endpoint is continuously determined throughout the trial.

[0269] In healthy volunteers, INO-4800, delivered via ID followed by EP using CELLECTRA® 2000, exhibited good tolerability, a tolerable safety profile, and is expected to induce an immune response against the SARS-CoV-2 spike glycoprotein.

[0270] Example 7: Phase 2 / 3 randomized, blinded, placebo-controlled trial to evaluate the safety, immunogenicity, and efficacy of INO-4800, a prophylactic vaccine against COVID-19 disease, administered intradermally followed by electroporation (EP) in healthy, seronegative adults at high risk of SARS-CoV-2 exposure. This is a Phase 2 / 3 randomized, placebo-controlled, multicenter trial to evaluate the safety, immunogenicity, and efficacy of INO-4800 administered by intradermal (ID) injection followed by electroporation (EP) using the CELLECTRA® 2000 device to prevent COVID-19 disease in participants at high risk of SARS-CoV-2 exposure. The Phase 2 segment will evaluate immunogenicity and safety in approximately 400 participants at two dose levels across three age groups. Safety and immunogenicity information from the Phase 2 segment will be used to determine the dose level for the Phase 3 efficacy segment of the trial, which will include approximately 6,178 participants. [Table 17-1] [Table 17-2]

[0271] Primary outcome measures: 1. Phase 2: Change from baseline in antigen-specific cellular immune response as measured by interferon-gamma (IFN-γ) enzyme-coupled immunospot (ELISpot) assay [Time frame: from baseline to day 393] 2. Phase 2: Change from baseline in neutralizing antibody response as measured by a pseudovirus-based neutralization assay [Time frame: from baseline to day 393] 3. Percentage of participants with virologically confirmed COVID-19 disease [Time frame: from 14 days after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)]

[0272] Secondary outcome measurement: 1. Phase 2 and Phase 3: Percentage of participants with unsolicited and solicited injection site reactions [Time frame: From the time of consent to 28 days (up to 56 days) after dose 2] 2. Phase 2 and Phase 3: Percentage of participants experiencing systemic adverse events (AEs) with solicited and ansolicited [Time frame: From the time of consent to 28 days post-dose (up to 56 days)] 3. Phase 2 and Phase 3: Percentage of participants experiencing serious adverse events (SAEs) [Time frame: from baseline to day 393] 4. Phase 2 and Phase 3: Percentage of participants experiencing adverse events of special interest (AESI) [Time frame: from baseline to day 393] 5. Phase 3: Percentage of participants who died from all causes [Time frame: from baseline to day 393] 6. Phase 3: Percentage of participants with non-severe COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 7. Phase 3: Percentage of participants with severe COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 8. Phase 3: Percentage of participants who died from COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 9. Phase 3: Percentage of participants with virologically confirmed SARS-CoV-2 infection [Time frame: from 14 days after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 10. Phase 3: Number of days to symptom resolution in participants with COVID-19 disease [Time frame: from 14 days after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 11. Phase 3: Change from baseline in antigen-specific cellular immune response as measured by the IFN-gamma ELISpot assay [Time frame: from baseline to day 393] 12. Phase 3: Change from baseline in neutralizing antibody response as measured by pseudovirus-based neutralization assay [Time frame: from baseline to day 393]

[0273] Eligibility Criteria Eligible age for the exam: 18 years or older Eligible genders for the exam: All Based on gender: None Accepting healthy volunteers: Yes

[0274] Main inclusion criteria: • You work or live in an environment with a high risk of SARS-CoV-2 exposure, and that exposure may be relatively long-term, or in particular, in confined spaces where personal protective equipment (PPE) is not consistently used. • Screening test results within the normal range for clinical testing, or determining that the principal investigator is not clinically important. • Postmenopausal status, surgical infertility, partner infertility, or use of medically effective contraception with a failure rate of less than 1% per year when used consistently and correctly from screening to 3 months after the last dose.

[0275] Main exclusion criteria: • Acute febrile illness with a body temperature > 100.4°F (38.0°C), or acute onset of upper or lower respiratory tract symptoms (e.g., cough, shortness of breath, sore throat). • Positive serum or molecular (reverse transcription polymerase chain reaction [RT-PCR]) test for SARS-CoV-2 at screening. • You must be pregnant or breastfeeding, or intend to become pregnant or become a father within the planned duration of the trial, starting with a screening visit within 3 months of your last dose. • A known history of uncontrolled HIV within the past three months, based on CD4 counts or detectable viral loads of fewer than 200 cells per cubic millimeter ( / mm^3). • You are currently participating in or have previously participated in a clinical trial using the investigational drug within 30 days prior to day 0. • You have previously received an investigational vaccine for the prevention or treatment of COVID-19, Middle East Respiratory Syndrome (MERS), or Severe Acute Respiratory Syndrome (SARS) (if you have a record of receiving a placebo in a previous trial, you are eligible for the trial). • Respiratory conditions requiring significant changes in treatment or hospitalization due to disease exacerbation within the six weeks prior to registration (e.g., asthma, chronic obstructive pulmonary disease). • Immunosuppression as a result of an underlying disease or treatment • There are no acceptable sites available for ID injection and EP. • Blood donation or transfusion within one month prior to day 0. • Reporting of alcohol or drug abuse or dependence, or use of illegal drugs (excluding cannabis use). • Any disease or condition that, in the opinion of the principal investigator, could affect the safety of the participant or the evaluation of any trial endpoint.

[0276] Example 8: A one- or two-dose regimen of the SARS-CoV-2 DNA vaccine INO-4800 provides protection against airway disease burden in a non-human primate (NHP) challenge model. The safety, immunogenicity, and efficacy of intradermal delivery of INO-4800, a synthetic DNA vaccine candidate encoding the SARS-CoV-2 spike antigen, were evaluated in a rhesus monkey model. Single-dose and two-dose vaccination regimens were assessed. Vaccination induced both binding and neutralizing antibodies against SARS-CoV-2, along with IFN-γ-producing T cells. Using high-dose SARS-CoV-2 Victoria01 strain (5 × 10^6 pfu), the impact of INO-4800 vaccination on lung disease burden was specifically evaluated, providing data on both vaccine safety and efficacy. A wide range of lower respiratory tract disease parameters were measured by applying histopathology, lung disease scoring metric systems, insight hybridization, viral RNA RT-PCR, and computed tomography (CT) scans to provide an understanding of the impact of vaccine-induced immunization on protective effects and potential vaccine-enhancing disease (VED).

[0277] This example describes the evaluation of the immunogenicity, efficacy, and safety of the SARS-CoV-2 DNA vaccine INO-4800 in a rigorous high-dose non-human primate challenge model. Intradermal delivery of 1 mg of INO-4800 to rhesus monkeys induced humoral and T-cell responses to the SARS-CoV-2 spike antigen in both two-dose and suboptimal one-dose regimens. No apparent clinical events were recorded in the animals throughout the study. Following high-dose SARS-CoV-2 challenge, reductions in viral load and lung disease burden were observed in both the one-dose and two-dose vaccine groups, supporting the efficacy of INO-4800. Importantly, vaccine enhancement disease (VED) was not observed, even in the one-dose group.

[0278] method: Vaccine. An optimized DNA sequence encoding the SARS-CoV-2 IgELS spike was constructed using Inovio's proprietary in silico gene optimization algorithm to enhance expression and immunogenicity. The optimized DNA sequence was synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate early promoter and bovine growth hormone polyadenylation signaling.

[0279] Animals: This study used 18 rhesus macaques (Macaca mulatta) of Indian origin. The test group consisted of 3 males and 3 females of each species, all adults aged 2.5–3.5 years, and weighing over 4 kg at the time of the challenge. Before the start of the experiment, socially compatible animals were randomly assigned to the challenge group to minimize bias. The animals were housed in cages in suitable social groups in accordance with the UK Home Office Code of Practice for the Housing and Care of Animals Provided or Used for Scientific Procedures (2014), and the National Commission for Improvement, Reduction and Exchange of Primates in Housing, Care and Use (NC3R) Guidelines, August 2006. Pre- and inter-challenge containment is described in [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19.bioRxiv, 2020:p.2020.09.17.301093.]. All experimental work was subject to on-site ethical review by the Animal Welfare Ethics Board (AWERB) at PHE Porton Down and was carried out under the authority of a UK Home Office Approved Project License (PDC57C033), approved in accordance with the requirements of the Home Office Animals (Scientific Treatment) Act of 1986. For procedures requiring removal from containment, animals were sedated by intramuscular (IM) injection with ketamine hydrochloride (Ketaset, 100 mg / ml, Fort Dodge Animal Health Ltd, Southampton, UK; 10 mg / kg). None of the animals had been previously used in experimental procedures.

[0280] Vaccination. Animals received 1 mg of SARS-CoV-2 DNA vaccine, INO-4800, by intradermal injection on day 28 only (1-dose group) or on days 0 and 28 (2-dose group), followed by electroporation (EP) treatment using a CELLECTRA 2000®-compatible constant current electroporation device with a 3P array (Inovio Pharmaceuticals).

[0281] During the vaccination phase, serum and heparinized whole blood were collected from animals under sedation every other week. Nasal and throat swabs were also collected on the 56th day, the day of the challenge. After the challenge, nasal swabs, throat swabs, and serum were collected at 1, 3, 5 dpc and cull (6, 7, or 8 dpc - alternating for a higher level of work involved in the procedure), and heparinized whole blood was collected at 3 dpc and cull. Nasal and throat swabs were obtained as described [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p.2020.09.17.301093.].

[0282] Clinical observation. Animals were monitored multiple times a day for behavioral and clinical changes. Behavior was assessed for contraindications, including depression, social withdrawal, aggression, changes in feeding patterns, respiratory patterns, respiratory rate, and coughing. Animals were observed and scored for activity and health throughout the tests as follows: Key: Activity level: A0 = active and agile; A1 = active only when stimulated by the operator; A2 = inactive / immobile even when stimulated; H = healthy; S = sneezing, C = cough, Nd = nasal discharge, Od = eye discharge, Rn = breath sounds, Lb = forced breathing, L = lethargy, Di = diarrhea, Ax = loss of appetite, Dx = dehydration, RD = dyspnea. Throughout the tests, the animals' body weight, body temperature, and hemoglobin levels were measured and recorded.

[0283] Viruses and cells SARS-CoV-2 Victoria / 01 / 2020 [Caly, L., et al., Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia. Med J Aust, 2020. 212(10): p.459-462] was provided generously by The Doherty Institute, Melbourne, Australia, as P1 cells after primary proliferation in Vero / hSLAM cells [ECACC04091501]. These cells were then passaged twice in Vero / hSLAM cells [ECACC04091501] using PHE Porton Down. Cell infection was performed with approximately 0.0005 MOI of virus, and the remaining attached cells were dissociated by gentle agitation with sterile 5 mm borosilicate beads. Subsequently, the cells were clarified by centrifugation at 1,000 × g for 10 minutes and collected on day 4. Whole-genome sequencing was performed on P3 challenge stocks using both Nanopore and Illumina as described in Lewandowski, K., et al., Metagenomic Nanopore Sequencing of Influenza Virus Direct from Clinical Respiratory Samples. J Clin Microbiol, 2019. 58(1). Viral titers in the challenge stocks were determined by plaque assay on Vero / E6 cells [ECACC 85020206]. Cell lines were obtained from the European Certified Cell Culture Collection (ECACC) PHE, Porton Down, UK. Cell cultures were maintained at 37°C in minimal essential medium (MEM) (Life Technologies, California, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma, Dorset, UK) and 25 mM HEPES (Life Technologies, California, USA). In addition, the Vero / hSLAM culture was supplemented with 0.4 mg / ml of genethicin (Invitrogen) to maintain the expression plasmid.The challenge substance was diluted in phosphate-buffered saline (PBS). Inoculum (5 × 10). 6 PFU was delivered via endotracheal route (2 ml) and intranasal infusion (1.0 ml total, 0.5 ml per nostril).

[0284] Computed tomography for clinical signs and in vivo imaging CT scans were performed two weeks and five days before SARS-CoV-2 challenge. CT imaging was performed on sedated animals in both supine and prone positions using a 16-slice Lightspeed CT scanner (General Electric Healthcare, Milwaukee, WI, USA), and the scans were evaluated by medical radiologists specializing in respiratory diseases (as previously described [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19.2020:p.2020.09.17.301093.]). To provide the ability to distinguish differences between individual NHPs with small disease volumes (i.e., less than 25% lung lesions), an improved scoring system was designed to assign scores for the possession of unusual and specific features of COVID in human patients (COVID pattern score) and the distribution of features through the lungs (zone score). The COVID pattern score was calculated as the sum of the number of identified nodules, the presence and extent of GGOs, and the score assigned to consolidation, according to the following system: Nodules: A score of 1 was assigned for one nodule, a score of 2 for two or three nodules, and a score of 3 for four or more nodules. GGOs: Each affected area was scored as follows: A score of 1 for areas measured less than 1 cm, a score of 2 for 1-2 cm, a score of 3 for 2-3 cm, and a score of 4 for areas greater than 3 cm. The scores for each area of ​​the GGO were summed to provide a total GGO score. Consolidation: Each affected area was scored as follows: A score of 1 for areas measured less than 1 cm, a score of 2 for 1-2 cm, a score of 3 for 2-3 cm, and a score of 4 for areas greater than 3 cm. The scores for each area of ​​the consolidation were summed to provide a total consolidation score. Compared to GGOs, the scoring system was weighted by doubling the score assigned to consolidation in order to account for the estimated additional disease impact of consolidation on the host.To determine the zone score, the lung was divided into 12 zones, and each side of the lung (top to bottom) was further divided into three zones: the upper zone (above the keel), the middle zone (from the keel to the inferior pulmonary vein), and the lower zone (below the inferior pulmonary vein). Each zone was further divided into two regions: the anterior region (the region anterior to the vertical line of the midpoint of the diaphragm in the sagittal position) and the posterior region (the region posterior to the vertical line of the midpoint of the diaphragm in the sagittal position). This resulted in a total of 12 zones, each of which was assigned a score of 1, indicating structural changes. The COVID pattern score and zones were summed to provide the total CT score.

[0285] Autopsy and histopathology of carcasses. Animals were euthanized at three different time points in groups of six (including one animal of each species and sex) at 6, 7, and 8 dpc. Bronchoalveolar lavage fluid (BAL) was collected from the right lung at autopsy. The left lung was dissected before BAL collection and used for subsequent histopathological and virological procedures. At autopsy, nasal and throat swabs, heparinized whole blood, and serum were collected along with tissue samples for histopathology. Samples from the left skull and left caudal lung lobe, along with the spleen, kidneys, liver, mediastinal and axillary lymph nodes, small intestine (duodenum), large intestine (colon), trachea, laryngeal inoculation site, and inflow area lymph nodes, were fixed by immersion in 10% neutral buffered formalin and conventionally treated with paraffin wax. 4 μm sections were cut, stained with hematoxylin and eosin (H&E), and examined under a microscope. A lung histopathology scoring system [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p. 2020.09.17.301093] was used to evaluate lesions affecting the airways and parenchyma. Lung histopathology was assessed using three tissue sections from each left lung lobe. In addition, samples were stained using RNAscope technology to identify SARS-CoV-2 viral RNA in the lung tissue sections. Briefly, tissues were pre-treated with hydrogen peroxide for 10 minutes (room temperature), followed by target recovery for 15 minutes (98-102°C), and protease plus for 30 minutes (40°C) (Advanced Cell Diagnostics). The V-nCoV2019-S probe (SARS-CoV-2 spike gene specific) was incubated on the tissue at 40°C for 2 hours. In addition, the samples were stained using RNAscope technology to identify SARS-CoV-2 viral RNA. Signal amplification was performed according to the RNAscope protocol using the RNAscope 2.5HD Detection Kit-Red (Advanced Cell Diagnostics, Biotechne).All H&E and ISH-stained slides were digitally scanned using a Panoramic 3D-Histech scanner and viewed using CaseViewer v2.4 software. The presence of viral RNA by ISH was assessed using whole lung tissue section slides. Digital image analysis was performed on RNAscope-labeled slides using the Nikon-NIS-Ar software package to confirm the percentage of stained cells within the lesions.

[0286] Quantification of viral load by RT-qPCR. RNA was isolated from nasal and throat swabs. Samples were inactivated in AVL (Qiagen) and ethanol. Downstream extraction was then performed using the BioSprint® 96 One-For-All vet kit (Indical) and Kingfisher Flex platform according to the manufacturer's instructions. Tissues were homogenized in buffer RLT + betamercaptoethanol (Qiagen). The tissue homogenates were then centrifuged using a QIAshredder homogenizer (Qiagen) according to the manufacturer's instructions and supplemented with ethanol. Downstream extraction was then performed from the tissue samples using the BioSprint® 96 One-For-All vet kit (Indical) and Kingfisher Flex platform according to the manufacturer's instructions.

[0287] Viral load was determined using reverse transcription quantitative polymerase chain reaction (RT-qPCR) targeting the SARS-CoV-2 nucleocapsid (N) gene region, performed using TaqPath® 1-Step RT-qPCR Master Mix, CG (Applied Biosystems®), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies), and QuantStudio® 7 Flex Real-Time PCR System. The sequences of the N1 primers and probes were as follows: 2019-nCoV_N1-forward, 5'GACCCCAAAATCAGCGAAAT3' (SEQ ID NO: 18); 2019-nCoV_N1-reverse, 5'TCTGGTTACTGCCAGTTGAATCTG3' (SEQ ID NO: 19); 2019-nCoV_N1-probe, 5'FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3' (SEQ ID NO: 20). The cycle conditions were as follows: 2 minutes at 25°C, 15 minutes at 50°C, 2 minutes at 95°C, followed by 3 seconds at 95°C and 30 seconds at 55°C for 45 cycles. The quantification standard was in vitro transcribed RNA of SARS-CoV-2N ORF (accession number NC_045512.2) with quantification of 1–6 log copies / μl. Positive swabs and fluid samples detected below the limit of quantification (LoQ) of 4.11 log copies / ml were assigned a value of 5 copies / μl, which is equivalent to 3.81 log copies / ml, while undetectable samples were assigned a value of less than 2.3 copies / μl, which corresponds to the limit of detection (LoD) of the assay, equivalent to 3.47 log copies / ml. Positive tissue samples detected below the limit of quantification (LoQ) of 4.76 log copies / ml were assigned a value of 5 copies / μl, which is equivalent to 4.46 log copies / g. Undetected samples were assigned a value of less than 2.3 copies / μl, which corresponds to the lower limit of detection (LoD) of the assay, equivalent to 4.76 log copies / g.

[0288] Subgenome RT-qPCR was performed on a QuantStudio® 7 Flex Real-Time PCR System using oligonucleotides specified by TaqMan® Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) and Wolfel, et al. Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465-469 (2020), with forward primers, probes, and reverse primers at final concentrations of 250 nM, 125 nM, and 500 nM, respectively. The sequences of the sgE primers and probes were as follows. 2019-nCoV_sgE-forward, 5'CGATCTCTTGTAGATCTGTTCTC3' (SEQ ID NO: 21); 2019-nCoV_sgE-reverse, 5'ATATTGCAGCAGTACGCACACA3' (SEQ ID NO: 22); 2019-nCoV_sgE-probe, 5'FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ13' (SEQ ID NO: 23).

[0289] The cycle conditions consisted of 45 cycles of 10 minutes at 50°C, 2 minutes at 95°C, followed by 10 seconds at 95°C and 30 seconds at 60°C. RT-qPCR amplicons were quantified against an in vitro transcription RNA standard of a full-length SARS-CoV-2 E ORF (accession number NC_045512.2) preceded by a UTR reader sequence and a putative E gene transcription regulatory sequence, as described by Wolfel et al [Wolfel, R., Corman, VM, Guggemos, W. et al. Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465-469 (2020)]. Positive samples detected below the lower limit of quantification (LLOQ) were assigned a value of 5 copies / μl, while undetectable samples were assigned a value of 0.9 copies / μl or less, corresponding to the lower limit of detection (LLOD) of the assay. For the extracted nasal swabs, throat swabs, and BAL samples, these correspond to LLOQ of 4.11 log copies / mL and LLOD of 3.06 log copies / mL. For the tissue samples, these correspond to LLOQ of 4.76 log copies / g and LLOD of 3.71 log copies / g.

[0290] Plaque reduction neutralization test. Neutralizing virus titer was measured in heat-inactivated (56°C, 30 minutes) serum samples. SARS-CoV-2 titer was 1.4 × 10⁶. 3 The serum was diluted to a concentration of pfu / ml (70 pfu / 50 μl) and mixed 50:50 in 1% FCS / MEM in 1:10 to 1:320 doubling serum dilutions in a 96-well V-bottom plate. The plate was incubated in a humidified box at 37°C for 1 hour to allow antibodies in the serum sample to neutralize the virus. The neutralized virus was transferred to the wells of a 24-well plate for a washed plaque assay (see plaque assay method), adsorbed for another 1 hour at 37°C, and then overlaid on plaque assay overlay medium. After incubation for 5 days at 37°C in a humicated box, the plate was fixed, stained, and plaques were counted.

[0291] Antigen-binding ELISA. Recombinant SARS-CoV-2 spike and RBD-specific IgG responses were determined by ELISA. Full-length trimers and stabilized forms of the SARS-CoV-2 spike protein were supplied by Lake Pharma (No. 46328). Recombinant SARS-CoV-2 receptor-binding domains (319-541) Myc-His were developed and kindly provided by MassBiologics. High-binding 96-well plates (Nunc Maxisorp, 442404) were coated with 50 μl per well of 2 μg / ml spike trimer (S1+S2) or RBD in 1× PBS (Gibco) and incubated overnight at 4°C. ELISA plates were washed and blocked for 1 hour with 5% fetal bovine serum (FBS, Sigma, F9665) in 1× PBS / 0.1% Tween® 20 at room temperature. Serum collected from animals after vaccination was initially diluted to 1 / 50, followed by eight 2-fold serial dilutions. After challenging, the samples were inactivated in 0.5% Triton and then diluted to an initial 1 / 100, followed by eight 3-fold serial dilutions. Serial dilutions were performed in 10% FBS in 1×PBS / 0.1% Tween® 20. After washing the plates, 50 μl / well of each serum dilution was added in two sequences to antigen-coated plates and incubated at room temperature for 2 hours. After washing, anti-monkey IgG conjugated to HRP (Invitrogen, PA1-84631) was diluted in 10% FBS in 1×PBS / 0.1% Tween® 20 (1:10,000), and 100 μl / well was added to the plates. The plates were then incubated at room temperature for 1 hour. After washing, a 1 mg / ml solution of O-phenylenediamine dihydrochloride (Sigma P9187) was prepared and 100 μl was added per well. Progression was stopped with 50 μl of 1 M hydrochloric acid (Fisher Chemical, J / 4320 / 15) per well, and absorbance at 490 nm was read using a Molecular Devices versamax plate reader with Softmax (version 7.0). Titer was determined using an endpoint titer determination method.For each sample, the endpoint titer is defined as the interaction of the highest sample dilution that yields a reading (OD) above the cutoff. The cutoff was determined for each experimental group as the mean OD + 3SD for the naive sample.

[0292] Isolation and resuscitation of peripheral blood mononuclear cells. PBMCs were isolated from whole blood coagulated with heparin (132 units per 8720 mL of blood) (BD Biosciences, Oxford, UK) using standard methods. PBMCs isolated from tissue were stored at -180°C. For resuscitation, PBMCs were thawed, washed with 1 U / ml DNase (Sigma) in R10 medium (RPMI 1640 supplemented with 2 mM L-glutamine, 50 U / ml penicillin-50 μg / ml streptomycin, and 10% thermoinactivated FBS), resuspended in R10 medium, and incubated overnight at 37°C and 5% CO2.

[0293] The ELISpot IFNγ assay was used to estimate the frequency of SARS-CoV-2 specific T cells and IFNγ production capacity in PBMCs using a human / monkey IFNγ kit (MabTech, Nacka, Sweden), as previously described [Sibley, LS, et al., ELISPOT Refinement Using Spot Morphology for Assessing Host Responses to Tuberculosis. Cells, 2012.1(1):p.5-14.]. Cells were measured at 2 × 10⁶ cells per well. 5The assay was performed on individual cells. Cells were stimulated overnight with a SARS-CoV-2 peptide pool spanning the ECD spike protein. 748 peptide pools were used, each consisting of 15-mer peptides with 9 amino acid duplication. Phorbol 12-myristate (Sigma) (100 ng / ml) and ionomycin (CN Biosciences, 753 Nottingham, UK) (1 mg / ml) were used as positive controls. Results were calculated and reported as spot-forming units (SFUs) per million cells. All SARS-CoV-2 peptides were dual-assayed, and antigen-specific SFUs were obtained by subtracting wells containing only culture medium. ELISPOT plates were analyzed using a CTL scanner and software (CTL, Germany), and further analysis was performed using GraphPad Prism (GraphPad Software, USA).

[0294] Statistics. All statistical analyses were performed using GraphPad Prism 7 or 8 software (La Jolla, CA). Data were considered significant if p < 0.05. The types of statistical analyses performed are detailed in the legend of the figures. Samples or animals were not excluded from the analysis.

[0295] result: Immunogenicity of single-dose and dual-dose regimens of INO-4800. Twelve rhesus monkeys (6 males and 6 females) were vaccinated with either a single dose (6 monkeys) or dual doses (6 monkeys) of INO-4800 on day 28, or on day 0 and day 28, respectively (Figure 22A). For each treatment, 1 mg of INO-4800 was administered intradermally, followed by CELLECTRA-ID EP. Six age- and sex-matched animals were provided as a control group without vaccination. Animals were observed and scored as agile and healthy throughout the study period, and no adverse events or clinical abnormalities were recorded (Figure 23). Serum titers of SARS-CoV-2 spike antigen-reactive IgG antibodies were measured every other week from day 0 to day 56 in all animals. In the single-dose group (INO-4800 X1), 14 days after vaccination, the mean endpoint titers were 467 for the SARS-CoV-2 spike antigen trimer S1+S2 ECD morphology, 442 for the RBD antigen, and 239 for live virus (Victoria / 01 / 2020, matched to the challenge strain) neutralizing titers (Figure 22B-D). In the two-dose group (INO-4800 X2), 2,142 mean endpoint titers were measured for the S1+S2 ECD, 1,538 for the RBD antigen, and 2,199 for live virus neutralizing titers, 14 days after the second vaccination (Figure 22B-D). Vaccination with INO-4800 induced a SARS-CoV-2 spike antigen-specific Th1 T cell response in the PBMC population as measured by IFN-γ ELISpot (Figure 22E). In summary, intradermal delivery of INO-4800 induced functional humoral and T-cell responses to the SARS-CoV-2 spike protein, enhanced after the second dose. On the day of viral challenge (day 56), serum levels of SARS-CoV-2 neutralizing antibodies were significantly higher in the vaccinated group compared to the control group (p=0.015). From day 56 to days 62-64 after viral challenge, there was a slight increase in SARS-CoV-2 spike binding and neutralizing antibody titers in all groups (Figure 22B-D).In the control group, there was an increase in the cellular immune response to peptides across the SARS-CoV-2 spike antigen after viral challenge, but there was little change in the vaccinated group, likely due to the control of viral infection by the humoral arm of the host immune system (Figure 22F).

[0296] Viral load in the upper and lower respiratory tract after SARS-CoV-2 challenge On day 56, all animals were challenged by delivering a total of 5 × 10^6 pfu of SARS-CoV-2 into both the upper and lower respiratory tracts. No obvious clinical symptoms were observed in any of the animals throughout the challenge period (6–8 days) (Figures 23A–23C). Nasal and throat swabs were collected from the animals at the indicated time points. The SARS-CoV-2 viral genome (viral RNA) and subgenome (sgmRNA) representing the replicated virus were measured by RT-qPCR (Figures 24A and 25A). Analysis of the area under the curve (AUC) level of viral RNA in the throat revealed a significant decrease in levels in the vaccinated group (Figure 24B). Furthermore, the peak viral load level measured in the INO-4800 X2 group was significantly lower compared to the control group (Figure 24C). Analysis revealed a significant inverse correlation between throat viral load and neutralizing and anti-RBD IgG titers (Figures 15A–15D). SARS-CoV-2 sgmRNA data revealed a similar trend to the decrease in viral load in the vaccinated group compared to the control group (Figures 25A-C). Analysis of the nasal compartment revealed a trend towards decreased viral RNA and sgmRNA levels and accelerated clearance in the vaccinated group compared to the control group, but this did not reach a statistically significant level (Figures 24D-F and 25D-F). Analysis revealed a significant inverse correlation between nasal viral load and neutralizing and anti-RBD IgG titers on day 3, but this was not evident on day 1 (Figures 15E-15H).

[0297] BAL fluid was collected from each animal at necropsy (6-8 days after challenge). Measurement of SARS-CoV-2 viral RNA and sgmRNA levels revealed a decrease in the mean viral load in the vaccinated group, although levels fluctuated within each group depending on the day of necropsy (Figures 26A, 26B). RT-qPCR was also performed on tissues collected at necropsy. At these points after challenge, the detected SARS-CoV-2 viral RNA levels were below the limit of quantification in most tissues except the lungs (Figure 27). Measurement of SARS-CoV-2 viral mRNA and sgmRNA levels detected in lung tissue samples showed a decrease in the mean viral load in vaccinated animals (Figures 26C and 26D).

[0298] In summary, the data showed a significant reduction in viral load in the throat and a trend toward a reduction in viral load in the lungs in the vaccinated group. BAL and lung tissue sampling at different time points after challenge (day 6, day 7, or day 8) would likely add to the observed within-group variability that would affect statistical analysis. RT-qPCR viral load data showed that INO-4800 vaccination had a positive effect on reducing viral load in rhesus monkeys challenged with high doses of SARS-CoV-2, with generally lower viral levels measured in the two-dose vaccine group compared to the single-dose vaccine group.

[0299] Lung disease burden after SARS-CoV-2 challenge. Lung disease burden was assessed in lung tissue collected at autopsy 6–8 days after the challenge. Analysis was performed in a double-blind manner on all animals in the study. Histopathological analysis of lung tissue was performed on multiple organ tissues, but only the lungs showed significant lesions consistent with SARS-CoV-2 infection. Lung lesions consistent with SARS-CoV-2 infection were observed in the lungs of animals from unvaccinated controls and at reduced levels in the vaccinated group. Representative histopathological images are provided in Figure 28. Briefly, the lung parenchyma consisted of multifocal to fused areas of pneumonia surrounded by unaffected parenchyma. Alveolar injury with necrosis of lung cells was a prominent feature in the affected areas. The alveolar spaces and interalveolar septa contained mixed inflammatory cells (including macrophages, lymphocytes, viable and degenerated neutrophils, and occasionally eosinophils) and edema. Type II lung cell hyperplasia was also observed in the distal bronchioles and bronchioloalveolar junctions. In larger airways, lesions, epithelial degeneration, and carcinogenesis were occasionally observed in the airway epithelium. A small number of mixed inflammatory cells, including neutrophils, lymphocytes, and occasionally eosinophils, infiltrated the bronchi and bronchial walls. In the lumens of some airways, mucus containing degenerated cells, mainly neutrophils and epithelial cells, was observed. Within the parenchyma, perivascular and peribronchiolar cellular infiltration was also observed, mostly consisting of lymphoid cells with infiltration.

[0300] Disease burden was quantified by applying the histopathological score and percentage of tissue area for SARS-CoV-2 RNA positivity. The unvaccinated group showed the highest histopathological score in the lungs compared to the vaccinated group (Figures 29A and 29C). Animals from the vaccinated group showed similar histopathological scores to the unvaccinated animals, with the exception of animal number 10A from the INO-4800X1 group, showing reduced pathology compared to the unvaccinated animals. Insights hybridization (ISH) was performed to detect the presence of SARS-CoV-2 RNA in lung tissue. Viral RNA was observed in lung cells and inflammatory cells within histopathological lesions at a reduced frequency in the vaccinated animals (Figure 29B).

[0301] CT scans were performed to provide unbiased, quantifiable in vivo metrics for lung disease. Results from lung CT imaging performed 5 days after SARS-CoV-2 challenge were evaluated for the presence of ground-glass opacities (GGO), consolidation, crazy paving, nodules, perilobular consolidation; distribution—upper, middle, lower, central 2 / 3, peripheral, and bronchial central—characteristic of COVID-19 disease, and pulmonary embolism. Medical radiologists were blinded to the treatment and clinical status of the animals. The extent of lung lesions was assessed and quantified using a scoring system developed for COVID disease. The parameters of the scoring system are provided in the Materials and Methods section. Lung abnormalities characteristic of COVID-19 disease were observed in 3 out of 6 animals and 2 out of 6 animals in the INO-4800 1-dose or 2-dose groups, respectively, and in 5 out of 6 unvaccinated animals in the control group (representative CT scan images are provided in Figure 30). The extent of lung lesions in animals with diseased lesions was less than 25%, and was considered a low level of disease (Figure 29D). Disease scores were highest in the unvaccinated control group and tended to decrease in the INO-4800 1-dose and 2-dose groups (Figures 29E-29G). Comparisons of scores between groups did not reach statistically significant differences (p=0.0584 between the two INO-4800 dose groups and the unvaccinated group, Mann-Whitney test). One outlier animal (10A) in the INO-4800 X1 group showed a higher score than the other animals. However, the disease level was still considered low, and a comparable disease burden was observed in other NHP SARS-CoV-2 challenge trials conducted under the same conditions. In summary, CT scanning provides a useful measure of SARS-CoV-2-induced disease in rhesus monkeys. Low-level abnormalities were reported five days after SARS-CoV-2 infection (involving less than 25% of the lungs). Evidence from CT scans suggested a trend in pulmonary disease burden between groups, with the highest disease burden in the unvaccinated control group.

[0302] In summary, animals that received a single dose of a two-dose regimen of INO-4800 vaccine after high-dose SARS-CoV-2 challenge in non-human primates showed reduced disease burden. Animals that received a suboptimal single-dose vaccination regimen also showed no signs of vaccine-enhancing disease.

[0303] Consideration This example describes the evaluation of the safety, immunogenicity, and efficacy of the SARS-CoV-2 DNA vaccine INO-4800 in a rigorous high-dose non-human primate challenge model. Intradermal delivery of 1 mg of INO-4800 to rhesus monkeys induced both humoral and T-cell responses to the SARS-CoV-2 spike antigen in both two-dose and one-dose regimens. No apparent clinical events were recorded in the animals throughout the study. Following the high-dose SARS-CoV-2 challenge, reductions in viral load and lung disease burden were observed in both the one-dose and two-dose vaccine groups, supporting the efficacy of INO-4800. Importantly, vaccine enhancement disease (VED) was not observed, even in the one-dose group.

[0304] The rhesus macaque model has become a widely used model for evaluating medical response to SARS-CoV-2. Importantly, wild-type non-adapted SARS-CoV-2 replicates in the respiratory tract of rhesus macaques, and the animals exhibit some of the features observed in humans with mild COVID-19 symptoms [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19.2020:p.2020.09.17.301093., Munoz-Fontela, C., et al., Animal models for COVID-19. Nature, 2020.586(7830):p.509-515]. Here, we focused on the lung disease burden in SARS-CoV-2 challenged rhesus macaques vaccinated with INO-4800. Although the levels of lung disease burden measured in animals were mild, a significant decrease in histopathology and viral detection scores in the lungs of vaccinated animals was observed (Figure 29). This suggests a potential positive impact on LRT disease observed in COVID-19 patients progressing to severe illness. Interestingly, a significant decrease in viral load in the throat compartment of the upper respiratory tract was also observed, but this was merely a trend toward the decrease in the nasal compartment. Different inductions of mucosal immunity may exist between the throat and nasal compartments. Interestingly, on day 1 post-challenge, a significant inverse correlation was observed between serum RBD-targeted antibodies and neutralizing antibodies in viral load in the throat, but not in the nose (Figure 15). However, levels of these antibodies in any of these URT compartments were not assayed to provide further evidence of increased levels of functional antibodies in the throat compared to the nasal cavity. Another possibility is widespread (5 × 10⁻⁶). 6It is possible that viral control in the nasal compartment to which a SARS-CoV-2 challenge dose of pfu was directly injected is at a higher level than in other mucosal compartments. Supporting this, data from control animals have shown that nasal swabs yield higher viral titers than throat swabs, and similar observations have been reported in COVID-19 subjects [Mohammadi, A., et al., SARS-CoV-2 detection in different respiratory sites: A systematic review and meta-analysis. EBioMedicine, 2020. 59: p.102903.].

[0305] Importantly, the data showed that enhanced respiratory disease (ERD) was not associated with INO-4800 immunization in either the single-dose or dual-dose regimen. In the INO-4800 x1 dose group, one animal (10A) showed the highest lung histopathology and CT scan scores. However, the multifocal lesions in animal 10A showed a similar histopathological pattern to those observed in animals from the unvaccinated group, and there was no apparent influx of different inflammatory cell subpopulations into the infiltrates. A potential feature of vaccine-enhanced disease is an increased influx of inflammatory cells such as eosinophils [Bolles, M., et al., A double-inactivated severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge. J Virol, 2011. 85(23): p.12201-15; Yasui, F., et al., Prior Immunization with Severe Acute Respiratory Syndrome (SARS)-Associated Coronavirus (SARS-CoV) Nucleocapsid Protein Causes Severe Pneumonia in Mice Infected with SARS-CoV. The Journal of Immunology, 2008. 181(9): p.6337-6348.]. CT scan and histopathological data for animal 10A were not associated with ERD and, rather, appeared to be similar in disease score and pattern to those of unvaccinated animals.Similar lung histopathological inflammation scores ranging from minimal to mild to mild to moderate were reported in samples analyzed 7 or 8 days after challenging in rhesus monkeys receiving other vaccine candidates [Corbett, KS, et al., Evaluation of the mRNA-1273 Vaccine against SARS-CoV-2 in Nonhuman Primates. New England Journal of Medicine, 2020. 383(16):p.1544-1555]. Currently, VED remains a theoretical concern regarding SARS-CoV-2 vaccination, and attempts to induce enhanced disease using formalin-inactivated whole virus preparations of SARS-CoV-2 have failed to replicate the pulmonary pathologies previously reported for other inactivated respiratory virus vaccines [Bewley, KR, et al., Immunological and pathological outcomes of SARS-CoV-2 challenge after formalin-inactivated vaccine immunization of ferrets and rhesus macaques. 2020: p. 2020.12.21. 423746].

[0306] This data complements the NHP SARS-CoV-2 challenge trial that demonstrated a reduction in LRT viral load several months after immunization with INO-4800 (Example 9). However, there are clear differences between trials, including different doses and variants used for the challenge stock, as well as the timing of the challenge. In the trial described in this example, animals were challenged four weeks after the last vaccination at a time when high levels of circulating neutralizing antibodies were present. In other trials, serum SARS-CoV-2 neutralizing antibody levels were low at the time of challenge, and protection appeared to depend on the recall of a memory response accompanied by a potent humoral and cellular response to the SARS-CoV-2 spike antigen detected in the animals. No similar magnitude of prior response was observed here, suggesting that protection may have been mediated by antibodies present in circulation at the time of challenge, supported by a correlation between serum SARS-CoV-2 targeted antibody levels and a reduction in viral load (Figure 15).

[0307] In conclusion, the results from this rigorous preclinical SARS-CoV-2 animal model provide further support for the efficacy and safety of the DNA vaccine INO-4800 as a preventive measure against COVID-19. Importantly, when tested as a single-dose immunization, the inventors observed a positive effect on lung disease burden and no VED was observed. Combined with the clinical data for INO-4800, INO-4800 possesses many attributes in terms of safety, efficacy, and logistical feasibility due to its high stability, thus negating the need for cold chain distribution requirements for global access. Furthermore, synthetic DNA vaccine technology is well-suited to highly accelerated development timelines, enabling the rapid design and testing of candidates for novel SARS-CoV-2 variants that exhibit potential for immune evasion [Wibmer, CK, et al., SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma. 2021: p. 2021.01.18.427166.; Moore, JP and PAOffit, SARS-CoV-2 Vaccines and the Growing Threat of Viral Variants. JAMA, 2021.].

[0308] Example 9: The SARS-CoV-2 DNA vaccine induces humoral and cellular immunity that results in a memory response providing past protection in rhesus monkey challenges. The immunogenicity of a synthetic DNA vaccine encoding the SARS-CoV-2 spike protein has been previously demonstrated in both mice and guinea pigs (Example 1). In this example, the durability of the INO-4800-induced immune response in rhesus monkeys is demonstrated. ID-EP administration in rhesus monkeys induces cellular and humoral responses to the SARS-CoV-2 S protein, with further cross-reactivity to the SARS-CoV-1 S protein. The protective effect is demonstrated for longer than 3 months post-final immunization, demonstrating the establishment of a pre-existing immune response and a reduction in viral load in vaccinated macaques. Following viral challenge, a reduction in subgenomic messenger RNA (sgmRNA) BAL viral load was observed compared to control animals administered 1 mg (one-fifth of the DNA dose) via intradermal (ID) delivery. This is associated with the induction of rapid recall responses in both the cellular and humoral immune arms, supporting the potential of INO-4800 as a candidate for moderate disease. No adverse events or evidence of vaccine-enhancing disease (VED) were observed in the vaccinated animals. A decrease in viral subgenomic RNA levels was observed in the lower lungs and lower vein ligament (VL). A trend toward VL reduction was observed in the nose. These data support the possibility that immunization with this DNA vaccine candidate may limit active viral replication, reduce disease severity, and decrease viral shedding in the nasal cavity.

[0309] The initial viral load detected in the control animals in this study was similar to that of a similar published study conducted under identical conditions (approximately 10%). 7 PFU / swab) (Yu et al., 2020, Science, eabc6284) was on average 1-2 log higher (10 in 4 / 5 NHP one day after the challenge) 9It is important to note that PFU / swab administration is required. Only two of the previously reported NHP trials included intranasal delivery as the route of administration for the challenge (van Doremalen et al., 2020, bioRxiv 2020.05.13.093195, Yu et al., 2020, Science, eabc6284). High-dose challenge vaccination is frequently used to ensure infection, but non-lethal systems such as this SARS-CoV-2 rhesus monkey model can artificially reduce the impact of potential protective vaccines and interventions (Durudas et al., 2011, Curr HIV Res 9, 276-288, Innis et al., 2019, Vaccine 37, 4830-4834). Despite these limitations, this study demonstrated a significant decrease in peak BAL sgmRNA and overall viral RNA, likely induced by rapid induction of immunological memory mediated by both B and T cell compartments. Wolfel et al. found a mean 6.5 × 10⁶ levels in patients 1–5 days post-symptom onset. 5 We reported nasal titers in copies / swabs (Wolfel et al., 2020, Nature 581, 465-469). These titers were significantly lower than the challenge dose and supportability for early control of the vaccine candidate during SARS-CoV-2 infection.

[0310] This study suggests that DNA vaccination with vaccine candidates targeting the full-length SARS-CoV-2 spike protein is likely to increase the availability of T cell immunodominant epitopes, resulting in a broader and more potent immune response compared to partial domains and cleaved immunogens. In this study, T cell cross-reactivity was observed against SARS-CoV-1.

[0311] In addition to T cells, INO-4800 induced a robust antibody response that rapidly increased after SARS-CoV-2 challenge. Further demonstration shows that INO-4800 induced a robust neutralizing antibody response against both the D614 and G614 SARS-CoV-2 variants. The D / G 614 site is located outside the RBD, and this shift has been suggested to potentially affect vaccine-induced antibodies (Korber B et al., 2020, Cell 182:1-16). Other studies have reported that the G614 variant exhibits increased SARS-CoV-2 infectivity (Hu et al., 2020, bioRxiv 2020.06.20.161323, Ozono S, 2020, bioRxiv 2020.06.15.151779). The data show comparable induction of neutralizing titers between the D614 and G614 variants, indicating that these responses are similarly recalled after the SARS-CoV-2 challenge.

[0312] material and method Non-human primate immunization, IFNγ ELISpot and ELISA A highly optimized DNA sequence encoding the DNA vaccine, INO-4800:SARS-CoV-2 IgE spike, was constructed using Inovio's proprietary in silico gene optimization algorithm to enhance expression and immunogenicity (Smith et al., 2020, Nat Commun 11, 2601). The optimized DNA sequence was synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate early promoter and bovine growth hormone polyadenylation signaling.

[0313] Animals: All rhesus monkey experiments were approved by the Institutional Animal Care and Use Committee of Bioqual (Rockville, Maryland) and an internationally accredited facility of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). Blood was collected for hemochemistry, PBMC isolation, and serological analysis. BAL was collected at 8 weeks to assay lung antibody levels, and collected on days 1, 2, 4, and 7 after the challenge to assay lung viral load.

[0314] Immunization, sampling, and viral challenge. Ten Chinese rhesus macaques (ranging from 4.55 kg to 5.55 kg) were randomly assigned to either an immunization study (3 males and 2 females) or a naive study (2 males and 3 females). Immunized macaques received two injections of 1 mg of SARS-CoV-2 DNA vaccine, INO-4800, at weeks 0 and 4 by ID-EP administration using a CELLECTRA 2000® adaptive constant current electroporation device (Inovio Pharmaceuticals) with a 3P array. Blood was collected at indicated time points for blood chemistry and analysis of peripheral blood mononuclear cells (PBMCs) isolation, and serum was collected for serological analysis. Bronchoalveolar lavage was collected at week 8 to assay lung antibody levels. BAL from naive animals was used as a control. At week 17, all animals were tested for 1.2 × 10⁶ 8 VP(1.1×10 4 The challenge was conducted using PFU)SARS-CoV-2. The virus was administered as 1 ml via the intranasal (IN) route (0.5 ml in each nostril) and 1 ml via the intratracheal (IT) route.

[0315] Peripheral blood mononuclear cell isolation. Blood was collected from each macaque into sodium citrate cell preparation tubes (CPT, BD Biosciences). The tubes were centrifuged to separate plasma and lymphocytes according to the manufacturer's protocol. Samples were transported from Bioqual to The Wistar Institute in cold packs on the same day for PBMC isolation. PBMCs were washed and residual erythrocytes were removed using ammonium chloride-potassium (ACK) lysis buffer. Cells were counted using a ViCell counter (Beckman Coulter) and resuspended in RPMI 1640 (Corning) supplemented with 10% fetal bovine serum (Atlas) and 1% penicillin / streptomycin (Gibco). Fresh cells were then plated for IFNγ ELISpot assay and flow cytometry.

[0316] IFN-γ enzyme-coupled immunosorbent spot (ELISpot). A monkey interferon-gamma (IFN-γ) ELISpot assay was performed to detect cellular responses. Monkey IFN-γ ELISpotPro (alkaline phosphatase) plates (Mabtech, Sweden, catalog no. 3421M-2APW-10) were blocked for at least 2 hours with RPMI 1640 (Corning) supplemented with 10% FBS and 1% penn / strep (R10). After PBMC isolation, 200,000 macaque-derived cells were added to each well in the presence of either 1) a duplicate peptide pool (15-mer with 9-mer duplication) corresponding to SARS-CoV-1, SARS-CoV-2, or MERS-CoV spike protein (5 μg / mL / final well concentration), 2) R10 containing DMSO (negative control), or 3) an anti-CD3 positive control (Mabtech, 1:1000 dilution). All samples were plated in triplicate. The plates were incubated overnight at 37°C in 5% CO2. After 18–20 hours, the plates were washed in PBS, and the spots were developed according to the manufacturer's protocol. Spots were imaged using a CTL Immunospot plate reader, and antigen-specific response was determined by subtracting the number of spots in the R10+DMSO-negative control well from the number of spots in the peptide pool-stimulated wells.

[0317] Antigen-binding ELISA. Serum and BAL samples were collected at each time point and evaluated for binding titer as shown. 96-well immunosorbent plates (NUNC) were coated overnight at 4°C with 1 ug / mL of recombinant SARS-CoV-2 S1+S2 ECD protein (Sino Biological 40589-V08B1), S1 protein (Sino Biological 40591-V08H), S2 protein (Sino Biological 40590-V08B), or receptor-binding domain (RBD) protein (Sino Biological 40595-V05H) in DPBS. ELISA plates were also coated with 1 ug / mL of recombinant SARS-CoV S1 protein (Sino Biological 40150-V08B1) and RBD protein (Sino Biological 40592-V08B) or MERS-CoV spike (Sino Biological 40069-V08B). The plates were washed four times with PBS + 0.05% Tween® 20 (PBS-T) and blocked at 37°C for 90 minutes with 5% skim milk powder in PBS-T (5% SM). Macac serum or BAL vaccine-vaccinated with INO-4800 was serially diluted in 5% SM and added to the washed ELISA plates, and incubated at 37°C for 1 hour. After incubation, the plates were washed four times with PBS-T and anti-monkey IgG conjugated with horseradish peroxidase (Southern Biotech 4700-5). The plates were washed four times with PBS-T and a one-step TMB solution (Sigma) was added to the plates. The reaction was stopped with an equal volume of 2N sulfuric acid. The plates were read at 450 nm and 570 nm within 30 minutes of development using a Biotek Synergy2 plate reader.

[0318] ACE2 competitive ELISA - non-human primates. 96-well half-area plates (Corning) were coated with 1 μg / mL PolyRab anti-His antibody (ThermoFisher, PA1-983B) at room temperature for 3 hours, and then blocked overnight with blocking buffer containing 1× PBS, 5% skim milk powder, 1% FBS, and 0.2% Tween®-20. The plates were then incubated with 10 μg / mL His6x-tagged SARS-CoV-2 (disclosed as "His6x" as SEQ ID NO: 25), S1+S2 ECD (Sinobiological, 40589-V08B1) at room temperature for 1-2 hours. NHP serum (day 0 or week 6) was serially diluted 3-fold in 1× PBS containing 1% FBS and 0.2% Tween® and pre-mixed with huACE2-IgMu at a constant concentration of 0.4 ug / ml. Next, the pre-mixture was added to the plate and incubated at room temperature for 1-2 hours. The plate was further incubated at room temperature for 1 hour with goat anti-mouse IgG H+L HRP (A90-116P, Bethyl Laboratories) at a 1:20,000 dilution, followed by the addition of a one-step TMB supersubstrate (ThermoFisher), and then quenched with 1M H2SO4. Absorbance at 450nm and 570nm was recorded using a BioTEK plate reader.

[0319] Flow cytometry-based ACE2 receptor binding inhibition assay. HEK-293T cells stably expressing ACE2-GFP were generated using retroviral transduction. After transduction, cells were fluid-sorted based on GFP expression to isolate GFP-positive cells. Single-cell cloning was performed on these cells to generate cell lines with equivalent ACE2-GFP expression. To detect inhibition of spike binding to ACE2, cells were incubated on ice for 60 minutes with serum collected from vaccinated animals at time of identification, and a 2.5 μg / ml dilution of the S1+S2 ECD-his tag (Sino Biological, catalog no. 40589-V08B1), and incubated on ice for 60 minutes. This mixture was then transferred to 150,000 293T-ACE2-GFP cells and incubated on ice for 90 minutes. After this, the cells were washed twice with PBS and subsequently stained with surelight® APC conjugate anti-his antibody (Abcam, ab72579) on ice for 30 minutes. As a positive control, spike protein was pre-incubated with recombinant human ACE2 and then transferred to 293T-Ace2-GFP cells. Data were acquired using BD LSRII and analyzed by FlowJo (version 10).

[0320] Pseudovirus neutralization assay. SARS-CoV-2 pseudovirus was prepared using HEK293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.RE- plasmid (NIH AIDS reagent) in a 1:1 ratio. 48 hours after transfection, the transfection supernatant was collected, concentrated to 12% final volume with FBS, filtered sterile (Millipore Sigma), and set aside for storage at -80°C. The SARS-CoV-2 pseudovirus neutralization assay was set up using D10 medium (DMEM supplemented with 10% FBS and 1× penicillin-streptomycin) in a 96-well format. CHO cells stably expressing Ace2 were used as target cells (Creative Biolabs, catalog no. VCeL-Wyb019). SARS-CoV-2 pseudovirus was titrated to obtain a relative luminescence unit (RLU) level greater than 20 times that of the control cells 72 hours after infection. To set up the neutralization assay, 10,000 CHO-ACE2 cells were plated in 100 μl of D10 medium in a 96-well plate and allowed to stand overnight at 37°C and for 24 hours in 5% CO2. The following day, monkey and rabbit serum from the INO-4800-vaccinated group and the control group was heat-inactivated and serially diluted as desired. The serum was incubated with a fixed amount of SARS-CoV-2 pseudovirus at room temperature for 90 minutes. 50 μl of medium was removed from the wells containing the plated CHO-ACE2 cells. After 90 minutes, the mixture was added to the plated CHO-ACE2 cells and incubated for 72 hours in a standard incubator (37% humidity, 5% CO2). After 72 hours, cells were lysed using the britelite plus luminescence reporter gene assay system (Perkin Elmer catalog number 6066769), and RLU was measured using a Biotek plate reader. Neutralizing titer (ID50) was calculated using GraphPad Prism 8 and defined as a cross-serum dilution in which RLU was reduced by 50% compared to RLU in the virus control well, after subtracting background RLU in the cell control well.

[0321] Viral RNA assay. Viral load was monitored using an RT-PCR assay, essentially as previously described (Abnink P et al 2019 Science). Briefly, RNA was extracted from bronchoalveolar lavage (BAL) supernatant and nasal swabs using QIAcube HT (Qiagen, Germany) and Cador pathogen HT kits. The RNA was reverse transcribed using superscript VILO (Invitrogen) and run in double cycles using QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems) according to the manufacturer's specifications. Viral load was calculated as viral RNA copies per mL or per swab, with assay sensitivity of 50 copies. The target for amplification was the SARS-CoV2 N (nucleocapsid) gene. The primers and probes for the target were as follows: 2019-nCoV_N1-F:5'-GACCCCAAAATCAGCGAAAT-3'(SEQ ID NO: 18);2019-nCoV_N1-R:5'-TCTGGTTACTGCCAGTTGAATCTG-3'(SEQ ID NO: 19);2019-nCoV_N1-P:5'-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3'(SEQ ID NO: 20).

[0322] Subgenome mRNA assay. SARS-CoV-2 E gene subgenome mRNA (sgmRNA) was evaluated by RT-PCR using an approach similar to that previously described (Wolfel R et al. 2020, Nature, 581, 465-469). To generate a standard curve, SARS-CoV-2 E gene sgmRNA was cloned into a pcDNA3.1 expression plasmid, and this insert was transcribed using an AmpliCap-Max T7 High Yield Message Maker Kit (Cellscript) to obtain RNA for the standard. Prior to RT-PCR, sample...

Claims

1. A nucleic acid molecule encoding the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike antigen, wherein the nucleic acid molecule is A nucleic acid sequence having at least 99% identity over the entire length of the nucleic acid sequence described in nucleotides 55 to 3837 of Sequence ID No. 2, Nucleic acid sequences having at least 99% identity throughout the entire length of Sequence ID No. 2, The nucleic acid sequence of nucleotides 55 to 3837 of Sequence ID No. 2, or Nucleic acid sequence of sequence number 2, Nucleic acid molecules, including those mentioned above.

2. An expression vector comprising the nucleic acid molecule described in claim 1.

3. The expression vector according to claim 2, comprising the nucleic acid sequence of SEQ ID NO:

3.

4. An immunogenic composition comprising an effective amount of the expression vector according to claim 2 or claim 3 and a pharmaceutically acceptable excipient.

5. The immunogenic composition according to claim 4, wherein the pharmaceutically acceptable excipient comprises a buffer.

6. The immunogenic composition according to claim 5, wherein the composition comprises 10 mg of the vector per 1 ml of physiological saline-sodium citrate buffer.

7. The immunogenic composition according to any one of claims 4 to 6, further comprising an adjuvant.

8. A pharmaceutical composition for inducing an immune response to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in subjects requiring such induction, comprising an effective amount of the immunogenic composition described in any one of claims 4 to 7.

9. A pharmaceutical composition for protecting a subject requiring protection from infection by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), comprising an effective amount of the immunogenic composition according to any one of claims 4 to 7.

10. A pharmaceutical composition for treating a subject requiring treatment for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, comprising an effective amount of the immunogenic composition described in any one of claims 4 to 7.

11. The pharmaceutical composition according to any one of claims 8 to 10, wherein the pharmaceutical composition is formulated to be administered by at least one of electroporation and injection.

12. The pharmaceutical composition according to any one of claims 8 to 10, wherein the pharmaceutical composition is formulated to be administered parenterally, followed by electroporation.

13. The pharmaceutical composition according to any one of claims 8 to 12, wherein the pharmaceutical composition is formulated to be administered in a dose of the vector of 0.5 mg to 2.0 mg.

14. The pharmaceutical composition according to any one of claims 8 to 12, wherein the pharmaceutical composition is formulated to be administered in a dose of 0.5 mg, 1.0 mg, or 2.0 mg of the vector.

15. A pharmaceutical composition according to any one of claims 8 to 14, used in combination with at least one additional agent for the treatment of SARS-CoV-2 infection or for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection.

16. Use of the vector according to claim 2 or claim 3 in the preparation of a pharmaceutical product.

17. Use of the vector according to claim 2 or 3 in the preparation of a pharmaceutical product for treating or protecting against infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

Images