Pyrazole-1-carboxamides as rip1 kinase inhibitors

Abstract

The invention provides novel substituted heterocyclic rings represented by Formula I, or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or prodrug thereof, and a composition comprising these compounds. The compounds provided can be used as inhibitors of RIPK1 and the therapeutic methods.

Description

PYRAZOLE-1-CARBOXAMIDES AS RIP1 KINASE INHIBITORS

[0001] This invention relates to a series of substituted heterocyclic compounds which are inhibitors of receptor-interacting protein-1 (RIP1) kinase-mediated disease or disorder and use the therapeutics.

[0002] Receptor-interacting protein-1 (RIPl) kinase is a serine / threonine protein kinase, referred to as RIPK1, RIP1 or RIP. RIPl kinase has a crucial role whether the cell live or die. RIP1 is involved in the apoptosis and non-apoptotic cell death; necroptosis [1]. The intracellular domains of TNF receptor1(TNFR1), FAS and TRAIL receptor 2 (TRAILR2) together include death domain (DD), they were stimulated by ligands tumor necrosis factor alpha (TNFα), Fas ligand (FASL) and TRAIL which recruit RIP1 and binding of their DD to that of RIP1. Stimulation of TNFR1 by TNFα leads to the formation of the complex I which leads to the activation of NF-kB has an important role in modulating the RIP1 of activation and activates an important cell survival program [2]. RIP1 activation can lead to cell death pathway by the formation of a RIP1-TNF receptor associated death domain protein (TRADD)-FAS-associated DD protein (FADD) - caspase 8 complexes (complex IIa), which stimulates caspase activation and leads to RIPK1-dependent apoptosis (RDA). [3-9]. If caspase-8 activity is blocked, the recruited protein receptor-interacting serine / threonine-protein kinase 3 (RIPK3) kinase which drives necroptosis by driving formation of a RIP1-RIP3- mixed lineage kinase domain-like (MLKL) complex (complex IIb), which drives the cell lysis and disruption of cell membrane [10-11].

[0003] Necroptosis and RIP1 have been serve a crucial checkpoint during embryonic development. The activation of necroptosis and RIP1 may represent an important pathological mechanism and implicated in many human diseases by mediating cell death and inflammation. Necroptosis may also has been related to disordered of pathogenesis of the central nervous system (CNS) diseases, atherosclerosis, Huntington's disease, colitis, steatohepatitis, acute hepatitis, stroke, myocardial infarction, the intestinal epithelium and skin. Therefore, necroptosis inhibitors are a crucial role for clinical drug development. [12-14]

[0004] Necroptosis can be inhibited by inactivating RIP1 kinases or RIP3 kinase. The first and often used inhibitor of necroptosis is RIP1-inhibitor necrostatin-1 (Nec-1). Nec-1 demonstrated efficiencyin vitroandin vivo. Nec-1 ameliorated renal and brain ischemia / reperfusion injury, ConA-induced hepatitis, DSS-induced colitis and decreased the symptoms of Huntington's disease in a murine study [15-19].

[0005] The novel compounds of this invention inhibit RIP1 kinase activity and are, therefore, expected to be-useful in the treatment of disease and / or condition associated with inflammation and / or necroptotic cell death

[0020] .

[0006] In recent, RIPl kinase inhibitors differ structurally from necrostatin class of compounds [21-22].

[0007] References cited above, each of which is hereby incorporated by reference in its entirety:

[0008] 1. Degterev, A., Hitomi, J., Germscheid, M., Ch'en, I., Korkina, O., Teng, X., Abbott, D., Cuny, G., Yuan, C., Wagner, G., Hedrick, S., Gerber,S., Lugovskoy, A. and Yuan, J. Identification of RIP1 kinase as a specific cellular target of necrostatins. Nat Chem Biol. 4, 313-321 (2008).

[0009] 2. Ofengeim, D. and Yuan, J. Regulation of RIP1 kinase signalling at the crossroads of inflammation and cell death. Nat. Rev. Mol. Cell Biol. 14, 727-736 (2013).

[0010] 3. Shan, B., Pan, H., Najafov, A. and Yuan, J. Necroptosis in development and diseases. Genes Dev. 32, 327-340 (2018).

[0011] 4. Vanden Berghe, T., Linkermann, A., Jouan-Lanhouet, S., Walczak, H. and Vandenabeele, P. Regulated necrosis: the expanding network of non-apoptotic cell death pathways. Nature reviews. Molecular cell biology. 15, 135-147 (2014).

[0012] 5. Newton, K. RIPK1 and RIPK3: critical regulators of inflammation and cell death. Trends in cell biology. 25, 347-353 (2015).

[0013] 6. de Almagro, M. C. and Vucic, D. Necroptosis: Pathway diversity and characteristics. Semin Cell Dev Biol. 39, 56-62 (2015).

[0014] 7. O'Donnell, M. A., Legarda-Addison, D., Skountzos, P., Yeh, W. C. and Ting, A. T. Ubiquitination of RIPl regulates an NF-kappaB-independent cell-death switch in TNF signaling. Curr Biol. 17, 418-424 (2007).

[0015] 8. Feoktistova, M., Geserick, P., Kellert, B., Dimitrova, D. P., Langlais, C., Hupe, M., Cain, K., MacFarlane, M., Hacker, G. and Leverkus, M. cIAPs block Ripoptosome formation, a RIPl / caspase-8 containing intracellular cell death complex differentially regulated by cFLIP isoforms. Molecular cell. 43, 449-463 (2011).

[0016] 9. Bertrand, M. J., Milutinovic, S., Dickson, K. M., Ho, W. C, Boudreault, A., Durkin, J., Gillard, J. W., Jaquith, J. B., Morris, S. J. and Barker, P. A. cIAPl and cIAP2 facilitate cancer cell survival by functioning as E3 ligases that promote RIPl ubiquitination. Mol Cell. 30, 689-700 (2008).

[0017] 10. Cho, Y.S., Challa, S., Moquin, D., Genga, R., Ray, T.D., Guildford, M. and Chan, F.K. Phosphorylation- driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus- induced inflammation. Cell. 137, 1112-1123 (2009).

[0018] 11. Sun, L., Wang, H., Wang, Z., He, S., Chen, S., Liao, D., Wang, L., Yan, J., Liu, W., Lei, X. and Wang, X. Mixed lineage kinase domain- like protein mediates necrosis signaling downstream of RIP3 kinase. Cell. 148, 213-227 (2012).

[0019] 12. Zhao, J., Jitkaew, S., Cai, Z., Choksi, S., Li, Q., Luo, J. and Liu, Z. G. Mixed lineage kinase domain-like is a key receptor interacting protein 3 downstream component of TNF-induced necrosis. Proceedings of the National Academy of Sciences of the United States of America. 109, 5322-5327 (2012).

[0020] 13. Sun, L., Wang, H., Wang, Z., He, S., Chen, S., Liao, D., Wang, L., Yan, J., Liu, W., Lei, X. and Wang, X. Mixed Lineage Kinase Domain-like Protein Mediates Necrosis

[0021] Signaling Downstream ofRIP3 Kinase. Cell. 148, 213-227 (2012).

[0022] 14. Linkermann, A. and Green, D. R. Necroptosis. The New England journal of medicine. 370, 455-465 (2014).

[0023] 15. Degterev, A., Huang, Z., Boyce, M., Li, Y., Jagtap, P., Mizushima, N. Cuny, G.D.,Mitchison, T.J., Moskowitz, M.A. and Yuan, J. Chemical Inhibitor of Nonapoptotic Cell Death with Therapeutic Potential for Ischemic Brain Injury. Nat. Chem. Biol. 1, 112-119 (2005).

[0024] 16. Linkermann, A., Brasen, J.H., Himmerkus, N., Liu, S., Huber, T.B., Kunzendorf, U. and Krautwald, S. Rip1 (Receptor-Interacting Protein Kinase 1) Mediates Necroptosis and Contributes to Renal Ischemia / Reperfusion Injury. Kidney Int. 81, 751-761 (2012).

[0025] 17. Jouan-Lanhouet, S., Arshad, M.I., Piquet-Pellorce, C., Martin-Chouly, C., Le Moigne-Muller, G., Van Herreweghe, F., Takahashi, N., Sergent, O., Lagadic-Gossmann, D. and Vandenabeele, P. TRAIL Induces Necroptosis Involving RIPK1 / RIPK3-Dependent PARP-1 Activation. Cell Death Differ.19, 2003-2014 (2012).

[0026] 18. Gunther, C., Martini, E., Wittkopf, N., Amann, K., Weigmann, B., Neumann, H., Waldner, M.J., Hedrick, S.M., Tenzer, S. and Neurath, M.F. Caspase-8 Regulates TNF-Alpha-Induced Epithelial Necroptosis and Terminal Ileitis. Nature. 477, 335-339 (2011).

[0027] 19. Zhu, S., Zhang, Y., Bai, G. and Li, H. Necrostatin-1 Ameliorates Symptoms in R6 / 2 Transgenic Mouse Model of Huntington's Disease. Cell. Death Dis. 2, e115 (2011).

[0028] 20. Newton, K., Dugger, D. L., Wickliffe, K. E., Kapoor, N., de Almagro, M. C, Vucic, D., Komuves, L., Ferrando, R. E., French, D. M., Webster, J., Roose-Girma, M., Warming, S. and

[0029] Dixit, V. M. Activity of protein kinase RIPK3 determines whether cells die by necroptosis or apoptosis. Science. 343, 1357-1360 (2014).

[0030] 21. Harris, P. A., Bandyopadhyay, D., Berger, S. B., Campobasso, N., Capriotti, C. A., Cox, J. A., Dare, L., Finger, J. N., Hoffman, S. J., Kahler, K. M., Lehr, R., Lich, J. D., Nagilla, R., Nolte, R. T., Ouellette, M. T., Pao, C. S., Schaeffer, M. C , Smallwood, A., Sun, H. H., Swift, B. A., Totoritis, R. D., Ward, P., Marquis, R. W., Bertin, J . and Gough, P. J. Discovery of Small Molecule RIPl Kinase Inhibitors for the Treatment of Pathologies Associated with Necroptosis. ACS medicinal chemistry letters. 4, 1238-1243 (2013).

[0031] 22. Najjar, M., Suebsuwong, C, Ray, S. S., Thapa, R. J., Maki, J. L., Nogusa, S., Shah, S., Saleh, D., Gough, P. J., Bertin, J., Yuan, J., Balachandran, S., Cuny, G. D. and Degterev, A. Structure Guided Design of Potent and Selective Ponatinib-Based Hybrid Inhibitors for RIPK1. Cell Rep. 24, 1850-1860 (2015).

[0032] The present invention is to provide a compound of formula I or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer, stereoisomer or prodrug thereof:

[0033]

[0034] wherein

[0035] R1is N-alkylamide, Pyridinone, Pyridazinone, Pyrazinone, Pyrimidinone, 4-6 membered heterocycloalkyl, or 4-6 membered heterocycloalkyl-C(O)-;

[0036] wherein said Pyridinone, Pyridazinone, Pyrazinone, Pyrimidinone, 4-6 membered heterocycloalkyl, or 4-6 membered heterocycloalkyl-C(O)- is optionally substituted by one or two substituents each independently selected from (C1-C4)alkyl, OH, (C1-C4)hydroxy, (C1-C4)alkoxy, halogen, cyano, NR3R4, and oxo;

[0037] L is O, -OCH2-, -OCH(CH3)-, -OCH2CH2-, -OCH2CH(OH)-, -OCH2CH2CH2-, -OCH2CH2CH(OH)-, -OCH2CH2CH(CH3)-, -OCH2CH2C(CH3)2-, -OCH2CH2CH2CH2-, or -OCH2CH2CH2CH(OH)-;

[0038] each R2is independently H, methyl, CF3,halogen, or cyano;

[0039] n is 1, 2 or 3;

[0040] R3and R4are independently selected from H, aliphatic, heteroaliphatic, aromatic, including aryl and heteroaryl, or heterocycloaliphatic; together with the nitrogen bound thereto provide a C3-6heterocyclic group.

[0041] In addition, the present invention is to provide a pharmaceutical composition for alleviating or ameliorating symptoms of an RIPK1 mediated disease or condition by inhibiting RIPK1 activity.

[0042] In addition, the present invention is to provide a method for alleviating or ameliorating symptoms of an RIPK1 mediated disease or condition by inhibiting RIPK1 activity.

[0043] In order to solve the technical problem, this invention provides a compound of formula I, or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or prodrug thereof:

[0044]

[0045] wherein

[0046] R1is N-alkylamide, Pyridinone, Pyridazinone, Pyrazinone, Pyrimidinone, 4-6 membered heterocycloalkyl, or 4-6 membered heterocycloalkyl-C(O)-;

[0047] wherein said Pyridinone, Pyridazinone, Pyrazinone, Pyrimidinone 4-6 membered heterocycloalkyl, or 4-6 membered heterocycloalkyl-C(O)- is optionally substituted by one or two substituents each independently selected from (C1-C4)alkyl, OH, (C1-C4)hydroxy, (C1-C4)alkoxy, halogen, cyano, NR3R4, and oxo;

[0048] L is O, -OCH2-, -OCH(CH3)-, -OCH2CH2-, -OCH2CH(OH)-, -OCH2CH2CH2-, -OCH2CH2CH(OH)-, -OCH2CH2CH(CH3)-, -OCH2CH2C(CH3)2-, -OCH2CH2CH2CH2-, or -OCH2CH2CH2CH(OH)-;

[0049] each R2is independently H, methyl, CF3,halogen, or cyano;

[0050] n is 1, 2 or 3;

[0051] R3and R4are independently selected from H, aliphatic, heteroaliphatic, aromatic, including aryl and heteroaryl, or heterocycloaliphatic; together with the nitrogen bound thereto provide a C3-6heterocyclic group.

[0052] In certain embodiments, the present invention is directed to a pharmaceutical composition comprising an effective amount of a compound of formula I or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or prodrug thereof. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, adjuvants and / or excipients.

[0053] In certain embodiments, such a composition may contain at least one of preservatives, agents for delaying absorption, fillers, binders, adsorbents, buffers, disintegrating agents, solubilizing agents, and other carriers, adjuvants and / or excipients as inert ingredients. The composition may be formulated with a method well-known in the art.

[0054] In certain embodiments, the present invention is directed to a method of treating a disease in an individual suffering from said disease comprising administering to said individual a therapeutically effective amount of a composition comprising a compound of formula I or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or prodrug thereof.

[0055] In certain embodiments, the present invention is directed to a method of treating a disorder in a mammal, comprising administering to said mammal a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or pro- drug thereof.

[0056] In certain embodiments, the present invention is directed to a method of treating a disorder in a human, comprising administering to said human a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or pro-drug thereof.

[0057] In certain embodiments, RIP1 kinase-mediated diseases or disorders are described herein and inflammatory or immune-regulatory disease or disorders include inflammatory bowel disease (including Crohn's disease and ulcerative colitis), psoriasis, systemic lupus erythematosus (SLE), retinal diseases (including age-related macular degeneration, diabetic retinopathy, glaucoma, retinal detachment, and retinitis pigmentosa), arthritis (including rheumatoid arthritis, spondylarthritis, gout, osteoarthritis, and systemic onset juvenile idiopathic arthritis (SoJIA)), graft-versus-host diseases brought about by transplantation, nonalcoholic steatohepatitis (NASH), ischemia reperfusion, multiple sclerosis, tumor necrosis factor receptor-associated periodic syndrome, multiple organ dysfunction syndrome (MODS), thermal injury / burn, systemic inflammatory response syndrome (SIRS), radiation injury, radiotherapy, chemotherapy, pneumonias, hemorrhagic shock, trauma (including multiple trauma), traumatic brain injury, acute pancreatitis, critical illness (in general), sepsis, septic shock, Stevens-Johnson syndrome, toxic epidermal necrolysis, stroke, heat stroke, stroke-associated pneumonia, Multi-Organ Dysfunction Syndrome (MODS), Acute Respiratory Distress Syndrome (ARDS), intestinal obstruction, liver cirrhosis, surgery, major abdominal operations, abdominal aortic aneurysm repair, large bowel resections, ischemia reperfusion injury (including ischemia reperfusion injury of solid organs, (gut, brain, liver, kidney), and limb ischemia), bowel ischemia (small intestine and large intestine), cardiac surgery requiring cardio-pulmonary bypass, autoimmune hepatitis, autoimmune hepatobiliary diseases, autoimmune ITP, Parkinson's Disease, Lewy body dementia, multiple system atrophy, Parkinson-plus syndromes, tauopathies, Alzheimer's Disease, Frontotemporal dementia, amyotrophic lateral sclerosis, spinal muscular atrophy, primary lateral sclerosis, Huntington's disease, ischemia, stroke, intracranial hemorrhage, cerebral hemorrhage, muscular dystrophy, progressive muscular atrophy, progressive muscular atrophy, pseudobulbar palsy, spinal muscular atrophy, inherited muscular atrophy, peripheral neuropathies, progressive supranuclear palsy, corticobasal degeneration, demyelinating disease, allergic disease, asthma, atopic dermatitis, type I diabetes, Wegener's granulomatosis, Behcet's disease, and interleukin-1 converting enzyme associated fever syndrome.

[0058] In certain embodiments, the present invention is directed to a method of treating a pancreatic cancer, metastatic adenocarcinoma of the pancreas, pancreatic ductal adenocarcinoma, mesothelioma, melanoma, colorectal cancer, acute myeloid leukemia, metastasis, glioblastoma, breast cancer, gallbladder cancer, clear cell renal carcinoma, non-small cell lung carcinoma, and radiation induced necrosis certain the RIP1 kinase-mediated disease or disorder in a mammal, including a human, comprising administering to said mammal a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt, ester, prodrug, solvate, such as hydrate, polymorph or tautomer thereof.

[0059] In certain embodiments, the present invention is directed to a method of treating a disorder or condition which is modulated by the RIP1 kinase in a mammal, including a human, comprising administering to said mammal an amount of the compound of formula I, or a pharmaceutically acceptable salt, ester, prodrug, solvate, such as hydrate, polymorph or tautomer thereof, effective to modulate said cascade. The appropriate dosage for a particular patient can be determined, according to known methods, by those skilled in the art.

[0060] In certain embodiments, the present invention is directed to use of compound of formula I or a pharmaceutically acceptable salt, ester, prodrug, solvate, such as hydrate, polymorph or tautomer thereof in the preparation of a pharmaceutical composition. The pharmaceutical composition can be used for treating a disorder or condition which is modulated by the RIP1 kinase in a mammal, including a human.

[0061] In certain embodiments, the present invention is directed to a pharmaceutical composition comprising a compound of formula I or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or prodrug thereof. In some embodiments, the pharmaceutical composition is in a form suitable for oral administration. In further or additional embodiments, the pharmaceutical composition is in the form of a tablet, capsule, pill, powder, sustained release formulation, solution and suspension. In some embodiments, the pharmaceutical composition is in a form suitable for parenteral injection, such as a sterile solution, suspension or emulsion; for topical administration as an ointment or cream or for rectal administration as a suppository. In further or additional embodiments, the pharmaceutical composition is in unit dosage forms suitable for single administration of precise dosages. In further or additional embodiments, the amount of compound of formula I is in the range of about 0.001 to about 1000 mg / kg body weight / day. In further or additional embodiments, the amount of compound of formula I is in the range of about 0.5 to about 50 mg / kg body weight / day.

[0062] In certain embodiments, the present invention is directed to a process for preparing a compound of formula I or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or prodrug thereof.

[0063] This invention relates to a series of substituted heterocyclic compounds which are inhibitors of receptor-interacting protein-1 (RIP1) kinase-mediated disease or disorder and use the therapeutics.

[0064] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized.

[0065] While preferred embodiments of the present invention have been shown and described herein such embodiments are provided by way of example only. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. Those ordinary skilled in the art will appreciate that numerous variations, changes, and substitutions are possible without departing from the invention. It is intended that the following claims define the scope of aspects of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

[0066] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in the application including, without limitation, patents, patent applications, articles, books, manuals, and treatises are hereby expressly incorporated by reference in their entirety for any purpose.

[0067] Certain Chemical Terminology

[0068] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the claimed subject matter belongs. All patents, patent applications, published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety. In the event that there is a plurality of definitions for terms herein, those in this section prevail. Where reference is made to a URL or other such identifier or address, it is understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet or other appropriate reference source. Reference thereto evidences the availability and public dissemination of such information.

[0069] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any subject matter claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. It should also be noted that use of "or" means "and / or" unless stated otherwise. Furthermore, use of the term "including" as well as other forms, such as "include", "includes", and "included" is not limiting. Likewise, use of the term comprising as well as other forms, such as "comprise", "comprises", and "comprised" is not limiting.

[0070] Definition of standard chemistry terms may be found in reference works, including Carey and Sundberg "ADVANCED ORGANIC CHEMISTRY 4THED." Vols. A (2000) and B (2001), Plenum Press, New York. Unless otherwise indicated, conventional methods of mass spectroscopy, NMR, HPLC, IR and UV / Vis spectroscopy and pharmacology, within the skill of the art are employed. Unless specific definitions are provided, the nomenclature employed in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those known in the art. Standard techniques can be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients. Reactions and purification techniques can be performed e.g., using kits of manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures can be generally performed of conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. Throughout the specification, groups and substituents thereof can be chosen by one skilled in the field to provide stable moieties and compounds.

[0071] Unless otherwise noted, the use of general chemical terms, such as though not limited to "alkyl," "amine," "aryl," are equivalent to their optionally substituted forms. For example, "alkyl," as used herein, includes optionally substituted alkyl.

[0072] The term "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances in which it does not. For example, "optionally substituted alkyl" means either "alkyl" or "substituted alkyl" as defined below. Further, an optionally substituted group may be un-substituted (e.g., CH2CH3), fully substituted (e.g., CF2CF3), mono-substituted (e.g., CH2CH2F) or substituted at a level anywhere in-between fully substituted and mono- substituted (e.g., CH2CHF2,CF2CH3, CFHCHF2, etc.). It will be understood by those skilled in the art with respect to any group containing one or more substituents that such groups are not intended to introduce any substitution or substitution patterns (e.g., substituted alkyl includes optionally substituted cycloalkyl groups, which in turn are defined as including optionally substituted alkyl groups, potentially ad infinitum) that are sterically impractical and / or synthetically non-feasible. Thus, any substituents described should generally be understood as having a maximum molecular weight of about 1,000 daltons, and more typically, up to about 500 daltons (except in those instances where macromolecular substituents are clearly intended, e.g., polypeptides, polysaccharides, polyethylene glycols, DNA, RNA and the like).

[0073] As used herein, C1-Cn, includes C1-C2, C1-C3, ... C1-Cn. By way of example only, a group designated as "C1-C4" indicates that there are one to four carbon atoms in the moiety, i.e. groups containing 1 carbon atom, 2 carbon atoms, 3 carbon atoms or 4 carbon atoms, as well as the ranges C1-C2and C1-C3. Thus, by way of example only, "C1-C4alkyl" indicates that there are one to four carbon atoms in the alkyl group, i.e., the alkyl group is selected from among methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl, and t-butyl. Whenever it appears herein, a numerical range such as "1 to 10" refers to each integer in the given range; e.g., "1 to 10 carbon atoms" means that the group may have 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, 6 carbon atoms, 7 carbon atoms, 8 carbon atoms, 9 carbon atoms, or 10 carbon atoms.

[0074] The terms "heteroatom" or "hetero" as used herein, alone or in combination, refer to an atom other than carbon and hydrogen. Heteroatoms are independently selected from among oxygen, nitrogen, sulfur, phosphorous, silicon, selenium and tin but are not limited to these atoms. In embodiments in which two or more heteroatoms are present, the two or more heteroatoms can be the same as each another, or some or all of the two or more heteroatoms can each be different from the others.

[0075] The term "alkyl" as used herein, alone or in combination, refers to an optionally substituted straight-chain, or optionally substituted branched-chain saturated hydrocarbon monoradical having from one to about ten carbon atoms, more preferably one to six carbon atoms. Examples include, but are not limited to methyl, ethyl, n-propyl, isopropyl, 2-methyl-l-propyl, 2-methyl-2-propyl, 2-methyl-l-butyl, 3 -methyl-l-butyl, 2-methyl-3-butyl, 2,2-dimethyl-l-propyl, 2-methyl-l-pentyl, 3 -methyl-1 -pentyl, 4-methyl-l-pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2 -dimethyl-l-butyl, 3,3 -dimethyl-1 -butyl, 2 -ethyl-l-butyl, n-butyl, isobutyl, sec-butyl, t-butyl, n-pentyl, isopentyl, neopentyl, tert-amyl and hexyl, and longer alkyl groups, such as heptyl, octyl and the like. Whenever it appears herein, a numerical range such as "C1-C6alkyl" or "C1_6alkyl", means that the alkyl group may consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms or 6 carbon atoms, although the present definition also covers the occurrence of the term "alkyl" where no numerical range is designated.

[0076] The term "aliphatic" as used herein, alone or in combination, refers to an optionally substituted, straight- chain or branched-chain, non-cyclic, saturated, partially unsaturated, or fully unsaturated nonaromatic hydrocarbon. Thus, the term collectively includes alkyl, alkenyl and alkynyl groups.

[0077] The terms "cycle", "cyclic", "ring" and "membered ring" as used herein, alone or in combination, refer to any covalently closed structure, including alicyclic, heterocyclic, aromatic, heteroaromatic and polycyclic fused or non-fused ring systems as described herein. Rings can be optionally substituted. Rings can form part of a fused ring system. The term "membered" is meant to denote the number of skeletal atoms that constitute the ring. Thus, by way of example only, cyclohexane, pyridine, pyran and pyrimidine are six-membered rings and cyclopentane, pyrrole, tetrahydrofuran and thiophene are five-membered rings.

[0078] The term "cycloalkyl" as used herein, alone or in combination, refers to an optionally substituted, saturated, hydrocarbon monoradical ring, containing from three to about fifteen ring carbon atoms or from three to about ten ring carbon atoms, though may include additional, non-ring carbon atoms as substituents (e.g. methylcyclopropyl).

[0079] A non-limiting example of "cycloalkyl" includes azinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxepanyl, thiepanyl, oxazepinyl, diazepinyl, thiazepinyl, 1,2,3,6-tetrahydropyridinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1,3-dioxolanyl, pyrazolinyl, dithianyl, dithiolanyl, dihydropyranyl, dihydrothienyl, dihydrofuranyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo [4. 1.0]heptyl, 3H-indolyl and quinolizinyl and the like. The terms also include all ring forms of the carbohydrates, including but not limited to the monosaccharides, the disaccharides and the oligosaccharides.

[0080] The term "aromatic" as used herein, refers to a planar, cyclic or polycyclic, ring moiety having a delocalized at-electron system containing 4n+2nelectrons, where n is an integer. Aromatic rings can be formed by five, six, seven, eight, nine, or more than nine atoms. Aromatics can be optionally substituted and can be monocyclic or fused- ring polycyclic. The term aromatic encompasses both all carbon containing rings (e.g., phenyl) and those rings containing one or more heteroatoms (e.g., pyridine).

[0081] Certain Pharmaceutical Terminology

[0082] The term "Necroptosis assay for RIP1 activity" as used herein refers to a compound that exhibits an IC50, with respect to RIP1 kinase activity, of no more than about 100 μM or not more than about 50 μM, as measured in the kinase assay described generally herein. "IC50" is that concentration of inhibitor which reduces the activity of an enzyme to half-maximal level. Compounds described herein have been discovered to exhibit inhibition against RIPK1. Compounds of the present invention preferably exhibit an IC50with respect to RIPK1 of no more than about 10 μM, more preferably, no more than about 5 μM, even more preferably not more than about 1 μM, and most preferably, not more than about 200 nM, as measured in necroptosis assay described herein.

[0083] The term "selective", "selectively", or "selectivity" as used herein refers to a compound of this invention having a lower IC50value for the enzyme as compared to any other enzymes (e.g., at least 2, 5, 10 or more-fold lower).

[0084] The term "subject", "patient" or "individual" as used herein in reference to individuals suffering from a disorder, a condition, and the like, encompasses mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non- mammals include, but are not limited to, birds, fish and the like. In one embodiment of the methods and compositions provided herein, the mammal is a human.

[0085] The terms "treat," "treating" or "treatment," and other grammatical equivalents as used herein, include alleviating, abating or ameliorating a disease or condition symptoms, preventing additional symptoms, ameliorating or preventing the underlying metabolic causes of symptoms, inhibiting the disease or condition, e.g., arresting the development of the disease or condition, relieving the disease or condition, causing regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition, and are intended to include prophylaxis. The terms further include achieving a therapeutic benefit and / or a prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the underlying disorder. For prophylactic benefit, the compositions may be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.

[0086] The terms "effective amount", "therapeutically effective amount" or "pharmaceutically effective amount" as used herein, refer to a sufficient amount of at least one agent or compound being administered which will relieve to some extent one or more of the symptoms of the disease or condition being treated. The result can be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, an "effective amount" for therapeutic uses is the amount of the composition comprising a compound as disclosed herein required to provide a clinically significant decrease in a disease. An appropriate "effective" amount in any individual case may be determined using techniques, such as a dose escalation study.

[0087] The terms "administer," "administering", "administration," and the like, as used herein, refer to the methods that may be used to enable delivery of compounds or compositions to the desired site of biological action. These methods include, but are not limited to oral routes, intraduodenal routes, parenteral injection (including intravenous, subcutaneous, intraperitoneal, intramuscular, intravascular or infusion), topical and rectal administration. Those of skill in the art are familiar with administration techniques that can be employed with the compounds and methods described herein, e.g., as discussed in Goodman and Gilman, The Pharmacological Basis of Therapeutics, current ed.; Pergamon; and Remington's, PharmaceuticalSciences(current edition), Mack Publishing Co., Easton, Pa. In preferred embodiments, the compounds and compositions described herein are administered orally.

[0088] The term "acceptable" as used herein, with respect to a formulation, composition or ingredient, means having no persistent detrimental effect on the general health of the subject being treated.

[0089] The term "pharmaceutically acceptable" as used herein, refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compounds described herein, and is relatively nontoxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[0090] The term "pharmaceutical composition," as used herein, refers to a biologically active compound, optionally mixed with at least one pharmaceutically acceptable chemical component, such as, though not limited to carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, and / or excipients.

[0091] The term "carrier" as used herein, refers to relatively nontoxic chemical compounds or agents that facilitate the incorporation of a compound into cells or tissues.

[0092] The term "agonist," as used herein, refers to a molecule such as a compound, a drug, an enzyme activator or a hormone modulator which enhances the activity of another molecule or the activity of a receptor site.

[0093] The term "antagonist," as used herein, refers to a molecule such as a compound, a drug, an enzyme inhibitor, or a hormone modulator, which diminishes, or prevents the action of another molecule or the activity of a receptor site.

[0094] The term "modulate," as used herein, means to interact with a target either directly or indirectly so as to alter the activity of the target, including, by way of example only, to enhance the activity of the target, to inhibit the activity of the target, to limit the activity of the target, or to extend the activity of the target.

[0095] The term "modulator," as used herein, refers to a molecule that interacts with a target either directly or indirectly. The interactions include, but are not limited to, the interactions of an agonist and an antagonist.

[0096] The term "pharmaceutically acceptable salt" as used herein, refers to salts that retain the biological effectiveness of the free acids and bases of the specified compound and that are not biologically or otherwise undesirable. Compounds described herein may possess acidic or basic groups and therefore may react with any of a number of inorganic or organic bases, and inorganic and organic acids, to form a pharmaceutically acceptable salt. These salts can be prepared in situ during the final isolation and purification of the compounds of the invention, or by separately reacting a purified compound in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed. Examples of pharmaceutically acceptable salts include those salts prepared by reaction of the compounds described herein with a mineral or organic acid or an inorganic base, such salts including, acetate, acrylate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, bisulfite, bromide, butyrate, butyn-1,4-dioate, camphorate, camphorsulfonate, caprylate, chlorobenzoate, chloride, citrate, cyclopentanepropionate, decanoate, digluconate, dihydrogenphosphate, dinitrobenzoate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hexyne-1,6-dioate, hydroxybenzoate, hydroxybutyrate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, iodide, isobutyrate, lactate, maleate, malonate, methanesulfonate, mandelate. metaphosphate, methoxybenzoate, methylbenzoate, monohydrogenphosphate, 1-napthalenesulfonate, 2-napthalenesulfonate, nicotinate, nitrate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, pyrosulfate, pyrophosphate, propiolate, phthalate, phenylacetate, phenylbutyrate, propanesulfonate, salicylate, succinate, sulfate, sulfite, suberate, sebacate, sulfonate, tartrate, thiocyanate, tosylate, undecanoate, and xylene sulfonate. Other acids, such as oxalic, while not in themselves pharmaceutically acceptable, may be employed in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable acid addition salts (See examples at Berge et al.,J. Pharm. Sci.1977,66, 1-19.). Further, those compounds described herein which may comprise a free acid group may react with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like. Illustrative examples of bases include sodium hydroxide, potassium hydroxide, choline hydroxide, sodium carbonate, and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like. It should be understood that the compounds described herein also include the quaternization of any basic nitrogen-containing groups they may contain. Water or oil-soluble or dispersible products may be obtained by such quaternization. See, for example, Berge et al.,supra.

[0097] The term "solvate" as used herein refers to a combination of a compound of this invention with a solvent molecule formed by solvation. In some situations, the solvate refers to a hydrate, i.e., the solvent molecule is a water molecule, the combination of a compound of this invention and water forms a hydrate.

[0098] The term "polymorph" or "polymorphism" as used herein refers to a compound of this invention present in different crystal lattice forms.

[0099] The term "ester" as used herein refers to a derivative of a compound of this invention derived from an oxoacid group and a hydroxyl group, either one of which can be present at the compound of this invention.

[0100] The term "tautomer" as used herein refers to an isomer readily interconverted from a compound of this invention by e.g., migration of a hydrogen atom or proton.

[0101] The term "pharmaceutically acceptable derivative or prodrug" as used herein, refers to any pharmaceutically acceptable salt, ester, salt of an ester or other derivative of a compound of this invention, which, upon administration to a recipient, is capable of providing, either directly or indirectly, a compound of this invention or a pharmaceutically active metabolite or residue thereof. Particularly favored derivatives or prodrugs are those that increase the bioavailability of the compounds of this invention when such compounds are administered to a patient (e.g., by allowing orally administered compound to be more readily absorbed into blood) or which enhance delivery of the parent compound to a biological compartment (e.g., the brain or lymphatic system).

[0102] Pharmaceutically acceptable prodrugs of the compounds described herein include, but are not limited to, esters, carbonates, thiocarbonates,N-acyl derivatives,N-acyloxyalkyl derivatives, quaternary derivatives of tertiary amines,N-Mannich bases, Schiff bases, amino acid conjugates, phosphate esters, metal salts and sulfonate esters. Various forms of prodrugs are well known in the art. See for exampleDesign of Prodrugs,Bundgaard, A. Ed., Elseview, 1985 andMethod in Enzymology,Widder, K. et al., Ed.; Academic, 1985, vol. 42, p. 309-396; Bundgaard, H. "Design and Application of Prodrugs" inA Textbook of Drug Design and Development,Krosgaard-Larsen and H. Bundgaard, Ed., 1991, Chapter 5, p. 113-191; and Bundgaard, H.,Advanced Drug Delivery Review,1992, 8, 1-38, each of which is incorporated herein by reference. The prodrugs described herein include, but are not limited to, the following groups and combinations of these groups; amine derived prodrugs: Hydroxy prodrugs include, but are not limited to acyloxyalkyl esters, alkoxycarbonyloxyalkyl esters, alkyl esters, aryl esters and disulfide containing esters.

[0103] The terms "enhance" or "enhancing," as used herein, means to increase or prolong either in potency or duration of a desired effect. Thus, in regard to enhancing the effect of therapeutic agents, the term "enhancing" refers to the ability to increase or prolong, either in potency or duration, the effect of other therapeutic agents on a system.

[0104] An "enhancing-effective amount," as used herein, refers to an amount adequate to enhance the effect of another therapeutic agent in a desired system.

[0105] The terms "pharmaceutical combination", "administering an additional therapy", "administering an additional therapeutic agent" and the like, as used herein, refer to a pharmaceutical therapy resulting from mixing or combining more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that at least one of the compounds described herein, and at least one co-agent, are both administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" means that at least one of the compounds described herein, and at least one co-agent, are administered to a patient as separate entities either simultaneously, concurrently or sequentially with variable intervening time limits, wherein such administration provides effective levels of the two or more compounds in the body of the patient. These also apply to cocktail therapies, e.g. the administration of three or more active ingredients.

[0106] The terms "co-administration", "administered in combination with" and their grammatical equivalents or the like, as used herein, are meant to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered by the same or different route of administration or at the same or different times. In some embodiments the compounds described herein will be co-administered with other agents. These terms encompass administration of two or more agents to an animal so that both agents and / or their metabolites are present in the animal at the same time. They include simultaneous administration in separate compositions, administration at different times in separate compositions, and / or administration in a composition in which both agents are present. Thus, in some embodiments, the compounds of the invention and the other agent (s) are administered in a single composition.

[0107] The term "metabolite," as used herein, refers to a derivative of a compound which is formed when the compound is metabolized.

[0108] The term "active metabolite," as used herein, refers to a biologically active derivative of a compound that is formed when the compound is metabolized.

[0109] The term "metabolized," as used herein, refers to the sum of the processes (including, but not limited to, hydrolysis reactions and reactions catalyzed by enzymes) by which a particular substance is changed by an organism. Thus, enzymes may produce specific structural alterations to a compound. For example, cytochrome P450 catalyzes a variety of oxidative and reductive reactions while uridine diphosphate glucuronyl transferases catalyze the transfer of an activated glucuronic-acid molecule to aromatic alcohols, aliphatic alcohols, carboxylic acids, amines and free sulfhydryl groups. Further information on metabolism may be obtained fromThe Pharmacological Basis of Therapeutics,9th Edition, McGraw-Hill (1996).

[0110] NMR spectra were recorded in DMSO-d6, MeOH-d4,and CDCl3solution in 5-mm o.d. tubes (Norell, Inc. 507-HP) at 30℃ and were collected on JEOL at 400 MHz for1H. The chemical shifts (δ) were relative to tetramethylsilane (TMS = 0.00 ppm) and expressed in ppm. LC / MS was taken on Ion-trap Mass Spectrometer on ISQ EM, Thermo Fisher Vanquish Flex (Column: hypersil Gold (C18, Ø2.1 x 50 mm, 1.9 μm, 120 Å, 30℃) operating in ESI(+) ionization mode; flow rate = 0.5 mL / min. Mobile phase = 0.01% heptafluorobutyric acid (HFBA) and 1.0% isopropyl alcohol (IPA) in water or CH3CN.

[0111]

[0112]

[0113] Intermediate 1: tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0114]

[0115] Step A: (S)-2-(tert-butoxycarbonylamino)-3-(4-methoxy-2-nitrophenoxy)propanoic acid

[0116] To a suspension of NaH (55wt%, 460 mg, 10.5 mmol) in dry DMF (20 mL) was slowly added a solution of N-Boc-L-serine (1.00 g, 4.87 mmol) in dry DMF (5.0 mL) at 0℃. The mixture was stirred at room temperature for 30 minutes and cooled to 0℃. After addition of a solution of 1-fluoro-4-methoxy-2-nitrobenzene (900 mg, 5.26 mmol) in dry DMF (5.0 mL) at 0℃, the reaction mixture was stirred at 0℃ for 2 hours. After quenched with 0.5 M aq. HCl, the mixture was extracted with EtOAc, washed with brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 4:1 to 1:1) to afford the title compound (900 mg, 48%) as a yellow oil. LC-MS: m / z = 257.01 [M+H]+.

[0117] Step B: (S)-3-(2-amino-4-methoxyphenoxy)-2-(tert-butoxycarbonylamino)propanoic acid

[0118] A suspension of (S)-2-(tert-butoxycarbonylamino)-3-(4-methoxy-2-nitrophenoxy)propanoic acid (350 mg, 0.982 mmol) and Pd / C (5wt%, 50 mg) in MeOH (10 mL) was stirred at room temperature for 2 hours under H2atmosphere (1 atm). After filtration through a Celite pad while washing with MeOH, the filtrate was concentratedin vacuoto afford the title compound (200 mg, 62%) as a black solid. LC-MS: m / z = 326.89 [M+H]+.

[0119] Step C: (S)-tert-butyl 7-methoxy-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-ylcarbamate

[0120] To solution of (S)-3-(2-amino-4-methoxyphenoxy)-2-(tert-butoxycarbonylamino)propanoic acid (320 mg, 0.981 mmol) in DMSO (3.0 mL) was added DIPEA (514 μL, 2.94 mmol) followed by HATU (373 mg, 0.981 mmol) at 0℃. The reaction mixture was stirred at room temperature for 30 minutes. After quenched with ice-water, the mixture was extracted with EtOAc, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1) to afford the title compound (200 mg, 66%) as a white solid.1H-NMR (400 MHz, CDCl3): δ7.17 (1H, brs), 6.90 (1H, d,J =8.8 Hz), 6.68-6.64 (2H, m), 5.48 (1H, brs), 4.69-4.61 (2H, m), 4.21 (1H, t,J =9.6 Hz), 3.79 (3H, s), 1.42 (9H, s).

[0121] Step D: tert-butyl (S)-(7-methoxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0122] To a solution of (S)-tert-butyl 7-methoxy-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-ylcarbamate (200 mg, 0.649 mmol) in DMF (5.0 mL) was added Cs2CO3(254 mg, 0.778 mmol) followed by a solution of MeI (48.7 μL, 0.778 mmol) in DMF (1.0 mL) at 0℃. The reaction mixture was stirred at 0℃ for 4 hours and then at room temperature for further 1 hour. After quenched with ice-water, the mixture was extracted with EtOAc, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 3:1) to afford the title compound (150 mg, 72%) as a colorless oil. LC-MS: m / z = 266.87 [M-tBu+H]+.

[0123] Step E: (S)-3-amino-7-hydroxy-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0124] To a solution of tert-butyl (S)-(7-methoxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (1.90 g, 5.89 mmol) in DCM (19 mL) was added BBr3(18.0 mL, 17.7 mmol) at 0℃. The reaction mixture was stirred at room temperature for 4 hours. A precipitated solid was collected by filtration, washed with Et2O and dried under vacuum to afford the title compound (1.70 g, 100%) as a white solid.1H-NMR (400 MHz, DMSO-d6): δ 9.49 (1H, s), 6.90 (1H, d,J =8.4 Hz), 6.68 (1H, d,J =2.8 Hz), 6.54 (1H, dd,J =9.0, 2.6 Hz), 4.13 (1H, dd,J =9.8, 7.3 Hz), 3.85-3.80 (1H, m), 3.51 (1H, dd,J =11.6, 8.0 Hz), 3.19 (3H, s).

[0125] Step F: tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0126] To a solution of (S)-3-amino-7-hydroxy-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one (300 mg, 1.44 mmol) in DMF (4.8 mL) was added (Boc)2O (629 mg, 2.88 mmol) and DMAP (35.0 mg, 0.288 mmol) at room temperature. The reaction mixture was stirred for 18 hours at room temperature. After quenched with water, the mixture was extracted with EtOAc, washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 3:1 to 1:1) to afford the title compound (205 mg, 46%) as a white solid.1H-NMR (400 MHz, DMSO-d6): δ 9.59 (1H, s), 7.08 (1H, d,J =8.8 Hz), 6.94 (1H, d,J =8.8 Hz), 6.74 (1H, d,J =2.8 Hz), 6.58 (1H, dd,J =8.2, 3.0 Hz), 4.33-4.27 (1H, m), 4.18-4.12 (2H, m), 3.14 (3H, s), 1.30 (9H, s).

[0127]

[0128] Intermediate 2: 4-(3-fluorobenzyl)-1H-pyrazole hydrochlolide

[0129]

[0130] Step A: 4-(3-fluorobenzyl]-1-(oxan-2-yl)pyrazole

[0131] To a solution of 1-(oxan-2-yl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (27.0 g, 97.1 mmol) and 1-(bromomethyl)-3-fluorobenzene (23.9 g, 126 mmol) in DME (189 mL), EtOH (54 mL) and H2O (54 mL) was added Pd(PPh3)4(2.24 g, 1.94 mmol) and K3PO4(61.8 g, 291 mmol) at room temperature. The reaction mixture was stirred at 60℃ for 5 hours under N2atmosphere. After dilution with water at room temperature, the mixture was extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by column chromatography on SiO2(pet. Ether:EtOAc = 5:1) to afford the title compound (25.0 g, 98%) as a yellow solid. LC-MS: m / z = 261.1 [M+H]+.

[0132] Step B: 4-(3-fluorobenzyl)-1H-pyrazole hydrochlolide

[0133] To a solution of 4-(2-fluorobenzyl)-1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazole (24.0 g, 92.2 mmol) in EtOAc (240 mL) was added HCl (4 M in 1,4-dioxane, 96.0 g, 2.63 mol) at 0℃. The reaction mixture was stirred at room temperature overnight. A precipitated solid was collected by filtration, washed with EtOAc, and dried under vacuum to afford the title compound (10.8 g, 55%) as an off-white solid.1H-NMR (400 MHz, DMSO-d6): δ 11.78 (2H, s), 7.88 (2H, d,J =2.6 Hz), 7.33 (1H, td,J =8.0, 6.2 Hz), 7.12 - 6.92 (3H, m), 3.86 (2H, s). LC-MS: m / z = 177.0 [M+H]+.

[0134]

[0135] Intermediate 3: (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0136]

[0137] Step A: (S)-3-amino-7-hydroxy-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0138] To a solution of tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1, 3.50 g, 11.4 mmol) in DCM (57 mL) was added HCl (4 M in dioxane, 14.2 mL, 56.8 mmol) at 0℃. The reaction mixture was stirred at room temperature for 20 hours and concentrated in vacuo to afford the title compound as a white solid, which was used for the next step without further purification.1H-NMR (400 MHz, CDCl3): δ 8.04 (1H, d,J =7.2 Hz), 7.89 (1H, d,J =0.8 Hz), 7.48 (1H, s), 7.28-7.23 (1H, m), 7.05-7.02 (1H, m), 6.97-6.85 (3H, m), 6.67-6.64 (2H, m), 5.83 (1H, s), 4.87 (1H, dt,J =11.2, 7.6 Hz), 4.67 (1H, dd,J =9.8, 7.4 Hz), 4.24 (1H, dd,J =10.8, 9.6 Hz), 3.81 (2H, s), 3.38 (3H, s).

[0139] Step B: (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0140] To a solution of (S)-3-amino-7-hydroxy-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride (2.78 g, 11.4 mmol) in DCE (57 mL) was added TEA (4.75 mL, 34.1 mmol) followed by CDI (2.12 g, 13.1 mmol) at 0℃. The reaction mixture was stirred at room temperature for 1 hour. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was dissolved in DCE (57 mL). After addition of 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2, 2.90 g, 13.6 mmol) and TEA (4.75 mL, 34.1 mmol) at 0℃, the reaction mixture was stirred at room temperature overnight. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1) to afford the title compound (1.50 g, 32%) as a white foam.1H-NMR (400 MHz, DMSO-d6) δ 9.81 (1H, s), 8.48 (3H, s), 7.05 (1H, d,J =8.8 Hz), 6.83 (1H, d,J =2.8 Hz), 6.69 (1H, dd,J =8.8, 2.8 Hz), 4.49 (1H, dd,J =9.6, 8.0 Hz), 4.33 (1H, t,J =10.4 Hz), 4.22 (1H, dd,J =11.0, 7.8 Hz), 3.29 (3H, s).

[0141]

[0142]

[0143] Intermediate 4: (S)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethyl methanesulfonate

[0144]

[0145] Step A: [(4S)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl]acetic acid

[0146] A solution of (-)-malic acid (10.0 g, 74.6 mmol) andp-TsOH (100 mg, 0.746 mmol) and in 2,2-dimethoxypropane (37 mL) was stirred at room temperature for 3.5 hours. After quenched with water at 0℃, the mixture was extracted with DCM twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residual solid with triturated with Et2O and collected by filtration to afford the title compound (4.10 g, 31%) as a white solid.1H-NMR (400 MHz, CDCl3): δ 9.34 (1H, s), 4.72 (1H, dd,J =6.5, 3.9 Hz), 3.00 (1H, dd,J =17.3, 3.9 Hz), 2.86 (1H, dd,J =17.3, 6.5 Hz), 1.63 (3H, s), 1.58 (3H, s).

[0147] Step B: (5S)-5-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolan-4-one

[0148] To the solution of [(4S)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl]acetic acid (4.00 g, 23.0 mmol) in THF (50 mL) was added BH3-THF (1 M in THF, 27.6 mL, 27.6 mmol) at 0℃. The reaction mixture was stirred at room temperature for 2 hours. After quenched with MeOH at 0℃, the mixture was concentrated in vacuo to afford the title compound, which was used in the next step without further purification.1H-NMR (400 MHz, CDCl3): δ 4.58 (1H, dd,J =7.1, 5.0 Hz), 3.94-3.77 (2H, m), 2.97 (1H, dd,J =17.2, 3.8 Hz), 2.22-2.10 (1H, m), 2.02 (1H, dtd,J =14.6, 6.8, 4.6 Hz), 1.64 (3H, s), 1.57 (3H, s).

[0149] Step C: (5S)-5-{2-[(tert-butyldimethylsilyl)oxy]ethyl}-2,2-dimethyl-1,3-dioxolan-4-one

[0150] To a solution of (5S)-5-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolan-4-one (7.00 g, 43.7 mmol) in DMF (150 mL) was added with imidazole (5.95 g, 87.4 mmol) followed by TBSCl (7.90 g, 52.4 mmol) at 0℃. The reaction mixture was stirred at room temperature for 4 hours. After quenched with ice-water at 0℃, the mixture was extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by column chromatography on SiO2(pet.Ether:EtOAc = 4:1) to afford the title compound (2.30 g, 19% for 2 steps) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 3.52 (2H, dd,J =9.9, 4.9 Hz), 3.47-3.43 (1H, m), 1.63-1.57 (2H, m), 1.54 (3H, s), 1.47 (3H, s), 0.83 (9H, s), -0.01 (6H, d,J =2.9 Hz).

[0151] Step D: (3S)-5-[(tert-butyldimethylsilyl)oxy]-2-methylpentane-2,3-diol

[0152] To a solution of (5S)-5-{2-[(tert-butyldimethylsilyl)oxy]ethyl}-2,2-dimethyl-1,3-dioxolan-4-one (2.20 g, 8.02 mmol) in Et2O (25 mL) and added MeMgBr (2.39 g, 20.0 mmol) at 0℃. The reaction mixture was stirred at room temperature for 1 hour. After quenched with saturated aq. NH4Cl at 0℃, the resulting mixture was extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by column chromatography on SiO2(pet.Ether:EtOAc = 1:4) to afford the title compound (316 mg, 15%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 3.90-3.69 (2H, m), 3.58-3.49 (1H, m), 2.74 (2H, s), 1.65-1.52 (2H, m), 1.11 (3H, s), 1.07 (3H, s), 0.82 (9H, s), -0.00 (6H, d,J =0.9 Hz).

[0153] Step E:tert-butyldimethyl{2-[(4S)-2,2,5,5-tetramethyl-1,3-dioxolan-4-yl]ethoxy}silane

[0154] A solution of (3S)-5-[(tert-butyldimethylsilyl)oxy]-2-methylpentane-2,3-diol (316 mg, 1.27 mmol) andp-TsOH (3.16 mg) in 2,2-dimethoxypropane (1.17 mL) was stirred at room temperature for 1 hour. After quenched with MeOH at 0℃, the resulting mixture was extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by column chromatography SiO2(pet.Ether:EtOAc = 10:1) to afford the title compound (239 mg, 65%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 3.80 (1H, dd,J =9.6, 3.1 Hz), 3.76-3.60 (2H, m), 1.68-1.50 (2H, m), 1.35 (3H, d,J =0.8 Hz), 1.26 (3H, d,J =0.8 Hz), 1.18 (3H, s), 1.02 (3H, s), 0.83 (9H, s), -0.00 (6H, d,J =2.2 Hz).

[0155] Step F: (S)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethan-1-ol

[0156] To a solution of (S)-tert-butyldimethyl(2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethoxy)silane (100 mg, 0.347 mmol) in THF (0.50 mL) was added TBAF (1 M in THF, 0.437 mL, 0.437 mmol) at 0℃. The reaction mixture was stirred at room temperature for 1 hour. After quenched with saturated aq.NaHCO3, the mixture was extracted with EtOAc, washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 10:1 to EtOAc only) to give the title compound (51.0 mg, 84%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 3.87-3.77 (3H, m), 2.34-2.16 (1H, brs), 1.81-1.74 (1H, m), 1.66-1.59 (1H, m), 1.41 (3H, s), 1.34 (3H, s), 1.25 (3H, s), 1.11 (3H, s).

[0157] Step G: (S)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethyl methanesulfonate

[0158] To a solution of (S)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethan-1-ol (51.0 mg, 0.293 mmol) in DCM (0.80 mL) were added TEA (0.0570 mL, 0.410 mmol) followed by MsCl (0.0210 mL, 0.263 mmol) at 0℃. The reaction mixture was stirred at 0℃ for 1 hour. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with saturated aq.NaHCO3and brine, dried over Na2SO4, filtered, and concentratedin vacuoto give the title compound (57.0 mg, 77%) as a yellow oil.1H-NMR (400 MHz, CDCl3): δ 4.44-4.31 (2H, m), 3.85-3.78 (1H, m), 3.02 (3H, s), 1.91-1.83 (2H, m), 1.40 (3H, s), 1.31 (3H, s), 1.26 (3H, s), 1.10 (3H, s).

[0159]

[0160] Intermediate 5: (5R)-5-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolan-4-one

[0161]

[0162] Step A: [(4R)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl]acetic acid

[0163] The title compound was prepared in a similar fashion toIntermediate 4(Step A) with D-(+)-malic acid and 2,2-dimethoxypropane. After work-up, the title compound (53%) as a white solid was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 4.77-4.68 (1H, m), 3.01 (1H, dd,J =17.3, 3.9 Hz), 2.90-2.81 (1H, m), 1.63 (3H, s), 1.58 (3H, s). LC-MS: m / z = 175 [M+H]+.

[0164] Step B: (5R)-5-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolan-4-one

[0165] The title compound was prepared in a similar fashion toIntermediate 4(Step B) with [(4R)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl]acetic acid and BH3-THF. After work-up, the title compound (crude) as a colorless oil was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 3.73 (1H, d,J =8.3 Hz), 3.43 (2H, d,J =5.5 Hz), 2.16 (1H, ddt,J =14.7, 7.3, 5.0 Hz), 2.01 (1H, dtd,J =14.4, 6.8, 4.6 Hz), 1.63 (3H, s), 1.57 (3H, d,J =1.8 Hz). LC-MS: m / z = 161 [M+H]+.

[0166]

[0167] Intermediate 6: (R)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethyl methanesulfonate

[0168]

[0169] Step A: (5R)-5-{2-[(tert-butyldimethylsilyl)oxy]ethyl}-2,2-dimethyl-1,3-dioxolan-4-one

[0170] The title compound was prepared in a similar fashion toIntermediate 4(Step C) with (5R)-5-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolan-4-one (Intermediate 5) and TBSCl. After work-up, the crude title compound (crude, 20%) as a colorless oil was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 3.78 (1H, dt,J =10.3, 5.8 Hz), 3.71-3.63 (2H, m), 2.07-1.97 (1H, m), 1.83 (1H, dddd,J =14.0, 7.9, 5.8, 5.1 Hz), 1.55 (3H, d,J =0.8 Hz), 1.48 (3H, d,J =0.7 Hz), 0.83 (9H, s), 0.00 (6H, s). LC-MS: m / z = 224 [M+H]+.

[0171] Step B: (3R)-5-[(tert-butyldimethylsilyl)oxy]-2-methylpentane-2,3-diol

[0172] The title compound was prepared in a similar fashion toIntermediate 4(Step D) with (5R)-5-{2-[(tert-butyldimethylsilyl)oxy]ethyl}-2,2-dimethyl-1,3-dioxolan-4-one and MeMgBr. After work-up, the crude title compound (crude, 28%) as a colorless oil was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 3.65-3.60 (2H, m), 3.41 (1H, d,J =6.5 Hz), 1.61 (1H, d,J =0.7 Hz), 1.54 (1H, s), 1.21 (3H, s), 1.17 (3H, s), 0.89 (9H, s), 0.05 (6H, d,J =1.6 Hz). LC-MS: m / z = 249 [M+H]+.

[0173] Step C: (R)-tert-butyldimethyl(2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethoxy)silane

[0174] The title compound was prepared in a similar fashion toIntermediate 4(Step E) with (3R)-5-[(tert-butyldimethylsilyl)oxy]-2-methylpentane-2,3-diol and 2,2-dimethoxypropane. The crude product was purified by column chromatography SiO2(pet.Ether:EtOAc = 19:1) to afford the title compound (18% for 3 steps) as a light yellow oil.1H-NMR (400 MHz, CDCl3): δ 3.87 (1H, dd,J =9.6, 3.1 Hz), 3.82 - 3.69 (2H, m), 1.62 (2H, dtd,J =8.2, 3.1, 1.5 Hz), 1.43 - 1.40 (3H, m), 1.33 (3H, s), 1.25 (3H, s), 1.10 (3H, s), 0.90 (9H, s), 0.07 (6H, d,J =2.2 Hz). LC-MS: m / z = 254 [M+H]+.

[0175] Step D: (R)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethan-1-ol

[0176] The title compound was prepared in a similar fashion toIntermediate 4(Step F) with (R)-tert-butyldimethyl(2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethoxy)silane and TBAF. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 10:1 to EtOAc only) to give the title compound (50%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 3.87-3.78 (3H, m), 2.22 (1H, t, 1H, d,J= 5.6 Hz), 1.81-1.75 (1H, m), 1.66-1.59 (1H, m), 1.41 (3H, s), 1.34 (3H, s), 1.25 (3H, s), 1.11 (3H, s).

[0177] Step E: (R)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethyl methanesulfonate

[0178] The title compound was prepared in a similar fashion toIntermediate 4(Step F) with (R)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethan-1-ol and MsCl. After work-up, the crude title compound (crude, 86%) as a yellow oil was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 4.43-4.33 (2H, m), 3.82 (1H, t, 1H, d,J= 6.4 Hz), 3.02 (3H, s), 1.94-1.86 (2H, m), 1.40 (3H, s), 1.32 (3H, s), 1.26 (3H, s), 1.10 (3H, s).

[0179]

[0180] Intermediate 7: ((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl) methyl methanesulfonate

[0181]

[0182] Step A: (2S,3R,4S)-2-(hydroxymethyl)-5-methoxyoxolane-3,4-diol

[0183] To a mixture of L-ribofuranose (10.0 g, 66.6 mmol) in MeOH (150 mL) was added conc. HCl (1.50 mL, 49.3 mmol) dropwise at 0℃. The mixture was stirred at room temperature for 18 hours. After neutralized with NaOH, the mixture was concentrated in vacuo. The residue was purified by column chromatography on SiO2(DCM:MeOH =10:1) to afford the title compound (9.00 g, 82%) as a colorless oil.1H-NMR (400 MHz, DMSO-d6): δ 4.99 (1H, d,J =4.5 Hz), 4.79 (1H, d,J =6.7 Hz), 4.63-4.61 (1H, m), 3.86-3.78 (2H, m), 3.78-3.73 (1H, m), 3.70 (1H, td,J =4.6, 1.2 Hz), 3.51 (1H, ddd,J =11.6, 5.7, 3.8 Hz), 3.42 (1H, ddd,J =6.4, 4.3, 2.3 Hz), 3.22 (3H, s).

[0184] Step B: (2S,3R,4R)-2-(hydroxymethyl) oxolane-3,4-diol

[0185] To a mixture of (2S,3R,4S)-2-(hydroxymethyl)-5-methoxyoxolane-3,4-diol (8.50 g, 51.8 mmol) in ACN (85 mL) was dropwise addedN,O-Bis(trimethylsilyl)acetamide (25.5 g, 125 mmol) at 0℃. The mixture was stirred at 40℃ for 4 hours and cool to 0℃. After slow addition of Et3SiH (29.7 g, 256 mmol) followed by TMSOTf (57.8 g, 260 mmol) at 0℃, the reaction mixture was stirred at room temperature for 4 hours. After neutralized with NaOH, the mixture was concentrated in vacuo. The residue was purified by column chromatography on SiO2(DCM:MeOH =10:1) to afford the title compound (6.00 g, 86%) as a white solid.1H-NMR (400 MHz, DMSO-d6): δ 4.78-4.72 (2H, m), 4.61 (1H, dd,J =6.1, 5.3 Hz), 3.98 (1H, q,J =4.8 Hz), 3.84 (1H, dd,J =9.0, 5.0 Hz), 3.76 (1H, td,J =6.1, 5.1 Hz), 3.58 (1H, ddd,J =6.3, 5.0, 3.4 Hz), 3.54-3.45 (2H, m), 3.36 (1H, ddd,J =11.5, 6.1, 5.1 Hz).

[0186] Step C: [(3aS,4S,6aR)-2,2-dimethyl-tetrahydrofuro[3,4-d] [1,3] dioxol-4-yl] methanol

[0187] A mixture of (2S,3R,4R)-2-(hydroxymethyl) oxolane-3,4-diol (6.00 g, 44.7 mmol), 2,2-dimethoxypropane (6.99 g, 67.1 mmol) andp-TsOH (0.770 g, 4.47 mmol) in acetone (60 mL) was stirred at room temperature for 30 min. After neutralized with saturated aq. NaHCO3solution, the mixture was extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by column chromatography on SiO2(pet.Ether:EtOAc = 1:1) to afford the title compound (426 mg, 5.4%) as a light yellow oil.1H-NMR (400 MHz, CDCl3): δ 4.81 (1H, ddd,J =6.4, 4.0, 2.5 Hz), 4.61 (1H, dd,J =6.4, 2.1 Hz), 4.13 (1H, ddd,J =6.4, 4.1, 2.1 Hz), 4.03-3.92 (2H, m), 3.67 (1H, dd,J =11.6, 4.1 Hz), 3.60 (1H, dd,J =11.6, 6.7 Hz), 1.53 (3H, s), 1.35 (3H, s).

[0188] Step D: ((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl) methyl methanesulfonate

[0189] To a solution of ((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methanol (100 mg, 0.574 mmol) and TEA (0.160 mL, 1.15 mmol) in DCM (5.8 mL) was added slowly MsCl (0.100 mL, 0.689 mmol) at 0℃. The reaction mixture was stirred at 0℃ for 2 hours and quenched with water. The mixture was partitioned between saturated aq. NaHCO3solution and EtOAc. The separated aqueous layer was extracted with EtOAc. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentratedin vacuoto afford the title compound (140 mg, 97%) as a yellow oil.1H-NMR (400 MHz, CDCl3): δ 4.87-4.84 (1H, m), 4.68 (1H, dd,J= 6.4, 1.4 Hz), 4.32-4.20 (3H, m), 4.05-3.97 (2H, m), 3.07 (3H, s), 1.52 (3H, s), 1.35 (3H, s).

[0190]

[0191]

[0192] Intermediate 8: benzyl (2S,4R)-4-((tert-butyldimethylsilyl)oxy)-2-(((methylsulfonyl)oxy)methyl)pyrrolidine-1-carboxylate

[0193]

[0194] Step A: methyl (2S,4R)-4-hydroxypyrrolidine-2-carboxylate

[0195] To a solution of (2S,4R)-4-hydroxypyrrolidine-2-carboxylic acid (1.00 g, 7.63 mmol) in MeOH (7.6 mL) was slowly added SOCl2(0.800 mL, 11.4 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours and concentrated in vacuo to give the title compound (1.10 g, 99%) as a yellow solid.1H-NMR (400 MHz, DMSO-d6): δ 5.56 (1H, d,J= 2.7 Hz), 4.48 (1H, dd,J= 10.7, 7.5 Hz), 4.42 (1H, s), 3.76 (3H, s), 3.35-3.32 (1H, m), 3.08 (1H, d,J= 11.9 Hz), 2.20-2.17 (1H, m), 2.13-2.06 (1H, m).

[0196] Step B: 1-benzyl 2-methyl (2S,4R)-4-hydroxypyrrolidine-1,2-dicarboxylate

[0197] To a solution of methyl (2S,4R)-4-hydroxypyrrolidine-2-carboxylate (920 mg, 6.34 mmol) in 1,4-dioxane (3.2 mL) was added a solution of NaHCO3(350 mg, 1.94 mmol) in water (3.2 mL) followed by CbzCl (1.00 mL, 6.97 mmol) at room temperature. The reaction mixture was stirred at room temperature for 18 hours. After dilution with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1) to give the title compound (1.10 g, 62%) as a colorless oil.1H-NMR (400 MHz, DMSO-d6): δ 7.40-7.27 (5H, m), 5.17 (1H, d,J= 1.4 Hz), 5.12-4.95 (2H, m), 4.37-4.27 (2H, m), 3.59 (3H, d,J= 40.3 Hz), 3.51-3.39 (2H, m), 2.21-2.12 (1H, m), 1.99-1.89 (1H, m).

[0198] Step C: 1-benzyl 2-methyl (2S,4R)-4-((tert-butyldimethylsilyl)oxy)pyrrolidine-1,2-dicarboxylate

[0199] To a solution of 1-benzyl 2-methyl (2S,4R)-4-hydroxypyrrolidine-1,2-dicarboxylate (920 mg, 3.29 mmol) in DCM (11 mL) was added imidazole (449 mg, 6.59 mmol) and TBSCl (546 mg, 3.62 mmol) at room temperature. The reaction mixture was stirred at room temperature for 1 hour. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuoto give the title compound (1.10 g, 85%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 7.36-7.29 (5H, m), 5.20 (1H, d,J= 12.3 Hz), 5.07 (1H, q,J= 12.7 Hz), 4.51-4.41 (2H, m), 3.76 (1.5H, s), 3.69-3.64 (1H, m), 3.54 (1.5H, s), 3.46 (1H, ddq,J= 34.2, 11.1, 1.3 Hz), 2.25-2.16 (2H, m), 2.07-2.00 (1H, m), 0.86 (9H, dd,J= 7.3, 2.7 Hz), 0.05 (6H, q,J= 3.2 Hz).

[0200] Step D: benzyl (2S,4R)-4-((tert-butyldimethylsilyl)oxy)-2-(hydroxymethyl)pyrrolidine-1-carboxylate

[0201] To a solution of 1-benzyl 2-methyl (2S,4R)-4-((tert-butyldimethylsilyl)oxy)pyrrolidine-1,2-dicarboxylate (1.10 g, 2.80 mmol) in THF (14 mL) was slowly added LiBH4(2.10 mL, 4.19 mmol) at 0℃. The reaction mixture was stirred at room temperature for 3 hours. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuoto give the title compound (950 mg, 93%) as a white solid.1H-NMR (400 MHz, CDCl3): δ 7.37-7.30 (5H, m), 5.16 (2H, d,J= 5.5 Hz), 4.61 (1H, dd,J= 8.7, 2.3 Hz), 4.31 (1H, t,J= 1.8 Hz), 4.22-4.16 (1H, m), 3.78-3.72 (1H, m), 3.63-3.50 (2H, m), 3.44 (1H, dd,J= 11.4, 4.1 Hz), 1.97 (1H, ddq,J= 13.0, 7.2, 1.6 Hz), 1.66-1.61 (1H, m), 0.86 (9H, t,J= 3.0 Hz), 0.05 (6H, d,J= 6.9 Hz).

[0202] Step E: benzyl (2S,4R)-4-((tert-butyldimethylsilyl)oxy)-2-(((methylsulfonyl)oxy)methyl)pyrrolidine-1-carboxylate

[0203] To a solution of benzyl (2S,4R)-4-((tert-butyldimethylsilyl)oxy)-2-(hydroxymethyl)pyrrolidine-1-carboxylate (950 mg, 2.60 mmol) and TEA (0.700 mL, 5.20 mmol) in DCM (13 mL) was slowly added MsCl (0.200 mL, 3.12 mmol) at 0℃. The reaction mixture was stirred at 0℃ for 2 hours and quenched with water. The mixture was partitioned between saturated aq. NaHCO3solution and DCM. The separated aqueous layer was extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentratedin vacuoto afford the title compound (900 mg, 78%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 7.36-7.29 (5H, m), 5.23-5.11 (2H, m), 4.62 (1H, q,J= 4.9 Hz), 4.42-4.38 (1H, m), 4.34-4.22 (2H, m), 3.58-3.46 (2H, m), 2.86 (3H, d,J= 30.2 Hz), 2.12-1.99 (2H, m), 0.85 (9H, s), 0.05 (6H, d,J= 6.4 Hz).

[0204]

[0205] Intermediate 9: (R)-(1-methyl-5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate

[0206]

[0207] Step A: (R)-(5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate

[0208] To a solution of (R)-5-(hydroxymethyl)pyrrolidin-2-one (350 mg, 3.04 mmol), DMAP (37.0 mg, 0.304 mmol) and TEA (0.500 mL, 3.65 mmol) in DCM (10 mL) was added slowlyp-TsCl (695 mg, 3.65 mmol) at 0℃. The reaction mixture was stirred at 0℃ for 2 hours and quenched with water. The mixture was partitioned between saturated aq. NaHCO3solution and EtOAc. The separated aqueous layer was extracted with EtOAc. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentratedin vacuo.The residue was purified by column chromatography on SiO2(DCM:EtOAc = 10:1) to give the title compound (520 mg, 64%) as a white solid.1H-NMR (400 MHz, CDCl3): δ 7.79 (2H, dt,J= 8.7, 1.8 Hz), 7.39-7.37 (2H, m), 5.66 (1H, s), 4.07 (1H, dd,J= 9.6, 3.7 Hz), 3.97-3.91 (1H, m), 3.85 (1H, dd,J= 9.6, 7.8 Hz), 2.47 (3H, s), 2.35-2.21 (3H, m), 1.80-1.72 (1H, m).

[0209] Step B: (R)-(1-methyl-5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate

[0210] To a suspension of NaH (60wt%, 69.0 mg, 1.72 mmol) in DMF (16 mL) was slowly added a solution of (R)-(5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate (420 mg, 1.56 mmol) in DMF at 0℃. The mixture was stirred at 0℃ for 20 mins. After addition of MeI (0.150 mL, 2.34 mmol) at 0℃, the reaction mixture was stirred at 0℃ for 1 hour and quenched with water at 0℃. The mixture was extracted with DCM, washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuoto give the title compound (220 mg, 50%) as a yellow oil.1H-NMR (400 MHz, CDCl3): δ 7.79 (2H, dt,J= 8.4, 1.9 Hz), 7.38 (2H, d,J= 7.8 Hz), 4.13 (1H, dd,J= 10.5, 3.7 Hz), 4.03 (1H, dd,J= 10.5, 4.1 Hz), 3.73 (1H, td,J= 8.2, 4.1 Hz), 2.71 (3H, s), 2.47 (3H, s), 2.45-2.26 (2H, m), 2.21-2.11 (1H, m), 1.86-1.78 (1H, m).

[0211]

[0212] Intermediate 10: (S)-(1-methyl-5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate

[0213]

[0214] Step A: (S)-(5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate

[0215] The title compound was prepared in a similar fashion toIntermediate 9(Step A) with (S)-5-(hydroxymethyl)pyrrolidin-2-one andp-TsCl. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 4:1) to give the title compound (54%) as a white solid.

[0216] Step B: (S)-(1-methyl-5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate

[0217] The title compound was prepared in a similar fashion toIntermediate 9(Step B) with (S)-(5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate and MeI. After work-up, the title compound (46%) as a yellow oil was obtained.1H-NMR (400 MHz, CDCl3): δ 7.79 (2H, dt,J= 8.4, 1.9 Hz), 7.38 (2H, d,J= 7.8 Hz), 4.13 (1H, dd,J= 10.5, 3.7 Hz), 4.03 (1H, dd,J= 10.5, 4.1 Hz), 3.73 (1H, td,J= 8.2, 4.1 Hz), 2.71 (3H, s), 2.47 (3H, s), 2.45-2.26 (2H, m), 2.21-2.11 (1H, m), 1.86-1.78 (1H, m).

[0218] Intermediate 11: (3-(bromomethyl)oxetan-3-yl)methyl acetate

[0219]

[0220] To a solution (3-(bromomethyl)oxetan-3-yl)methanol (0.200 g, 1.11 mmol) in DCM (11 mL) was successively added TEA (0.385 mL, 2.76 mmol), DMAP (6.75 mg, 0.0550 mmol) and acetic anhydride (0.208 mL, 2.21 mmol) at room temperature. The reaction mixture was stirred at room temperature for 3 hours and quenched with water. The mixture was extracted with DCM twice. The combined organic layers were washed with water, saturated aq. NaHCO3and brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1) to give the title compound (0.170 g, 69%) as a pale yellow oil.1H-NMR (400 MHz, CDCl3): δ 4.49-4.43 (4H, m), 4.40 (2H, s), 3.74 (2H, s), 2.10 (3H, s).

[0221]

[0222] Intermediate 12: 2-(1,2-oxazinan-2-yl)ethyl methanesulfonate

[0223]

[0224] Step A: methyl 2-(1,2-oxazinan-2-yl)acetate

[0225] To a solution of 1,2-oxazinane hydrochloride (800 mg, 6.47 mmol) and TEA (1.00 mL, 7.77 mmol) in DMF (32 mL) was slowly added NaH (60wt%, 390 mg, 9.71 mmol) at 0℃. The mixture was stirred at 0℃ for 10 mins. After addition of methyl bromoacetate (0.680 mL, 7.12 mmol) at 0℃, the reaction mixture was stirred at room temperature for 5 hours. After quenched with water at 0℃, the mixture was extracted with DCM, washed with water and brine, dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1) to give the title compound (577 mg, 56%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 3.96 (2H, t,J= 5.3 Hz), 3.75 (3H, brs), 3.44 (2H, s), 2.82 (2H, s), 1.86-1.81 (2H, m), 1.58-1.52 (2H, m).

[0226] Step B: 2-(1,2-oxazinan-2-yl)ethan-1-ol

[0227] To a solution of methyl 2-(1,2-oxazinan-2-yl)acetate (577 mg, 3.62 mmol) in THF (18 mL) was added LAH (1 M solution in THF, 5.00 mL, 4.71 mmol) at 0℃. The mixture was stirred at room temperature for 1.5 hours. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered and concentratedin vacuoto give the title compound (380 mg, 80%) as a colorless oil, which was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 3.93 (2H, t,J= 5.3 Hz), 3.75 (2H, brs), 2.78 (4H, t,J= 4.8 Hz), 1.85-1.77 (2H, m), 1.60-1.54 (2H, m).

[0228] Step C: 2-(1,2-oxazinan-2-yl)ethyl methanesulfonate

[0229] To a solution of 2-(1,2-oxazinan-2-yl)ethan-1-ol (100 mg, 0.762 mmol) and TEA (0.200 mL, 1.14 mmol) in DCM (4.0 mL) was added MsCl (0.100 mL, 0.839 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered and concentratedin vacuoto give the title compound(130 mg, 81%) as a brown oil, which was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 4.41 (2H, t,J= 4.8 Hz), 3.90 (2H, t,J= 5.3 Hz), 3.06 (3H, s), 2.91 (2H, t,J= 5.3 Hz), 2.76 (2H, brs), 1.82-1.76 (2H, m), 1.59-1.53 (2H, m).

[0230]

[0231] Intermediate 13:tert-butyl (S)-(7-(2-hydroxyethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0232]

[0233] Step A:tert-butyl (S)-(7-(2-(benzyloxy)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0234] To a stirred solution of tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1,1.00 g, 3.24 mmol) in DMF (16 mL) was added K2CO3(1.12 g, 8.11 mmol) followed by ((2-bromoethoxy)methyl)benzene (0.616 mL, 3.89 mmol) at room temperature. The reaction mixture was stirred at 80℃ for 22 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 5:1 to 2:1) to afford the title compound (1.38 g, 96%) as a colorless sticky oil.1H-NMR (400 MHz, CDCl3): δ 7.38-7.27 (5H, m), 7.04 (1H, d,J =8.4 Hz), 6.76-6.71 (2H, m), 5.48 (1H, d,J =7.2 Hz), 4.67-4.57 (3H, m), 4.55-4.50 (1H, m), 4.14-4.06 (3H, m), 3.84-3.81 (2H, m), 3.35 (3H, s), 1.39 (9H, s).

[0235] Step B:tert-butyl (S)-(7-(2-hydroxyethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0236] A suspension tert-butyl (S)-(7-(2-(benzyloxy)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (1.38 g, 3.11 mmol) and Pd / C (10wt%, 17 mg, 0.156 mmol) in MeOH (16 mL) and EtOAc (16 mL) was stirred at room temperature for 18 hours under N2atmosphere (1 atm). After filtration through Celite pad, the filtrated was concentratedin vacuo. The residue was purified by recrystallization from hexanes and EtOAc to afford title compound (1.02 g, 93%) as a white solid.1H-NMR (400 MHz, CDCl3): δ 7.06 (1H, d,J =8.0 Hz), 6.76-6.72 (2H, m), 5.47 (1H, d,J =7.2 Hz), 4.65 (1H, dt,J =11.3, 7.4 Hz), 4.53 (1H, dd,J =9.6, 8.0 Hz), 4.13-4.05 (3H, m), 3.99-3.96 (2H, m), 3.38 (3H, s), 1.98 (1H, t,J =6.2 Hz), 1.40 (9H, s).

[0237]

[0238] Intermediate 14: (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate

[0239]

[0240] To a solution of tert-butyl (S)-(7-(2-hydroxyethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 13, 300 mg, 0.0850 mmol) in DCM (0.85 mL) was added MsCl (7.91 μL, 0.102 mmol) at room temperature. The reaction mixture was stirred at room temperature for 1 hour. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuoto afford the title compound (33 mg, 90%) as a colorless oil, which was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 7.08 (1H, d,J= 8.7 Hz), 6.73 (2H, td,J= 8.3, 2.9 Hz), 5.47 (1H, d,J= 7.3 Hz), 4.68-4.61 (1H, m), 4.59-4.56 (2H, m), 4.54-4.48 (1H, m), 4.23 (2H, t,J= 4.6 Hz), 4.11 (1H, dd,J= 11.4, 9.6 Hz), 3.38 (3H, s), 3.10 (3H, d,J= 4.1 Hz), 1.39 (9H, s).

[0241]

[0242] Intermediate 15: 3-(benzyloxy)-1-(2-chloroethyl)-3-methylazetidine

[0243]

[0244] Step A: tert-butyl 3-(benzyloxy)-3-methylazetidine-1-carboxylate

[0245] To a solution of tert-butyl 3-hydroxy-3-methylazetidine-1-carboxylate (0.500 g, 2.67 mmol) in DMF (8.9 mL) was added NaH (0.117 g, 2.94 mmol) at 0℃. The mixture was stirred at 0℃ for 30 min. After addition of benzylbromide (0.476 mL, 4.01 mmol) at 0℃. The reaction mixture was stirred at 100℃ for 2 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes only to Hexanes:EtOAc = 10:1 to 6:1) to afford the title compound (0.558 g, 75%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 7.38-7.33 (4H, m), 7.32-7.28 (1H, m), 4.43 (2H, s), 4.00 (2H, d,J= 8.7 Hz), 3.73 (2H, d,J= 9.1 Hz), 1.57 (3H, s).

[0246] Step B: 3-(benzyloxy)-3-methylazetidine 2,2,2-trifluoroacetate

[0247] To a solution of tert-butyl 3-(benzyloxy)-3-methylazetidine-1-carboxylate (0.558 g, 2.01 mmol) in DCM (6.7 mL) was added trifluoroacetic acid (0.775 mL, 10.1 mmol) at 0℃. The reaction mixture was stirred at room temperature for 2 hours and quenched with NaHCO3powder (1.35 g, 16.1 mmol). The mixture was filtered through Celite 545. The filtrate was concentratedin vacuoto afford the title compound (0.538 g, 92%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 9.19 (1H, s), 8.86 (1H, s), 7.39-7.30 (5H, m), 4.44 (2H, s), 4.15-4.09 (2H, m), 3.91-3.86 (2H, m), 1.65 (3H, s).

[0248] Step C: 3-(benzyloxy)-1-(2-chloroethyl)-3-methylazetidine

[0249] To a solution of 3-(benzyloxy)-3-methylazetidine 2,2,2-trifluoroacetate (0.438 g, 1.50 mmol) in DCE (7.5 mL) was added 2-chloroacetaldehyde in water (0.573 ml, 4.51 mmol) and AcOH (0.172 ml, 3.01 mmol) at 0℃. The mixture was stirred at 0℃ for 5 min before addition of NaBH(OAc)3(0.637 g, 3.01 mmol) at 0℃. The reaction mixture was stirred at room temperature for 2 hours and quenched with water. The mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuoto afford the title compound (0.272 g, crude) as a yellow oil, which was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 7.36-7.29 (5H, m), 4.40 (2H, s), 3.60-3.54 (4H, m), 3.35 (2H, d,J= 7.3 Hz), 3.00 (2H, t,J= 6.2 Hz), 1.62 (3H, s).

[0250]

[0251] Intermediate 16: 1-(2-chloroethyl)-3,3-difluoroazetidine

[0252]

[0253] To a solution of 3,3-difluoroazetidine hydrochloride (200 mg, 1.54 mmol) and AcOH (0.177 mL, 3.09 mmol) in DCE (5.0 mL) was added 2-chloroacetaldehyde (50wt% in water, 0.588 mL, 4.63 mmol) followed by NaBH(OAc)3(654 mg, 3.09 mmol) at 0℃. The reaction mixture was stirred at room temperature for 3 hours and quenched with water. The separated aqueous layer was extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentratedin vacuoto afford the title compound (256 mg, crude) as a yellow oil, which was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 3.75-3.69 (4H, m), 3.53 (2H, t,J= 6.2 Hz), 2.96-2.92 (2H, m).

[0254]

[0255] Example 1: 4-(3-fluorobenzyl)-N-((S)-5-methyl-4-oxo-7-(2-((S)-2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0256]

[0257] To a solution of (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3, 40.0 mg, 0.0970 mmol) and (S)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethyl methanesulfonate (Intermediate 4, 25.0 mg, 0.0970 mmol) in DMF (1.0 mL) was added Cs2CO3(95.0 mg, 0.292 mmol) at room temperature. The reaction mixture was stirred at room temperature for 4.5 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on NH-SiO2(Hexanes:EtOAc = 5:1 to 3:1) to afford the title compound (7.0 mg, 13%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.2 Hz), 7.87 (1H, s), 7.46 (1H, s), 7.28-7.21 (1H, m), 7.11-09 (1H, m), 6.95-6.84 (3H, m), 6.78-6.75 (2H, m), 4.93-4.86 (1H, m), 4.65 (1H, dd,J= 9.6, 8.0 Hz), 4.23 (1H, dd,J= 11.2, 10.0 Hz), 4.16-4.07 (2H, m), 3.95-3.90 (1H, m), 3.80 (2H, s), 3.41 (3H, s), 2.03-1.89 (2H, m), 1.43 (3H, s), 1.34 (3H, s), 1.29 (3H, s), 1.15 (3H, s). LC-MS: m / z = 567.1 [M+H]+.

[0258]

[0259] Example 2: 4-(3-fluorobenzyl)-N-((S)-5-methyl-4-oxo-7-(2-((R)-2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0260]

[0261] The title compound was prepared in a similar fashion toExample 1with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and (R)-2-(2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethyl methanesulfonate (Intermediate 6). The crude product was purified by column chromatography on NH-SiO2(Hexanes:EtOAc = 5:1 to 3:1) to afford the title compound (18%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.2 Hz), 7.87 (1H, s), 7.46 (1H, s), 7.28-7.21 (1H, m), 7.11-7.09 (1H, m), 6.95-6.84 (3H, m), 6.78-6.75 (2H, m), 4.93-4.86 (1H, m), 4.67-4.65 (1H, dd,J= 9.6, 7.6 Hz), 4.23 (1H, dd,J= 11.2, 10.0 Hz), 4.16-4.05 (2H, m), 3.95-3.90 (1H, m), 3.80 (2H, s), 3.41 (3H, s), 2.00-1.85 (2H, m), 1.43 (3H, s), 1.34 (3H, s), 1.30 (3H, s), 1.15 (3H, s). LC-MS: m / z = 567.1 [M+H]+.

[0262]

[0263] Example 3: N-((S)-7-(2-((R)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0264]

[0265] To a solution of (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3, 260 mg, 0.634 mmol) and (R)-5-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolan-4-one (Intermediate 5) (122 mg, 0.760 mmol) in THF (6.3 mL) was added PPh3(249 mg, 0.950 mmol) followed by DIAD (0.190 mL, 0.950 mmol) at room temperature. The reaction mixture was stirred at room temperature for 1.5 hours. After concentration in vacuo, the residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 3:1 to 1:1) to give the title compound (160 mg, 46%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.13-7.11 (1H, m), 6.97-6.85 (3H, m), 6.79-6.76 (2H, m), 4.93-4.86 (1H, m), 4.68-4.63 (2H, m), 4.25 (1H, dd,J= 11.0, 10.1 Hz), 4.21-4.09 (2H, m), 3.81 (2H, s), 3.42 (3H, s), 2.44-2.36 (1H, m), 2.28-2.18 (1H, m), 1.59 (3H, s), 1.57-1.58 (3H, s). LC-MS: m / z = 553.0 [M+H]+.

[0266]

[0267] Example 4:N-((S)-7-((R)-4-(dimethylamino)-3-hydroxy-4-oxobutoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0268]

[0269] To a solution of N-((S)-7-(2-((R)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide (Example 3) (30.0 mg, 0.0540 mmol) in ACN (0.27 mL) was added NMe2(2 M in MeOH, 0.136 mL, 0.271 mmol). The reaction mixture was stirred at 50℃ for 4 hours. After concentrationin vacuo, the residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1 to EtOAc:MeOH = 97:3) to give the title compound (9.5 mg, 32%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (d,J =7.2 Hz, 1H), 7.88 (d,J =0.8 Hz, 1H), 7.47 (s, 1H), 7.28-7.22 (m, 1H), 7.12-7.10 (m, 1H), 6.96-6.84 (m, 3H), 6.79-6.74 (m, 2H), 4.89 (dt,J =11.2, 7.5 Hz, 1H), 4.68-4.62 (m, 2H), 4.28-4.22 (m, 2H), 4.12-4.08 (m, 1H), 3.81 (s, 3H), 3.42 (s, 3H), 3.06 (s, 3H), 3.05 (s, 3H), 2.21-2.13 (m, 1H), 1.89-1.81 (m, 1H). LC-MS: m / z = 540.1 [M+H]+.

[0270]

[0271] Example 5: 4-(3-fluorobenzyl)-N-((S)-7-((R)-3-hydroxy-4-oxo-4-(pyrrolidin-1-yl)butoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0272]

[0273] The title compound was prepared in a similar fashion toExample 4with N-((S)-7-(2-((R)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide (Example 3) and pyrrolidine. The crude product was purified by column chromatography on SiO2(EtOAc only) to give the title compound (90%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (d,J =8.0 Hz, 1H), 7.88 (s, 1H), 7.46 (s, 1H), 7.27-7.22 (m, 1H), 7.10 (d,J =8.8 Hz, 1H), 6.96-6.84 (m, 3H), 6.78-6.74 (m, 2H), 4.89 (dt,J =11.2, 7.4 Hz, 1H), 4.65 (dd,J =10.0, 7.6 Hz, 1H), 4.45 (d,J =8.8 Hz, 1H), 4.27-4.21 (m, 2H), 4.14-4.08 (m, 1H), 3.80 (s, 2H), 3.78 (brs, 1H), 3.64-3.39 (m, 4H), 3.41 (s, 3H), 2.21-2.12 (m, 1H), 2.07-1.85 (m, 5H). LC-MS: m / z = 566.1 [M+H]+.

[0274]

[0275] Example 6: 4-(3-fluorobenzyl)-N-((S)-7-((R)-3-hydroxy-4-morpholino-4-oxobutoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0276]

[0277] The title compound was prepared in a similar fashion toExample 4with N-((S)-7-(2-((R)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide (Example 3) and morpholine. The crude product was purified by column chromatography on SiO2(EtOAc only) to give the title compound (34%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (d,J =7.2 Hz, 1H), 7.88 (s, 1H), 7.47 (s, 1H), 7.30-7.22 (m, 1H), 7.11 (d,J =8.4 Hz, 1H), 6.96-6.85 (m, 3H), 6.78-6.74 (m, 2H), 4.89 (dt,J =9.4, 6.3 Hz, 1H), 4.66 (dd,J =9.6, 7.2 Hz, 1H), 4.60 (dd,J =9.8, 2.2 Hz, 1H), 4.28-4.22 (m, 2H), 4.15-4.08 (m, 1H), 3.81 (s, 2H), 3.81-3.63 (m, 6H), 3.50 (t,J =4.6 Hz, 2H), 3.42 (s, 3H), 2.16-2.08 (m, 1H), 1.91-1.83 (m, 1H). LC-MS: m / z = 582.1 [M+H]+.

[0278]

[0279] Example 7: N-((S)-7-(((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0280]

[0281] Step A: tert-butyl ((S)-7-(((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0282] The title compound was prepared in a similar fashion toExample 1with tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1) and ((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methylmethanesulfonate (Intermediate 7).The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1) to afford the title compound (60%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.06 (1H, d,J= 8.7 Hz), 6.72-6.68 (2H, m), 5.46 (1H, d,J= 7.3 Hz), 4.94-4.91 (1H, m), 4.84 (1H, dd,J= 6.2, 1.6 Hz), 4.67-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.3 Hz), 4.38 (1H, td,J= 4.5, 1.7 Hz), 4.13-4.01 (5H, m), 3.38 (3H, s), 1.55 (3H, s), 1.40 (9H, s), 1.39 (3H, s).

[0283] Step B: (S)-7-(((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-3-((2,2,2-trifluoroacetyl)-l4-azanyl)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0284] To a solution of tert-butyl ((S)-7-(((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (45.0 mg, 0.0970 mmol) in DCM (0.50 mL) was added TFA (22.0 μL, 0.291 mmol) at 0℃. The reaction mixture was stirred at room temperature for 20 hours and concentratedin vacuoto afford the title compound (25.0 mg, 56%) as a white foam. LC-MS: m / z = 565.20 [M+H]+.

[0285] Step C: N-((S)-7-(((3aR,4R,6aS)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0286] To a solution of (S)-7-(((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-3-((2,2,2-trifluoroacetyl)-l4-azanyl)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one (20.0 mg, 0.043 mmol) in DCE (0.40 mL) was added CDI (7.00 mg, 0.043 mmol) followed by TEA (15.0 μL, 0.108 mmol) at 0℃. The mixture was stirred at 0℃ for 1 hour. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuo.

[0287] To a solution of the residue in DCE (0.40 mL) was added 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2, 8.00 mg, 0.0390 mmol) and TEA (15.0 μL, 0.108 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(DCM:EtOAc = 10:1) to give the title compound (7.00 mg, 29%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.12 (1H, dd,J= 6.9, 2.3 Hz), 7.00-6.85 (3H, m), 6.74 (2H, dd,J= 7.1, 2.5 Hz), 4.94-4.84 (3H, m), 4.66 (1H, dd,J= 9.8, 7.5 Hz), 4.38 (1H, q,J= 2.3 Hz), 4.25 (1H, dd,J= 11.2, 9.8 Hz), 4.08-4.04 (4H, m), 3.81 (2H, s), 3.41 (3H, s), 1.39 (3H, s), 1.25 (3H, s). LC-MS: m / z = 567.2 [M+H]+.

[0288]

[0289] Example 8: N-((S)-7-(((2S,3R,4R)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0290]

[0291] To a solution of N-((S)-7-(((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide (Example 7, 5.00 mg, 8.82 μmol) in MeOH (88 μL) was added HCl (4M in dioxane, 11 μL, 0.044 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours and concentratedin vacuoto give the title compound (2.0 mg, 43%) as a white foam.1H-NMR (400 MHz, MeOH-d4): δ 7.95 (1H, s), 7.56 (1H, s), 7.32-7.26 (1H, m), 7.14 (1H, d,J= 8.7 Hz), 7.04 (2H, d,J= 7.3 Hz), 6.96-6.88 (3H, m), 4.58-4.54 (1H, m), 4.41-4.34 (1H, m), 4.25-4.16 (2H, m), 4.12-4.03 (3H, m), 3.85 (2H, s), 3.79-3.72 (1H, m), 3.67-3.63 (1H, m), 3.58-3.55 (1H, m), 3.40 (3H, s). LC-MS: m / z = 527.1 [M+H]+.

[0292]

[0293] Example 9: 4-(3-fluorobenzyl)-N-((S)-7-(((2S,4R)-4-hydroxy-1-methylpyrrolidin-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0294]

[0295] Step A: benzyl (2S,4R)-2-((((S)-3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)methyl)-4-((tert-butyldimethylsilyl)oxy)pyrrolidine-1-carboxylate

[0296] A mixture of tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1, 450 mg, 1.46 mmol), benzyl (2S,4R)-4-((tert-butyldimethylsilyl)oxy)-2-(((methylsulfonyl)oxy)methyl)pyrrolidine-1-carboxylate (Intermediate 8, 842 mg, 1.90 mmol) and Cs2CO3(951 mg, 2.92 mmol) in DMF (9.7 mL) was stirred at 50℃ for 18 hours. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(DCM:EtOAc = 10:1) to give the title compound (350 mg, 37%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.36-7.30 (5H, m), 7.04-6.94 (1H, m), 6.73 (1H, d,J= 11.4 Hz), 6.57 (1H, t,J= 9.4 Hz), 5.47 (1H, d,J= 7.3 Hz), 5.22-5.08 (2H, m), 4.67-4.60 (1H, m), 4.52 (2H, t,J= 7.5 Hz), 4.33-4.27 (1H, m), 4.18-3.92 (3H, m), 3.54 (1H, d,J= 5.0 Hz), 3.42 (dd, J = 11.0, 4.1 Hz, 1H), 3.35 (3H, d,J= 19.2 Hz), 2.20-2.03 (2H, m), 1.40 (9H, s), 0.88 (9H, s), 0.07 (6H, d,J= 5.9 Hz).

[0297] Step B: tert-butyl ((S)-7-(((2S,4R)-4-((tert-butyldimethylsilyl)oxy)pyrrolidin-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0298] A suspension of benzyl (2S,4R)-2-((((S)-3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)methyl)-4-((tert-butyldimethylsilyl)oxy)pyrrolidine-1-carboxylate (430 mg, 0.660 mmol) and Pd / C (10 wt%, 70 mg) in EtOAc (6.5 mL) was stirred at room temperature for 2 hours under H2atmosphere (1 atm). After filtration through a Celite pad while washing with EtOAc, the filtrate was concentratedin vacuoto afford the title compound (320 mg, 94%) as a pale brown foam.1H-NMR (400 MHz, CDCl3): δ 7.03 (1H, d,J= 9.1 Hz), 6.72-6.68 (2H, m), 5.47 (1H, d,J= 7.3 Hz), 4.67-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.3 Hz), 4.43-4.39 (1H, m), 4.09 (1H, dd,J= 11.2, 9.8 Hz), 3.85 (2H, d,J= 5.5 Hz), 3.79-3.73 (1H, m), 3.37 (3H, s), 3.03 (1H, dd,J= 11.4, 4.1 Hz), 2.87 (1H, d,J= 11.4 Hz), 2.19 (1H, brs), 1.94-1.89 (1H, m), 1.72-1.66 (1H, m), 1.40 (9H, s), 0.89 (9H, s), 0.08 (6H, d,J= 3.2 Hz).

[0299] Step C: tert-butyl ((S)-7-(((2S,4R)-4-((tert-butyldimethylsilyl)oxy)-1-methylpyrrolidin-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0300] To a solution of tert-butyl((S)-7-(((2S,4R)-4-((tert-butyldimethylsilyl)oxy)pyrrolidin-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (260 mg, 0.498 mmol) and formaldehyde (0.190 mL, 2.49 mmol) in MeOH was added AcOH (29.0 μL, 0.498 mmol) followed by NaBH3CN (125 mg, 1.99 mmol) at 10℃. The reaction mixture was stirred at room temperature for 18 hours. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with 2 N aq. NaOH solution and brine, dried over Na2SO4, filtered, and concentratedin vacuoto give the title compound (224 mg, 84%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.04 (1H, d,J= 8.7 Hz), 6.72 (2H, td,J= 9.1, 2.7 Hz), 5.47 (1H, d,J= 7.3 Hz), 4.68-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.8 Hz), 4.43-4.37 (1H, m), 4.09 (1H, dd,J= 11.0, 9.6 Hz), 3.88 (2H, d,J= 4.6 Hz), 3.37 (3H, s), 3.32 (1H, dd,J= 9.4, 5.7 Hz), 2.95-2.89 (1H, m), 2.47 (3H, s), 2.33 (1H, dd,J= 9.6, 6.4 Hz), 2.05-1.88 (2H, m), 1.40 (9H, s), 0.90 (9H, s), 0.07 (6H, d,J= 2.3 Hz).

[0301] Step D: (S)-3-amino-7-(((2S,4R)-4-hydroxy-1-methylpyrrolidin-2-yl)methoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0302] To a solution of tert-butyl ((S)-7-(((2S,4R)-4-((tert-butyldimethylsilyl)oxy)-1-methylpyrrolidin-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (220 mg, 0.411 mmol) in DCM (4.0 mL) was added HCl (4 M in dioxane, 0.500 mL, 2.05 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours and concentratedin vacuoto give the title compound (130 mg, 99%) as a yellow solid.1H-NMR (400 MHz, DMSO-d6): δ 8.48 (3H, brs), 7.25-7.20 (2H, m), 6.95 (1H, dd,J= 8.7, 2.7 Hz), 5.64 (1H, s), 4.52 (1H, dd,J= 10.1, 7.8 Hz), 4.43-4.36 (4H, m), 4.24 (1H dd,J= 11.0, 7.8 Hz), 4.06-3.99 (1H, m), 3.79-3.71 (1H, m), 3.36 (3H, s), 3.00 (3H, s), 2.15 (1H, q,J= 6.6 Hz), 2.01-1.95 (1H, m).

[0303] Step E: 4-(3-fluorobenzyl)-N-((S)-7-(((2S,4R)-4-hydroxy-1-methylpyrrolidin-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0304] The title compound was prepared in a similar fashion toExample 7(Step C) with (S)-3-amino-7-(((2S,4R)-4-hydroxy-1-methylpyrrolidin-2-yl)methoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 10:1) to give the title compound (30.0 mg, 16%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.11 (1H, d,J= 9.1 Hz), 6.97-6.85 (3H, m), 6.76 (2H, dd,J= 11.4, 2.7 Hz), 4.93-4.87 (1H, m), 4.66 (1H, dd,J= 9.8, 7.5 Hz), 4.50 (1H, dd,J= 9.8, 6.6 Hz), 4.25 (1H, dd,J= 11.0, 10.1 Hz), 3.97-3.94 (2H, m), 3.81 (2H, s), 3.51-3.47 (1H, m), 3.41 (3H, s), 3.04-2.99 (1H, m), 2.51 (3H, s), 2.39 (1H, q,J= 5.2 Hz), 2.15-2.07 (1H, m), 2.01-1.94 (1H, m). LC-MS: m / z = 524.1 [M+H]+.

[0305]

[0306] Example 10: 4-(3-fluorobenzyl)-N-((S)-5-methyl-7-(((R)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0307]

[0308] Step A: tert-butyl ((S)-5-methyl-7-(((R)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0309] The title compound was prepared in a similar fashion toExample 9(Step A) with tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1) and (R)-(1-methyl-5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate (Intermediate 9). The crude product was purified by column chromatography on SiO2(DCM:MeOH = 20:1) to afford the title compound (70%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.08-7.06 (1H, m), 6.72-6.69 (2H, m), 5.49 (1H, d,J= 7.3 Hz), 4.68-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.8 Hz), 4.15-4.03 (2H, m), 3.98 (1H, q,J= 4.7 Hz), 3.90 (1H, td,J= 8.5, 4.1 Hz), 3.39 (3H, s), 2.92 (3H, s), 2.60-2.51 (1H, m), 2.45-2.37 (1H, m), 2.31-2.22 (1H, m), 2.02-1.93 (1H, m), 1.40 (9H, s).

[0310] Step B: (S)-3-amino-5-methyl-7-(((R)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0311] To a solution of tert-butyl ((S)-5-methyl-7-(((R)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (220 mg, 0.520 mmol) in DCM (3.0 mL) was added HCl (4 M in dioxane, 0.660 mL, 2.62 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours and concentratedin vacuoto give the title compound (180 mg, 96%) as a yellow solid.1H-NMR (400 MHz, DMSO-d6): δ 8.45 (3H, s), 7.20 (1H, d,J= 9.1 Hz), 7.13 (1H, d,J= 2.7 Hz), 6.90 (1H, dd,J= 8.9, 3.0 Hz), 4.50 (1H, dd,J= 9.6, 7.8 Hz), 4.36 (1H, t,J= 10.3 Hz), 4.28 (1H, d,J= 4.1 Hz), 4.18 (1H, dd,J= 10.3, 3.9 Hz), 4.04 (1H, dd,J= 10.1, 4.1 Hz), 3.88 (1H, q,J= 4.0 Hz), 3.35 (3H, s), 2.76 (3H, s), 2.43-2.34 (1H, m), 2.24-2.10 (2H, m), 1.90-1.82 (1H, m).

[0312] Step C: 4-(3-fluorobenzyl)-N-((S)-5-methyl-7-(((R)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0313] The title compound was prepared in a similar fashion toExample 7(Step C) with (S)-3-amino-5-methyl-7-(((R)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:MeOH = 20:1) to give the title compound (46%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.13 (1H, dd,J= 5.5, 4.1 Hz), 7.00-6.85 (3H, m), 6.77-6.73 (2H, m), 4.93-4.87 (1H, m), 4.66 (1H, dd,J= 9.8, 7.5 Hz), 4.26 (1H, dd,J= 11.0, 9.6 Hz), 4.04 (2H, dq,J= 30.6, 4.6 Hz), 3.90 (1H, td,J= 8.5, 4.1 Hz), 3.81 (2H, s), 3.42 (3H, s), 2.93 (3H, s), 2.60-2.52 (1H, m), 2.45-2.37 (1H, m), 2.32-2.22 (1H, m), 2.03-1.94 (1H, m). LC-MS: m / z = 522.2 [M+H]+.

[0314]

[0315] Example 11: 4-(3-fluorobenzyl)-N-((S)-5-methyl-7-(((S)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0316]

[0317] Step A: tert-butyl ((S)-5-methyl-7-(((S)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0318] The title compound was prepared in a similar fashion toExample 9(Step A) with tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1) and (S)-(1-methyl-5-oxopyrrolidin-2-yl)methyl 4-methylbenzenesulfonate (Intermediate 10). The crude product was purified by column chromatography on SiO2(DCM:MeOH = 10:1) to afford the title compound (71%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.06-7.04 (1H, m), 6.50-6.49 (2H, m), 5.50 (1H, d,J= 7.2 Hz), 4.68-4.61 (1H, m), 4.52 (1H, m), 4.12-4.04 (2H, m), 3.96 (1H, m), 3.90 (1H, m), 3.38 (3H, s), 2.91 (3H, s), 2.60-2.51 (1H, m), 2.45-2.37 (1H, m), 2.31-2.22 (1H, m), 2.02-1.93 (1H, m), 1.40 (9H, s).

[0319] Step B: (S)-3-amino-5-methyl-7-(((S)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0320] The title compound was prepared in a similar fashion toExample 10(Step B) with tert-butyl ((S)-5-methyl-7-(((S)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate and HCl. After concentration, the title compound (quant.) was obtained as a yellow solid, which was used for the next reaction without further purification. LC-MS: m / z = 320.1 [M+H]+

[0321] Step C: 4-(3-fluorobenzyl)-N-((S)-5-methyl-7-(((S)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0322] The title compound was prepared in a similar fashion toExample 7(Step C) with (S)-3-amino-5-methyl-7-(((S)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:MeOH = 9:1) to give the title compound (52%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.2 Hz), 7.87 (1H, s), 7.47 (1H, s), 7.26-7.23 (1H, m), 7.13 (1H, d,J= 9.6 Hz), 7.00-6.85 (3H, m), 6.77-6.73 (2H, m), 4.91-4.88 (1H, m), 4.66 (1H, dd,J= 9.8, 7.5 Hz), 4.26 (1H, dd,J= 11.0, 9.6 Hz), 4.04 (2H, m), 3.90 (1H, td,J= 8.5, 4.1 Hz), 3.81 (2H, s), 3.42 (3H, s), 2.93 (3H, s), 2.60-2.52 (1H, m), 2.43-2.35 (1H, m), 2.32-2.22 (1H, m), 2.03-1.94 (1H, m). LC-MS: m / z = 522.1 [M+H]+.

[0323]

[0324] Example 12: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(N-methylacetamido)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0325]

[0326] Step A: tert-butyl-(S)-(2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)

[0327] -5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl)(methyl)carbamate

[0328] The title compound was prepared in a similar fashion toExample 3with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and tert-butyl (2-hydroxyethyl)(methyl)carbamate. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 4:1) to give the title compound (48%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.11 (1H, d,J= 9.1 Hz), 6.97-6.85 (3H, m), 6.77-6.74 (2H, m), 4.93-4.87 (1H, m), 4.66 (1H, dd,J= 9.6, 7.3 Hz), 4.25 (1H, t,J= 10.5 Hz), 4.11 (2H, t,J= 7.1 Hz), 3.81 (2H, s), 3.62 (2H, s), 3.42 (3H, s), 3.00 (3H, s), 1.47 (9H, s).

[0329] Step B: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(methylamino)ethoxy)

[0330] -4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0331] To a solution of tert-butyl(S)-(2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl)(methyl)carbamate (100 mg, 0.176 mmol) in DCM (1.8 mL) was added HCl (4 M in dioxane, 0.200 mL, 0.881 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours and concentratedin vacuoto afford the title compound (70.0 mg, 85%) as a white solid, which was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 9.88 (1H, s), 7.96 (1H, d,J= 7.3 Hz), 7.86 (1H, s), 7.46 (1H, s), 7.23 (1H, d,J= 7.8 Hz), 7.10 (1H, d,J= 8.7 Hz), 7.00-6.86 (5H, m), 4.89-4.82 (1H, m), 4.63 (1H, dd,J= 9.6, 7.3 Hz), 4.39 (2H, br s), 4.25 (1H, t,J= 10.3 Hz), 3.81 (2H, s), 3.40 (3H, br s), 3.34 (2H, s), 2.74 (3H, s).

[0332] Step C: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(N-methylacetamido)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0333] To a solution of (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(methylamino)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (60.0 mg, 0.128 mmol) in DCM (1.2 mL) was added TEA (36.0 μL, 0.257 mmol) and Ac2O (12.0 μL, 0.128 mmol) at 15℃. The reaction mixture was stirred at 15℃ for 1 hour. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(DCM:MeOH = 20:1) to give the title compound (45.0 mg, 69%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.24 (1H, d,J= 8.2 Hz), 7.14-7.10 (1H, m), 7.00-6.85 (3H, m), 6.76-6.73 (2H, m), 4.93-4.86 (1H, m), 4.68-4.63 (1H, m), 4.25 (1H, td,J= 10.5, 3.4 Hz), 4.17-4.08 (2H, m), 3.81 (2H, s), 3.78-3.74 (2H, m), 3.42 (3H, s), 3.11 (3H, d,J= 61.7 Hz), 2.11 (3H, d,J= 8.2 Hz). LC-MS: m / z = 510.10 [M+H]+.

[0334]

[0335] Example 13: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(2-oxopyrrolidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0336]

[0337] Step A: tert-butyl (S)-(5-methyl-4-oxo-7-(2-(2-oxopyrrolidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0338] The title compound was prepared in a similar fashion toExample 9(Step A) with (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1)and 2-(2-oxopyrrolidin-1-yl)ethyl methanesulfonate. The crude product was purified by column chromatography on SiO2(DCM:MeOH = 20:1) to give the title compound (57%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.05 (1H, dd,J= 12.6, 3.9 Hz), 6.71-6.67 (2H, m), 5.47 (1H, d,J= 7.3 Hz), 4.68-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.3 Hz), 4.12-4.07 (3H, m), 3.69 (2H, td,J= 5.0, 1.9 Hz), 3.60-3.56 (2H, m), 3.38 (3H, s), 2.42 (2H, t,J= 8.2 Hz), 2.10-2.02 (2H, m), 1.40 (9H, s).

[0339] Step B: (S)-3-amino-5-methyl-7-(2-(2-oxopyrrolidin-1-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0340] The title compound was prepared in a similar fashion toExample 10(Step B) with tert-butyl (S)-(5-methyl-4-oxo-7-(2-(2-oxopyrrolidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate. After concentration, the crude (99%) as a yellow solid was used for the next reaction without further purification.1H-NMR (400 MHz, DMSO-d6): δ 8.43 (3H, s), 7.18 (1H, d,J= 8.7 Hz), 7.11 (1H, d,J= 2.7 Hz), 6.88 (1H, dd,J= 8.7, 2.7 Hz), 4.50 (1H, dd,J= 9.6, 7.3 Hz), 4.36 (1H, t,J= 10.3 Hz), 4.27-4.22 (1H, m), 4.10 (2H, t,J= 5.7 Hz), 3.56-3.53 (2H, m), 3.47-3.44 (2H, m), 3.35 (3H, s), 2.22 (2H, t,J= 8.2 Hz), 1.96-1.88 (2H, m).

[0341] Step C: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(2-oxopyrrolidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0342] The title compound was prepared in a similar fashion toExample 7(Step C) with (S)-3-amino-5-methyl-7-(2-(2-oxopyrrolidin-1-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 10:1) to give the title compound (63%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.8 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.12 (1H, dd,J= 5.5, 3.7 Hz), 7.00-6.85 (3H, m), 6.75-6.72 (2H, m), 4.93-4.87 (1H, m), 4.65 (1H, dd,J= 9.6, 7.8 Hz), 4.25 (1H, dd,J= 11.0, 10.1 Hz), 4.11 (2H, t,J= 5.3 Hz), 3.81 (2H, s), 3.70 (2H, t,J= 4.8 Hz), 3.59 (2H, t,J= 7.3 Hz), 3.42 (3H, s), 2.42 (2H, t,J= 8.2 Hz), 2.07 (2H, q,J= 7.5 Hz). LC-MS: m / z = 522.10 [M+H]+.

[0343]

[0344] Example 14: 4-(3-fluorobenzyl)-N-((S)-7-(2-((S)-3-hydroxy-2-oxopyrrolidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0345]

[0346] Step A: N-((S)-7-(2-((S)-3-(benzyloxy)-2-oxopyrrolidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0347] The title compound was prepared in a similar fashion toExample 3with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and (S)-3-(benzyloxy)-1-(2-hydroxyethyl)pyrrolidin-2-one. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:4) to give the title compound (72%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 1.1 Hz), 7.41-7.28 (6H, m), 7.25-7.23 (1H, m), 7.11 (1H, t,J= 4.8 Hz), 7.00-6.85 (3H, m), 6.72 (2H, td,J= 4.8, 2.7 Hz), 4.97 (1H, d,J= 11.9 Hz), 4.92-4.86 (1H, m), 4.77 (1H, d,J= 11.9 Hz), 4.65 (1H, dd,J= 9.6, 7.8 Hz), 4.25 (1H, dd,J= 11.0, 9.6 Hz), 4.16-4.11 (3H, m), 3.81 (2H, s), 3.79-3.74 (1H, m), 3.69-3.57 (2H, m), 3.50-3.43 (1H, m), 3.40 (3H, s), 2.38-2.30 (1H, m), 2.09-2.00 (1H, m).

[0348] Step B: 4-(3-fluorobenzyl)-N-((S)-7-(2-((S)-3-hydroxy-2-oxopyrrolidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0349] A suspension of N-((S)-7-(2-((S)-3-(benzyloxy)-2-oxopyrrolidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide (50.0 mg, 0.080 mmol) and Pd / C (10wt%, 8.00 mg) in MeOH (0.80 mL) was stirred at room temperature for 18 hours under H2atmosphere (balloon). After filtered through a Celite pad while washing with MeOH, the filtrate was concentratedin vacuo.The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:4) to give the title compound (5.00 mg, 11%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.12 (1H, dd,J= 7.3, 2.3 Hz), 7.00-6.85 (3H, m), 6.73 (2H, dd,J= 7.5, 2.5 Hz), 4.93-4.87 (1H, m), 4.65 (1H, dd,J= 9.6, 7.8 Hz), 4.37 (1H, t,J= 8.5 Hz), 4.25 (1H, dd,J= 11.2, 9.8 Hz), 4.16-4.09 (2H, m), 3.85-3.79 (3H, m), 3.65-3.60 (1H, m), 3.56-3.51 (2H, m), 3.41 (3H, s), 3.05 (1H, s), 2.53-2.45 (1H, m), 2.05-1.97 (1H, m). LC-MS: m / z = 538.10 [M+H]+.

[0350]

[0351] Example 15: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(4-methyl-3-oxopiperazin-1-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0352]

[0353] Step A:tert-butyl (S)-(5-methyl-7-(2-(4-methyl-3-oxopiperazin-1-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0354] The title compound was prepared in a similar fashion toExample 9(Step A)with tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1) and 2-(4-methyl-3-oxopiperazin-1-yl)ethyl methanesulfonate. The crude product was purified by column chromatography on SiO2(DCM:MeOH = 99:1 to 95:5) to give the title compound (19%) as a yellow oil.1H-NMR (400 MHz, CDCl3): δ 7.05 (1H, d,J =8.4Hz), 6.73-6.69 (2H, m), 5.47 (1H, d,J =7.2 Hz), 4.67-4.61 (1H, m), 4.51 (1H, dd,J =9.2, 7.6 Hz), 4.14-4.06 (3H, m), 3.37-3.35 (5H, m), 3.29 (2H, s), 2.96 (3H, s), 2.88-2.83 (4H, m), 1.39 (9H, s).

[0355] Step B: (S)-3-amino-5-methyl-7-(2-(4-methyl-3-oxopiperazin-1-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0356] The title compound was prepared in a similar fashion toExample 10(Step B)with tert-butyl (S)-(5-methyl-7-(2-(4-methyl-3-oxopiperazin-1-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate. After concentration, the crude product as a yellow solid was used for the next reaction without further purification. LC-MS: m / z = 349.1 [M+H]+.

[0357] Step 3: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(4-methyl-3-oxopiperazin-1-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0358] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-amino-5-methyl-7-(2-(4-methyl-3-oxopiperazin-1-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one, HCl and 4-(3-fluorobenzyl)-1H-pyrazole, HCl (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 10:1 to 2:1 and DCM:MeOH=99:1 to 95:5) to give the title compound (40%) as a yellow foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J =7.2 Hz), 7.87 (1H, s), 7.46 (1H, s), 7.27-7.21 (1H, m), 7.10 (1H, d,J =8.8 Hz), 6.95-6.84 (3H, m), 6.78-6.73 (2H, m), 4.92-4.85 (1H, m), 4.65 (1H, dd,J =9.6, 7.6 Hz), 4.24 (1H, dd,J =10.8, 10.0 Hz), 4.11 (2H, t,J =5.2 Hz), 3.80 (2H, s), 3.40 (3H, s), 3.37 (2H, t,J =5.6 Hz), 3.31 (2H, s), 2.96 (3H, s), 2.90-2.85 (4H, m). LC-MS: m / z = 551.1 [M+H]+.

[0359] Example 16: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(2-oxopyridin-1(2H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0360]

[0361] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 1-(2-hydroxyethyl)pyridin-2(1H)-one. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:4) to give the title compound (19%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 7.3 Hz), 7.87 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.43 (1H, dd,J= 6.9, 1.4 Hz), 7.39-7.34 (1H, m), 7.24-7.23 (1H, m), 7.09 (1H, dd,J= 7.5, 1.6 Hz), 7.00-6.85 (3H, m), 6.73 (2H, dd,J= 8.5, 2.1 Hz), 6.59 (1H, d,J= 9.1 Hz), 6.20 (1H, td,J= 6.9, 1.4 Hz), 4.90-4.83 (1H, m), 4.64 (1H, td,J= 6.7, 3.0 Hz), 4.40-4.21 (5H, m), 3.81 (2H, s), 3.40 (3H, s). LC-MS: m / z = 532.10 [M+H]+.

[0362]

[0363] Example 17: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-((tetrahydro-2H-pyran-4-yl)oxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0364]

[0365] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and tetrahydro-2H-pyran-4-ol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 3:1 to 1:1) to give the title compound (25%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J =7.6 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.10 (1H, dd,J =5.4, 4.2 Hz), 6.96-6.84 (3H, m), 6.78-6.75 (2H, m), 4.92 (1H, dt,J =11.1, 7.4 Hz), 4.66 (1H, dd,J =9.6, 8.0 Hz), 4.48-4.42 (1H, m), 4.25 (dd,J= 11.4, 9.8 Hz), 4.02-3.97 (2H, m), 3.81 (2H, s), 3.62-3.57 (2H, m), 3.41 (3H, s), 2.09-2.00 (2H, m), 1.85-1.76 (2H, m). LC-MS: m / z = 495.1 [M+H]+.

[0366]

[0367] Example 18: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(tetrahydro-2H-pyran-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0368]

[0369] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 2-(tetrahydro-2H-pyran-4-yl)ethan-1-ol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1 to 1:1) following by NH-SiO2(Hexanes:EtOAc = 2:1) to give the title compound (65%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.6 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.10 (1H, dd,J =7.4, 1.8 Hz), 6.96-6.84 (3H, m), 6.76-6.73 (2H, m), 4.90 (1H, dt,J =11.2, 7.4 Hz), 4.65 (1H, dd,J =9.6, 8.0 Hz), 4.24 (1H, dd,J =11.0, 9.8 Hz), 4.02-3.96 (4H, m), 3.81 (2H, s), 3.45-3.38 (5H, m), 1.86-1.73 (3H, m), 1.69-1.66 (2H, m), 1.59 (3H, s), 1.37 (2H, m). LC-MS: m / z = 523.1 [M+H]+.

[0370]

[0371] Example 19: (S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxytetrahydro-2H-pyran-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0372]

[0373] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 4-(2-hydroxyethyl)tetrahydro-2H-pyran-4-ol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:4) to give the title compound (19%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.24-7.23 (1H, m), 7.12 (1H, d,J= 8.7 Hz), 7.00-6.85 (3H, m), 6.78-6.74 (2H, m), 4.93-4.87 (1H, m), 4.65 (1H, dd,J= 9.8, 7.5 Hz), 4.28-4.21 (3H, m), 3.86-3.75 (6H, m), 3.42 (3H, s), 2.27 (1H, s), 2.03 (2H, t,J= 5.9 Hz), 1.81-1.71 (2H, m), 1.64 (2H, d,J= 12.3 Hz). LC-MS: m / z = 539.20 [M+H]+.

[0374]

[0375] Example 20: (S)-4-(3-fluorobenzyl)-N-(7-(oxetan-3-ylmethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0376]

[0377] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and oxetan-3-ylmethanol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1 to 1:2) to give the title compound (26%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J =7.6 Hz), 7.88 (1H, d,J =0.8 Hz), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.14-7.11 (1H, m), 6.96-6.84 (3H, m), 6.79-6.76 (2H, m), 4.94-4.86 (3H, m), 4.66 (1H, dd,J =9.6, 7.2 Hz), 4.58 (2H, t,J =6.0 Hz), 4.25 (1H, dd,J =11.0, 9.8 Hz), 4.20 (2H, d,J =6.8 Hz), 3.81 (2H, s), 3.50-3.40 (4H, m). LC-MS: m / z = 481.1 [M+H]+

[0378]

[0379] Example 21: (S)-4-(3-fluorobenzyl)-N-(7-(2-(oxetan-3-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0380]

[0381] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 2-(oxetan-3-yl)ethan-1-ol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1 to 1:2) to give the title compound (72%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.6 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.10 (1H, d,J =8.0 Hz), 6.96-6.85 (3H, m), 6.72-6.69 (2H, m), 4.92-4.84 (3H, m), 4.65 (1H, dd,J =9.6, 8.0 Hz), 4.52 (2H, td,J =6.3, 1.7 Hz), 4.24 (1H, dd,J =11.0, 9.8 Hz), 3.93 (2H, t,J =6.2 Hz), 3.81 (2H, s), 3.41 (3H, s), 3.28-3.21 (1H, m), 2.22-2.17 (2H, m). LC-MS: m / z = 495.1 [M+H]+.

[0382]

[0383] Example 22: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-((3-methyloxetan-3-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0384]

[0385] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and (3-methyloxetan-3-yl)methanol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1) following by NH-SiO2(Hexanes:EtOAc = 2:1) to give the title compound (43%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J =7.2 Hz), 7.88 (1H, d,J =0.9 Hz), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.13 (1H, dd,J =6.8, 2.8 Hz), 6.96-6.84 (3H, m), 6.81-6.77 (2H, m), 4.90 (1H, dt,J =11.2, 7.4 Hz), 4.68-4.63 (3H, m), 4.48 (2H, d,J =6.0 Hz), 4.25 (1H, dd,J =10.8, 9.6 Hz), 4.02 (2H, s), 3.81 (2H, s), 3.43 (3H, s), 1.45 (3H, s). LC-MS: m / z = 495.1 [M+H]+.

[0386]

[0387] Example 23: (S)-N-(7-((3-ethyloxetan-3-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0388]

[0389] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and (3-ethyloxetan-3-yl)methanol. The crude product was purified by column chromatography on NH-SiO2(Hexanes:EtOAc = 3:1 to 2:1) following by SiO2(Hexanes:EtOAc = 4:1 to 1:1) to give the title compound (27%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J =7.2 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.14-7.12 (1H, m), 6.96-6.85 (3H, m), 6.81-6.78 (2H, m), 4.91 (1H, dt,J =11.2, 7.4 Hz), 4.66 (1H, dd,J =9.6, 7.2 Hz), 4.58 (2H, dd,J =6.0, 2.0 Hz), 4.51 (2H, d,J =6.4 Hz), 4.25 (1H, dd,J =11.2, 10.0 Hz), 4.08 (2H, s), 3.81 (2H, s), 3.43 (3H, s), 1.89 (2H, q,J =7.6 Hz), 0.95 (3H, t,J =7.6 Hz). LC-MS: m / z = 509.1 [M+H]+.

[0390]

[0391] Example 24: (S)-4-(3-fluorobenzyl)-N-(7-(2-(3-hydroxyoxetan-3-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0392]

[0393] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 3-(2-hydroxyethyl)oxetan-3-ol. The crude product was purified by column chromatography on SiO2(EtOAc only) to give the title compound (24%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.24-7.23 (1H, m), 7.12 (1H, d,J= 8.7 Hz), 7.00-6.85 (3H, m), 6.78-6.73 (2H, m), 4.93-4.86 (1H, m), 4.68-4.63 (5H, m), 4.28-4.25 (1H, m), 4.22 (2H, d,J= 5.9 Hz), 3.81 (2H, s), 3.42 (3H, s), 2.97 (1H, s), 2.41 (2H, t,J= 5.7 Hz). LC-MS: m / z = 511.10 [M+H]+.

[0394]

[0395] Example 25: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(piperidin-4-ylmethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0396]

[0397] Step A: tert-butyl (S)-4-(((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)methyl)piperidine-1-carboxylate

[0398] The title compound was prepared in a similar fashion toExample 3(Step A) with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and tert-butyl 4-(hydroxymethyl)piperidine-1-carboxylate. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 5:1 to 2:1) to give the title compound (21%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.2 Hz), 7.88 (1H, s), 7.46 (1H, s), 7.28-7.22 (1H, m), 7.10 (1H, dd,J =6.4, 2.8 Hz), 6.96-6.85 (3H, m), 6.75-6.72 (2H, m), 4.90 (1H, dt,J =11.2, 7.5 Hz), 4.65 (1H, dd,J =9.8, 7.4 Hz), 4.27-4.09 (3H, m), 3.81-3.79 (4H, m), 3.41 (3H, s), 2.76 (2H, t,J =12.4 Hz), 2.02-1.91 (1H, m), 1.83 (2H, d,J =12.4 Hz), 1.47 (9H, s), 1.34-1.23 (2H, m).

[0399] Step B: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(piperidin-4-ylmethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0400] The title compound was prepared in a similar fashion toExample 12(Step B) with tert-butyl (S)-4-(((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)methyl)piperidine-1-carboxylate. The crude product was purified by column chromatography on SiO2(DCM:MeOH = 95:5 to 80:20) to give the title compound (94%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.6 Hz), 7.88 (1H, s), 7.46 (1H, s), 7.27-7.22 (1H, m), 7.11 (1H, dd,J =7.2, 2.4 Hz), 6.96-6.85 (3H, m), 6.73-6.70 (2H, m), 4.89 (1H, dt,J =11.1, 7.4 Hz), 4.65 (1H, dd,J =9.8, 7.8 Hz), 4.25 (1H, dd,J =11.0, 10.2 Hz), 3.85 (2H, d,J =6.0 Hz), 3.81 (2H, s), 3.58 (2H, d,J =12.4 Hz), 3.41 (3H, s), 2.97-2.91 (2H, m), 2.11-2.07 (3H, m), 1.89-1.81 (2H, m). LC-MS: m / z = 508.1 [M+H]+.

[0401]

[0402] Example 26: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-((1-methylpiperidin-4-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0403]

[0404] To a solution of (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(piperidin-4-ylmethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Example 25,30 mg, 0.059 mmol) in MeOH (0.59 mL) was added AcOH (3.38 μL, 0.059 mmol) followed by formaldehyde solution (37 wt.% in H2O, 0.022 mL, 0.30 mmol). The mixture was stirred for 30 min at room temperature and cooled to 0℃. After addition of NaBH3CN (14.9 mg, 0.236 mmol) at 0℃, the reaction mixture was stirred for 17 hours at room temperature. After evaporation of MeOH, the residue was partitioned between DCM and water. The separated aqueous layer was extracted with DCM twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentratedin vacuo. The residue was purified by column chromatography on SiO2(DCM:MeOH = 95:5 to 80:20) to afford the title compound (28 mg, 91%) as a colorless oil.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.2 Hz), 7.88 (1H, s), 7.46 (1H, s), 7.28-7.22 (1H, m), 7.10 (1H, dd,J =6.6, 2.6 Hz), 7.00-6.84 (3H, m), 6.75-6.71 (2H, m), 4.89 (1H, dt,J =11.1, 7.5 Hz), 4.65 (1H, dd,J =9.8, 7.4 Hz), 4.24 (1H, dd,J =11.4, 9.8 Hz), 3.82-3.81 (4H, m), 3.41 (3H, s), 3.06 (2H, d,J =10.0 Hz), 2.41 (3H, s), 2.19-2.13 (2H, m), 1.92-1.79 (3H, m), 1.63-1.57 (2H, m). LC-MS: m / z = 522.1 [M+H]+.

[0405]

[0406] Example 27: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(piperidin-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0407]

[0408] Step A: tert-butyl (S)-4-(2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl)piperidine-1-carboxylate

[0409] The title compound was prepared in a similar fashion toExample 3(Step A)with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and tert-butyl 4-(2-hydroxyethyl)piperidine-1-carboxylate. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 5:1 to 2:1) to give the title compound (42%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.2 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.27-7.22 (1H, m), 7.11-7.09 (1H, m), 6.96-6.85 (3H, m), 6.75-6.73 (2H, m), 4.90 (1H, dt,J =11.1, 7.5 Hz), 4.65 (1H, dd,J =9.8, 7.4 Hz), 4.24 (1H, dd,J =11.4, 9.8 Hz), 4.00 (2H, t,J =6.0 Hz), 3.81 (2H, s), 3.41 (3H, s), 2.72 (2H, t,J =10.6 Hz), 1.75-1.60 (7H, m), 1.45-1.41 (9H, m), 1.20-1.14 (2H, m).

[0410] Step 2: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(piperidin-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0411] The title compound was prepared in a similar fashion toExample 12(Step B)with tert-butyl (S)-4-(2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl)piperidine-1-carboxylate. The crude product was purified by column chromatography on NH-SiO2(DCM:MeOH=99:1 to 98:2) to give the title compound (74%) as a white solid.1H-NMR (400 MHz, CDCl3): δ 7.88 (1H, s), 7.46 (1H, s), 7.27-7.22 (1H, m), 7.10 (1H, dd,J =7.2, 2.0 Hz), 6.96-6.85 (3H, m), 6.75-6.73 (2H, m), 4.90 (1H, dd,J =11.2, 7.6 Hz), 4.65 (1H, dd,J =10.0, 7.6 Hz), 4.24 (1H, dd,J =11.4, 9.8 Hz), 4.00 (2H, t,J =6.2 Hz), 3.81 (2H, s), 3.41 (3H, s), 3.09-3.06 (2H, m), 2.62 (2H, td,J =12.2, 2.4 Hz), 1.76-1.61 (5H, m), 1.23-1.14 (2H, m). LC-MS: m / z = 522.2 [M+H]+.

[0412]

[0413] Example 28: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(1-methylpiperidin-4-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0414]

[0415] The title compound was prepared in a similar fashion toExample 26with (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(piperidin-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide. The crude product was purified by column chromatography on SiO2(DCM:MeOH = 9:1 to 8:2) to afford the title compound (52%) as a pale yellow solid.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J =7.2 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.10 (1H, dd,J =7.2, 2.0 Hz), 6.96-6.84 (3H, m), 6.75-6.73 (2H, m), 4.90 (1H, dt,J =11.1, 7.4 Hz), 4.65 (1H, dd,J =9.8, 7.4 Hz), 4.24 (1H, dd,J =11.4, 9.8 Hz), 3.99 (2H, t,J =6.4 Hz), 3.81 (2H, s), 3.41 (3H, s), 2.90 (2H, d,J =11.2 Hz), 2.29 (3H, s), 2.00-1.95 (2H, m), 1.77-1.73 (4H, m), 1.60-1.48 (1H, m), 1.42-1.33 (2H, m). LC-MS: m / z = 536.2 [M+H]+.

[0416]

[0417] Example 29: (S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxypiperidin-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0418]

[0419] Step A: tert-butyl (S)-4-(2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl)-4-hydroxypiperidine-1-carboxylate

[0420] The title compound was prepared in a similar fashion toExample 3(Step A)with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and tert-butyl 4-hydroxy-4-(2-hydroxyethyl)piperidine-1-carboxylate. The crude product was purified by column chromatography on SiO2(Hexanes: EtOAc = 1:1) to give the title compound (37%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.48 (1H, d,J= 4.6 Hz), 7.24-7.22 (1H, m), 7.12 (1H, d,J= 8.2 Hz), 7.00-6.85 (3H, m), 6.78-6.74 (2H, m), 4.93-4.87 (1H, m), 4.65 (1H, dd,J= 9.8, 7.5 Hz), 4.28-4.25 (1H, m), 4.21 (2H, t,J= 6.2 Hz), 3.88-3.83 (2H, m), 3.81 (2H, s), 3.42 (3H, s), 3.22 (2H, t,J= 13.3 Hz), 2.22 (1H, s), 2.01 (2H, t,J= 5.9 Hz), 1.69-1.59 (4H, m), 1.46 (9H, s).

[0421] Step B: (S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxypiperidin-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0422] The title compound was prepared in a similar fashion toExample 12(Step B)with tert-butyl (S)-4-(2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl)-4-hydroxypiperidine-1-carboxylate. The crude product was purified by column chromatography on SiO2(DCM:MeOH = 10:1) to afford the title compound (91%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.14 (1H, d,J= 9.1 Hz), 7.00-6.85 (3H, m), 6.78-6.75 (2H, m), 4.93-4.86 (1H, m), 4.65 (1H, dd,J= 9.8, 7.5 Hz), 4.29-4.21 (3H, m), 3.81 (2H, s), 3.42 (3H, s), 3.35 (4H, d,J= 7.3 Hz), 2.78 (1H, s), 2.12-2.05 (4H, m), 1.90 (2H, d,J= 14.2 Hz). LC-MS: m / z = 538.20 [M+H]+.

[0423]

[0424] Example 30: (S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxy-1-methylpiperidin-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0425]

[0426] The title compound was prepared in a similar fashion toExample 26with (S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxypiperidin-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide. The crude product was purified by column chromatography on SiO2(DCM:MeOH = 10:1) to afford the title compound (44%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 7.8 Hz), 7.88 (1H, s), 7.48 (1H, s), 7.25-7.23 (1H, m), 7.15 (1H, d,J= 8.7 Hz), 7.00-6.85 (3H, m), 6.79-6.75 (2H, m), 4.93-4.87 (1H, m), 4.64 (1H, dd,J= 9.8, 7.5 Hz), 4.29-4.23 (3H, m), 3.81 (2H, s), 3.42 (3H, s), 3.29-3.23 (2H, m), 3.18-3.11 (2H, m), 2.96 (1H, s), 2.74 (3H, s), 2.32-2.25 (2H, m), 2.12 (2H, dd,J= 6.6, 4.3 Hz), 1.89 (2H, d,J= 13.7 Hz). LC-MS: m / z = 552.20 [M+H]+

[0427]

[0428] Example 31: (S)-N-(7-((1,1-dioxidotetrahydro-2H-thiopyran-4-yl)oxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0429]

[0430] The title compound was prepared in a similar fashion toExample 3(Step A)with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 4-hydroxytetrahydro-2H-thiopyran 1,1-dioxide. The crude product was purified by column chromatography on SiO2(Pet. ether:EtOAc = 1:2) to give the title compound (15%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.8 Hz), 7.88 (1H, s), 7.48 (1H, s), 7.29-7.23 (1H, m), 7.15 (1H, dd,J= 7.3, 1.8 Hz), 7.00-6.85 (3H, m), 6.78 (2H, dd,J= 7.8, 2.3 Hz), 4.94-4.90 (1H, m), 4.68-4.65 (1H, m), 4.27 (1H, dd,J= 11.0, 10.1 Hz), 3.82 (2H, s), 3.42 (3H, s), 3.40-3.37 (1H, m), 3.09 (1H, t,J= 6.4 Hz), 2.98 (2H, dd,J= 14.9, 3.9 Hz), 2.52-2.38 (5H, m). LC-MS: m / z = 543.10 [M+H]+.

[0431]

[0432] Example 32: (S)-N-(7-((1,1-dioxidotetrahydro-2H-thiopyran-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0433]

[0434] The title compound was prepared in a similar fashion toExample 3(Step A)with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 4-(hydroxymethyl)tetrahydro-2H-thiopyran 1,1-dioxide. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:4) to give the title compound (26%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.12 (1H, dd,J= 5.7, 3.9 Hz), 7.00-6.85 (3H, m), 6.74-6.71 (2H, m), 4.93-4.87 (1H, m), 4.65 (1H, dd,J= 9.6, 7.3 Hz), 4.25 (1H, dd,J= 11.0, 10.1 Hz), 3.87 (2H, d,J= 5.0 Hz), 3.81 (2H, s), 3.42 (3H, s), 3.17-2.97 (4H, m), 2.31-2.29 (2H, m), 2.09-2.05 (2H, m), 1.93-1.88 (1H, m). LC-MS: m / z = 557.10 [M+H]+.

[0435]

[0436] Example 33: (S)-N-(7-(2-(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0437]

[0438] The title compound was prepared in a similar fashion toExample 3(Step A)with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 4-(2-hydroxyethyl)tetrahydro-2H-thiopyran 1,1-dioxide. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:3) to give the title compound (50%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.12 (1H, dd,J= 7.3, 1.8 Hz), 7.00-6.85 (3H, m), 6.73 (2H, dd,J= 7.5, 2.5 Hz), 4.94-4.87 (1H, m), 4.64 (1H, dd,J= 9.8, 7.5 Hz), 4.25 (1H, dd,J= 11.0, 10.1 Hz), 4.02 (2H, t,J= 5.7 Hz), 3.81 (2H, s), 3.42 (3H, s), 3.11-2.96 (5H, m), 2.19 (2H, d,J= 13.7 Hz), 2.00-1.91 (2H, m), 1.8-1.82 (2H, m). LC-MS: m / z = 571.10 [M+H]+.

[0439]

[0440] Example 34: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(3-(tetrahydro-2H-pyran-4-yl)propoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0441]

[0442] The title compound was prepared in a similar fashion toExample 3with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 3-(tetrahydro-2H-pyran-4-yl)propan-1-ol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 4:1 to 3:1) following NH-SiO2(Hexanes:EtOAc = 4:1 to 3:1) to give the title compound (11%) as a yellow foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J =7.6 Hz), 7.88 (1H, d,J =0.8 Hz), 7.46 (1H, s), 7.27-7.22 (1H, m), 7.11-7.09 (1H, m), 6.96-6.84 (3H, m), 6.75-6.72 (2H, m), 4.90 (1H, dt,J =11.2, 7.5 Hz), 4.65 (1H, dd,J =9.8, 7.4 Hz), 4.24 (1H, dd,J =11.2, 9.6 Hz), 3.99-3.93 (4H, m), 3.81 (2H, s), 3.42-3.36 (5H, m), 1.85-1.78 (2H, m), 1.66-1.62 (2H, m), 1.60-1.49 (1H, m), 1.46-1.40 (2H, m), 1.36-1.27 (2H, m). LC-MS: m / z = 537.2 [M+H]+.

[0443]

[0444] Example 35: (S)-4-(3-fluorobenzyl)-N-(7-((3-(hydroxymethyl)oxetan-3-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0445]

[0446] Step A:(S)-(3-(((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)methyl)oxetan-3-yl)methyl acetate

[0447] To a solution of (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate3) (172 mg, 0.418 mmol) and (3-(bromomethyl)oxetan-3-yl)methyl acetate (Intermediate 11) (140 mg, 0.628 mmol) in DMF (4.2 mL) was added Cs2CO3(204 mg, 0.628 mmol). The reaction mixture was stirred at 30℃ for 4 hours. After concentration in vacuo, the residue was diluted with water and extracted with EtOAc twice. The combined organic layers were washed with brine, dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1) to give the title compound (175 mg, 76%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.6 Hz), 7.88 (1H, d,J =0.8 Hz), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.13 (1H, dd,J =5.2, 4.4 Hz), 7.00-6.84 (3H, m), 6.80-6.77 (2H, m), 4.90 (1H, dt,J =11.2, 7.4 Hz), 4.66 (1H, dd,J =10.0, 7.6 Hz), 4.60 (4H, m), 4.45 (2H, s), 4.26 (1H, dd,J =11.0, 10.2 Hz), 4.19 (2H, s), 3.81 (2H, s), 3.43 (3H, s), 2.10 (3H, s).

[0448] Step B: (S)-4-(3-fluorobenzyl)-N-(7-((3-(hydroxymethyl)oxetan-3-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0449] To a solution of (S)-(3-(((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)methyl)oxetan-3-yl)methyl acetate (50.0 mg, 0.0900 mmol) in MeOH (0.91 mL) was added K2CO3(6.25 mg, 0.0450 mmol) at 0℃. The reaction mixture was stirred at 0℃ for 30 min and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:2 to 1:8) to afford the title compound (41.0 mg, 88%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.6 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.13 (1H, dd,J =7.6, 1.6 Hz), 7.00-6.85 (3H, m), 6.82-6.79 (2H, m), 4.90 (1H, dt,J =11.1, 7.4 Hz), 4.66 (1H, dd,J =9.8, 7.4 Hz), 4.62-4.57 (4H, m), 4.28-4.23 (3H, m), 4.06 (2H, d,J =3.6 Hz), 3.81 (2H, s), 3.43 (3H, s). LC-MS: m / z = 511.1 [M+H]+.

[0450]

[0451] Example 36: (S)-N-(5-methyl-4-oxo-7-(2-(piperidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-imidazole-1-carboxamide

[0452]

[0453] Step A: tert-butyl (S)-(5-methyl-4-oxo-7-(2-(piperidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0454] To a solution of tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1, 0.183 g, 0.594 mmol) in DMF (2.9 mL) was added Cs2CO3(0.581 g, 1.78 mmol) and 1-(2-chloroethyl)piperidine (0.114 g, 0.772 mmol) at room temperature. The reaction mixture was stirred at 50℃ for 18 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(DCM:MeOH = 20:1) to afford the title compound (0.175 g, 70%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.04 (1H, d,J= 8.0 Hz), 6.73-6.69 (2H, m), 5.47 (1H, d,J= 7.2 Hz), 4.68-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.6 Hz), 4.11-4.06 (3H, m), 3.37 (3H, s), 2.77 (2H, t,J= 6.0 Hz), 2.52 (3H, s), 1.47-1.46 (2H, m), 1.39 (9H, s), 1.31-1.25 (2H, m).

[0455] Step B: (S)-3-amino-5-methyl-7-(2-(piperidin-1-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0456] To a solution of tert-butyl (S)-(5-methyl-4-oxo-7-(2-(piperidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (0.175 g, 0.417 mmol) in DCM (4.1 mL) was added HCl (4 M in dioxane, 2.08 mL, 8.34 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours and then concentratedin vacuoto afford the title compound (0.172 g, crude) as a yellow oil, which was used for the next reaction without further purification.

[0457] Step C: (S)-N-(5-methyl-4-oxo-7-(2-(piperidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-imidazole-1-carboxamide

[0458] The title compound was prepared in a similar fashion toExample 7(Step C) with (S)-3-amino-5-methyl-7-(2-(piperidin-1-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:MeOH = 20:1 to 10:1) to give the title compound (52%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.6 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.27-7.22 (2H, m), 7.11-7.09 (1H, m), 6.96-6.85 (3H, m), 6.77-6.74 (2H, m), 4.93-4.86 (1H, m), 4.65 (1H, dd,J= 9.8, 7.4 Hz), 4.24 (1H, t,J= 10.6 Hz), 4.10 (2H, t,J= 6.0 Hz), 3.81 (2H, s), 3.41 (3H, s), 2.78 (2H, t,J= 6.0 Hz), 2.52 (4H, s), 1.65-1.59 (4H, m), 1.47-1.46 (2H, m). LC-MS: m / z = 522.2 [M+H]+.

[0459]

[0460] Example 37: (S)-N-(7-(2-(4,4-difluoropiperidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0461]

[0462] The title compound was prepared in a similar fashion toExample 3with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 2-(4,4-difluoropiperidin-1-yl)ethan-1-ol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1) to give the title compound (18%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.8 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.24-7.22 (1H, m), 7.11 (1H, dd,J= 5.7, 3.9 Hz), 7.00-6.85 (3H, m), 6.77-6.74 (2H, m), 4.93-4.87 (1H, m), 4.65 (1H, dd,J= 9.6, 7.3 Hz), 4.25 (1H, dd,J= 11.2, 9.8 Hz), 4.08 (2H, t,J= 5.7 Hz), 3.81 (2H, s), 3.41 (3H, s), 2.87 (2H, t,J= 5.5 Hz), 2.70 (4H, t,J= 5.5 Hz), 2.08-2.00 (4H, m). LC-MS: m / z = 558.20 [M+H]+.

[0463]

[0464] Example 38: (S)-N-(7-(2-(1,2-oxazinan-2-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0465]

[0466] Step A: tert-butyl (S)-(7-(2-(1,2-oxazinan-2-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0467] To a solution of tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1, 120 mg, 0.389 mmol) and 2-(1,2-oxazinan-2-yl)ethyl methanesulfonate (Intermediate 12, 98.0 mg, 0.467 mmol) in DMF (4.0 mL) was added Cs2CO3(254 mg, 0.778 mmol) at room temperature. The reaction mixture was stirred at 30℃ for 24 hours. After quenched with water, the mixture was extracted with DCM twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2-NH2(Hexanes:EtOAc = 3:1) to the title compound (70 mg, 43%) as a pale yellow oil.1H-NMR (400 MHz, CDCl3): δ 7.03 (1H, d,J= 8.7 Hz), 6.77-6.72 (2H, m), 5.48 (1H, d,J= 6.9 Hz), 4.68-4.61 (1H, m), 4.52 (H, dd,J= 9.6, 7.3 Hz), 4.20-4.15 (2H, m), 3.95-3.89 (3H, m), 3.37 (3H, s), 3.01 (2H, t,J= 5.9 Hz), 2.78-2.86 (2H, brs), 1.84-1.78 (2H, m), 1.57-1.54 (2H, m), 1.39 (9H, s).

[0468] Step B: (S)-7-(2-(1,2-oxazinan-2-yl)ethoxy)-3-amino-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0469] The title compound was prepared in a similar fashion toIntermediate 3(Step A)with tert-butyl (S)-(7-(2-(1,2-oxazinan-2-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate. The crude product (84%) was used for the next reaction without further purification.

[0470] Step C: (S)-N-(7-(2-(1,2-oxazinan-2-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0471] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-7-(2-(1,2-oxazinan-2-yl)ethoxy)-3-amino-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 15:1) to give the title compound (21%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.24-7.22 (1H, m), 7.10 (1H, dd,J= 7.8, 1.4 Hz), 7.00-6.85 (3H, m), 6.81-6.78 (2H, m), 4.93-4.87 (1H, m), 4.66 (1H, dd,J= 9.6, 7.3 Hz), 4.24 (1H, dd,J= 11.0, 10.1 Hz), 4.18 (2H, t,J= 5.0 Hz), 3.94 (2H, t,J= 5.3 Hz), 3.81 (2H, s), 3.41 (3H, s), 3.02 (2H, t,J= 5.9 Hz), 2.83 (2H, brs), 1.84-1.80 (2H, m), 1.56-1.54 (2H, m). LC-MS: m / z = 524.10 [M+H]+.

[0472]

[0473] Example 39: (S)-N-(7-(2-(1,1-dioxidothiomorpholino)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0474]

[0475] The title compound was prepared in a similar fashion toExample 3with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 4-(2-hydroxyethyl)thiomorpholine 1,1-dioxide. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1) to give the title compound (46%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.8 Hz), 7.88 (1H, d,J= 0.9 Hz), 7.47 (1H, s), 7.25-7.23 (1H, m), 7.12 (1H dd,J= 5.5, 3.7 Hz), 7.00-6.85 (3H, m), 6.76-6.73 (2H, m), 4.93-4.87 (1H, m), 4.65 (1H, dd,J= 9.8, 7.5 Hz), 4.26 (1H, dd,J= 11.2, 9.8 Hz), 4.09 (2H, t,J= 5.3 Hz), 3.81 (2H, s), 3.42 (3H, s), 3.19-3.17 (4H, m), 3.10 (4H, t,J= 4.1 Hz), 3.01 (2H, t,J= 5.3 Hz). LC-MS: m / z = 572.10 [M+H]+.

[0476]

[0477] Example 40: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl azetidine-1-carboxylate

[0478]

[0479] Step A: (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl azetidine-1-carboxylate

[0480] To a solution of (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14,33.0 mg, 0.0770 mmol) in DMF (0.77 mL) was added Cs2CO3(100 mg, 0.307 mmol) followed by azetidine hydrochloride (22.0 mg, 0.230 mmol) at room temperature. The reaction mixture was stirred at 50℃ for 18 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 3:1 to 1:5) to afford the title compound (19.0 mg, 56%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.05 (1H, d,J= 8.7 Hz), 6.75-6.70 (2H, m), 5.47 (1H, d,J= 7.8 Hz), 4.67-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.3 Hz), 4.43-4.38 (2H, m), 4.16-4.09 (3H, m), 4.03 (4H, t,J= 7.8 Hz), 3.38 (3H, s), 2.28-2.21 (2H, m), 1.39 (9H, s).

[0481] Step B: (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl azetidine-1-carboxylate

[0482] To a solution of (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl azetidine-1-carboxylate (19.0 mg, 0.0440 mmol) in DCM (0.43 mL) was added TFA (0.0170 mL, 0.218 mmol). The reaction mixture was stirred at room temperature overnight and then was concentrated in vacuo to afford the title compound (16.0 mg, crude) as a colorless oil, which was used for the next reaction without further purification.1H-NMR (400 MHz, CDCl3): δ 7.11 (1H, d,J= 9.6 Hz), 6.80-6.77 (2H, m), 4.67 (1H, t,J= 8.7 Hz), 4.51 (1H, t,J= 10.5 Hz), 4.43-4.38 (2H, m), 4.29 (1H, t,J= 9.1 Hz), 4.17-4.13 (2H, m), 4.03 (4H, t,J= 7.8 Hz), 3.32 (3H, s), 2.28-2.21 (2H, m).

[0483] Step C: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl azetidine-1-carboxylate

[0484] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl azetidine-1-carboxylate and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography by prep-HPLC to afford the title compound (26%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.26-7.22 (1H, m), 7.11 (1H, d,J= 9.1 Hz), 7.00-6.85 (3H, m), 6.78-6.75 (2H, m), 4.93-4.86 (1H, m), 4.65 (1H, dd,J= 9.6, 7.3 Hz), 4.40 (2H, t,J= 4.6 Hz), 4.25 (1H, dd,J= 11.0, 9.6 Hz), 4.15 (2H, t,J= 4.7 Hz), 4.03 (4H, t,J= 7.5 Hz), 3.81 (2H, s), 3.41 (3H, s), 2.28-2.21 (2H, m). ). LC-MS: m / z = 538.2 [M+H]+.

[0485]

[0486] Example 41: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3,3-difluoroazetidine-1-carboxylate

[0487]

[0488] The title compound was prepared in a similar fashion toExample 40with (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14) and 3,3-difluoroazetidine hydrochloride in 3 steps. The crude compound was purified by column chromatography on SiO2(DCM:EtOAc = 20:1 to 1:1) to afford the title compound (22% in 3 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.8 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.12 (1H, dd,J= 8.2, 0.9 Hz), 6.96-6.85 (3H, m), 6.76 (2H, dd,J= 11.0, 2.7 Hz), 4.93-4.86 (1H, m), 4.65 (1H, dd,J= 9.6, 7.3 Hz), 4.46 (2H, t,J= 4.8 Hz), 4.35 (4H, t,J= 11.9 Hz), 4.25 (1H, dd,J= 11.2, 9.8 Hz), 4.17 (2H, t,J= 4.8 Hz), 3.81 (2H, s), 3.42 (3H, s). LC-MS: m / z = 574.1 [M+H]+.

[0489]

[0490] Example 42: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3-hydroxy-3-methylazetidine-1-carboxylate

[0491]

[0492] Step A: tert-butyl (S)-(5-methyl-7-(2-(((4-nitrophenoxy)carbonyl)oxy)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0493] To a solution of tert-butyl (S)-(7-(2-hydroxyethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 13,1.31 g, 3.72 mmol) and TEA (1.55 mL, 11.1 mmol) in DCM (18 mL) was added 4-nitrophenyl carbonochloridate (0.974 g, 4.83 mmol) at 0℃. The reaction mixture was stirred at 0℃ for 1 hour and then was concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 8:1 to 1:4) to afford title compound (1.36 g, 71%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 8.30 (2H, td,J= 6.2, 3.7 Hz), 7.41 (2H, dt,J= 9.9, 2.6 Hz), 7.08 (1H, d,J= 8.7 Hz), 6.76 (2H, td,J= 9.1, 2.7 Hz), 5.47 (1H, d,J= 7.3 Hz), 4.68-4.62 (3H, m), 4.53 (1H, dd,J= 9.6, 7.3 Hz), 4.26 (2H, t,J= 4.6 Hz), 4.14-4.09 (2H, m), 3.38 (3H, s), 1.40 (9H, s)

[0494] Step B: (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3-hydroxy-3-methylazetidine-1-carboxylate

[0495] To a solution of 3-methylazetidin-3-ol hydrochloride (0.391 g, 3.17 mmol) in DMF (52 mL) was added DIPEA (1.37 mL, 7.92 mmol) followed by tert-butyl (S)-(5-methyl-7-(2-(((4-nitrophenoxy)carbonyl)oxy)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (1.36 g, 2.64 mmol) at 0℃. The reaction mixture was stirred at 0℃ for 30 min and then was quenched with water. The mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1 to 1:3) to afford the title compound (1.09 g 89%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.07 (1H, d,J= 8.7 Hz, 1H), 6.78-6.75 (2H, m), 5.52 (1H, d,J= 7.3 Hz), 4.63-4.56 (1H, m), 4.51 (1H, t,J= 8.5 Hz), 4.39-4.07 (5H, m), 3.80 (4H, s), 3.38 (3H, s), 2.95 (1H, s), 1.49 (3H, s), 1.39 (9H, s).

[0496] Step C: (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3-hydroxy-3-methylazetidine-1-carboxylate

[0497] The title compound was prepared in a similar fashion toExample 40(Step B)with(S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3-hydroxy-3-methylazetidine-1-carboxylate. The crude product was used for the next reaction without further purification.1H-NMR (400 MHz, DMSO-d6): δ 8.35 (2H, brs), 7.18 (1H, d,J= 9.1 Hz), 7.13 (1H, d,J= 2.7 Hz), 6.88 (1H, dd,J= 8.7, 2.7 Hz), 5.63 (1H, s), 4.46 (1H, dd,J= 9.1, 7.3 Hz), 4.38-4.27 (4H, m), 4.18 (2H, t,J= 3.0 Hz), 3.73 (4H, s), 3.35 (3H, s), 1.34 (3H, s).

[0498] Step D: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3-hydroxy-3-methylazetidine-1-carboxylate

[0499] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3-hydroxy-3-methylazetidine-1-carboxylate and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 10:1 to 1:3) to afford the title compound (78%) as a white foam.1H-NMR (400 MHz, DMSO-d6): δ 8.44 (1H, d,J= 7.8 Hz), 8.10 (1H, s), 7.72 (1H, s), 7.33 (1H, dd,J= 14.4, 8.0 Hz), 7.15 (1H, d,J= 8.7 Hz), 7.11-7.07 (3H, m), 7.04-6.99 (1H, m), 6.86 (1H, dd,J= 8.9, 3.0 Hz), 5.61 (1H, s), 4.72-4.66 (1H, m), 4.62-4.56 (1H, m), 4.39 (1H, dd,J= 9.6, 7.8 Hz), 4.29 (2H, t,J= 4.3 Hz), 4.19 (2H, t,J= 4.3 Hz), 3.83 (2H, s), 3.74 (4H, s), 3.31 (3H, s), 1.34 (3H, s). LC-MS: m / z = 568.1 [M+H]+.

[0500]

[0501] Example 43: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl morpholine-4-carboxylate

[0502]

[0503] Step A: (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl morpholine-4-carboxylate

[0504] The title compound was prepared in a similar fashion toExample 42(Step B)withtert-butyl (S)-(5-methyl-7-(2-(((4-nitrophenoxy)carbonyl)oxy)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Example 42(step A),180 mg, 0.348 mmol) and morpholine. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1 to 1:3) to afford the title compound (175 mg, quant.) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.05 (1H, d,J =8.8 Hz), 6.74-6.69 (2H, m), 5.47 (1H, d,J =7.2 Hz), 4.63 (1H, dt,J =11.3, 7.4 Hz), 4.50 (1H, dd,J =9.6, 7.2 Hz), 4.44 (2H, t,J =4.6 Hz), 4.15-4.06 (3H, m), 3.66 (4H, s), 3.49 (4H, t,J =5.0 Hz), 3.37 (3H, s), 1.73 (1H, s), 1.38 (9H, s).

[0505] Step B: (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl morpholine-4-carboxylate hydrochloride

[0506] To a solution of (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl morpholine-4-carboxylate (175 mg, 0.376 mmol) in DCM (3.759 mL) was added HCl (4 M in dioxane, 0.940 mL, 3.76 mmol) at 0℃. The reaction mixture was stirred at room temperature for 18 hours and concentratedin vacuoto afford the title compound (132 mg, crude) as a white foam, which was used for the next reaction without further purification.

[0507] Step C: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl morpholine-4-carboxylate

[0508] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl morpholine-4-carboxylate hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 2:1 to 1:4) followed by on SiO2(DCM:EtOAc = 20:1 to 1:1) to afford the title compound (65%) as a white foam.1H-NMR (400 MHz, CDCl3):δ 7.97 (1H, d,J =7.6 Hz), 7.88 (1H, d,J =0.8 Hz), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.13-7.10 (1H, m), 6.96-6.84 (3H, m), 6.78-6.74 (2H, m), 4.90 (1H, dt,J =11.2, 7.4 Hz), 4.65 (1H, dd,J =9.6, 8.0 Hz), 4.46 (2H, t,J =4.6 Hz), 4.25 (1H, dd,J =11.0, 9.8 Hz), 4.18 (2H, t,J =4.8 Hz), 3.81 (2H, s), 3.66 (4H, s), 3.49 (4H, t,J =4.8 Hz), 3.41 (3H, s). LC-MS: m / z = 568.2 [M+H]+.

[0509]

[0510] Example 44: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 4-hydroxy-4-methylpiperidine-1-carboxylate

[0511]

[0512] Step A: (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 4-hydroxy-4-methylpiperidine-1-carboxylate

[0513] The title compound was prepared in a similar fashion toExample 42(Step B)with (S)-(5-methyl-7-(2-(((4-nitrophenoxy)carbonyl)oxy)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Example 42, step A) and 4-methylpiperidin-4-ol. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1 to 1:4) to afford the title compound (72%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.05 (1H, d,J =8.4 Hz), 6.76-6.73 (2H, m), 5.51 (1H, d,J =6.8 Hz), 4.60 (1H, dt,J =11.1, 7.4 Hz), 4.54-4.07 (6H, m), 3.81-3.63 (2H, m), 3.38 (3H, s), 3.28-3.11 (2H, m), 1.53 (4H, s), 1.39 (9H, s), 1.25 (3H, s).

[0514] Step B: (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 4-hydroxy-4-methylpiperidine-1-carboxylate hydrochloride

[0515] The title compound was prepared in a similar fashion toExample 42(Step C)with (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 4-hydroxy-4-methylpiperidine-1-carboxylate as a white foam, which was used for next reaction without further purification.

[0516] Step C: (S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 4-hydroxy-4-methylpiperidine-1-carboxylate

[0517] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-2-((3-amino-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 4-hydroxy-4-methylpiperidine-1-carboxylate hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 20:1 to 1:3) to afford the title compound (35%) as a white foam.1H-NMR (400 MHz, CDCl3):δ 7.99 (1H, d,J =7.2 Hz), 7.87 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.13-7.10 (1H, m), 7.00-6.85 (3H, m), 6.79-6.77 (2H, m), 4.87 (1H, dt,J =11.2, 7.5 Hz), 4.65 (1H, dd,J =9.8, 7.4 Hz), 4.42 (2H, brs), 4.27-4.15 (3H, m), 3.81-3.68 (4H, m), 3.41 (3H, s), 3.30-3.21 (2H, m), 1.55 (4H, brs), 1.38 (1H, s), 1.25 (3H, s). LC-MS: m / z = 596.2 [M+H]+.

[0518]

[0519] Example 45: (S)-N-(7-(2-(aziridin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0520]

[0521] The title compound was prepared in a similar fashion toExample 3with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 2-(aziridin-1-yl)ethan-1-ol. The crude product was purified by prep-HPLC to give the title compound (2%) as a colorless oil.1H-NMR (400 MHz, MeOH-d4): δ 7.95 (1H, s), 7.56 (1H, s), 7.29 (1H, td,J= 7.8, 6.4 Hz), 7.15 (1H, d,J= 8.7 Hz), 7.05-7.02 (2H, m), 6.97-6.88 (3H, m), 4.89-4.82 (1H, m), 4.56 (1H, dd,J= 9.8, 7.5 Hz), 4.37 (1H, dd,J= 11.2, 9.8 Hz), 4.17 (2H, t,J= 5.0 Hz), 3.85 (2H, s), 3.41 (3H, s), 2.72-2.65 (2H, m), 1.83 (2H, t,J= 2.1 Hz), 1.47 (2H, t,J= 2.1 Hz). LC-MS: m / z = 480.1 [M+H]+.

[0522]

[0523] Example 46: (S)-4-(3-fluorobenzyl)-N-(7-(2-(3-hydroxy-3-methylazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0524]

[0525] Step A: tert-butyl (S)-(7-(2-(3-(benzyloxy)-3-methylazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0526] To a solution of tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1,0.233 g, 0.756 mmol) in DMF (15 mL) was successively added Cs2CO3(0.739 g, 2.26 mmol), 3-(benzyloxy)-1-(2-chloroethyl)-3-methylazetidine (Intermediate 15, 0.272 g, 1.13 mmol) and KI (0.188 g, 1.13 mmol) at room temperature. The reaction mixture was stirred at 75℃ overnight. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(EtOAc only to EtOAc:MeOH = 8:1) to afford the title compound (0.218 g, 56%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.36-7.28 (5H, m), 7.04 (1H, d,J= 8.2 Hz), 6.70 (2H, dd,J= 12.6, 2.5 Hz), 5.47 (1H, d,J= 7.8 Hz), 4.67-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.3 Hz), 4.41 (2H, s), 4.13-4.06 (1H, m), 3.97 (2H, t,J= 5.5 Hz), 3.44 (2H, d,J= 7.8 Hz), 3.37 (3H, s), 3.24 (2H, d,J= 6.9 Hz), 2.93 (2H, t,J= 5.5 Hz), 1.61 (3H, s), 1.39 (9H, s).

[0527] Step B: (S)-3-amino-7-(2-(3-(benzyloxy)-3-methylazetidin-1-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0528] To a solution of tert-butyl (S)-(7-(2-(3-(benzyloxy)-3-methylazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (0.188 g, 0.367 mmol) in DCM (7.3 mL) was added HCl (4 M in dioxane, 0.919 mL, 3.67 mmol) at room temperature. The reaction mixture was stirred at 30℃ overnight. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuoto afford the title compound (0.212 g, crude) as a white foam, which was used for the next reaction without further purification. LC-MS: m / z = 412.1 [M+H]+.

[0529] Step C: (S)-3-amino-7-(2-(3-hydroxy-3-methylazetidin-1-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0530] A suspension of (S)-3-amino-7-(2-(3-(benzyloxy)-3-methylazetidin-1-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride (0.151 g, 0.337 mmol), Pd / C (10wt%, 0.057 g, 0.054 mmol), and AcOH (0.019 mL, 0.337 mL) in MeOH (6.7 mL) was stirred at room temperature overnight under H2atmosphere. After filtration through a Celite pad, the filtrated was concentratedin vacuoto afford title compound (0.117 g, crude) as a white foam, which was used for the next reaction without further purification. LC-MS: m / z = 322.1 [M+H]+.

[0531] Step D: (S)-4-(3-fluorobenzyl)-N-(7-(2-(3-hydroxy-3-methylazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0532] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-amino-7-(2-(3-hydroxy-3-methylazetidin-1-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 5:1 to EtOAc:MeOH = 8:1) to give the title compound (13% for 3 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J= 7.8 Hz), 7.88 (1H, s), 7.46 (1H, s), 7.26-7.22 (1H, m), 7.10 (1H, d,J= 9.6 Hz), 6.96-6.85 (3H, m), 6.74 (2H, t,J= 3.2 Hz), 4.93-4.86 (1H, m), 4.65 (1H, dd,J= 9.8, 7.5 Hz), 4.27-4.21 (1H, m), 3.98 (2H, t,J= 5.5 Hz), 3.81 (2H, s), 3.45-3.41 (5H, m), 3.18 (2H, d,J= 7.8 Hz), 2.90 (2H, t,J= 5.5 Hz), 1.52 (3H, s). LC-MS: m / z = 524.1 [M+H]+.

[0533] Example 47: (S)-N-(7-(2-(3,3-difluoroazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0534]

[0535] Step A: tert-butyl (S)-(7-(2-(3,3-difluoroazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0536] A mixture of tert-butyl (S)-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (Intermediate 1, 200 mg, 0.549 mmol), 1-(2-chloroethyl)-3,3-difluoroazetidine (Intermediate 16,100 mg, 0.560 mmol), NaI (194 mg, 1.30 mmol) and Cs2CO3(634 mg, 1.95 mmol) in DMF (6.0 mL) was stirred at 100℃ for 18 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were washed with water and brine, dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(Hexanes:EtOAc = 3:1 to 1:1) to afford the title compound (50.0 mg, 18%) as a yellow foam.1H-NMR (400 MHz, CDCl3): δ 7.04 (1H, d,J= 8.4 Hz), 6.70-6.66 (2H, m), 5.46 (1H, d,J= 7.2 Hz), 4.67-4.60 (1H, m), 4.51 (1H, dd,J= 9.6, 7.2 Hz), 4.08 (1H, dd,J= 11.2, 9.6 Hz), 3.99 (2H, t,J= 5.2 Hz), 3.72 (4H, t,J= 13.4 Hz), 3.36 (3H, s), 2.97 (2H, t,J= 5.0 Hz), 1.39 (9H, s).

[0537] Step B: (S)-3-amino-7-(2-(3,3-difluoroazetidin-1-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0538] To a solution of (S)-(7-(2-(3,3-difluoroazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (50.0 mg, 0.119 mmol) in DCM (0.40 mL) was added HCl (4 M in dioxane, 0.298 mL, 1.19 mmol) at 0℃. The reaction mixture was stirred at room temperature for 5 hours and concentratedin vacuoto afford the title compound (43.0 mg, crude) as a yellow solid, which was used for the next reaction without further purification. LC-MS: m / z = 328.0 [M+H]+.

[0539] Step C: (S)-N-(7-(2-(3,3-difluoroazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0540] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-amino-7-(2-(3,3-difluoroazetidin-1-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1) to give the title compound (13% for 2 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 7.2 Hz), 7.87 (1H, s), 7.46 (1H, s), 7.27-7.21 (1H, m), 7.11-7.08 (1H, m), 6.95-6.84 (3H, m), 6.74-6.69 (2H, m), 4.92-4.85 (1H, m), 4.65 (1H, dd,J= 9.6, 7.2 Hz), 4.24 (1H, dd,J= 11.2, 10.0 Hz), 4.01 (2H, t,J= 5.4 Hz), 3.80 (2H, s), 3.73 (4H, t,J= 12.2 Hz), 3.40 (3H, s), 2.98 (2H, t,J= 5.2 Hz). MS: m / z = 530.1 [M+H]+.

[0541]

[0542] Example 48: (S)-N-(7-(2-(2-oxa-6-azaspiro[3.3]heptan-6-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0543]

[0544] Step A: tert-butyl (S)-(7-(2-(2-oxa-6-azaspiro[3.3]heptan-6-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0545] To a solution of (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14, 0.244 g, 0.567 mmol) in DMF (5.6 mL) was added Cs2CO3(0.739 g, 2.26 mmol) followed by 2-oxa-6-azaspiro[3.3]heptane (0.100 mL, 1.13 mmol) at room temperature. The reaction mixture was stirred at 50℃ for 4 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by column chromatography on SiO2(DCM:MeOH = 100:1 to 20:1) to afford title compound (0.144 g, 58%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.04 (1H, d,J= 8.7 Hz), 6.71-6.67 (2H, m), 5.47 (1H, d,J= 6.9 Hz), 4.76 (4H, s), 4.67-4.61 (1H, m), 4.52 (1H, dd,J= 9.6, 7.3 Hz), 4.09 (1H, dd,J= 11.2, 9.8 Hz), 3.92 (2H, t,J= 5.5 Hz), 3.48 (4H, s), 3.37 (3H, s), 2.78 (2H, t,J= 5.3 Hz), 1.40 (9H, s).

[0546] Step B: (S)-7-(2-(2-oxa-6-azaspiro[3.3]heptan-6-yl)ethoxy)-3-amino-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0547] To a solution of tert-butyl (S)-(7-(2-(2-oxa-6-azaspiro[3.3]heptan-6-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (0.144 g, 0.332 mmol) in DCM (3.3 mL) was added TFA (0.256 mL, 3.32 mmol) at room temperature. The reaction mixture was stirred at room temperature for 2 hours and then concentratedin vacuoto afford the title compound (0.111 g, crude) as a white foam, which was used for the next reaction without further purification.

[0548] Step C: (S)-N-(7-(2-(2-oxa-6-azaspiro[3.3]heptan-6-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide

[0549] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-7-(2-(2-oxa-6-azaspiro[3.3]heptan-6-yl)ethoxy)-3-amino-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by prep-HPLC to give the title compound (8% for 2 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.98 (1H, d,J= 7.3 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.10 (1H, dd,J= 7.8, 1.8 Hz), 7.00-6.85 (3H, m), 6.73 (2H, dd,J= 8.0, 2.5 Hz), 4.92-4.86 (1H, m), 4.76 (4H, s), 4.65 (1H, dd,J= 9.6, 7.8 Hz), 4.24 (1H, dd,J= 11.2, 9.8 Hz), 3.94 (2H, t,J= 5.5 Hz), 3.81 (2H, s), 3.49 (4H, s), 3.40 (3H, s), 2.80 (2H, t,J= 5.3 Hz). MS: m / z = 536.1 [M+H]+.

[0550]

[0551] Example 49: (S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-morpholinoethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0552]

[0553] The title compound was prepared in a similar fashion toExample 3with (S)-4-(3-fluorobenzyl)-N-(7-hydroxy-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide (Intermediate 3) and 2-morpholinoethan-1-ol. The crude compound was purified by column chromatography on SiO2(Hexanes:EtOAc = 1:1 to EtOAc:MeOH = 98:2) to give the title compound (38%) as a white foam.1H-NMR (400 MHz, CDCl3):δ 7.98 (1H, d,J =7.2 Hz), 7.88 (1H, s), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.11 (1H, m), 7.00-6.84 (3H, m), 6.78-6.74 (2H, m), 4.90 (1H, dt, 11.2, 7.5 Hz), 4.65 (1H, dd,J =9.6, 7.6 Hz), 4.24 (1H, dd,J =10.8, 10.0 Hz), 4.10 (2H, t,J =5.6 Hz), 3.81 (2H, s), 3.75 (4H, t,J =4.4 Hz), 3.41 (3H, s), 2.82 (2H, t,J =5.6 Hz), 2.59 (4H, t,J =4.6 Hz). MS: m / z = 542.2 [M+H]+.

[0554]

[0555] Example 50: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxopyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0556]

[0557] Step A: tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxopyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0558] To a solution of (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14, 1.13 g, 2.64 mmol) in DMF (26 mL) was added K2CO3(1.46 g, 10.6 mmol) and pyridazin-3(2H)-one (0.304 g, 3.17 mmol) at room temperature. The reaction mixture was stirred at 70℃ for 4 hours. After quenched with water, the mixture was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4, filtered and concentratedin vacuo. The residue was purified by SiO2(Hexanes:EtOAC = 10:1 to DCM:MeOH = 50:1) to afford the title compound (1.05 g, 92%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.80 (1H, q,J= 1.8 Hz), 7.21 (1H, dd,J= 9.6, 3.7 Hz), 7.02 (1H, d,J= 8.7 Hz), 6.95 (1H, dd,J= 9.4, 1.6 Hz), 6.72 (2H, td,J= 8.2, 2.7 Hz), 5.46 (1H, d,J= 6.9 Hz), 4.62-4.55 (3H, m), 4.50 (1H, dd,J= 9.4, 7.5 Hz), 4.37 (2H, t,J= 5.5 Hz), 4.11-4.05 (1H, m), 3.36 (3H, s), 1.39 (9H, s).

[0559] Step B: (S)-3-((l2-chloranyl)-l4-azanyl)-5-methyl-7-(2-(6-oxopyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0560] To a solution of tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxopyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate (1.05 g, 2.42 mmol) in DCM (24 mL) was added HCl (4 M in dioxane, 12.1 mL, 48.6 mmol) at room temperature. The reaction mixture was stirred at 35℃ for 1 hour and then concentratedin vacuoto afford the title compound as a white foam, which was used for the next reaction without further purification.

[0561] Step C: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxopyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0562] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-((l2-chloranyl)-l4-azanyl)-5-methyl-7-(2-(6-oxopyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc =10:1 to 1:4 and DCM:EtOAc = 20:1 to 1:4) to afford the title compound (45% for 2 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 7.3 Hz), 7.87 (1H, s), 7.80 (1H, q,J= 1.8 Hz), 7.46 (1H, s), 7.27-7.23 (1H, m), 7.22-7.19 (1H, m), 7.08 (1H, d,J= 9.1 Hz), 6.97-6.85 (4H, m), 6.77 (2H, dd,J= 10.7, 2.5 Hz), 4.89-4.83 (1H, m), 4.66-4.56 (3H, m), 4.39 (2H, td,J= 5.7, 2.4 Hz), 4.23 (1H, dd,J= 11.2, 9.8 Hz), 3.81 (2H, s), 3.40 (3H, s). MS: m / z = 533.1 [M+H]+.

[0563]

[0564] Example 51: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-5-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0565]

[0566] Step A: tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxo-5-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0567] The title compound was prepared in a similar fashion toExample 50(Step A)with (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14) and 4-(trifluoromethyl)pyridazin-3(2H)-one. The crude product was purified by column chromatography on SiO2(DCM:EtOAc =20:1 to 8:1) to afford the title compound (63%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.92 (1H, d,J= 3.7 Hz), 7.55 (1H, d,J= 4.1 Hz), 7.03 (1H, dd,J= 7.3, 1.8 Hz), 6.72-6.70 (2H, m), 5.46 (1H, d,J= 7.3 Hz), 4.67-4.56 (3H, m), 4.49 (1H, dd,J= 9.6, 7.3 Hz), 4.40 (2H, t,J= 5.5 Hz), 4.08 (1H, dd,J= 11.0, 9.6 Hz), 3.36 (3H, s), 1.39 (9H, s).

[0568] Step B: (S)-3-amino-5-methyl-7-(2-(6-oxo-5-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0569] The title compound was prepared in a similar fashion toExample 50(Step B)with tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxo-5-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate. The crude product was used for the next reaction without further purification.

[0570] Step C: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-5-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0571] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-amino-5-methyl-7-(2-(6-oxo-5-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 20:1 to 12:1) to afford the title compound (44% for 2 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 7.3 Hz), 7.93 (1H, d,J= 4.1 Hz), 7.87 (1H, s), 7.55 (1H, d,J= 3.7 Hz), 7.47 (1H, s), 7.28-7.22 (1H, m), 7.09 (1H, q,J= 3.2 Hz), 6.96-6.85 (3H, m), 6.78-6.75 (2H, m), 4.89-4.82 (1H, m), 4.65-4.61 (3H, m), 4.44-4.40 (2H, m), 4.24 (1H, dd,J= 11.0, 9.6 Hz), 3.81 (2H, s), 3.40 (3H, s). MS: m / z = 601.1 [M+H]+.

[0572]

[0573] Example 52: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-4-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0574]

[0575] Step A: tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxo-4-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0576] The title compound was prepared in a similar fashion toExample 50(Step A)with (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14) and 5-(trifluoromethyl)pyridazin-3(2H)-one. The crude product was purified by column chromatography on SiO2(DCM:EtOAc =20:1 to 9:1) to afford the title compound (78%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 2.1 Hz), 7.21 (1H, d,J= 0.9 Hz), 7.04 (1H, d,J= 8.7 Hz), 6.73-6.69 (2H, m), 5.45 (1H, d,J= 7.3 Hz), 4.63-4.58 (3H, m), 4.50 (1H, dd,J= 9.4, 7.5 Hz), 4.36 (2H, t,J= 5.5 Hz), 4.09 (1H, dd,J= 11.0, 9.6 Hz), 3.37 (3H, s), 1.39 (9H, s).

[0577] Step B: (S)-3-amino-5-methyl-7-(2-(6-oxo-4-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0578] The title compound was prepared in a similar fashion toExample 50(Step B)with tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxo-4-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate. The crude product was used for the next reaction without further purification.

[0579] Step C: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-4-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0580] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-amino-5-methyl-7-(2-(6-oxo-4-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 20:1 to 12:1) to afford the title compound (17% for 2 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (2H, q,J= 2.4 Hz), 7.87 (1H, s), 7.46 (1H, s), 7.26-7.21 (2H, m), 7.10 (1H, dd,J= 7.8, 1.4 Hz), 6.96-6.85 (3H, m), 6.76-6.74 (2H, m), 4.91-4.84 (1H, m), 4.66-4.60 (3H, m), 4.39 (2H, t,J= 5.3 Hz), 4.24 (1H, dd,J= 11.3, 9.7 Hz), 3.81 (2H, s), 3.40 (3H, s). MS: m / z = 601.1 [M+H]+.

[0581] Example 53: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-3-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0582]

[0583] Step A: tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxo-3-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0584] The title compound was prepared in a similar fashion toExample 50(Step A)with (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14) and 6-(trifluoromethyl)pyridazin-3(2H)-one. The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 20:1 to 9:1) to afford the title compound (51%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.47 (1H, d,J= 9.6 Hz), 7.04 (2H, t,J= 9.1 Hz), 6.71 (2H, dd,J= 11.2, 2.5 Hz), 5.46 (1H, d,J= 7.3 Hz), 4.63-4.56 (3H, m), 4.50 (1H, dd,J= 9.6, 7.3 Hz), 4.38 (2H, td,J= 5.5, 1.9 Hz), 4.08 (1H, dd,J= 10.9, 9.7 Hz), 3.36 (3H, s), 1.39 (9H, s).

[0585] Step B: (S)-3-amino-5-methyl-7-(2-(6-oxo-3-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one

[0586] The title compound was prepared in a similar fashion toExample 50(Step B)with tert-butyl (S)-(5-methyl-4-oxo-7-(2-(6-oxo-3-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate. The crude product was used for the next reaction without further purification.

[0587] Step C: (S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-3-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0588] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-amino-5-methyl-7-(2-(6-oxo-3-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 20:1 to 9:1) to afford the title compound (50% for 2 steps) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.96 (1H, d,J= 7.3 Hz), 7.87 (1H, s), 7.48-7.45 (2H, m), 7.30-7.22 (1H, m), 7.10-7.04 (2H, m), 6.96-6.85 (3H, m), 6.77-6.74 (2H, m), 4.89-4.82 (1H, m), 4.66-4.59 (3H, m), 4.42-4.39 (2H, m), 4.24 (1H, dd,J= 11.0, 10.1 Hz), 3.81 (2H, s), 3.40 (3H, s). MS: m / z = 601.0 [M+H]+.

[0589]

[0590] Example 54: (S)-4-(3-fluorobenzyl)-N-(7-(2-(4-methoxy-6-oxopyridazin-1(6H)-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0591]

[0592] Step A:tert-butyl (S)-(7-(2-(4-methoxy-6-oxopyridazin-1(6H)-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate

[0593] The title compound was prepared in a similar fashion toExample 50(Step A)with (S)-2-((3-((tert-butoxycarbonyl)amino)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl methanesulfonate (Intermediate 14) and 5-methoxypyridazin-3(2H)-one. The crude product was purified by column chromatography on SiO2(Hexanes:EtOAc = 10:1 to 1:2) to afford the title compound (75%) as a white foam.1H-NMR (400 MHz, CDCl3): δ 7.59 (1H, d,J =2.8 Hz), 7.02 (1H, d,J =8.8 Hz), 6.74-6.69 (2H, m), 6.14 (1H, d,J =2.4 Hz), 5.46 (1H, d,J =6.8 Hz), 4.64-4.44 (4H, m), 4.31 (2H, t,J =5.4 Hz), 4.12-4.05 (1H, m), 3.80 (3H, s), 3.36 (3H, s), 1.38 (9H, s).

[0594] Step B: (S)-3-amino-7-(2-(4-methoxy-6-oxopyridazin-1(6H)-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride

[0595] The title compound was prepared in a similar fashion toExample 50(Step B)withtert-butyl (S)-(7-(2-(4-methoxy-6-oxopyridazin-1(6H)-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)carbamate. The crude product was used for the next reaction without further purification.

[0596] Step C: (S)-4-(3-fluorobenzyl)-N-(7-(2-(4-methoxy-6-oxopyridazin-1(6H)-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide

[0597] The title compound was prepared in a similar fashion toExample 7(Step C)with (S)-3-amino-7-(2-(4-methoxy-6-oxopyridazin-1(6H)-yl)ethoxy)-5-methyl-2,3-dihydrobenzo[b][1,4]oxazepin-4(5H)-one hydrochloride and 4-(3-fluorobenzyl)-1H-pyrazole hydrochloride (Intermediate 2). The crude product was purified by column chromatography on SiO2(DCM:EtOAc = 5:1 to 1:4) to afford the title compound (30% for 2 steps) as a white foam.

[0598] 1H-NMR (400 MHz, CDCl3): δ 7.97 (1H, d,J =7.2 Hz), 7.87 (1H, s), 7.59 (1H, d,J =2.8 Hz), 7.46 (1H, s), 7.28-7.22 (1H, m), 7.08 (1H, d,J =8.4 Hz), 7.00-6.85 (3H, m), 6.78-6.74 (2H, m), 6.14 (1H, d,J =3.2 Hz), 4.87 (1H, dt,J =11.1, 7.4 Hz), 4.64 (1H, dd,J =9.8, 7.4 Hz), 4.56-4.46 (2H, m), 4.34 (2H, t,J =5.6 Hz), 4.23 (1H, dd,J =11.2, 9.6 Hz), 3.81 (5H, m), 3.40 (3H, s). MS: m / z = 563.1 [M+H]+.

[0599] Biological Activity

[0600] Cell culture:

[0601] Human colon carcinoma cell HT-29 (KCLB 30038), BV2 mouse microglial cell (cell was a kind gift from Dr. Nak-Yun Sung, Senior researcher at Korea Prime Pharmacy CO., LTD.) and human microglial cell HMC3 (ATCC　 CRL-3304TM). HT-29 cell was grown in Roswell Park Memorial Institute (RPMI) 1640, BV2 cell was grown in Dulbecco's Modified Eagle's Medium (DMEM) and HMC3 cell was grown in Minimum Essential Media Eagle (MEM) supplemented with 10% fetal bovine serum and 1% mixture of penicillin and streptomycin (Gibco). Cells were maintained at 37℃ in a humidified 5% CO2 atmosphere.

[0602] Cell-based necroptosis assay for RIPK1 activity:

[0603] To measure the activity of RIPK1 inhibitor in necroptotic cells, HT-29 cells were treated by control DMSO, human TNFα (Peprotech, Rocky Hill, USA), SM-164 (Biovision, California, USA) and a pan-caspase inhibitor Z-VAD-FMK (Invivogen, San Diego, USA). Cells were pretreated with Z-VAD-FMK 20 μM. After 30 min, human TNFα 10 ng / ml, SM-164 100 nM and RIPK1 Inhibitor (0.0001, 0.001, 0.01, 0.02, 0.05, 0.1, 1, 10 uM) were treated for 24 h. Cell viability was measured by Cell Counting Kit 8 (CCK-8) (Dong-in, Seoul, Korea).

[0604] Immunoblotting:

[0605] Biological activity of the compounds of RIPK1 inhibitor was determined by measuring their ability to inhibitor TNFα induced phospho-RIPK1 (ser 166) levels, phospho-RIPK3 levels, phospho-MLKL levels in HMC3 cells. Cells were pretreated with Z-VAD-FMK 20 μM. After 30 min, human TNFα 20 ng / ml, SM-164 100 nM and RIPK1 inhibitor (0.1, 1, 10 nM) were treated for 7 h under serum free media. Cells were lysed with cold lysis buffer containing 25 mM HEPES pH 7.6, 150 nM NaCl, 1% NP40, 1% sodium deoxycholate, 0.1% SDS, and protease inhibitor mixture (Bimake, Houston, USA) using sonicators. The cells were centrifuged at 15,000 rpm, 4℃ for 5 min. After protein concentration of the lysates (supernatants) was quantified using BCA assay (Thermo Fisher Scientific, Waltham, USA), lysates were mixed with LDS sample buffer and heating at 70 for 10 min. (Invitrogen, California, USA). Extracts were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by electro-transfer to polyvinylidene difluoride (PVDF) membranes and probed with an anti-phospho-RIPK1 antibody, anti-phospho-RIPK3 antibody and anti-phospho-MLKL antibody (Cell Signaling technology, Danvers, USA) and β-actin (Proteintech, Rosement, USA), followed by horseradish peroxidase conjugated anti-rabbit (Cell Signaling technology, Danvers, USA), anti-mouse IgG and revealed with Super Signal West dura kit (Pierce). The membranes are placed in an image analyzer (Imagequant, LAS 500, GE Healthcare), connected to a computer which allows the image generation (software Image reader LAS 500).

[0606] Inflammation cytokine:

[0607] Total RNA was extracted and purified from PureLinkTMRNA mini kit (Thermo Fisher Scientific, Waltham, USA) according to the manufacture's protocol. Reverse transcription reactions were performed with AccuPower CycleScript RT PreMix (dT20) (Bioneer, Daejeon, Korea). Synthesis of cDNA was carried out using SimpliAmp Thermal Cycler (Applied Biosystems, Carlsbad, CA) and RT-PCR conditions were 15℃ for 30 sec, 42℃ for 4 min, 55℃ for 30 sec in 12 cycles, and heat inactivation was performed 95℃ for 5 min. For qPCR, SYBR Green PCR Master Mix (Thermo Fisher Scientific, Waltham, USA) was used in QuantStudio 3 (Applied Biosystems, Carlsbad, CA) and the PCR conditions were 95℃ for 10 min, 40 cycles of 95℃ for 15 s, and 60℃ for 30 s. The relative mRNA levels were calculated using cycle threshold (Ct) method. GAPDH was used as the endogenous control. PCR primers used in this study are listed in Table 1.

[0608] PCR primers used in this studyPrimerSpeciesSequenceTNF-amouseForwardTGTAGCCCACGTCGTAGCAAReverseAGGTACAACCCATCGGCTGGIL-1βmouseForwardTGTGCAAGTGTCTGAAGCAGCReverseTGGAAGCAGCCCTTCATCTTIL-6mouseForwardCCACTTCACAAGTCGGAGGCReverseGCCATTGCACAACTCTTTTCTCGAPDHmouseForwardTCACCACCATGGAGAAGGCReverseGCTAAGCAGTTGGTGGTGCA

[0609]

[0610] Cell-base RIPK1 activity in HT29 cellsExampleNecroptosisphspho-RIPK1 (Ser166)1AA2AA3BA4AA5AA6AA7AA8BA9AA10AA11AA12AA13AA14AA15AA16AA17AA18AA19AA20AA21AA22AA23AA24AA25BB26AA27AA28AA29BA30AA31AA32AA32AA33AA34AA35AA36AB37AA38AA39AA40AA41AA42AA45AB49AA50AA

[0611] A: below 10 nM, B: 10~50 nM, C: above 50 nM

[0612] The novel compounds of this invention inhibit RIP1 kinase activity and are, therefore, expected to be-useful in the treatment of disease and / or condition associated with inflammation and / or necroptotic cell death.

Claims

1.A compound, according to formula Ior a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer, stereoisomer or prodrug thereof, whereinR1is N-alkylamide, Pyridinone, Pyridazinone, Pyrazinone, Pyrimidinone, 4-6 membered heterocycloalkyl, or 4-6 membered heterocycloalkyl-C(O)-;wherein said Pyridinone, Pyridazinone, Pyrazinone, Pyrimidinone, 4-6 membered heterocycloalkyl, or 4-6 membered heterocycloalkyl-C(O)- is optionally substituted by one or two substituents each independently selected from (C1-C4)alkyl, OH, (C1-C4)hydroxy, (C1-C4)alkoxy, halogen, cyano, NR3R4, and oxo;L is O, -OCH2-, -OCH(CH3)-, -OCH2CH2-, -OCH2CH(OH)-, -OCH2CH2CH2-, -OCH2CH2CH(OH)-, -OCH2CH2CH(CH3)-, -OCH2CH2C(CH3)2-, -OCH2CH2CH2CH2-, or -OCH2CH2CH2CH(OH)-;each R2is independently H, methyl, CF3,halogen, or cyano;n is 1, 2 or 3;R3and R4are independently selected from H, aliphatic, heteroaliphatic, aromatic, including aryl and heteroaryl, or heterocycloaliphatic; together with the nitrogen bound thereto provide a C3-6heterocyclic group.2.The compound of claims 1, wherein the compound is:4-(3-fluorobenzyl)-N-((S)-5-methyl-4-oxo-7-(2-((S)-2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;4-(3-fluorobenzyl)-N-((S)-5-methyl-4-oxo-7-(2-((R)-2,2,5,5-tetramethyl-1,3-dioxolan-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;N-((S)-7-(2-((R)-2,2-dimethyl-5-oxo-1,3-dioxolan-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;N-((S)-7-((R)-4-(dimethylamino)-3-hydroxy-4-oxobutoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;4-(3-fluorobenzyl)-N-((S)-7-((R)-3-hydroxy-4-oxo-4-(pyrrolidin-1-yl)butoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;4-(3-fluorobenzyl)-N-((S)-7-((R)-3-hydroxy-4-morpholino-4-oxobutoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;N-((S)-7-(((3aS,4S,6aR)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;N-((S)-7-(((2S,3R,4R)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;4-(3-fluorobenzyl)-N-((S)-7-(((2S,4R)-4-hydroxy-1-methylpyrrolidin-2-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;4-(3-fluorobenzyl)-N-((S)-5-methyl-7-(((R)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;4-(3-fluorobenzyl)-N-((S)-5-methyl-7-(((S)-1-methyl-5-oxopyrrolidin-2-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(N-methylacetamido)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(2-oxopyrrolidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide4-(3-fluorobenzyl)-N-((S)-7-(2-((S)-3-hydroxy-2-oxopyrrolidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(4-methyl-3-oxopiperazin-1-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(2-oxopyridin-1(2H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-((tetrahydro-2H-pyran-4-yl)oxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(tetrahydro-2H-pyran-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxytetrahydro-2H-pyran-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(oxetan-3-ylmethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(2-(oxetan-3-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-7-((3-methyloxetan-3-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-N-(7-((3-ethyloxetan-3-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(2-(3-hydroxyoxetan-3-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(piperidin-4-ylmethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-7-((1-methylpiperidin-4-yl)methoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(piperidin-4-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-(1-methylpiperidin-4-yl)ethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxypiperidin-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(2-(4-hydroxy-1-methylpiperidin-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-N-(7-((1,1-dioxidotetrahydro-2H-thiopyran-4-yl)oxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-N-(7-((1,1-dioxidotetrahydro-2H-thiopyran-4-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-N-(7-(2-(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(3-(tetrahydro-2H-pyran-4-yl)propoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-((3-(hydroxymethyl)oxetan-3-yl)methoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-N-(5-methyl-4-oxo-7-(2-(piperidin-1-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-imidazole-1-carboxamide;(S)-N-(7-(2-(4,4-difluoropiperidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-N-(7-(2-(1,2-oxazinan-2-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-N-(7-(2-(1,1-dioxidothiomorpholino)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl azetidine-1-carboxylate;(S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3,3-difluoroazetidine-1-carboxylate;(S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 3-hydroxy-3-methylazetidine-1-carboxylate;(S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl morpholine-4-carboxylate;(S)-2-((3-(4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamido)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-7-yl)oxy)ethyl 4-hydroxy-4-methylpiperidine-1-carboxylate;(S)-N-(7-(2-(aziridin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(2-(3-hydroxy-3-methylazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-N-(7-(2-(3,3-difluoroazetidin-1-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-N-(7-(2-(2-oxa-6-azaspiro[3.3]heptan-6-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-4-(3-fluorobenzyl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-7-(2-morpholinoethoxy)-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxopyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-5-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-4-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(5-methyl-4-oxo-7-(2-(6-oxo-3-(trifluoromethyl)pyridazin-1(6H)-yl)ethoxy)-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide;(S)-4-(3-fluorobenzyl)-N-(7-(2-(4-methoxy-6-oxopyridazin-1(6H)-yl)ethoxy)-5-methyl-4-oxo-2,3,4,5-tetrahydrobenzo[b][1,4]oxazepin-3-yl)-1H-pyrazole-1-carboxamide; orapharmaceutically acceptable salt thereof.3.The compound of claim 1 to 2, wherein the compound inhibits activity of a receptor interacting protein kinase 1 (RIPK1).4.A method for inhibiting an RIPK1 enzyme in a cell, comprising the step of contacting the cell with the compound of claim 1 to 2 in an amount sufficient to inhibit an activity of the RIPK1 enzyme.5.A method for alleviating or ameliorating symptoms of an RIPK1 mediated disease or condition by inhibiting RIPK1 activity, the method comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising the compound of claim 1 to 2 or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or pro-drug thereof, wherein the RIPK mediated disease or condition is a disease related to inflammation and necroptotic cell death.6.Use of a compound of claim 1 to 2 or a pharmaceutically acceptable salt thereof , solvate, polymorph, ester, tautomer or prodrug thereof in the preparation of in the preparation of a pharmaceutical composition for treating or ameliorating inflammatory bowel disease including Crohn's disease and ulcerative colitis, psoriasis, retinal diseases (including age-related macular degeneration, diabetic retinopathy, glaucoma, retinal detachment, and retinitis pigmentosa), arthritis including rheumatoid arthritis, spondyloarthritis, gout, osteoarthritis, and systemic onset juvenile idiopathic arthritis (SoJIA), transplant rejection, organ transplantation for donors and recipients, multiple sclerosis, tumor necrosis factor receptor-associated periodic syndrome, multiple organ dysfunction syndrome (MODS), thermal injury / burn, systemic inflammatory response syndrome (SIRS), radiation injury, radiotherapy, chemotherapy, pneumonias, hemorrhagic shock, trauma including multiple trauma, traumatic brain injury, acute pancreatitis, critical illness, sepsis, septic shock, Stevens-Johnson syndrome, toxic epidermal necrolysis, stroke, heat stroke, stroke-associated pneumonia, Multi-Organ Dysfunction Syndrome (MODS), Acute Respiratory Distress Syndrome (ARDS), intestinal obstruction, liver cirrhosis, surgery, major abdominal operations, abdominal aortic aneurysm repair, large bowel resections, ischemia reperfusion injury including ischemia reperfusion injury of solid organs, limb ischemia, bowel ischemia, cardiac surgery requiring cardio-pulmonary bypass, autoimmune hepatitis, autoimmune hepatobiliary diseases, autoimmune ITP, allergic disease, asthma, atopic dermatitis, type I diabetes, Wegener's granulomatosis, Behcet's disease, interleukin-1 converting enzyme associated fever syndrome, pancreatic cancer, metastatic adenocarcinoma of the pancreas, pancreatic ductal adenocarcinoma, mesothelioma, melanoma, colorectal cancer, acute myeloid leukemia, metastasis, glioblastoma, breast cancer, gallbladder cancer, clear cell renal carcinoma, non-small cell lung carcinoma, or radiation induced necrosis.7.Use of a compound of any of claims 1 to 2, wherein the disease is Parkinson's Disease, Lewy body dementia, multiple system atrophy, Parkinson-plus syndromes, tauopathies, Alzheimer's Disease, Frontotemporal dementia, amyotrophic lateral sclerosis (ALS), spinal muscular atrophy, primary lateral sclerosis, Huntington's disease, ischemia, stroke, intracranial hemorrhage, cerebral hemorrhage, muscular dystrophy, progressive muscular atrophy, progressive muscular atrophy, pseudobulbar palsy, spinal muscular atrophy, inherited muscular atrophy, peripheral neuropathies, progressive supranuclear palsy, corticobasal degeneration, multiple sclerosis, or demyelinating disease.8.The method of claim 5, further comprising administering an effective amount of one or more therapeutic agents.9.A pharmaceutical composition for alleviating or ameliorating symptoms of an RIPK1 mediated disease or condition by inhibiting RIPK1 activity,a. an effective amount of a compound of any of claim 1 to 2 or a pharmaceutically acceptable salt, solvate, polymorph, ester, tautomer or prodrug thereof; andb. one or more therapeutic agents, wherein the RIPK1 mediated disease or condition is selected from the group consisting of pancreatic cancer, lung cancer, colon cancer, gastric cancer, glioblastoma, melanoma, multiple sclerosis, psoriasis, colitis, rheumatoid arthritis, sepsis, renal and brain ischemia-reperfusion injury, Alzheimer's disease, amyotrophic lateral sclerosis (ASL), Parkinson's disease, dermatitis, and asthma.10.The pharmaceutical composition of claim 9, wherein the pharmaceutical composition is formulated for oral administration.11.The pharmaceutical composition of claim 10, wherein the pharmaceutical composition is in a form of a tablet or capsule.12.The pharmaceutical composition of claim 11, wherein amount of the compound of claim 1 to 2 is in a range of 0.001 to 1000 mg / kg body weight / day.13.The pharmaceutical composition of claim 12, wherein amount of the compound of claim 1 to 2 is in a range of 0.5 to 50 mg / kg body weight / day.14.A method of claim 5, wherein the compound inhibits necroptosis in a cancer cell.15.A method of claim 5, wherein the compound decreases protein level of RIPK1 in a microglial cell.16.A method of claim 5, wherein the compound decreases mRNA level of TNF-alpha, IL-beta, and IL-6 in a microglial cell.

Images